Sample records for dihydrofolate reductase-thymidylate synthase

  1. Inhibitor-bound complexes of dihydrofolate reductase-thymidylate synthase from Babesia bovis

    PubMed Central

    Begley, Darren W.; Edwards, Thomas E.; Raymond, Amy C.; Smith, Eric R.; Hartley, Robert C.; Abendroth, Jan; Sankaran, Banumathi; Lorimer, Donald D.; Myler, Peter J.; Staker, Bart L.; Stewart, Lance J.


    Babesiosis is a tick-borne disease caused by eukaryotic Babesia parasites which are morphologically similar to Plasmodium falciparum, the causative agent of malaria in humans. Like Plasmodium, different species of Babesia are tuned to infect different mammalian hosts, including rats, dogs, horses and cattle. Most species of Plasmodium and Babesia possess an essential bifunctional enzyme for nucleotide synthesis and folate metabolism: dihydrofolate reductase-thymidylate synthase. Although thymidylate synthase is highly conserved across organisms, the bifunctional form of this enzyme is relatively uncommon in nature. The structural characterization of dihydrofolate reductase-thymidylate synthase in Babesia bovis, the causative agent of babesiosis in livestock cattle, is reported here. The apo state is compared with structures that contain dUMP, NADP and two different antifolate inhibitors: pemetrexed and raltitrexed. The complexes reveal modes of binding similar to that seen in drug-resistant malaria strains and point to the utility of applying structural studies with proven cancer chemotherapies towards infectious disease research. PMID:21904052

  2. Two crystal structures of dihydrofolate reductase-thymidylate synthase from Cryptosporidium hominis reveal protein–ligand interactions including a structural basis for observed antifolate resistance

    SciTech Connect

    Anderson, Amy C.


    An analysis of the protein–ligand interactions in two crystal structures of DHFR-TS from C. hominis reveals a possible structural basis for observed antifolate resistance in C. hominis DHFR. A comparison with the structure of human DHFR reveals residue substitutions that may be exploited for the design of species-selective inhibitors. Cryptosporidium hominis is a protozoan parasite that causes acute gastrointestinal illness. There are no effective therapies for cryptosporidiosis, highlighting the need for new drug-lead discovery. An analysis of the protein–ligand interactions in two crystal structures of dihydrofolate reductase-thymidylate synthase (DHFR-TS) from C. hominis, determined at 2.8 and 2.87 Å resolution, reveals that the interactions of residues Ile29, Thr58 and Cys113 in the active site of C. hominis DHFR provide a possible structural basis for the observed antifolate resistance. A comparison with the structure of human DHFR reveals active-site differences that may be exploited for the design of species-selective inhibitors.

  3. Structures of dihydrofolate reductase-thymidylate synthase of Trypanosoma cruzi in the folate-free state and in complex with two antifolate drugs, trimetrexate and methotrexate

    SciTech Connect

    Senkovich, Olga; Schormann, Norbert; Chattopadhyay, Debasish


    The flagellate protozoan parasite Trypanosoma cruzi is the pathogenic agent of Chagas disease (also called American trypanosomiasis), which causes approximately 50 000 deaths annually. The disease is endemic in South and Central America. The parasite is usually transmitted by a blood-feeding insect vector, but can also be transmitted via blood transfusion. In the chronic form, Chagas disease causes severe damage to the heart and other organs. There is no satisfactory treatment for chronic Chagas disease and no vaccine is available. There is an urgent need for the development of chemotherapeutic agents for the treatment of T. cruzi infection and therefore for the identification of potential drug targets. The dihydrofolate reductase activity of T. cruzi, which is expressed as part of a bifunctional enzyme, dihydrofolate reductase-thymidylate synthase (DHFR-TS), is a potential target for drug development. In order to gain a detailed understanding of the structure-function relationship of T. cruzi DHFR, the three-dimensional structure of this protein in complex with various ligands is being studied. Here, the crystal structures of T. cruzi DHFR-TS with three different compositions of the DHFR domain are reported: the folate-free state, the complex with the lipophilic antifolate trimetrexate (TMQ) and the complex with the classical antifolate methotrexate (MTX). These structures reveal that the enzyme is a homodimer with substantial interactions between the two TS domains of neighboring subunits. In contrast to the enzymes from Cryptosporidium hominis and Plasmodium falciparum, the DHFR and TS active sites of T. cruzi lie on the same side of the monomer. As in other parasitic DHFR-TS proteins, the N-terminal extension of the T. cruzi enzyme is involved in extensive interactions between the two domains. The DHFR active site of the T. cruzi enzyme shows subtle differences compared with its human counterpart. These differences may be exploited for the development of

  4. Trypanosoma brucei DHFR-TS Revisited: Characterisation of a Bifunctional and Highly Unstable Recombinant Dihydrofolate Reductase-Thymidylate Synthase

    PubMed Central

    Gibson, Marc W.; Dewar, Simon; Ong, Han B.; Sienkiewicz, Natasha


    Bifunctional dihydrofolate reductase–thymidylate synthase (DHFR-TS) is a chemically and genetically validated target in African trypanosomes, causative agents of sleeping sickness in humans and nagana in cattle. Here we report the kinetic properties and sensitivity of recombinant enzyme to a range of lipophilic and classical antifolate drugs. The purified recombinant enzyme, expressed as a fusion protein with elongation factor Ts (Tsf) in ThyA- Escherichia coli, retains DHFR activity, but lacks any TS activity. TS activity was found to be extremely unstable (half-life of 28 s) following desalting of clarified bacterial lysates to remove small molecules. Stability could be improved 700-fold by inclusion of dUMP, but not by other pyrimidine or purine (deoxy)-nucleosides or nucleotides. Inclusion of dUMP during purification proved insufficient to prevent inactivation during the purification procedure. Methotrexate and trimetrexate were the most potent inhibitors of DHFR (Ki 0.1 and 0.6 nM, respectively) and FdUMP and nolatrexed of TS (Ki 14 and 39 nM, respectively). All inhibitors showed a marked drop-off in potency of 100- to 1,000-fold against trypanosomes grown in low folate medium lacking thymidine. The most potent inhibitors possessed a terminal glutamate moiety suggesting that transport or subsequent retention by polyglutamylation was important for biological activity. Supplementation of culture medium with folate markedly antagonised the potency of these folate-like inhibitors, as did thymidine in the case of the TS inhibitors raltitrexed and pemetrexed. PMID:27175479

  5. Functional analysis of Plasmodium vivax dihydrofolate reductase-thymidylate synthase genes through stable transformation of Plasmodium falciparum.


    Auliff, Alyson M; Balu, Bharath; Chen, Nanhua; O'Neil, Michael T; Cheng, Qin; Adams, John H


    Mechanisms of drug resistance in Plasmodium vivax have been difficult to study partially because of the difficulties in culturing the parasite in vitro. This hampers monitoring drug resistance and research to develop or evaluate new drugs. There is an urgent need for a novel method to study mechanisms of P. vivax drug resistance. In this paper we report the development and application of the first Plasmodium falciparum expression system to stably express P. vivax dhfr-ts alleles. We used the piggyBac transposition system for the rapid integration of wild-type, single mutant (117N) and quadruple mutant (57L/58R/61M/117T) pvdhfr-ts alleles into the P. falciparum genome. The majority (81%) of the integrations occurred in non-coding regions of the genome; however, the levels of pvdhfr transcription driven by the P. falciparum dhfr promoter were not different between integrants of non-coding and coding regions. The integrated quadruple pvdhfr mutant allele was much less susceptible to antifolates than the wild-type and single mutant pvdhfr alleles. The resistance phenotype was stable without drug pressure. All the integrated clones were susceptible to the novel antifolate JPC-2067. Therefore, the piggyBac expression system provides a novel and important tool to investigate drug resistance mechanisms and gene functions in P. vivax.

  6. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish


    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  7. Lausannevirus Encodes a Functional Dihydrofolate Reductase Susceptible to Proguanil

    PubMed Central

    Mueller, L.; Hauser, P. M.; Gauye, F.


    ABSTRACT Lausannevirus belongs to the family Marseilleviridae within the group of nucleocytoplasmic large DNA viruses (NCLDVs). These giant viruses exhibit unique features, including a large genome, ranging from 100 kb to 2.5 Mb and including from 150 to more than 2,500 genes, as well as the presence of genes coding for proteins involved in transcription and translation. The large majority of Lausannevirus open reading frames have unknown functions. Interestingly, a bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is encoded in the Lausannevirus genome. The enzyme plays central roles in DNA precursor biosynthesis. DHFR is the pharmacological target of antifolates, such as trimethoprim, pyrimethamine, and proguanil. First, the functionality of Lausannevirus DHFR-TS was demonstrated by the successful complementation of a DHFR-deficient Saccharomyces cerevisiae strain with a plasmid expressing the heterologous gene. Additionally, using this heterologous expression system, we demonstrated the in vitro susceptibility of Lausannevirus DHFR-TS to proguanil and its resistance to pyrimethamine and trimethoprim. Proguanil may provide a unique and useful treatment if Lausannevirus proves to be a human pathogen. To our knowledge, this is the first time that a DHFR-TS has been described and characterized in an NCLDV. PMID:28137801

  8. Dihydrofolate Reductase and Thymidylate Synthase Transgenes Resistant to Methotrexate Interact to Permit Novel Transgene Regulation*

    PubMed Central

    Rushworth, David; Mathews, Amber; Alpert, Amir; Cooper, Laurence J. N.


    Methotrexate (MTX) is an anti-folate that inhibits de novo purine and thymidine nucleotide synthesis. MTX induces death in rapidly replicating cells and is used in the treatment of multiple cancers. MTX inhibits thymidine synthesis by targeting dihydrofolate reductase (DHFR) and thymidylate synthase (TYMS). The use of MTX to treat cancer also causes bone marrow suppression and inhibits the immune system. This has led to the development of an MTX-resistant DHFR, DHFR L22F, F31S (DHFRFS), to rescue healthy cells. 5-Fluorouracil-resistant TYMS T51S, G52S (TYMSSS) is resistant to MTX and improves MTX resistance of DHFRFS in primary T cells. Here we find that a known mechanism of MTX-induced increase in DHFR expression persists with DHFRFS and cis-expressed transgenes. We also find that TYMSSS expression of cis-expressed transgenes is similarly decreased in an MTX-inducible manner. MTX-inducible changes in DHFRFS and TYMSSS expression changes are lost when both genes are expressed together. In fact, expression of the DHFRFS and TYMSSS cis-expressed transgenes becomes correlated. These findings provide the basis for an unrecognized post-transcriptional mechanism that functionally links expression of DHFR and TYMS. These findings were made in genetically modified primary human T cells and have a clear potential for use in clinical applications where gene expression needs to be regulated by drug or maintained at a specific expression level. We demonstrate a potential application of this system in the controlled expression of systemically toxic cytokine IL-12. PMID:26242737

  9. Beyond Thymidylate Synthase and Dihydrofolate Reductase: Impact of Non-coding microRNAs in Anticancer Chemoresistance.


    Ju, Jingfang


    Chemoresistance is one of the major reasons for the failure of anticancer chemotherapy in treating advanced stage cancer. The mechanism of chemoresistance to fluoropyrimidines and antifolates has been extensively investigated in the past 40 years. It has been well established that thymidylate synthase (TYMS, TS) and dihydrofolate reductase (DHFR) are two major targets for fluoropyrimidines and antifolates, respectively. The regulatory mechanism of TS and DHFR expression is rather complex involving transcriptional, post-transcriptional and translational regulations. Our recent understanding of the chemoresistance mechanism has been extended beyond the simple one target/drug view. In this review, we will focus on the recent advancement of non-coding microRNAs (miRNAs) in contributing to the regulations of TS and DHFR expression, and to the chemoresistance mechanism of fluoropyrimidines and antifolates.

  10. Sulfa and trimethoprim-like drugs - antimetabolites acting as carbonic anhydrase, dihydropteroate synthase and dihydrofolate reductase inhibitors.


    Capasso, Clemente; Supuran, Claudiu T


    Recent advances in microbial genomics, synthetic organic chemistry and X-ray crystallography provided opportunities to identify novel antibacterial targets for the development of new classes of antibiotics and to design more potent antimicrobial compounds derived from existing antibiotics in clinical use for decades. The antimetabolites, sulfa drugs and trimethoprim (TMP)-like agents, are inhibitors of three families of enzymes. One family belongs to the carbonic anhydrases, which catalyze a simple but physiologically relevant reaction in all life kingdoms, carbon dioxide hydration to bicarbonate and protons. The other two enzyme families are involved in the synthesis of tetrahydrofolate (THF), i.e. dihydropteroate synthase (DHPS) and dihydrofolate reductase. The antibacterial agents belonging to the THF and DHPS inhibitors were developed decades ago and present significant bacterial resistance problems. However, the molecular mechanisms of drug resistance both to sulfa drugs and TMP-like inhibitors were understood in detail only recently, when several X-ray crystal structures of such enzymes in complex with their inhibitors were reported. Here, we revue the state of the art in the field of antibacterials based on inhibitors of these three enzyme families.

  11. Human dihydrofolate reductase and thymidylate synthase form a complex in vitro and co-localize in normal and cancer cells.


    Antosiewicz, Anna; Jarmuła, Adam; Przybylska, Dorota; Mosieniak, Grażyna; Szczepanowska, Joanna; Kowalkowska, Anna; Rode, Wojciech; Cieśla, Joanna


    Enzymes involved in thymidylate biosynthesis, thymidylate synthase (TS), and dihydrofolate reductase (DHFR) are well-known targets in cancer chemotherapy. In this study, we demonstrated for the first time, that human TS and DHFR form a strong complex in vitro and co-localize in human normal and colon cancer cell cytoplasm and nucleus. Treatment of cancer cells with methotrexate or 5-fluorouracil did not affect the distribution of either enzyme within the cells. However, 5-FU, but not MTX, lowered the presence of DHFR-TS complex in the nucleus by 2.5-fold. The results may suggest the sequestering of TS by FdUMP in the cytoplasm and thereby affecting the translocation of DHFR-TS complex to the nucleus. Providing a strong likelihood of DHFR-TS complex formation in vivo, the latter complex is a potential new drug target in cancer therapy. In this paper, known 3D structures of human TS and human DHFR, and some protozoan bifunctional DHFR-TS structures as templates, are used to build an in silico model of human DHFR-TS complex structure, consisting of one TS dimer and two DHFR monomers. This complex structure may serve as an initial 3D drug target model for prospective inhibitors targeting interfaces between the DHFR and TS enzymes.

  12. A nanotherapy strategy significantly enhances anticryptosporidial activity of an inhibitor of bifunctional thymidylate synthase-dihydrofolate reductase from Cryptosporidium.


    Mukerjee, Anindita; Iyidogan, Pinar; Castellanos-Gonzalez, Alejandro; Cisneros, José A; Czyzyk, Daniel; Ranjan, Amalendu Prakash; Jorgensen, William L; White, A Clinton; Vishwanatha, Jamboor K; Anderson, Karen S


    Cryptosporidiosis, a gastrointestinal disease caused by protozoans of the genus Cryptosporidium, is a common cause of diarrheal diseases and often fatal in immunocompromised individuals. Bifunctional thymidylate synthase-dihydrofolate reductase (TS-DHFR) from Cryptosporidium hominis (C. hominis) has been a molecular target for inhibitor design. C. hominis TS-DHFR inhibitors with nM potency at a biochemical level have been developed however drug delivery to achieve comparable antiparasitic activity in Cryptosporidium infected cell culture has been a major hurdle for designing effective therapies. Previous mechanistic and structural studies have identified compound 906 as a nM C. hominis TS-DHFR inhibitor in vitro, having μM antiparasitic activity in cell culture. In this work, proof of concept studies are presented using a nanotherapy approach to improve drug delivery and the antiparasitic activity of 906 in cell culture. We utilized PLGA nanoparticles that were loaded with 906 (NP-906) and conjugated with antibodies to the Cryptosporidium specific protein, CP2, on the nanoparticle surface in order to specifically target the parasite. Our results indicate that CP2 labeled NP-906 (CP2-NP-906) reduces the level of parasites by 200-fold in cell culture, while NP-906 resulted in 4.4-fold decrease. Moreover, the anticryptosporidial potency of 906 improved 15 to 78-fold confirming the utility of the antibody conjugated nanoparticles as an effective drug delivery strategy.

  13. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function

    SciTech Connect

    Schormann, N.; Senkovich, O.; Walker, K.; Wright, D.L.; Anderson, A.C.; Rosowsky, A.; Ananthan, S.; Shinkre, B.; Velu, S.; Chattopadhyay, D.


    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  14. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function.


    Schormann, N; Senkovich, O; Walker, K; Wright, D L; Anderson, A C; Rosowsky, A; Ananthan, S; Shinkre, B; Velu, S; Chattopadhyay, D


    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  15. Use of bacterial surrogates as a tool to explore antimalarial drug interaction: Synergism between inhibitors of malarial dihydrofolate reductase and dihydropteroate synthase.


    Talawanich, Yuwadee; Kamchonwongpaisan, Sumalee; Sirawaraporn, Worachart; Yuthavong, Yongyuth


    Interaction between antimalarial drugs is important in determining the outcome of chemotherapy using drug combinations. Inhibitors of dihydrofolate reductase (DHFR) such as pyrimethamine and of dihydropteroate synthase (DHPS) such as sulfa drugs are known to have synergistic interactions. However, studies of the synergism are complicated by the fact that the malaria parasite can also salvage exogenous folates, and the salvage may also be affected by the drugs. It is desirable to have a convenient system to study interaction of DHFR and DHPS inhibitors without such complications. Here, we describe the use of Escherichia coli transformed with malarial DHFR and DHPS, while its own corresponding genes have been inactivated by optimal concentration of trimethoprim and genetic knockout, respectively, to study the interaction of the inhibitors. Marked synergistic effects are observed for all combinations of pyrimethamine and sulfa inhibitors in the presence of trimethoprim. At 0.05μM trimethoprim, sum of fractional inhibitory concentrations, ΣFIC of pyrimethamine with sulfadoxine, pyrimethamine with sulfathiazole, pyrimethamine with sulfamethoxazole, and pyrimethamine with dapsone are in the range of 0.24-0.41. These results show synergism between inhibitors of the two enzymes even in the absence of folate transport and uptake. This bacterial surrogate system should be useful as a tool for assessing the interactions of drug combinations between the DHFR and DHPS inhibitors.

  16. An innovative strategy for dual inhibitor design and its application in dual inhibition of human thymidylate synthase and dihydrofolate reductase enzymes.


    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo


    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs.

  17. An Innovative Strategy for Dual Inhibitor Design and Its Application in Dual Inhibition of Human Thymidylate Synthase and Dihydrofolate Reductase Enzymes

    PubMed Central

    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo


    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs. PMID:23577115

  18. Molecular epidemiology of malaria in Cameroon. XXVII. Clinical and parasitological response to sulfadoxine-pyrimethamine treatment and Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase alleles in Cameroonian children.


    Tahar, Rachida; Basco, Leonardo K


    The rapidly changing epidemiology of antifolate-resistant Plasmodium falciparum in Africa requires monitoring. The present study was designed to assess the degree of association between the clinical and parasitological response to sulfadoxine-pyrimethamine and allelic combinations of dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes. Of 357 children who completed the 14-day follow-up, an adequate clinical and parasitological response was observed in 316 patients (88.5%) and early and late failures occurred in 18 (5%) and 23 (6.4%, mostly due to recrudescence) patients, respectively. The majority of clinical isolates were characterized as "quadruple" (n=196, 55.2%; N51I-C59R-S108N in DHFR and A437G in DHPS) or "triple" mutants (n=97, 27.3%; N51I-C59R-S108N in DHFR and wild-type DHPS; S108N+N51I or C59R in DHFR and A437G in DHPS). Wild-type, single mutation, and double mutation were observed in 29, 20, and 13 parasites, respectively. The comparison of different sets of mutations and early or late failures did not reveal any molecular marker associated with treatment outcome when the follow-up period was limited to 14 days (P>0.05). In this study, the determination of dhfr-dhps genotypes was of limited value to predict the treatment outcome in individual patients, mostly due to few treatment failures and few wild-type haplotypes. Further monitoring will be required to define the relationship between clinical response to SP therapy and parasite genotypes in our epidemiological setting.

  19. Molecular epidemiology of malaria in Cameroon. XXX. sequence analysis of Plasmodium falciparum ATPase 6, dihydrofolate reductase, and dihydropteroate synthase resistance markers in clinical isolates from children treated with an artesunate-sulfadoxine-pyrimethamine combination.


    Menemedengue, Virginie; Sahnouni, Khalifa; Basco, Leonardo; Tahar, Rachida


    Plasmodium falciparum dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are reliable molecular markers for antifolate resistance. The P. falciparum ATPase 6 (pfatp6) gene has been proposed to be a potential marker for artemisinin resistance. In our previous clinical study, we showed that artesunate-sulfadoxine-pyrimethamine is highly effective against uncomplicated malaria in Yaoundé, Cameroon. In the present study, dhfr, dhps, and pfatp6 mutations in P. falciparum isolates obtained from children treated with artesunate-sulfadoxine-pyrimethamine were determined. All 61 isolates had wild-type Pfatp6 263, 623, and 769 alleles, and 11 (18%) had a single E431K substitution. Three additional mutations, E643Q, E432K, and E641Q, were detected. The results did not indicate any warning signal of serious concern (i.e., no parasites were seen with quintuple dhfr-dhps, DHFR Ile164Leu, or pfatp6 mutations), as confirmed by the high clinical efficacy of artesunate-sulfadoxine-pyrimethamine. Further studies are required to identify a molecular marker that reliably predicts artemisinin resistance.

  20. Multiparameter Screening on SlipChip Used for Nanoliter Protein Crystallization Combining Free Interface Diffusion and Microbatch Methods

    SciTech Connect

    Li, Liang; Du, Wenbin; Ismagilov, Rustem F.


    This paper describes two SlipChip-based approaches to protein crystallization: a SlipChip-based free interface diffusion (FID) method and a SlipChip-based composite method that simultaneously performs microbatch and FID crystallization methods in a single device. The FID SlipChip was designed to screen multiple reagents, each at multiple diffusion equilibration times, and was validated by screening conditions for crystallization of two proteins, enoyl-CoA hydratase from Mycobacterium tuberculosis and dihydrofolate reductase/thymidylate synthase from Babesia bovis, against 48 different reagents at five different equilibration times each, consuming 12 {micro}L of each protein for a total of 480 experiments using three SlipChips. The composite SlipChip was designed to screen multiple reagents, each at multiple mixing ratios and multiple equilibration times, and was validated by screening conditions for crystallization of two proteins, enoyl-CoA hydratase from Mycobacterium tuberculosis and dihydrofolate reductase/thymidylate synthase from Babesia bovis. To prevent cross-contamination while keeping the solution in the neck channels for FID stable, the plates of the SlipChip were etched with a pattern of nanowells. This nanopattern was used to increase the contact angle of aqueous solutions on the surface of the silanized glass. The composite SlipChip increased the number of successful crystallization conditions and identified more conditions for crystallization than separate FID and microbatch screenings. Crystallization experiments were scaled up in well plates using conditions identified during the SlipChip screenings, and X-ray diffraction data were obtained to yield the protein structure of dihydrofolate reductase/thymidylate synthase at 1.95 {angstrom} resolution. This free-interface diffusion approach provides a convenient and high-throughput method of setting up gradients in microfluidic devices and may find additional applications in cell-based assays.

  1. Tales of Dihydrofolate Binding to R67 Dihydrofolate Reductase

    PubMed Central


    Homotetrameric R67 dihydrofolate reductase possesses 222 symmetry and a single active site pore. This situation results in a promiscuous binding site that accommodates either the substrate, dihydrofolate (DHF), or the cofactor, NADPH. NADPH interacts more directly with the protein as it is larger than the substrate. In contrast, the p-aminobenzoyl-glutamate tail of DHF, as monitored by nuclear magnetic resonance and crystallography, is disordered when bound. To explore whether smaller active site volumes (which should decrease the level of tail disorder by confinement effects) alter steady state rates, asymmetric mutations that decreased the half-pore volume by ∼35% were constructed. Only minor effects on kcat were observed. To continue exploring the role of tail disorder in catalysis, 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide-mediated cross-linking between R67 DHFR and folate was performed. A two-folate, one-tetramer complex results in the loss of enzyme activity where two symmetry-related K32 residues in the protein are cross-linked to the carboxylates of two bound folates. The tethered folate could be reduced, although with a ≤30-fold decreased rate, suggesting decreased dynamics and/or suboptimal positioning of the cross-linked folate for catalysis. Computer simulations that restrain the dihydrofolate tail near K32 indicate that cross-linking still allows movement of the p-aminobenzoyl ring, which allows the reaction to occur. Finally, a bis-ethylene-diamine-α,γ-amide folate adduct was synthesized; both negatively charged carboxylates in the glutamate tail were replaced with positively charged amines. The Ki for this adduct was ∼9-fold higher than for folate. These various results indicate a balance between folate tail disorder, which helps the enzyme bind substrate while dynamics facilitates catalysis. PMID:26637016

  2. Synthesis, antimalarial activity and molecular docking of hybrid 4-aminoquinoline-1,3,5-triazine derivatives.


    Bhat, Hans Raj; Singh, Udaya Pratap; Thakur, Anjali; Kumar Ghosh, Surajit; Gogoi, Kabita; Prakash, Anil; Singh, Ramendra K


    A series of novel hybrid 4-aminoquinoline 1,3,5-triazine derivatives was synthesized in a five-steps reaction and evaluated for their in vitro antimalarial activity against chloroquine-sensitive (3D7) and chloroquine-resistant (RKL-2) strains of Plasmodium falciparum. Entire synthetic derivatives showed higher antimalarial activity on the sensitive strain while two compounds, viz., 9a and 9c displayed good activity against both the strains of P. falciparum. The observed activity was further substantiated by docking study on both wild and qradruple mutant type P. falciparum dihydrofolate reductase-thymidylate synthase (pf-DHFR-TS).

  3. Over-production of dihydrofolate reductase leads to sulfa-dihydropteroate resistance in yeast.


    Patel, Onisha; Karnik, Kuldeep; Macreadie, Ian G


    Dihydropteroate synthase (DHPS) can metabolise sulfa drugs into sulfa-dihydropteroate (sulfa-DHP), which inhibits cell growth through competition with dihydrofolate (DHF), possibly indicating dihydrofolate reductase (DHFR) as the target of sulfa-DHP. The effect of over-production of DHFR on sulfa-DHP resistance was examined in Saccharomyces cerevisiae using a strain that requires DHF for growth. This strain was transformed with a plasmid which encodes over-production of DHFR in the presence of CuSO4. Over-production led to resistance to sulfa-DHP suggesting that sulfa-DHP targets DHFR. Spontaneous mutants hyper-resistant to sulfa-DHP did not show any changes within DHFR.

  4. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.


    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  5. Human endothelial dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling.


    Whitsett, Jennifer; Rangel Filho, Artur; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vasquez-Vivar, Jeannette


    Tetrahydrobiopterin (BH₄) is required for NO synthesis and inhibition of superoxide release from endothelial NO synthase. Clinical trials using BH₄ to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH₄. One of the oxidation products of BH₄, 7,8-dihydrobiopterin (7,8-BH₂), is recycled back to BH₄ by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH₄ treatment is lacking. To characterize this reaction, we applied a novel multielectrode coulometric HPLC method that enabled the direct quantification of 7,8-BH₂ and BH₄, which is not possible with fluorescence-based methodologies. We found that basal untreated BH₄ and 7,8-BH₂ concentrations in human endothelial cells (ECs) are lower than in bovine and murine endothelioma cells. Treatment of human ECs with BH₄ transiently increased intracellular BH₄ while accumulating the more stable 7,8-BH₂. This was different from bovine or murine ECs, which resulted in preferential BH₄ increase. Using BH₄ diastereomers, 6S-BH₄ and 6R-BH₄, the narrow contribution of enzymatic DHFR recycling to total intracellular BH₄ was demonstrated. Reduction of 7,8-BH₂ to BH₄ occurs at very slow rates in cells and needs supraphysiological levels of 7,8-BH₂, indicating this reaction is kinetically limited. Activity assays verified that human DHFR has very low affinity for 7,8-BH₂ (DHF7,8-BH₂) and folic acid inhibits 7,8-BH₂ recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies, which may be further aggravated by folate supplements.

  6. Molecular phylogeny of Trypanosoma cruzi from Central America (Guatemala) and a comparison with South American strains.


    Iwagami, M; Higo, H; Miura, S; Yanagi, T; Tada, I; Kano, S; Agatsuma, T


    Molecular phylogenetic analysis was carried out for 21 strains of Trypanosoma cruzi, nine of which were obtained from Guatemala and 12 from South America. Phylogenetic trees were constructed using the nucleotide sequences of two nuclear gene regions, dihydrofolate reductase-thymidylate synthase (DHFR-TS) and trypanothione reductase (TR), and contiguous portions of two mitochondrial genes, cytochrome oxidase subunit II (COII) and reduced nicotinamide adenine dinucleotide dehydrogenase subunit 1 (ND1). Possible genetic exchange between the rather divergent lineages of T. cruzi II from South America was suggested in the trees of the two nuclear genes. T. cruzi I strains obtained from Guatemala and Colombia were identical in all the genes examined, but other T. cruzi I isolates from South America were rather polymorphic in the DHFR-TS and mitochondrial genes. No genetic exchange was identified between T. cruzi I populations from Central and South America in the present study.

  7. Microsecond subdomain folding in dihydrofolate reductase.


    Arai, Munehito; Iwakura, Masahiro; Matthews, C Robert; Bilsel, Osman


    The characterization of microsecond dynamics in the folding of multisubdomain proteins has been a major challenge in understanding their often complex folding mechanisms. Using a continuous-flow mixing device coupled with fluorescence lifetime detection, we report the microsecond folding dynamics of dihydrofolate reductase (DHFR), a two-subdomain α/β/α sandwich protein known to begin folding in this time range. The global dimensions of early intermediates were monitored by Förster resonance energy transfer, and the dynamic properties of the local Trp environments were monitored by fluorescence lifetime detection. We found that substantial collapse occurs in both the locally connected adenosine binding subdomain and the discontinuous loop subdomain within 35 μs of initiation of folding from the urea unfolded state. During the fastest observable ∼550 μs phase, the discontinuous loop subdomain further contracts, concomitant with the burial of Trp residue(s), as both subdomains achieve a similar degree of compactness. Taken together with previous studies in the millisecond time range, a hierarchical assembly of DHFR--in which each subdomain independently folds, subsequently docks, and then anneals into the native conformation after an initial heterogeneous global collapse--emerges. The progressive acquisition of structure, beginning with a continuously connected subdomain and spreading to distal regions, shows that chain entropy is a significant organizing principle in the folding of multisubdomain proteins and single-domain proteins. Subdomain folding also provides a rationale for the complex kinetics often observed.

  8. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.


    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  9. Correlated Protein Motion Measurements of Dihydrofolate Reductase Crystals

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea


    We report the first direct measurements of the long range structural vibrational modes in dihydrofolate reductase (DHFR). DHFR is a universal housekeeping enzyme that catalyzes the reduction of 7,8-dihydrofolate to 5,6,7,8-tetra-hydrofolate, with the aid of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH). This crucial enzymatic role as the target for anti-cancer [methotrexate (MTX)], and other clinically useful drugs, has made DHFR a long-standing target of enzymological studies. The terahertz (THz) frequency range (5-100 cm-1), corresponds to global correlated protein motions. In our lab we have developed Crystal Anisotropy Terahertz Microscopy (CATM), which directly measures these large scale intra-molecular protein vibrations, by removing the relaxational background of the solvent and residue side chain librational motions. We demonstrate narrowband features in the anisotropic absorbance for mouse DHFR with the ligand binding of NADPH and MTX single crystals as well as Escherichia coli DHFR with the ligand binding of NADPH and MTX single crystals. This work is supported by NSF grant MRI2 grant DBI2959989.

  10. Structure and kinetics assays of recombinant Schistosoma mansoni dihydrofolate reductase.


    Serrão, Vitor Hugo Balasco; Romanello, Larissa; Cassago, Alexandre; de Souza, Juliana Roberta Torini; Cheleski, Juliana; DeMarco, Ricardo; Brandão-Neto, José; Pereira, Humberto D'Muniz


    The parasite Schistosoma mansoni possesses all pathways for pyrimidine biosynthesis, in which dihydrofolate reductase (DHFR), thymidylate cycle participants, is essential for nucleotide metabolism to obtain energy and structural nucleic acids. Thus, DHFRs have been widely suggested as therapeutic targets for the treatment of infectious diseases. In this study, we expressed recombinant SmDHFR in a heterologous manner to obtain structural, biochemical and kinetic information. X-ray diffraction of recombinant SmDHFR at 1.95Å resolution showed that the structure exhibited the canonical DHFR fold. Isothermal titration calorimetry was used to determine the kinetic constants for NADP(+) and dihydrofolate. Moreover, inhibition assays were performed using the commercial folate analogs methotrexate and aminopterin; these analogs are recognized as folate competitors and are used as chemotherapeutic agents in cancer and autoimmune diseases. This study provides information that may prove useful for the future discovery of novel drugs and for understanding these metabolic steps from this pathway of S. mansoni, thus aiding in our understanding of the function of these essential pathways for parasite metabolism.

  11. Fluorescent analogues of methotrexate: characterization and interaction with dihydrofolate reductase.


    Kumar, A A; Kempton, R J; Anstead, G M; Freisheim, J H


    The dansylated derivatives of lysine and ornithine analogues of methotrexate exhibit fluorescence properties characteristic of the dansyl moiety with an excitation at 328 nm and an emission maximum at 580 nm in aqueous media. As in the case of dansyl amino acids, the fluorescence emission is dependent upon the polarity of the medium. In solvents of low dielectric constant there is an enhancement of the dansyl fluorescence intensity as well as a shift to shorter wavelengths. The dansylated analogues show a reduction in the quantum yields as compared to N epsilon-dansyl-L-lysine and 5-(N,N-dimethylamino)-1-naphthalenesulfonic acid. The absorption spectra of the two dansyl analogues are similar to the spectra of the parent basic amino acid precursors but with reduced molar extinction values. The two fluorescent analogues of methotrexate were found to be potent inhibitors of purified dihydrofolate reductases from Lactobacillus casei and from chicken liver. The binding of these fluorescent analogues to either dihydrofolate reductase resulted in 10-15-nm blue shift of the ligand emission maxima and a 2-5-fold enhancement of the emission. These fluorescent properties of the bound ligands indicate a possible interaction of the dansyl moiety with a region on the enzyme molecule which is more hydrophobic relative to the surrounding solvent.

  12. Optical observation of correlated motions in dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea


    Enzyme function relies on its structural flexibility to make conformational changes for substrate binding and product release. An example of a metabolic enzyme where such structural changes are vital is dihydrofolate reductase (DHFR). DHFR is essential in both prokaryotes and eukaryotes for the nucleotide biosynthesis by catalyzing the reduction of dihydrofolate to tetrahydrofolate. NMR dynamical measurements found large amplitude fast dynamics that could indicate rigid-body, twisting-hinge motion for ecDHFR that may mediate flux. The role of such long-range correlated motions in function was suggested by the observed sharp decrease in enzyme activity for the single point mutation G121V, which is remote from active sites. This decrease in activity may be caused by the mutation interfering with the long-range intramolecular vibrations necessary for rapid access to functional configurations. We use our new technique of crystal anisotropy terahertz microscopy (CATM), to observe correlated motions in ecDHFR crystals with the bonding of NADPH and methotrexate. We compare the measured intramolecular vibrational spectrum with calculations using normal mode analysis.

  13. Amplification and loss of dihydrofolate reductase genes in a Chinese hamster ovary cell line

    SciTech Connect

    Kaufman, R.J.; Schimke, R.T.


    During stepwise increases in the methotrexate concentration in culture medium, the authors selected Chinese hamster ovary cells that contained elevated dihydrofolate reductase levels which were proportional to the number of dihydrofolate reductase gene copies (i.e., gene amplification). The authors studied the dihydrofolate reductase levels in individual cells that underwent the initial steps of methotrexate resistance by using the fluorescence-activated cell sorter technique. Such cells constituted a heterogeneous population with differing dihydrofolate reductase levels, and they characteristically lost the elevated enzyme levels when they were grown in the absence of methotrexate. The progeny of individual cells with high enzyme levels behaved differently and could lose all or variable numbers of the amplified genes.

  14. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal.


    Ndiaye, D; Daily, J P; Sarr, O; Ndir, O; Gaye, O; Mboup, S; Wirth, D F


    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in Plasmodium falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analysed from patients (5 years or older) with mild malaria after informed consent was obtained. Longitudinal samples were collected between 2000 and 2003 in Pikine, a suburb of Dakar. Geographically diverse site sampling was carried out in 2003. The mutation prevalence in DHFR codons 51, 59 and 108 is 65%, 61% and 78% in Pikine, 2003. The overall prevalence of the triple mutation that is associated with high-level pyrimethamine resistance is 61%. The mutation prevalence rate in DHPS codons 436 and 437 is 21% and 40%, respectively. There is significant geographic variation in genotypic resistance, as samples from Pikine in 2003 had higher mutation prevalence in the pfdhfr and pfdhps genes compared to samples from Tambacounda (P < 0.015). In summary, this study demonstrates a high background prevalence of SP resistance mutations already present in P. falciparum in Senegal.

  15. Hydride transfer during catalysis by dihydrofolate reductase from Thermotoga maritima.

    PubMed Central

    Maglia, Giovanni; Javed, Masood H; Allemann, Rudolf K


    DHFR (dihydrofolate reductase) catalyses the metabolically important reduction of 7,8-dihydrofolate by NADPH. DHFR from the hyperthermophilic bacterium Thermotoga maritima (TmDHFR), which shares similarity with DHFR from Escherichia coli, has previously been characterized structurally. Its tertiary structure is similar to that of DHFR from E. coli but it is the only DHFR characterized so far that relies on dimerization for stability. The midpoint of the thermal unfolding of TmDHFR was at approx. 83 degrees C, which was 30 degrees C higher than the melting temperature of DHFR from E. coli. The turnover and the hydride-transfer rates in the kinetic scheme of TmDHFR were derived from measurements of the steady-state and pre-steady-state kinetics using absorbance and stopped-flow fluorescence spectroscopy. The rate constant for hydride transfer was found to depend strongly on the temperature and the pH of the solution. Hydride transfer was slow (0.14 s(-1) at 25 degrees C) and at least partially rate limiting at low temperatures but increased dramatically with temperature. At 80 degrees C the hydride-transfer rate of TmDHFR was 20 times lower than that observed for the E. coli enzyme at its physiological temperature. Hydride transfer depended on ionization of a single group in the active site with a p K(a) of 6.0. While at 30 degrees C, turnover of substrate by TmDHFR was almost two orders of magnitude slower than by DHFR from E. coli; the steady-state rates of the two enzymes differed only 8-fold at their respective working temperatures. PMID:12765545

  16. Electrostatic Channeling in P. falciparum DHFR-TS: Brownian Dynamics and Smoluchowski Modeling

    PubMed Central

    Metzger, Vincent T.; Eun, Changsun; Kekenes-Huskey, Peter M.; Huber, Gary; McCammon, J. Andrew


    We perform Brownian dynamics simulations and Smoluchowski continuum modeling of the bifunctional Plasmodium falciparum dihydrofolate reductase-thymidylate synthase (P. falciparum DHFR-TS) with the objective of understanding the electrostatic channeling of dihydrofolate generated at the TS active site to the DHFR active site. The results of Brownian dynamics simulations and Smoluchowski continuum modeling suggest that compared to Leishmania major DHFR-TS, P. falciparum DHFR-TS has a lower but significant electrostatic-mediated channeling efficiency (∼15–25%) at physiological pH (7.0) and ionic strength (150 mM). We also find that removing the electric charges from key basic residues located between the DHFR and TS active sites significantly reduces the channeling efficiency of P. falciparum DHFR-TS. Although several protozoan DHFR-TS enzymes are known to have similar tertiary and quaternary structure, subtle differences in structure, active-site geometry, and charge distribution appear to influence both electrostatic-mediated and proximity-based substrate channeling. PMID:25418308

  17. A second target of benzamide riboside: dihydrofolate reductase.


    Roussel, Breton; Johnson-Farley, Nadine; Kerrigan, John E; Scotto, Kathleen W; Banerjee, Debabrata; Felczak, Krzysztof; Pankiewicz, Krzysztof W; Gounder, Murugesan; Lin, HongXia; Abali, Emine Ercikan; Bertino, Joseph R


    Dihydrofolate reductase (DHFR) is an essential enzyme involved in de novo purine and thymidine biosynthesis. For several decades, selective inhibition of DHFR has proven to be a potent therapeutic approach in the treatment of various cancers including acute lymphoblastic leukemia, non-Hodgkin's lymphoma, osteogenic sarcoma, carcinoma of the breast, and head and neck cancer. Therapeutic success with DHFR inhibitor methotrexate (MTX) has been compromised in the clinic, which limits the success of MTX treatment by both acquired and intrinsic resistance mechanisms. We report that benzamide riboside (BR), via anabolism to benzamide adenine dinucleotide (BAD) known to potently inhibit inosine monophosphate dehydrogenase (IMPDH), also inhibits cell growth through a mechanism involving downregulation of DHFR protein. Evidence to support this second site of action of BR includes the finding that CCRF-CEM/R human T-cell lymphoblasic leukemia cells, resistant to MTX as a consequence of gene amplification and overexpression of DHFR, are more resistant to BR than are parental cells. Studies of the mechanism by which BR lowers DHFR showed that BR, through its metabolite BAD, reduced NADP and NADPH cellular levels by inhibiting nicotinamide adenine dinucleotide kinase (NADK). As consequence of the lack of NADPH, DHFR was shown to be destabilized. We suggest that, inhibition of NADK is a new approach to downregulate DHFR and to inhibit cell growth.

  18. Solvent effects on catalysis by Escherichia coli dihydrofolate reductase.


    Loveridge, E Joel; Tey, Lai-Hock; Allemann, Rudolf K


    Hydride transfer catalyzed by dihydrofolate reductase (DHFR) has been described previously within an environmentally coupled model of hydrogen tunneling, where protein motions control binding of substrate and cofactor to generate a tunneling ready conformation and modulate the width of the activation barrier and hence the reaction rate. Changes to the composition of the reaction medium are known to perturb protein motions. We have measured kinetic parameters of the reaction catalyzed by DHFR from Escherichia coli in the presence of various cosolvents and cosolutes and show that the dielectric constant, but not the viscosity, of the reaction medium affects the rate of reaction. Neither the primary kinetic isotope effect on the reaction nor its temperature dependence were affected by changes to the bulk solvent properties. These results are in agreement with our previous report on the effect of solvent composition on catalysis by DHFR from the hyperthermophile Thermotoga maritima. However, the effect of solvent on the temperature dependence of the kinetic isotope effect on hydride transfer catalyzed by E. coli DHFR is difficult to explain within a model, in which long-range motions couple to the chemical step of the reaction, but may indicate the existence of a short-range promoting vibration or the presence of multiple nearly isoenergetic conformational substates of enzymes with similar but distinct catalytic properties.

  19. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    PubMed Central

    Beierlein, Jennifer M.; Frey, Kathleen M.; Bolstad, David B.; Pelphrey, Phillip M.; Joska, Tammy M.; Smith, Adrienne E.; Priestley, Nigel D.; Wright, Dennis L.; Anderson, Amy C.


    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 Å resolution. The structure reveals several features that can be exploited for further development of this lead series. PMID:19007108

  20. A DFT-based QSAR study on inhibition of human dihydrofolate reductase.


    Karabulut, Sedat; Sizochenko, Natalia; Orhan, Adnan; Leszczynski, Jerzy


    Diaminopyrimidine derivatives are frequently used as inhibitors of human dihydrofolate reductase, for example in treatment of patients whose immune system are affected by human immunodeficiency virus. Forty-seven dicyclic and tricyclic potential inhibitors of human dihydrofolate reductase were analyzed using the quantitative structure-activity analysis supported by DFT-based and DRAGON-based descriptors. The developed model yielded an RMSE deviation of 1.1 a correlation coefficient of 0.81. The prediction set was characterized by R(2)=0.60 and RMSE=3.59. Factors responsible for inhibition process were identified and discussed. The resulting model was validated via cross validation and Y-scrambling procedure. From the best model, we found several mass-related descriptors and Sanderson electronegativity-related descriptors that have the best correlations with the investigated inhibitory concentration. These descriptors reflect results from QSAR studies based on characteristics of human dihydrofolate reductase inhibitors.

  1. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    SciTech Connect

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A


    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  2. Recombinant bovine dihydrofolate reductase produced by mutagenesis and nested PCR of murine dihydrofolate reductase cDNA.


    Cody, Vivian; Mao, Qilong; Queener, Sherry F


    Recent reports of the slow-tight binding inhibition of bovine liver dihydrofolate reductase (bDHFR) in the presence of polyphenols isolated from green tea leaves has spurred renewed interest in the biochemical properties of bDHFR. Earlier studies were done with native bDHFR but in order to validate models of polyphenol binding to bDHFR, larger quantities of bDHFR are necessary to support structural studies. Bovine DHFR differs from its closest sequence homologue, murine DHFR, by 19 amino acids. To obtain the bDHFR cDNA, murineDHFR cDNA was transformed by a series of nested PCRs to reproduce the amino acid coding sequence for bovine DHFR. The bovine liver DHFR cDNA has an open reading frame of 561 base pairs encoding a protein of 187 amino acids that has a high level of conservation at the primary sequence level with other DHFR enzymes, and more so for the amino acid residues in the active site of the mammalian DHFR enzymes. Expression of the bovine DHFR cDNA in bacterial cells produced a stable recombinant protein with high enzymatic activity and kinetic properties similar to those previously reported for the native protein.

  3. The Effect of Protein Mass Modulation on Human Dihydrofolate Reductase

    PubMed Central

    Francis, Kevin; Sapienza, Paul J.; Lee, Andrew L.; Kohen, Amnon


    Dihydrofolate reductase (DHFR) from Escherichia coli has long served as a model enzyme with which to elucidate possible links between protein dynamics and the catalyzed reaction. Such physical properties of its human counterpart have not been rigorously studied so far, but recent computer-based simulations suggest that these two DHFRs differ significantly in how closely coupled the protein dynamics and the catalyzed C-H→C hydride transfer step are. To test this prediction, two contemporary probes for studying the effect of protein dynamics on catalysis were combined here: temperature dependence of intrinsic kinetic isotope effects (KIEs) that are sensitive to the physical nature of the chemical step, and protein mass-modulation that slows down fast dynamics (femto- to picosecond timescale) throughout the protein. The intrinsic H/T KIEs of human DHFR, like those of E. coli DHFR, are shown to be temperature-independent in the range from 5–45 °C, indicating fast sampling of donor and acceptor distances (DADs) at the reaction’s transition state (or tunneling ready state – TRS). Mass modulation of these enzymes through isotopic labeling with 13C, 15N, and 2H at nonexchangeable hydrogens yield an 11% heavier enzyme. The additional mass has no effect on the intrinsic KIEs of the human enzyme. This finding indicates that the mass-modulation of the human DHFR affects neither DAD distribution nor the DAD’s conformational sampling dynamics. Furthermore, reduction in the enzymatic turnover number and the dissociation rate constant for the product indicate that the isotopic substitution affects kinetic steps that are not the catalyzed C-H→C hydride transfer. The findings are discussed in terms of fast dynamics and their role in catalysis, the comparison of calculations and experiments, and the interpretation of isotopically-modulated heavy enzymes in general. PMID:26813442

  4. Environmental Adaptation of Dihydrofolate Reductase from Deep-Sea Bacteria.


    Ohmae, Eiji; Gekko, Kunihiko; Kato, Chiaki


    In order to elucidate the molecular adaptation mechanisms of enzymes to the high hydrostatic pressure of the deep sea, we cloned, purified, and characterized more than ten dihydrofolate reductases (DHFRs) from bacteria living in deep-sea and ambient atmospheric pressure environments. The nucleotide and amino acid sequences of these DHFRs indicate the deep-sea bacteria are adapted to their environments after the differentiation of their genus from ancestors inhabiting atmospheric pressure environments. In particular, the backbone structure of the deep-sea DHFR from Moritella profunda (mpDHFR) almost overlapped with the normal homolog from Escherichia coli (ecDHFR). Thus, those of other DHFRs would also overlap on the basis of their sequence similarities. However, the structural stability of both DHFRs was quite different: compared to ecDHFR, mpDHFR was more thermally stable but less stable against urea and pressure unfolding. The smaller volume changes due to unfolding suggest that the native structure of mpDHFR has a smaller cavity and/or enhanced hydration compared to ecDHFR. High hydrostatic pressure reduced the enzymatic activity of many DHFRs, but three deep-sea DHFRs and the D27E mutant of ecDHFR exhibited pressure-dependent activation. The inverted activation volumes from positive to negative values indicate the modification of their structural dynamics, conversion of the rate-determining step of the enzymatic reaction, and different contributions of the cavity and hydration to the transition-state structure. Since the cavity and hydration depend on amino acid side chains, DHFRs would adapt to the deep-sea environment by regulating the cavity and hydration by substituting their amino acid side chains without altering their backbone structure. The results of this study clearly indicate that the cavity and hydration play important roles in the adaptation of enzymes to the deep-sea environment.

  5. ATP synthase.


    Junge, Wolfgang; Nelson, Nathan


    Oxygenic photosynthesis is the principal converter of sunlight into chemical energy. Cyanobacteria and plants provide aerobic life with oxygen, food, fuel, fibers, and platform chemicals. Four multisubunit membrane proteins are involved: photosystem I (PSI), photosystem II (PSII), cytochrome b6f (cyt b6f), and ATP synthase (FOF1). ATP synthase is likewise a key enzyme of cell respiration. Over three billion years, the basic machinery of oxygenic photosynthesis and respiration has been perfected to minimize wasteful reactions. The proton-driven ATP synthase is embedded in a proton tight-coupling membrane. It is composed of two rotary motors/generators, FO and F1, which do not slip against each other. The proton-driven FO and the ATP-synthesizing F1 are coupled via elastic torque transmission. Elastic transmission decouples the two motors in kinetic detail but keeps them perfectly coupled in thermodynamic equilibrium and (time-averaged) under steady turnover. Elastic transmission enables operation with different gear ratios in different organisms.

  6. The crystal structure of dihydrofolate reductase from Thermotoga maritima: molecular features of thermostability.


    Dams, T; Auerbach, G; Bader, G; Jacob, U; Ploom, T; Huber, R; Jaenicke, R


    Two high-resolution structures have been obtained for dihydrofolate reductase from the hyperthermophilic bacterium Thermotoga maritima in its unliganded state, and in its ternary complex with the cofactor NADPH and the inhibitor, methotrexate. While the overall fold of the hyperthermophilic enzyme is closely similar to monomeric mesophilic dihydrofolate reductase molecules, its quaternary structure is exceptional, in that T. maritima dihydrofolate reductase forms a highly stable homodimer. Here, the molecular reasons for the high intrinsic stability of the enzyme are elaborated and put in context with the available data on the physical parameters governing the folding reaction. The molecule is extremely rigid, even with respect to structural changes during substrate binding and turnover. Subunit cooperativity can be excluded from structural and biochemical data. Major contributions to the high intrinsic stability of the enzyme result from the formation of the dimer. Within the monomer, only subtle stabilizing interactions are detectable, without clear evidence for any of the typical increments of thermal stabilization commonly reported for hyperthermophilic proteins. The docking of the subunits is optimized with respect to high packing density in the dimer interface, additional salt-bridges and beta-sheets. The enzyme does not show significant structural changes upon binding its coenzyme, NADPH, and the inhibitor, methotrexate. The active-site loop, which is known to play an important role in catalysis in mesophilic dihydrofolate reductase molecules, is rearranged, participating in the association of the subunits; it no longer participates in catalysis.

  7. Loss and stabilization of amplified dihydrofolate reductase genes in mouse sarcoma S-180 cell lines

    SciTech Connect

    Kaufman, R.J.; Brown, P.C.; Schimke, R.T.


    The authors studied the loss and stabilization of dihydrofolate reductase genes in clones of a methotrexate-resistant murine S-180 cell line. These cells contained multiple copies of the dihydrofolate reductase gene which were associated with double minute chromosomes. The growth rate of these cells in the absence of methotrexate was inversely related to the degree of gene amplification (number of double minute chromosomes). Cells could both gain and lose genes as a result of an unequal distribution of double minute chromosomes into daughter cells at mitosis. The loss of amplified dihydrofolate reductase genes during growth in the absence of methotrexate resulted from the continual generation of cells containing lower numbers of double minute chromosomes. Because of the growth advantage of these cells, they became dominant in the population. They also studied an unstably resistant S-180 cell line (clone) that, after 3 years of continuous growth in methotrexate, generated cells containing stably amplified dihydrofolate reductase genes. These genes were present on one or more chromosomes, and they were retained in a stable state.

  8. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.


    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  9. Endothelial human dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling

    PubMed Central

    Whitsett, Jennifer; Filho, Artur Rangel; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vásquez-Vivar, Jeannette


    Tetrahydrobiopterin (BH4) is required for NO synthesis and inhibition of superoxide release from eNOS. Clinical trials using BH4 to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH4. One of the oxidation products of BH4, 7,8-dihydrobiopterin (7,8-BH2), is recycled back to BH4 by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH4 treatment is lacking. To characterize this reaction, we applied a novel multi-electrode coulometric HPLC method that enabled the direct quantification of 7,8-BH2 and BH4 which is not possible with fluorescent-based methodologies. We found that basal untreated BH4 and 7,8-BH2 concentrations in human ECs is lower than bovine and murine endothelioma cells. Treatment of human ECs with BH4 transiently increased intracellular BH4 while accumulating the more stable 7,8-BH2. This was different from bovine or murine ECs that resulted in preferential BH4 increase. Using BH4 diastereomers, 6S-BH4 and 6R-BH4, the narrow contribution of enzymatic DHFR recycling to total intracellular BH4 was demonstrated. Reduction of 7,8-BH2 to BH4 occurs at very slow rates in cells and needs supra-physiological levels of 7,8-BH2, indicating this reaction is kinetically limited. Activity assays verified that hDHFR has very low affinity for 7,8-BH2 (DHF7,8-BH2) and folic acid inhibits 7,8-BH2 recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies which may be further aggravated by folate supplements. PMID:23707606

  10. Probing the structure of Leishmania major DHFR TS and structure based virtual screening of peptide library for the identification of anti-leishmanial leads.


    Rajasekaran, Rajalakshmi; Chen, Yi-Ping Phoebe


    Leishmaniasis, a multi-faceted ethereal disease is considered to be one of the World's major communicable diseases that demands exhaustive research and control measures. The substantial data on these protozoan parasites has not been utilized completely to develop potential therapeutic strategies against Leishmaniasis. Dihydrofolate reductase thymidylate synthase (DHFR-TS) plays a major role in the infective state of the parasite and hence the DHFR-TS based drugs remains of much interest to researchers working on Leishmaniasis. Although, crystal structures of DHFR-TS from different species including Plasmodium falciparum and Trypanosoma cruzi are available, the experimentally determined structure of the Leishmania major DHFR-TS has not yet been reported in the Protein Data Bank. A high quality three dimensional structure of L.major DHFR-TS has been modeled through the homology modeling approach. Carefully refined and the energy minimized structure of the modeled protein was validated using a number of structure validation programs to confirm its structure quality. The modeled protein structure was used in the process of structure based virtual screening to figure out a potential lead structure against DHFR TS. The lead molecule identified has a binding affinity of 0.51 nM and clearly follows drug like properties.

  11. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer

    NASA Astrophysics Data System (ADS)

    Nilsson, Roland; Jain, Mohit; Madhusudhan, Nikhil; Sheppard, Nina Gustafsson; Strittmatter, Laura; Kampf, Caroline; Huang, Jenny; Asplund, Anna; Mootha, Vamsi K.


    Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta-analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses.

  12. Next-Generation Sequencing of Plasmodium vivax Patient Samples Shows Evidence of Direct Evolution in Drug-Resistance Genes

    PubMed Central

    Flannery, Erika L.; Wang, Tina; Akbari, Ali; Corey, Victoria C.; Gunawan, Felicia; Bright, A. Taylor; Abraham, Matthew; Sanchez, Juan F.; Santolalla, Meddly L.; Baldeviano, G. Christian; Edgel, Kimberly A.; Rosales, Luis A.; Lescano, Andrés G.; Bafna, Vineet; Vinetz, Joseph M.; Winzeler, Elizabeth A.


    Understanding the mechanisms of drug resistance in Plasmodium vivax, the parasite that causes the most widespread form of human malaria, is complicated by the lack of a suitable long-term cell culture system for this parasite. In contrast to P. falciparum, which can be more readily manipulated in the laboratory, insights about parasite biology need to be inferred from human studies. Here we analyze the genomes of parasites within 10 human P. vivax infections from the Peruvian Amazon. Using next-generation sequencing we show that some P. vivax infections analyzed from the region are likely polyclonal. Despite their polyclonality we observe limited parasite genetic diversity by showing that three or fewer haplotypes comprise 94% of the examined genomes, suggesting the recent introduction of parasites into this geographic region. In contrast we find more than three haplotypes in putative drug-resistance genes, including the gene encoding dihydrofolate reductase-thymidylate synthase and the P. vivax multidrug resistance associated transporter, suggesting that resistance mutations have arisen independently. Additionally, several drug-resistance genes are located in genomic regions with evidence of increased copy number. Our data suggest that whole genome sequencing of malaria parasites from patients may provide more insight about the evolution of drug resistance than genetic linkage or association studies, especially in geographical regions with limited parasite genetic diversity. PMID:26719854

  13. Inducible Knockdown of Plasmodium Gene Expression Using the glmS Ribozyme

    PubMed Central

    Prommana, Parichat; Uthaipibull, Chairat; Wongsombat, Chayaphat; Kamchonwongpaisan, Sumalee; Yuthavong, Yongyuth; Knuepfer, Ellen; Holder, Anthony A.; Shaw, Philip J.


    Conventional reverse genetic approaches for study of Plasmodium malaria parasite gene function are limited, or not applicable. Hence, new inducible systems are needed. Here we describe a method to control P. falciparum gene expression in which target genes bearing a glmS ribozyme in the 3′ untranslated region are efficiently knocked down in transgenic P. falciparum parasites in response to glucosamine inducer. Using reporter genes, we show that the glmS ribozyme cleaves reporter mRNA in vivo leading to reduction in mRNA expression following glucosamine treatment. Glucosamine-induced ribozyme activation led to efficient reduction of reporter protein, which could be rapidly reversed by removing the inducer. The glmS ribozyme was validated as a reverse-genetic tool by integration into the essential gene and antifolate drug target dihydrofolate reductase-thymidylate synthase (PfDHFR-TS). Glucosamine treatment of transgenic parasites led to rapid and efficient knockdown of PfDHFR-TS mRNA and protein. PfDHFR-TS knockdown led to a growth/arrest mutant phenotype and hypersensitivity to pyrimethamine. The glmS ribozyme may thus be a tool for study of essential genes in P. falciparum and other parasite species amenable to transfection. PMID:24023691

  14. Molecular genetic transfection of the coccidian parasite Sarcocystis neurona.


    Gaji, Rajshekhar Y; Zhang, Deqing; Breathnach, Cormac C; Vaishnava, Shipra; Striepen, Boris; Howe, Daniel K


    Sarcocystis neurona is an apicomplexan parasite that is the major cause of equine protozoal myeloencephalitis (EPM). The biology of this pathogen remains poorly understood in part due to unavailability of molecular genetic tools. Hence, with an objective to develop DNA transfection capabilities for S. neurona, the 5' flanking region of the SnSAG1 gene was isolated from a genomic library and used to construct expression plasmids. In transient assays, the reporter molecules beta-galactosidase (beta-gal) and yellow fluorescent protein (YFP) could be detected in electroporated S. neurona, thereby confirming the feasibility of transgene expression in this organism. Stable transformation of S. neurona was achieved using a mutant dihydrofolate reductase thymidylate synthase (DHFR-TS) gene of Toxoplasma gondii that confers resistance to pyrimethamine. This selection system was used to create transgenic S. neurona that stably express beta-gal and YFP. As shown in this study, these transgenic clones can be useful for analyzing growth rate of parasites in vitro and for assessing drug sensitivities. More importantly, the DNA transfection methods described herein should greatly facilitate studies examining intracellular parasitism by this important coccidian pathogen.

  15. Synthesis and cytotoxicity of substituted ethyl 2-phenacyl-3-phenylpyrrole-4-carboxylates.


    Evans, Michael A; Smith, Daniel C; Holub, Justin M; Argenti, Anthony; Hoff, Mafoloe; Dalglish, Gerard A; Wilson, Donna L; Taylor, Brett M; Berkowitz, Joshua D; Burnham, Bruce S; Krumpe, Keith; Gupton, John T; Scarlett, Tanya C; Durham Jr, Richard W; Hall, Iris H


    The substituted ethyl-2-phenacyl-3-phenylpyrrole-4-carboxylates were synthesized by a condensation of a beta-chloroenal and an alpha-aminoketone under neutral conditions. They proved to be potent cytotoxic agents against the growth of murine L1210 and P388 leukemias and human HL-60 promyelocytic leukemia, HuT-78 lymphoma, and HeLa-S(3) uterine carcinoma. Selective compounds were active against the growth of Tmolt(3) and Tmolt(4) leukemias and THP-1 acute monocytic leukemia, liver Hepe-2, ovary 1-A9, ileum HCT-8 adenocarcinoma, and osteosarcoma HSO. A mode of action study in HL-60 cells demonstrated that DNA and protein syntheses were inhibited after 60 min at 100 microM. DNA and RNA polymerases, PRPP-amido transferase, dihydrofolate reductase, thymidylate synthase, and TMP kinase activities were interfered with by the agent with reduction of d[NTP] pools. Nonspecific interaction with the bases of DNA and cross-linking of the DNA may play a role in the mode of action of these carboxylates.

  16. Loop-Mediated Isothermal Amplification and LFD Combination for Detection of Plasmodium falciparum and Plasmodium vivax.


    Kongkasuriyachai, Darin; Yongkiettrakul, Suganya; Kiatpathomchai, Wansika; Arunrut, Narong


    Loop-mediated isothermal amplification (LAMP) has been used to detect several pathogens including malaria parasites from field and clinical samples. In this protocol, the malaria LAMP technology is developed to differentiate between Plasmodium falciparum (Pf) and Plasmodium vivax (Pv) species by targeting the dihydrofolate reductase thymidylate synthase (dhfr-ts) gene, a known target for the antifolate class of drugs such as Pyrimethamine. LAMP primer sets are designed and validated for species specific amplification. Additionally, specific probes help improve detection and visualization of the products when combined with lateral flow dipstick-based (LFD) detection. The protocols are further simplified to eliminate tedious sample preparation steps, such that crude lysis prepared simply by diluting few microliter (μL) of blood sample with distilled water is sufficient. The LAMP-LFD malaria dhfr-ts protocols are sensitive and can detect as little as 1 picogram (pg) of PfDNA and 1 nanogram (ng) of PvDNA, or a few microliters of crude lysate from infected blood samples (Yongkiettrakul et al., Parasitol Int 63: 777-784, 2014). These simplified steps not only reduce cost but also increase the potential for large application in the fields and clinical settings.

  17. Double targeted gene replacement for creating null mutants.


    Cruz, A; Coburn, C M; Beverley, S M


    We have used double gene targeting to create homozygous gene replacements in the protozoan parasite Leishmania major, an asexual diploid. This method uses two independent selectable markers in successive rounds of gene targeting to replace both alleles of an endogenous gene. We developed an improved hygromycin B-resistance cassette encoding hygromycin phosphotransferase (HYG) for use as a selectable marker for Leishmania. HYG-containing vectors functioned equivalently to those containing the neomycin phosphotransferase (NEO) cassette previously used for extrachromosomal transformation or gene targeting. Drug resistances conferred by the NEO and HYG markers were independent, allowing simultaneous selection for both markers. A HYG targeting vector was utilized to replace the single dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene remaining in a line heterozygous for a NEO replacement at the dhfr-ts locus (+/neo), with a targeting efficiency comparable to that seen with wild-type recipients. The resultant dhfr-ts- line (hyg/neo) was auxotrophic for thymidine. The double targeted replacement method will enable functional genetic testing in a variety of asexual diploids, including cultured mammalian cells and fungi such as Candida albicans. Additionally, it may be possible to use Leishmania bearing conditionally auxotrophic gene replacements as safe, improved live vaccines for leishmaniasis.

  18. Global phylogeographic limits of Hawaii's avian malaria

    USGS Publications Warehouse

    Beadell, J.S.; Ishtiaq, F.; Covas, R.; Melo, M.; Warren, B.H.; Atkinson, C.T.; Bensch, S.; Graves, G.R.; Jhala, Y.V.; Peirce, M.A.; Rahmani, A.R.; Fonseca, D.M.; Fleischer, R.C.


    The introduction of avian malaria (Plasmodium relictum) to Hawaii has provided a model system for studying the influence of exotic disease on naive host populations. Little is known, however, about the origin or the genetic variation of Hawaii's malaria and traditional classification methods have confounded attempts to place the parasite within a global ecological and evolutionary context. Using fragments of the parasite mitochondrial gene cytochrome b and the nuclear gene dihydrofolate reductase-thymidylate synthase obtained from a global survey of greater than 13 000 avian samples, we show that Hawaii's avian malaria, which can cause high mortality and is a major limiting factor for many species of native passerines, represents just one of the numerous lineages composing the morphological parasite species. The single parasite lineage detected in Hawaii exhibits a broad host distribution worldwide and is dominant on several other remote oceanic islands, including Bermuda and Moorea, French Polynesia. The rarity of this lineage in the continental New World and the restriction of closely related lineages to the Old World suggest limitations to the transmission of reproductively isolated parasite groups within the morphological species. ?? 2006 The Royal Society.

  19. A qualitative and quantitative cytochemical assay of dihydrofolate reductase in erythroid cells.


    Nano, R; Gerzeli, G; Invernizzi, R; Supino, R


    The distribution and intensity of dihydrofolate reductase (DHFR) cytochemically demonstrable was studied in erythroid cells. Cells of normal human bone marrow, of human erythroleukaemia (M6), and cells of the Friend (MEL) clone 745A murine erythroleukaemia (also after differentiation with dimethylsulphoxide, DMSO) were stained according to Gerzeli and de Piceis Polver (1969) technique; quantification of the reaction product was made using a Vickers M86 microdensitometer. The enzyme activity progressively decreased during the normal differentiation of the erythropoietic series while persisted at high levels in erythroleukaemia cells. It can be suggested that in the 1st case, the cytochemical pattern of dihydrofolate reductase may be a useful added tool for studying the erythroid differentiation. In the 2nd case, the increased level of this enzyme may be related to an amplification of the gene of DHFR in the malignant transformation.

  20. Dihydrofolate reductase as a model for studies of enzyme dynamics and catalysis

    PubMed Central

    Kohen, Amnon


    Dihydrofolate reductase from Escherichia coli (ecDHFR) serves as a model system for investigating the role of protein dynamics in enzyme catalysis. We discuss calculations predicting a network of dynamic motions that is coupled to the chemical step catalyzed by this enzyme. Kinetic studies testing these predictions are presented, and their potential use in better understanding the role of these dynamics in enzyme catalysis is considered. The cumulative results implicate motions across the entire protein in catalysis. PMID:26918149

  1. Molecular modeling toward selective inhibitors of dihydrofolate reductase from the biological warfare agent Bacillus anthracis.


    Giacoppo, Juliana O S; Mancini, Daiana T; Guimarães, Ana P; Gonçalves, Arlan S; da Cunha, Elaine F F; França, Tanos C C; Ramalho, Teodorico C


    In the present work, we applied docking and molecular dynamics techniques to study 11 compounds inside the enzymes dihydrofolate reductase (DHFR) from the biological warfare agent Bacillus anthracis (BaDHFR) and Homo sapiens sapiens (HssDHFR). Six of these compounds were selected for a study with the mutant BaF96IDHFR. Our results corroborated with experimental data and allowed the proposition of a new molecule with potential activity and better selectivity for BaDHFR.

  2. Functional significance of evolving protein sequence in dihydrofolate reductase from bacteria to humans.


    Liu, C Tony; Hanoian, Philip; French, Jarrod B; Pringle, Thomas H; Hammes-Schiffer, Sharon; Benkovic, Stephen J


    With the rapidly growing wealth of genomic data, experimental inquiries on the functional significance of important divergence sites in protein evolution are becoming more accessible. Here we trace the evolution of dihydrofolate reductase (DHFR) and identify multiple key divergence sites among 233 species between humans and bacteria. We connect these sites, experimentally and computationally, to changes in the enzyme's binding properties and catalytic efficiency. One of the identified evolutionarily important sites is the N23PP modification (∼mid-Devonian, 415-385 Mya), which alters the conformational states of the active site loop in Escherichia coli dihydrofolate reductase and negatively impacts catalysis. This enzyme activity was restored with the inclusion of an evolutionarily significant lid domain (G51PEKN in E. coli enzyme; ∼2.4 Gya). Guided by this evolutionary genomic analysis, we generated a human-like E. coli dihydrofolate reductase variant through three simple mutations despite only 26% sequence identity between native human and E. coli DHFRs. Molecular dynamics simulations indicate that the overall conformational motions of the protein within a common scaffold are retained throughout evolution, although subtle changes to the equilibrium conformational sampling altered the free energy barrier of the enzymatic reaction in some cases. The data presented here provide a glimpse into the evolutionary trajectory of functional DHFR through its protein sequence space that lead to the diverged binding and catalytic properties of the E. coli and human enzymes.

  3. Relationship of amplified dihydrofolate reductase genes to double minute chromosomes in unstably resistant mouse fibroblast cell lines.

    PubMed Central

    Brown, P C; Beverley, S M; Schimke, R T


    Murine 3T6 selected in increasing concentrations of methotrexate were unstable with respect to dihydrofolate reductase overproduction and methotrexate resistance when they are cultured in the absence of methotrexate. An analysis of the karyotypes of these resistant cells revealed the presence of numerous double minute chromosomes. We observed essentially identical kinetics of loss of dihydrofolate reductase gene sequences in total deoxyribonucleic acid and in deoxyribonucleic acid from fractions enriched in double minute chromosomes and in the numbers of double minute chromosomes per cell during reversion to methotrexate sensitivity, and this suggested that unstably amplified gene sequences were localized on double minute chromosomes. This conclusion ws also supported by an analysis of cell populations sorted according to dihydrofolate reductase enzyme contents, in which relative gene amplification and double minute chromosome content were related proportionally. Images PMID:6287217

  4. Enhancement of methotrexate resistance and dihydrofolate reductase gene amplification by treatment of mouse 3T6 cells with hydroxyurea.

    PubMed Central

    Brown, P C; Tlsty, T D; Schimke, R T


    We investigated various parameters associated with the initial selection of mouse 3T6 cells for resistance to single concentrations of methotrexate and characterized resistant colonies for the presence of additional (amplified) copies of the dihydrofolate reductase gene. Our results indicate that the frequency of occurrence of dihydrofolate reductase gene amplification varies with the selecting concentration of methotrexate and is highly variable between clonally derived sublines of mouse 3T6 cells. Second, we increased the frequency of occurrence of cells with amplified dihydrofolate reductase genes by transiently inhibiting DNA synthesis with hydroxyurea before the selection of cells in single concentrations of methotrexate. This effect was dependent on the concentration of hydroxyurea, the time of exposure to the drug, and the time interval between the removal of hydroxyurea and the selection of cells in methotrexate. Images PMID:6877240

  5. [Comparison of Physico-chemical Aspects between E. coli and Human Dihydrofolate Reductase: an Equilibrium Unfolding Study].


    Thapliyal, Charu; Jain, Neha; Chaudhuri, Pratima


    A protein, differing in origin, may exhibit variable physicochemical behaviour, difference in sequence homology, fold and function. Thus studying structure-function relationship of proteins from altered sources is meaningful in the sense that it may give rise to comparative aspects of their sequence-structure-function relationship. Dihydrofolate reductase is an enzyme involved in cell cycle regulation. It is a significant enzyme as.a target for developing anticancer drugs. Hence, detailed understanding of structure-function relationships of wide variants of the enzyme dihydrofolate reductase would be important for developing an inhibitor or an antagonist against the enzyme involved in the cellular developmental processes. In this communication, we have reported the comparative structure-function relationship between E. coli and human dihydrofolate reductase. The differences in the unfolding behaviour of these two proteins have been investigated to understand various properties of these two proteins like relative' stability differences and variation in conformational changes under identical denaturing conditions. The equilibrium unfolding mechanism of dihydrofolate reductase proteins using guanidine hydrochloride as a denaturant in the presence of various types of osmolytes has been monitored using loss in enzymatic activity, intrinsic tryptophan fluorescence and an extrinsic fluorophore 8-anilino-1-naphthalene-sulfonic acid as probes. It has been observed that osmolytes, such as 1M sucrose, and 30% glycerol, provided enhanced stability to both variants of dihydrofolate reductase. Their level of stabilisation has been observed to be dependent on intrinsic protein stability. It was observed that 100 mM proline does not show any 'significant stabilisation to either of dihydrofolate reductases. In the present study, it has been observed that the human protein is relatively less stable than the E.coli counterpart.

  6. A study of chromosomal changes associated with amplified dihydrofolate reductase genes in rat hepatoma cells and their dedifferentiated variants

    PubMed Central


    We have examined the karyological consequences of dihydrofolate reductase gene amplification in a series of six rat hepatoma cell lines, all derived from the same clone. Cells of three of these lines express a series of liver-specific functions whereas those of three others fail to express these functions. Cells of each line have been subjected to stepwise selection for methotrexate resistance and, in most cases, resistance is associated with a 40-50-fold amplification of sequences hybridizing to a dihydrofolate reductase cDNA probe. In one line no modified chromosome is observed, whereas in two others the amplified genes are associated with an expanded chromosomal region. R- banding analysis of these karyotypes showed that few changes have occurred. These observations apply to two of the well-differentiated lines, and to a variant able to revert to the differentiated state. In contrast, in the two stably dedifferentiated hepatoma cell lines, amplified dihydrofolate reductase genes are found on large chromosomes of variable size, on ring chromosomes, and on chromosomes containing terminal, median, or multiple centromeres. We conclude that the nature of the chromosomal changes associated with dihydrofolate reductase gene amplification are the result of differences in cell lines rather than in the protocols employed for selection. PMID:6746737

  7. Dihydrofolate reductase: low-resolution mass-spectrometric analysis of an elastase digest as a sequencing tool (Short Communication)

    PubMed Central

    Morris, Howard R.; Batley, Karen E.; Harding, Nigel G. L.; Bjur, Richard A.; Dann, John G.; King, Rodney W.


    An elastase digest of a protein of unknown structure, dihydrofolate reductase, was studied by mass spectrometry. This soluble digest contained a large number of small peptides in different yields, within the ideal molecular-weight range (200–1200) for mixture-analysis mass spectrometry. Sequences of the major component peptides in the digest are reported. PMID:4207389

  8. Disagreement in genotyping results of drug resistance alleles of the Plasmodium falciparum dihydrofolate reductase (Pfdhfr) gene by allele-specific PCR (ASPCR) assays and Sanger sequencing.


    Sharma, Divya; Lather, Manila; Dykes, Cherry L; Dang, Amita S; Adak, Tridibes; Singh, Om P


    The rapid spread of antimalarial drug resistance in Plasmodium falciparum over the past few decades has necessitated intensive monitoring of such resistance for an effective malaria control strategy. P. falciparum dihydropteroate synthase (Pfdhps) and P. falciparum dihydrofolate reductase (Pfdhfr) genes act as molecular markers for resistance against the antimalarial drugs sulphadoxine and pyrimethamine, respectively. Resistance to pyrimethamine which is used as a partner drug in artemisinin combination therapy (ACT) is associated with several mutations in the Pfdhfr gene, namely A16V, N51I, C59R, S108N/T and I164L. Therefore, routine monitoring of Pfdhfr-drug-resistant alleles in a population may help in effective drug resistance management. Allele-specific PCR (ASPCR) is one of the commonly used methods for molecular genotyping of these alleles. In this study, we genotyped 55 samples of P. falciparum for allele discrimination at four codons of Pfdhfr (N51, C59, S108 and I164) by ASPCR using published methods and by Sanger's DNA sequencing method. We found that the ASPCR identified a significantly higher number of mutant alleles as compared to the DNA sequencing method. Such discrepancies arise due to the non-specificity of some of the allele-specific primer sets and due to the lack of sensitivity of Sanger's DNA sequencing method to detect minor alleles present in multiple clone infections. This study reveals the need of a highly specific and sensitive method for genotyping and detecting minor drug-resistant alleles present in multiple clonal infections.

  9. Comparative stability of dihydrofolate reductase mutants in vitro and in vivo.


    Leontiev, V V; Uversky, V N; Gudkov, A T


    Dihydrofolate reductase mutants with amino acid replacements in the active center (Thr35-->Asp mutant, Arg57-->His mutant and the mutant with triple replacement Thr35-->Asp, Asn37-->Ser, Arg57-->His) were obtained by site-directed mutagenesis. The stabilization effect of trimethoprim and NADP.H on the protein tertiary structure in vitro has been investigated. In the case of mutants with a 'weak' tertiary structure (Thr35-->Asp35 and the triple mutant) the separate addition of ligands does not affect their stability. The simultaneous addition of these ligands to Thr35-->Asp35 and the triple mutant leads to the large increase in their stability. A distinct correlation was found between the in vitro studied stability of the mutant proteins to the urea- or heat-induced denaturation and the level of proteolytic degradation of these mutants previously observed in vivo.

  10. Triazine-benzimidazole hybrids: anticancer activity, DNA interaction and dihydrofolate reductase inhibitors.


    Singla, Prinka; Luxami, Vijay; Paul, Kamaldeep


    A new series of triazine-benzimidazole hybrids has been synthesized with different substitution of primary and secondary amines at one of the position of triazine in moderate to good yields. These compounds were evaluated for their inhibitory activities over 60 human tumor cell lines at one dose and five dose concentrations. Compounds 6b, 8 and 9 showed broad spectrum of antitumor activities with GI50 values of 9.79, 2.58 and 3.81μM, respectively. DNA binding studies also indicated strong interaction properties of these compounds. These synthesized compounds also showed inhibition of mammalian dihydrofolate reductase (DHFR). Compound 6b was depicted as the most active member of DHFR inhibitor with IC50 value of 1.05μM. Molecular modelling studies were used to identify the stabilized interactions of Compound 6b within the active site of enzyme for DHFR.

  11. Thermal Adaptation of Dihydrofolate Reductase from the Moderate Thermophile Geobacillus stearothermophilus

    PubMed Central


    The thermal melting temperature of dihydrofolate reductase from Geobacillus stearothermophilus (BsDHFR) is ∼30 °C higher than that of its homologue from the psychrophile Moritella profunda. Additional proline residues in the loop regions of BsDHFR have been proposed to enhance the thermostability of BsDHFR, but site-directed mutagenesis studies reveal that these proline residues contribute only minimally. Instead, the high thermal stability of BsDHFR is partly due to removal of water-accessible thermolabile residues such as glutamine and methionine, which are prone to hydrolysis or oxidation at high temperatures. The extra thermostability of BsDHFR can be obtained by ligand binding, or in the presence of salts or cosolvents such as glycerol and sucrose. The sum of all these incremental factors allows BsDHFR to function efficiently in the natural habitat of G. stearothermophilus, which is characterized by temperatures that can reach 75 °C. PMID:24730604

  12. Barrier crossing in dihydrofolate reductase does not involve a rate-promoting vibration

    NASA Astrophysics Data System (ADS)

    Dametto, Mariangela; Antoniou, Dimitri; Schwartz, Steven D.


    We have studied atomic motions during the chemical reaction catalysed by the enzyme dihydrofolate reductase of Escherichia coli (EcDHFR), an important enzyme for nucleic acid synthesis. In our earlier work on the enzymes human lactate dehydrogenase and purine nucleoside phosphorylase, we had identified fast sub-ps motions that are part of the reaction coordinate. We employed Transition Path Sampling (TPS) and our recently developed reaction coordinate identification methodology to investigate if such fast motions couple to the reaction in DHFR on the barrier-crossing timescale. While we identified some protein motions near the barrier crossing event, these motions do not constitute a compressive promoting vibration, and do not appear as a clearly identifiable protein component in reaction.

  13. Discovery of Potent and Selective Leads against Toxoplasma gondii Dihydrofolate Reductase via Structure-Based Design.


    Welsch, Matthew E; Zhou, Jian; Gao, Yueqiang; Yan, Yunqing; Porter, Gene; Agnihotri, Gautam; Li, Yingjie; Lu, Henry; Chen, Zhongguo; Thomas, Stephen B


    Current treatment of toxoplasmosis targets the parasite's folate metabolism through inhibition of dihydrofolate reductase (DHFR). The most widely used DHFR antagonist, pyrimethamine, was introduced over 60 years ago and is associated with toxicity that can be largely attributed to a similar affinity for parasite and human DHFR. Computational analysis of biochemical differences between Toxoplasma gondii and human DHFR enabled the design of inhibitors with both improved potency and selectivity. The approach described herein yielded TRC-19, a promising lead with an IC50 of 9 nM and 89-fold selectivity in favor of Toxoplasma gondii DHFR, as well as crystallographic data to substantiate in silico methodology. Overall, 50% of synthesized in silico designs met hit threshold criteria of IC50 < 10 μM and >2-fold selectivity favoring Toxoplasma gondii, further demonstrating the efficiency of our structure-based drug design approach.

  14. Malaria antifolate resistance with contrasting Plasmodium falciparum dihydrofolate reductase (DHFR) polymorphisms in humans and Anopheles mosquitoes

    PubMed Central

    Mharakurwa, Sungano; Kumwenda, Taida; Mkulama, Mtawa A. P.; Musapa, Mulenga; Chishimba, Sandra; Shiff, Clive J.; Sullivan, David J.; Thuma, Philip E.; Liu, Kun; Agre, Peter


    Surveillance for drug-resistant parasites in human blood is a major effort in malaria control. Here we report contrasting antifolate resistance polymorphisms in Plasmodium falciparum when parasites in human blood were compared with parasites in Anopheles vector mosquitoes from sleeping huts in rural Zambia. DNA encoding P. falciparum dihydrofolate reductase (EC was amplified by PCR with allele-specific restriction enzyme digestions. Markedly prevalent pyrimethamine-resistant mutants were evident in human P. falciparum infections—S108N (>90%), with N51I, C59R, and 108N+51I+59R triple mutants (30–80%). This resistance level may be from selection pressure due to decades of sulfadoxine/pyrimethamine use in the region. In contrast, cycloguanil-resistant mutants were detected in very low frequency in parasites from human blood samples—S108T (13%), with A16V and 108T+16V double mutants (∼4%). Surprisingly, pyrimethamine-resistant mutants were of very low prevalence (2–12%) in the midguts of Anopheles arabiensis vector mosquitoes, but cycloguanil-resistant mutants were highly prevalent—S108T (90%), with A16V and the 108T+16V double mutant (49–57%). Structural analysis of the dihydrofolate reductase by in silico modeling revealed a key difference in the enzyme within the NADPH binding pocket, predicting the S108N enzyme to have reduced stability but the S108T enzyme to have increased stability. We conclude that P. falciparum can bear highly host-specific drug-resistant polymorphisms, most likely reflecting different selective pressures found in humans and mosquitoes. Thus, it may be useful to sample both human and mosquito vector infections to accurately ascertain the epidemiological status of drug-resistant alleles. PMID:22065788

  15. Kinetic and Chemical Mechanism of the Dihydrofolate Reductase from Mycobacterium tuberculosis

    PubMed Central

    Czekster, Clarissa M.; Vandemeulebroucke, An; Blanchard, John S.


    Dihydrofolate reductase from Mycobacterium tuberculosis catalyzes the NAD(P)H dependent reduction of dihydrofolate, yielding NAD(P)+ and tetrahydrofolate, the primary one carbon unit carrier in biology. Tetrahydrofolate needs to be recycled so that reactions involved in dTMP synthesis and purine metabolism are maintained. In this work, we report the kinetic characterization of the MtDHFR. This enzyme has a sequential steady-state random kinetic mechanism, probably with a preferred pathway with NADPH binding first. A pKa value for an enzymic acid of approximately 7.0 was identified from the pH dependence of V, and the analysis of the primary kinetic isotope effects revealed that the hydride transfer step is at least partly rate limiting throughout the pH range analyzed. Additionally, the determination and analysis of solvent, and multiple kinetic isotope effects was conducted, and equilibrium isotope effects were measured on the equilibrium constant. D2OV and D2OV/K[4R-4-2H]-NADH were slightly inverse at pH 6.0, and inverse values for D2OV[4R-4-2H]-NADH and D2OV/K[4R-4-2H]-NADH suggested that a pre-equilibrium protonation is occurring before the hydride transfer step, indicating a stepwise mechanism for proton and hydride transfer. The same value was obtained for DkH at pH values of 5.5 and 7.5, reaffirming the rate-limiting nature of the hydride transfer step. A chemical mechanism is proposed based on the results obtained here. PMID:21138249

  16. Structure-activity relationship for enantiomers of potent inhibitors of B. anthracis dihydrofolate reductase

    PubMed Central

    Bourne, Christina R.; Wakeham, Nancy; Nammalwar, Baskar; Tseitin, Vladimir; Bourne, Philip C.; Barrow, Esther W.; Mylvaganam, Shankari; Ramnarayan, Kal; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.


    Background Bacterial resistance to antibiotic therapies is increasing and new treatment options are badly needed. There is an overlap between these resistant bacteria and organisms classified as likely bioterror weapons. For example, Bacillus anthracis is innately resistant to the anti-folate trimethoprim due to sequence changes found in the dihydrofolate reductase enzyme. Development of new inhibitors provides an opportunity to enhance the current arsenal of anti-folate antibiotics while also expanding the coverage of the anti-folate class. Methods We have characterized inhibitors of Bacillus anthracis dihydrofolate reductase by measuring the Ki and MIC values and calculating the energetics of binding. This series contains a core diaminopyrimidine ring, a central dimethoxybenzyl ring, and a dihydrophthalazine moiety. We have altered the chemical groups extended from a chiral center on the dihydropyridazine ring of the phthalazine moiety. The interactions for the most potent compounds were visualized by X-ray structure determination. Results We find that the potency of individual enantiomers is divergent with clear preference for the S-enantiomer, while maintaining a high conservation of contacts within the binding site. The preference for enantiomers seems to be predicated largely by differential interactions with protein residues Leu29, Gln30 and Arg53. Conclusions These studies have clarified the activity of modifications and of individual enantiomers, and highlighted the role of the less-active R-enantiomer in effectively diluting the more active S-enantiomer in racemic solutions. This directly contributes to the development of new antimicrobials, combating trimethoprim resistance, and treatment options for potential bioterrorism agents. PMID:22999981

  17. Cancer metabolism and oxidative stress: Insights into carcinogenesis and chemotherapy via the non-dihydrofolate reductase effects of methotrexate

    PubMed Central

    Hess, Joshua A.; Khasawneh, Mohamad K.


    Methotrexate has been in use as an anti-cancer agent for over 60 years. Though inhibition of dihydrofolate reductase is its best known mechanisms of action, its non-dihydrofolate reductase dependent mechanisms disrupt metabolic pathways resulting in a depletion of NAD(P)H and increasing oxidative stress. These mechanisms highlight a novel dependence of cancer cells on their metabolic abnormalities to buffer oxidative stress and chemotherapeutic agents interfere with these cellular abilities. Mitochondria appear to play a significant role in maintaining cancer cell viability and alterations in metabolism seen in cancer cells aid this mitochondrial ability. Further research is needed to understand the effects of other chemotherapeutic agents on these pathways. PMID:26674389

  18. Sequence-specific sup 1 H and sup 15 N resonance assignments for human dihydrofolate reductase in solution

    SciTech Connect

    Stockman, B.J.; Nirmala, N.R.; Wagner, G. ); Delcamp, T.J.; DeYarman, M.T.; Freisheim, J.H. )


    Dihydrofolate reductase is an intracellular target enzyme for folate antagonists, including the anticancer drug methotrexate. In order to design novel drugs with altered binding properties, a detailed description of protein-drug interactions in solution is desirable to understand the specificity of drug binding. As a first step in this process, heteronuclear three-dimensional NMR spectroscopy has been used to make sequential resonance assignments for more than 90% of the residues in human dihydrofolate reductase complexed with methotrexate. Uniform enrichment of the 21.5-kDa protein with {sup 15}N was required to obtain the resonance assignments via heteronuclear 3D NMR spectroscopy since homonuclear 2D spectra did not provide sufficient {sup 1}H resonance dispersion. Medium- and long-range NOE's have been used to characterize the secondary structure of the binary ligand-enzyme complex in solution.

  19. The Tail Wagging the Dog: Insights into Catalysis in R67 Dihydrofolate Reductase

    SciTech Connect

    Kamath, Ganesh K; Agarwal, Pratul K


    Plasmid-encoded R67 dihydrofolate reductase (DHFR) catalyzes a hydride transfer reaction between substrate dihydrofolate (DHF) and its cofactor, nicotinamide adenine dinucleotide phosphate (NADPH). R67 DHFR is a homotetramer that exhibits numerous characteristics of a primitive enzyme, including promiscuity in binding of substrate and cofactor, formation of nonproductive complexes, and the absence of a conserved acid in its active site. Furthermore, R67's active site is a pore, which is mostly accessible by bulk solvent. This study uses a computational approach to characterize the mechanism of hydride transfer. Not surprisingly, NADPH remains fixed in one-half of the active site pore using numerous interactions with R67. Also, stacking between the nicotinamide ring of the cofactor and the pteridine ring of the substrate, DHF, at the hourglass center of the pore, holds the reactants in place. However, large movements of the p-aminobenzoylglutamate tail of DHF occur in the other half of the pore because of ion pair switching between symmetry-related K32 residues from two subunits. This computational result is supported by experimental results that the loss of these ion pair interactions (located >13 {angstrom} from the center of the pore) by addition of salt or in asymmetric K32M mutants leads to altered enzyme kinetics [Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Hicks, S. N., et al. (2004) J. Biol. Chem. 279, 46995?47002]. The tail movement at the edge of the active site, coupled with the fixed position of the pteridine ring in the center of the pore, leads to puckering of the pteridine ring and promotes formation of the transition state. Flexibility coupled to R67 function is unusual as it contrasts with the paradigm that enzymes use increased rigidity to facilitate attainment of their transition states. A comparison with chromosomal DHFR indicates a number of similarities, including puckering of the nicotinamide ring and changes in the DHF tail

  20. Defining the binding site of homotetrameric R67 dihydrofolate reductase and correlating binding enthalpy with catalysis.


    Strader, Michael Brad; Chopra, Shaileja; Jackson, Michael; Smiley, R Derike; Stinnett, Lori; Wu, Jun; Howell, Elizabeth E


    R67 dihydrofolate reductase (DHFR) is a novel protein that possesses 222 symmetry. A single active site pore traverses the length of the homotetramer. Although the 222 symmetry implies that four symmetry-related binding sites should exist for each substrate as well as each cofactor, isothermal titration calorimetry (ITC) studies indicate only two molecules bind. Three possible combinations include two dihydrofolate molecules, two NADPH molecules, or one substrate with one cofactor. The latter is the productive ternary complex. To evaluate the roles of A36, Y46, T51, G64, and V66 residues in binding and catalysis, a site-directed mutagenesis approach was employed. One mutation per gene produces four mutations per active site pore, which often result in large cumulative effects. Conservative mutations at these positions either eliminate the ability of the gene to confer trimethoprim resistance or have no effect on catalysis. This result, in conjunction with previous mutagenesis studies on K32, K33, S65, Q67, I68, and Y69 [Strader, M. B., et al. (2001) Biochemistry 40, 11344-11352; Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Park, H., et al. (1997) Protein Eng. 10, 1415-1424], allows mapping of the active site surface. Residues for which conservative mutations have large effects on binding and catalysis include K32, Q67, I68, and Y69. These residues form a stripe that establishes the ligand binding surface. Residues that accommodate conservative mutations that do not greatly affect catalysis include K33, Y46, T51, S65, and V66. Isothermal titration calorimetry studies were also conducted on many of the mutants described above to determine the enthalpy of folate binding to the R67 DHFR.NADPH complex. A linear correlation between this DeltaH value and log k(cat)/K(m) is observed. Since structural tightness appears to be correlated with the exothermicity of the binding interaction, this leads to the hypothesis that enthalpy-driven formation of the ternary

  1. Down-regulation of dihydrofolate reductase inhibits the growth of endothelial EA.hy926 cell through induction of G1 cell cycle arrest via up-regulating p53 and p21(waf1/cip1) expression.


    Fei, Zhewei; Gao, Yong; Qiu, Mingke; Qi, Xianqin; Dai, Yuxin; Wang, Shuqing; Quan, Zhiwei; Liu, Yingbin; Ou, Jingmin


    Folic acid supplementation may meliorate cardiovascular disease risk by improving vascular endothelial structure and function. However, the underlying mechanisms are still lack of a global understanding. To be used, folic acid must be converted to 7,8-dihydrofolate by dihydrofolate reductase to generate one-carbon derivatives serving as important cellular cofactors in the synthesis of nucleotides and amino acids required for cell growth. Therefore, this study explored the effect of dihydrofolate reductase knockdown on endothelial EA.hy926 cell growth and the mechanism involved. We found that down-regulation of dihydrofolate reductase inhibited EA.hy926 cell proliferation, and induced G1 phase arrest. Meanwhile, the expression of regulators necessary for G1/S phase transition, such as cyclin-dependent kinases CDK2, CDK4 and CDK6, were remarkably down-regulated; by contrast, the cell cycle inhibitors p21(waf/cip1), p27(Kip1) and p53 were significantly up-regulated after dihydrofolate reductase knockdown. Furthermore, supplementation of 5-methyltetrahydrofolate to the dihydrofolate reductase knockdown cells could weaken the inhibitory effect of dihydrofolate reductase knockdown on cell proliferation, simultaneously, inducing the expression of p53 and p21(waf/cip1) falling back moderately. Our findings suggest that attenuating dihydrofolate reductase may cause imbalanced expression of cell cycle regulators, especially up-regulation of p53-p21(waf/cip1) pathway, leading to G1 cell cycle arrest, thereby inhibiting the growth of endothelial EA.hy926 cells.

  2. Dihydrofolate reductase is required for the development of heart and outflow tract in zebrafish.


    Sun, Shuna; Gui, Yonghao; Jiang, Qiu; Song, Houyan


    Folic acid is very important for embryonic development and folic acid inhibition can cause congenital heart defects in vertebrates. Dihydrofolate reductase (DHFR) is a key enzyme in folate-mediated metabolism. The dysfunction of DHFR disrupts the key biological processes which folic acid participates in. DHFR gene is conserved during vertebrate evolution. It is important to investigate the roles of DHFR in cardiac developments. In this study, we showed that DHFR knockdown resulted in the abnormal developments of zebrafish embryos in the early stages. Obvious malformations in heart and outflow tract (OFT) were also observed in DHFR knockdown embryos. DHFR overexpression rescued the abnormal phenotypes in the DHFR knockdown group. DHFR knockdown had negative impacts on the expressions of NKX2.5 (NK2 transcription factor-related 5), MEF2C (myocyte-specific enhancer factor 2C), TBX20 (T-box 20), and TBX1 (T-box 1) which are important transcriptional factors during cardiac development process, while DHFR overexpression had positive effects. DHFR was required for Hedgehog pathway. DHFR knockdown caused reduced cell proliferation and increased apoptosis, while its overexpression promoted cell proliferation and inhibited apoptosis. Taken together, our study suggested that DHFR plays crucial roles in the development of heart and OFT in zebrafish by regulating gene transcriptions and affecting cell proliferation and apoptosis.

  3. Increased Dynamic Effects in a Catalytically Compromised Variant of Escherichia coli Dihydrofolate Reductase

    PubMed Central


    Isotopic substitution (15N, 13C, 2H) of a catalytically compromised variant of Escherichia coli dihydrofolate reductase, EcDHFR-N23PP/S148A, has been used to investigate the effect of these mutations on catalysis. The reduction of the rate constant of the chemical step in the EcDHFR-N23PP/S148A catalyzed reaction is essentially a consequence of an increase of the quasi-classical free energy barrier and to a minor extent of an increased number of recrossing trajectories on the transition state dividing surface. Since the variant enzyme is less well set up to catalyze the reaction, a higher degree of active site reorganization is needed to reach the TS. Although millisecond active site motions are lost in the variant, there is greater flexibility on the femtosecond time scale. The “dynamic knockout” EcDHFR-N23PP/S148A is therefore a “dynamic knock-in” at the level of the chemical step, and the increased dynamic coupling to the chemical coordinate is in fact detrimental to catalysis. This finding is most likely applicable not just to hydrogen transfer in EcDHFR but also to other enzymatic systems. PMID:24252106

  4. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans.


    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sadanandan E; Zou, Jing; Zhou, Xuedong; Wu, Hui


    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0±10.2nM for the biofilm and 8.7±1.9nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the most potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries.

  5. Reduced impact of pyrimethamine drug pressure on Plasmodium malariae dihydrofolate reductase gene.


    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy; Ménard, Didier


    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples).

  6. Reduced Impact of Pyrimethamine Drug Pressure on Plasmodium malariae Dihydrofolate Reductase Gene

    PubMed Central

    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy


    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples). PMID:22123682

  7. Interaction of dihydrofolate reductase with methotrexate: Ensemble and single-molecule kinetics

    NASA Astrophysics Data System (ADS)

    Rajagopalan, P. T. Ravi; Zhang, Zhiquan; McCourt, Lynn; Dwyer, Mary; Benkovic, Stephen J.; Hammes, Gordon G.


    The thermodynamics and kinetics of the interaction of dihydrofolate reductase (DHFR) with methotrexate have been studied by using fluorescence, stopped-flow, and single-molecule methods. DHFR was modified to permit the covalent addition of a fluorescent molecule, Alexa 488, and a biotin at the N terminus of the molecule. The fluorescent molecule was placed on a protein loop that closes over methotrexate when binding occurs, thus causing a quenching of the fluorescence. The biotin was used to attach the enzyme in an active form to a glass surface for single-molecule studies. The equilibrium dissociation constant for the binding of methotrexate to the enzyme is 9.5 nM. The stopped-flow studies revealed that methotrexate binds to two different conformations of the enzyme, and the association and dissociation rate constants were determined. The single-molecule investigation revealed a conformational change in the enzyme-methotrexate complex that was not observed in the stopped-flow studies. The ensemble averaged rate constants for this conformation change in both directions is about 2-4 s1 and is attributed to the opening and closing of the enzyme loop over the bound methotrexate. Thus the mechanism of methotrexate binding to DHFR involves multiple steps and protein conformational changes.

  8. Dynamics of Immobilized and Native Escherichia coli Dihydrofolate Reductase by Quasielastic Neutron Scattering. Biophysical Journal

    SciTech Connect

    Tehei, M; Smith, Jeremy C; Monk, C; Olliver, J; Oettl, M; Kurkal-Siebert, V; Finney, J.L.; Daniel, R. M.


    The internal dynamics of native and immobilized Escherichia coli dihydrofolate reductase (DHFR) have been examined using incoherent quasielastic neutron scattering. These results reveal no difference between the high frequency vibration mean-square displacement of the native and the immobilized E. coli DHFR. However, length-scale-dependent, picosecond dynamical changes are found. On longer length scales, the dynamics are comparable for both DHFR samples. On shorter length scales, the dynamics is dominated by local jump motions over potential barriers. The residence time for the protons to stay in a potential well is {tau}=7.95{+-}1.02ps for the native DHFR and {tau}=20.36{+-}1.80ps for the immobilized DHFR. The average height of the potential barrier to the local motions is increased in the immobilized DHFR, and may increase the activation energy for the activity reaction, decreasing the rate as observed experimentally. These results suggest that the local motions on the picosecond timescale may act as a lubricant for those associated with DHFR activity occurring on a slower millisecond timescale. Experiments indicate a significantly slower catalytic reaction rate for the immobilized E. coli DHFR. However, the immobilization of the DHFR is on the exterior of the enzyme and essentially distal to the active site, thus this phenomenon has broad implications for the action of drugs distal to the active site.

  9. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase.


    Luk, Louis Y P; Ruiz-Pernía, J Javier; Adesina, Aduragbemi S; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vincent; Allemann, Rudolf K


    Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N-terminal segment containing heavy isotopes ((2) H, (13) C, (15) N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C-terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N-terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C-terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C-terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis.

  10. Evidence for two interconverting protein isomers in the methotrexate complex of dihydrofolate reductase from Escherichia coli

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )


    Two-dimensional {sup 1}H NMR methods and a knowledge of the X-ray crystal structure have been used to make resonance assignments for the amino acid side chains of dihydrofolate reductase from Escherichia coli complexed with methotrexate. The H7 proton on the pteridine ring of methotrexate was found to have NOEs to the methyl protons of Leu-28 which were assigned by using the L28F mutant. These NOEs indicated that the orientation of the methotrexate pteridine ring is similar in both solution and crystal structures. During the initial assignment process, it became evident that many of the resonances in this complex, unlike those of the folate complex, are severally broadened or doubled. The observation of two distinct sets of resonances in a ratio of approximately 2:1 was attributed to the presence of two protein isomers. Many of the side chains with clearly doubled resonances were located in the {beta}-sheet and the active site. Preliminary studies on the apoprotein also revealed doubled resonances in the absence of the inhibitor, indicating the existence of the protein isomers prior to methotrexate binding. In contrast to the methotrexate complex, the binary complex with folate and the ternary MTX-NADPH-DHFR complex presented a single enzyme form. These results are proposed to reflect the ability of folate and NADPH to bind predominantly to one protein isomer.

  11. Dihydrofolate synthetase and folylpolyglutamate synthetase: direct evidence for intervention of acyl phosphate intermediates

    SciTech Connect

    Banerjee, R.V.; Shane, B.; McGuire, J.J.; Coward, J.K.


    The transfer of /sup 17/O and/or /sup 18/O from (COOH-/sup 17/O or -/sup 18/O) enriched substrates to inorganic phosphate (P/sub i/) has been demonstrated for two enzyme-catalyzed reactions involved in folate biosynthesis and glutamylation. COOH-/sup 18/O-labeled folate, methotrexate, and dihydropteroate, in addition to (/sup 17/O)-glutamate, were synthesized and used as substrates for folylpolyglutamate synthetase (FPGS) isolated from Escherichia coli, hog liver, and rat liver and for dihydrofolate synthetase (DHFS) isolated from E. coli. P/sub i/ was purified from the reaction mixtures and converted to trimethyl phosphate (TMP), which was then analyzed for /sup 17/O and /sup 18/O enrichment by nuclear magnetic resonance (NMR) spectroscopy and/or mass spectroscopy. In the reactions catalyzed by the E. coli enzymes, both NMR and quantitative mass spectral analyses established that transfer of the oxygen isotope from the substrate /sup 18/O-enriched carboxyl group to P/sub i/ occurred, thereby providing strong evidence for an acyl phosphate intermediate in both the FPGS- and DHFS-catalyzed reactions. Similar oxygen-transfer experiments were carried out by use of two mammalian enzymes. The small amounts of P/sub i/ obtained from reactions catalyzed by these less abundant FPGS proteins precluded the use of NMR techniques. However, mass spectral analysis of the TMP derived from the mammalian FPGS-catalyzed reactions showed clearly that /sup 18/O transfer had occurred.

  12. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J


    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  13. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase†

    PubMed Central

    Luk, Louis Y. P.; Ruiz‐Pernía, J. Javier; Adesina, Aduragbemi S.; Loveridge, E. Joel


    Abstract Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N‐terminal segment containing heavy isotopes (2H, 13C, 15N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C‐terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N‐terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C‐terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C‐terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis. PMID:26079622

  14. Effect of pH on hydride transfer by Escherichia coli dihydrofolate reductase.


    Loveridge, E Joel; Allemann, Rudolf K


    The kinetic isotope effect (KIE) on hydride transfer in the reaction catalysed by dihydrofolate reductase from Escherichia coli (EcDHFR) is known to be temperature dependent at pH 7, but essentially independent of temperature at elevated pH. Here, we show that the transition from the temperature-dependent regime to the temperature-independent regime occurs sharply between pH 7.5 and 8. The activation energy for hydride transfer is independent of pH. The mechanism leading to the change in behaviour of the KIEs is not clear, but probably involves a conformational change in the enzyme brought about by deprotonation of a key residue (or residues) at high pH. The KIE on hydride transfer at low pH suggests that the rate constant for the reaction is not limited by a conformational change to the enzyme under these conditions. The effect of pH on the temperature dependence of the rate constants and KIEs for hydride transfer catalysed by EcDHFR suggests that enzyme motions and conformational changes do not directly influence the chemistry, but that the reaction conditions affect the conformational ensemble of the enzyme prior to reaction and control the reaction though this route.

  15. Virtual ligand screening against Escherichia coli dihydrofolate reductase: improving docking enrichment using physics-based methods.


    Bernacki, Katarzyna; Kalyanaraman, Chakrapani; Jacobson, Matthew P


    Motivated by their participation in the McMaster Data-Mining and Docking Competition, the authors developed 2 new computational technologies and applied them to docking against Escherichia coli dihydrofolate reductase: a receptor preparation procedure that incorporates rotamer optimization of side chains and a physics-based rescoring procedure for estimating relative binding affinities of the protein-ligand complexes. Both methods use the same energy function, consisting of the all-atom OPLS-AA force field and a generalized Born solvent model, which treats the protein receptor and small-molecule ligands in a consistent manner. Thus, the energy function is similar to that used in more sophisticated approaches, such as free-energy perturbation and the molecular mechanics Poisson-Boltzmann/surface area, but sampling during the rescoring procedure is limited to simple energy minimization of the ligand. The use of a highly efficient minimization algorithm permitted the authors to apply this rescoring procedure to hundreds of thousands of protein-ligand complexes during the competition, using a modest Linux cluster. To test these methods, they used the 12 competitive inhibitors identified in the training set, plus methotrexate, as positive controls in enrichment studies with both the training and test sets, each containing 50,000 compounds. The key conclusion is that combining the receptor preparation and rescoring methods makes it possible to identify most of the positive controls within the top few tenths of a percent of the rank-ordered training and test set libraries.

  16. Catalysis by dihydrofolate reductase and other enzymes arises from electrostatic preorganization, not conformational motions.


    Adamczyk, Andrew J; Cao, Jie; Kamerlin, Shina C L; Warshel, Arieh


    The proposal that enzymatic catalysis is due to conformational fluctuations has been previously promoted by means of indirect considerations. However, recent works have focused on cases where the relevant motions have components toward distinct conformational regions, whose population could be manipulated by mutations. In particular, a recent work has claimed to provide direct experimental evidence for a dynamical contribution to catalysis in dihydrofolate reductase, where blocking a relevant conformational coordinate was related to the suppression of the motion toward the occluded conformation. The present work utilizes computer simulations to elucidate the true molecular basis for the experimentally observed effect. We start by reproducing the trend in the measured change in catalysis upon mutations (which was assumed to arise as a result of a "dynamical knockout" caused by the mutations). This analysis is performed by calculating the change in the corresponding activation barriers without the need to invoke dynamical effects. We then generate the catalytic landscape of the enzyme and demonstrate that motions in the conformational space do not help drive catalysis. We also discuss the role of flexibility and conformational dynamics in catalysis, once again demonstrating that their role is negligible and that the largest contribution to catalysis arises from electrostatic preorganization. Finally, we point out that the changes in the reaction potential surface modify the reorganization free energy (which includes entropic effects), and such changes in the surface also alter the corresponding motion. However, this motion is never the reason for catalysis, but rather simply a reflection of the shape of the reaction potential surface.

  17. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans

    PubMed Central

    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sandanandan; Zou, Jing; Zhou, Xuedong; Wu, Hui


    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0 ± 10.2 nM for the biofilm and 8.7 ± 1.9 nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000 nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries. PMID:26022931

  18. Inhibition of Bacterial Dihydrofolate Reductase by 6-Alkyl-2,4-diaminopyrimidines

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Bunce, Richard A.; Wakeham, Nancy; Bourne, Philip C.; Ramnarayan, Kal; Mylvaganam, Shankari; Berlin, K. Darrell; Barrow, Esther W.; Barrow, William W.


    A series of (±)-6-alkyl-2,4-diaminopyrimidine-based inhibitors of bacterial dihydrofolate reductase (DHFR) have been prepared and evaluated for biological potency against Bacillus anthracis and Staphylococcus aureus. Biological studies reveal attenuated activity relative to earlier structures lacking substitution at C6 of the diaminopyrimidine moiety, though minimum inhibitory concentration (MIC) values are in the 0.125–8 μg/mL range for both organisms. This effect was rationalized from previous three-dimensional X-ray structure studies that indicate the presence of a side pocket containing two water molecules adjacent to the main binding pocket. Because of the hydrophobic nature of the substitutions at C6 the main interactions are with protein residues Leu20 and Leu28. These interactions lead to a minor conformational change in the protein, which opens the pocket containing these waters such that it is continuous with the main binding pocket. These water molecules are reported to play a critical role in the catalytic reaction. This highlights a new area for inhibitor expansion within the limited architectural variation at the catalytic site of bacterial DHFR. PMID:22930550

  19. Targeted Mutations of Bacillus anthracis Dihydrofolate Reductase Condense Complex Structure-Activity Relationships

    SciTech Connect

    J Beierlein; N Karri; A Anderson


    Several antifolates, including trimethoprim (TMP) and a series of propargyl-linked analogues, bind dihydrofolate reductase from Bacillus anthracis (BaDHFR) with lower affinity than is typical in other bacterial species. To guide lead optimization for BaDHFR, we explored a new approach to determine structure-activity relationships whereby the enzyme is altered and the analogues remain constant, essentially reversing the standard experimental design. Active site mutants of the enzyme, Ba(F96I)DHFR and Ba(Y102F)DHFR, were created and evaluated with enzyme inhibition assays and crystal structures. The affinities of the antifolates increase up to 60-fold with the Y102F mutant, suggesting that interactions with Tyr 102 are critical for affinity. Crystal structures of the enzymes bound to TMP and propargyl-linked inhibitors reveal the basis of TMP resistance and illuminate the influence of Tyr 102 on the lipophilic linker between the pyrimidine and aryl rings. Two new inhibitors test and validate these conclusions and show the value of the technique for providing new directions during lead optimization.

  20. Exploring QSAR, pharmacophore mapping and docking studies and virtual library generation for cycloguanil derivatives as PfDHFR-TS inhibitors.


    Ojha, Probir Kumar; Roy, Kunal


    Resistance of available antimalarial drugs against Plasmodium species is one of the major problems of malaria control in the developing world. In the present study, we have performed QSAR, pharmacophore mapping and molecular docking studies of cycloguanil derivatives as Plasmodium falciparum dihydrofolate reductase thymidylate synthase (PfDHFR-TS) inhibitors to explore essential features required for the antimalarial activity and important interaction patterns between the enzyme and ligands for the design of new potent PfDHFR-TS inhibitors. The QSAR studies have been carried out using topological parameters along with thermodynamic and structural descriptors. Acceptable values of internal and external validation parameters for the developed QSAR models confirm acceptability of the models. Pharmacophore mapping revealed that two hydrogen bond donor (HBD) features and a hydrophobic feature (HYD) are important parameters for PfDHFR-TS inhibitory activity. The docking studies suggest that the PfDHFR-TS inhibitors interact with Asp54, Ile14, Ile164, ser108, Ser111, Tyr170, Met55, Ala16, Thr185, Leu46, Cys15, Phe58, Ile112, Trp48, Tyr57 and Leu119 amino acid residues. The QSAR, pharmacophore and docking studies inferred that i) branching of the substituents at R1 and R2 positions should be less (small alkyl chain substituents are favored); ii) the electronegativity of the molecules should be high but within some limit; iii) the size and volume of the molecules should be high; iv) molecules should be flexible enough; v) R configuration at C6 position of the triazine ring favors the inhibitory binding affinity; vi) the substituents of the phenyl ring at 3, 4 and 5 position of the phenyl ring should be small hydrophobic groups. Based on these studies, we have designed a library of cycloguanil derivatives with good in silico predicted PfDHFR-TS inhibitory activity.

  1. Rational drug design approach for overcoming drug resistance: application to pyrimethamine resistance in malaria.


    McKie, J H; Douglas, K T; Chan, C; Roser, S A; Yates, R; Read, M; Hyde, J E; Dascombe, M J; Yuthavong, Y; Sirawaraporn, W


    Pyrimethamine acts by selectively inhibiting malarial dihydrofolate reductase-thymidylate synthase (DHFR-TS). Resistance in the most important human parasite, Plasmodium falciparum, initially results from an S108N mutation in the DHFR domain, with additional mutation (most commonly C59R or N51I or both) imparting much greater resistance. From a homology model of the 3-D structure of DHFR-TS, rational drug design techniques have been used to design and subsequently synthesize inhibitors able to overcome malarial pyrimethamine resistance. Compared to pyrimethamine (Ki 1.5 nM) with purified recombinant DHFR fromP. falciparum, the Ki value of the m-methoxy analogue of pyrimethamine was 1.07 nM, but against the DHFR bearing the double mutation (C59R + S108N), the Ki values for pyrimethamine and the m-methoxy analogue were 71.7 and 14.0 nM, respectively. The m-chloro analogue of pyrimethamine was a stronger inhibitor of both wild-type DHFR (with Ki 0.30 nM) and the doubly mutant (C59R +S108N) purified enzyme (with Ki 2.40 nM). Growth of parasite cultures of P. falciparum in vitro was also strongly inhibited by these compounds with 50% inhibition of growth occurring at 3.7 microM for the m-methoxy and 0.6 microM for the m-chloro compounds with the K1 parasite line bearing the double mutation (S108N + C59R), compared to 10.2 microM for pyrimethamine. These inhibitors were also found in preliminary studies to retain antimalarial activity in vivo in P. berghei-infected mice.

  2. New developments in malaria diagnostics

    PubMed Central

    Versteeg, Inge; Migchelsen, Stephanie J; González, Iveth J; Perkins, Mark D; Mens, Petra F; Schallig, Henk DFH


    Currently available rapid diagnostic tests (RDTs) for malaria show large variation in sensitivity and specificity, and there are concerns about their stability under field conditions. To improve current RDTs, monoclonal antibodies (mAbs) for novel malaria antigens have been developed and screened for their possible use in new diagnostic tests. Three antigens, glutamate rich protein (GLURP), dihydrofolate reductase-thymidylate synthase (DHFR-TS) and heme detoxification protein (HDP), were selected based on literature searches. Recombinant antigens were produced and used to immunize mice. Antibody-producing cell lines were subsequently selected and the resulting antibodies were screened for specificity against Plasmodium falciparum and Plasmodium vivax. The most optimal antibody couples were selected based on antibody affinity (expressed as dissociation constants, KD) and detection limit of crude antigen extract from P. falciparum 3D7 culture. The highest affinity antibodies have KD values of 0.10 nM ± 0.014 (D5) and 0.068 ± 0.015 nM (D6) for DHFR-TS mAbs, 0.10 ± 0.022 nM (H16) and 0.21 ± 0.022 nM (H18) for HDP mAbs and 0.11 ± 0.028 nM (G23) and 0.33 ± 0.093 nM (G22) for GLURP mAbs. The newly developed antibodies performed at least as well as commercially available histidine rich protein antibodies (KD of 0.16 ± 0.13 nM for PTL3 and 1.0 ± 0.049 nM for C1–13), making them promising reagents for further test development. PMID:22327435

  3. Circularly permuted dihydrofolate reductase possesses all the properties of the molten globule state, but can resume functional tertiary structure by interaction with its ligands.

    PubMed Central

    Uversky, V. N.; Kutyshenko, V. P.; Protasova NYu; Rogov, V. V.; Vassilenko, K. S.; Gudkov, A. T.


    It is obvious that functional activity of a protein molecule is closely related to its structure. On the other hand, the understanding of structure-function relationship still remains one of the intriguing problems of molecular biology. There is widespread belief that mutagenesis presents a real way to solve this problem. Following this assumption, we have investigated the effect of circular permutation in dihydrofolate reductase from E. coli on protein structure and functioning. It has been shown that in the absence of ligands two circularly permuted variants of dihydrofolate reductase possess all the properties of the molten globule state. However, after addition of ligands they gain the native-like structural properties and specific activity. This means that the in vitro folding of permuted dihydrofolate reductase is terminated at the stage of the molten globule formation. Interaction of permuted protein with ligands leads to the structural adjustment and formation of active protein molecules. PMID:8880908

  4. Geranyl diphosphate synthase from mint


    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan


    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  5. Geranyl diphosphate synthase from mint


    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.


    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  6. A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer.


    Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Nakajima, Miki


    Dihydrofolate reductase (DHFR) plays a key role in folate metabolism and is a target molecule of methotrexate. An increase in the cellular expression level of DHFR is one of the mechanisms of tumor resistance to methotrexate. The present study investigated the possibility that adenosine-to-inosine RNA editing, which causes nucleotide conversion by adenosine deaminase acting on RNA (ADAR) enzymes, might modulate DHFR expression. In human breast adenocarcinoma-derived MCF-7 cells, 26 RNA editing sites were identified in the 3'-UTR of DHFR. Knockdown of ADAR1 decreased the RNA editing levels of DHFR and resulted in a decrease in the DHFR mRNA and protein levels, indicating that ADAR1 up-regulates DHFR expression. Using a computational analysis, miR-25-3p and miR-125a-3p were predicted to bind to the non-edited 3'-UTR of DHFR but not to the edited sequence. The decrease in DHFR expression by the knockdown of ADAR1 was restored by transfection of antisense oligonucleotides for these miRNAs, suggesting that RNA editing mediated up-regulation of DHFR requires the function of these miRNAs. Interestingly, we observed that the knockdown of ADAR1 decreased cell viability and increased the sensitivity of MCF-7 cells to methotrexate. ADAR1 expression levels and the RNA editing levels in the 3'-UTR of DHFR in breast cancer tissues were higher than those in adjacent normal tissues. Collectively, the present study demonstrated that ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p and miR-125a-3p binding sites in the 3'-UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate.

  7. Protein Mass-Modulated Effects in the Catalytic Mechanism of Dihydrofolate Reductase: Beyond Promoting Vibrations

    PubMed Central


    The role of fast protein dynamics in enzyme catalysis has been of great interest in the past decade. Recent “heavy enzyme” studies demonstrate that protein mass-modulated vibrations are linked to the energy barrier for the chemical step of catalyzed reactions. However, the role of fast dynamics in the overall catalytic mechanism of an enzyme has not been addressed. Protein mass-modulated effects in the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR) are explored by isotopic substitution (13C, 15N, and non-exchangeable 2H) of the wild-type ecDHFR (l-DHFR) to generate a vibrationally perturbed “heavy ecDHFR” (h-DHFR). Steady-state, pre-steady-state, and ligand binding kinetics, intrinsic kinetic isotope effects (KIEint) on the chemical step, and thermal unfolding experiments of both l- and h-DHFR show that the altered protein mass affects the conformational ensembles and protein–ligand interactions, but does not affect the hydride transfer at physiological temperatures (25–45 °C). Below 25 °C, h-DHFR shows altered transition state (TS) structure and increased barrier-crossing probability of the chemical step compared with l-DHFR, indicating temperature-dependent protein vibrational coupling to the chemical step. Protein mass-modulated vibrations in ecDHFR are involved in TS interactions at cold temperatures and are linked to dynamic motions involved in ligand binding at physiological temperatures. Thus, mass effects can affect enzymatic catalysis beyond alterations in promoting vibrations linked to chemistry. PMID:24820793

  8. A molecular model of the folate binding site of Pneumocystis carinii dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Southerland, William M.


    The inhibition of Pneumocystis carinii dihydrofolate reductase (DHFR) continues to be the major treatment strategy for P. carinii pneumonia (PCP). The design of new anti-pneumocystis agents would be significantly enhanced by the availability of a 3D model of the methotrexate (MTX) binding site of the P. carinii DHFR. However, an X-ray crystal structure of the P. carinii DHFR is not yet available. Alignment of the amino acid sequences of P. carinii and Lactobacillus casei DHFRs indicates that the two proteins show approximately 80% homology among MTX binding-site residues. This high level of homology suggests that the L. casei DHFR MTX binding-site structure could serve as a structural template in developing a model of the P. carinii DHFR MTX binding site. Therefore, the X-ray crystal structure of L. casei DHFR was used to develop a 3D model of the methotrexate binding site of P. carinii DHFR. The molecular modeling and dynamics software QUANTA/CHARMm was used. Amino acid residue mutations and deletions were performed using QUANTA and macromolecular minimizations were achieved with CHARMm. The MTX binding-site residues of L. casei DHFR were mutated to the corresponding residues of the P. carinii DHFR sequence. The resulting structure was extensively minimized. The resulting P. carinii MTX binding-site model showed significant differences in hydrogen-bonding patterns from the L. casei MTX binding site. Also, the P. carinii site is more hydrophobic than the corresponding L. casei site. Analysis of atom-to-atom close contacts between methotrexate and protein binding-site residues indicates that the P. carinii MTX binding-site complex is primarily stabilized by hydrophobic interactions, while the L. casei complex is mostly stabilized by electrostatic interactions. The model is consistent with the observed increased sensitivity of P. carinii DHFR to lipid-soluble inhibitors and provides a rational basis for the design of new anti-pneumocystis agents.

  9. Pivotal role of dihydrofolate reductase knockdown in the anticancer activity of 2-hydroxyoleic acid

    PubMed Central

    Lladó, Victoria; Terés, Silvia; Higuera, Mónica; Álvarez, Rafael; Noguera-Salva, Maria Antònia; Halver, John E.; Escribá, Pablo V.; Busquets, Xavier


    α-Hydroxy-9-cis-octadecenoic acid, a synthetic fatty acid that modifies the composition and structure of lipid membranes. 2-Hydroxyoleic acid (HOA) generated interest due to its potent, yet nontoxic, anticancer activity. It induces cell cycle arrest in human lung cancer (A549) cells and apoptosis in human leukemia (Jurkat) cells. These two pathways may explain how HOA induces regression of a variety of cancers. We showed that HOA repressed the expression of dihydrofolate reductase (DHFR), the enzyme responsible for tetrahydrofolate (THF) synthesis. Folinic acid, which readily produces THF without the participation of DHFR, reverses the antitumor effects of HOA in A549 and Jurkat cells, as well as the inhibitory influence on cyclin D and cdk2 in A549 cells, and on DNA and PARP degradation in Jurkat cells. This effect was very specific, because either elaidic acid (an analog of HOA) or other lipids, failed to alter A549 or Jurkat cell growth. THF is a cofactor necessary for DNA synthesis. Thus, impairment of DNA synthesis appears to be a common mechanism involved in the different responses elicited by cancer cells following treatment with HOA, namely cell cycle arrest or apoptosis. Compared with other antifolates, such as methotrexate, HOA did not directly inhibit DHFR but rather, it repressed its expression, a mode of action that offers certain therapeutic advantages. These results not only demonstrate the effect of a fatty acid on the expression of DHFR, but also emphasize the potential of HOA to be used as a wide-spectrum drug against cancer. PMID:19666584

  10. Thermal Stabilization of Dihydrofolate Reductase Using Monte Carlo Unfolding Simulations and Its Functional Consequences

    PubMed Central

    Whitney, Anna; Shakhnovich, Eugene I.


    Design of proteins with desired thermal properties is important for scientific and biotechnological applications. Here we developed a theoretical approach to predict the effect of mutations on protein stability from non-equilibrium unfolding simulations. We establish a relative measure based on apparent simulated melting temperatures that is independent of simulation length and, under certain assumptions, proportional to equilibrium stability, and we justify this theoretical development with extensive simulations and experimental data. Using our new method based on all-atom Monte-Carlo unfolding simulations, we carried out a saturating mutagenesis of Dihydrofolate Reductase (DHFR), a key target of antibiotics and chemotherapeutic drugs. The method predicted more than 500 stabilizing mutations, several of which were selected for detailed computational and experimental analysis. We find a highly significant correlation of r = 0.65–0.68 between predicted and experimentally determined melting temperatures and unfolding denaturant concentrations for WT DHFR and 42 mutants. The correlation between energy of the native state and experimental denaturation temperature was much weaker, indicating the important role of entropy in protein stability. The most stabilizing point mutation was D27F, which is located in the active site of the protein, rendering it inactive. However for the rest of mutations outside of the active site we observed a weak yet statistically significant positive correlation between thermal stability and catalytic activity indicating the lack of a stability-activity tradeoff for DHFR. By combining stabilizing mutations predicted by our method, we created a highly stable catalytically active E. coli DHFR mutant with measured denaturation temperature 7.2°C higher than WT. Prediction results for DHFR and several other proteins indicate that computational approaches based on unfolding simulations are useful as a general technique to discover stabilizing

  11. Elucidating features that drive the design of selective antifolates using crystal structures of human dihydrofolate reductase.


    Lamb, Kristen M; G-Dayanandan, Narendran; Wright, Dennis L; Anderson, Amy C


    The pursuit of antimicrobial drugs that target dihydrofolate reductase (DHFR) exploits differences in sequence and dynamics between the pathogenic and human enzymes. Here, we present five crystal structures of human DHFR bound to a new class of antimicrobial agents, the propargyl-linked antifolates (PLAs), with a range of potency (IC50 values of 0.045-1.07 μM) for human DHFR. These structures reveal that interactions between the ligands and Asn 64, Phe 31, and Phe 34 are important for increased affinity for human DHFR and that loop residues 58-64 undergo ligand-induced conformational changes. The utility of these structural studies was demonstrated through the design of three new ligands that reduce the number of contacts with Asn 64, Phe 31, and Phe 34. Synthesis and evaluation show that one of the designed inhibitors exhibits the lowest affinity for human DHFR of any of the PLAs (2.64 μM). Comparisons of structures of human and Staphylococcus aureus DHFR bound to the same PLA reveal a conformational change in the ligand that enhances interactions with residues Phe 92 (Val 115 in huDHFR) and Ile 50 (Ile 60 in huDHFR) in S. aureus DHFR, yielding selectivity. Likewise, comparisons of human and Candida glabrata DHFR bound to the same ligand show that hydrophobic interactions with residues Ile 121 and Phe 66 (Val 115 and Asn 64 in human DHFR) yield selective inhibitors. The identification of residue substitutions that are important for selectivity and the observation of active site flexibility will help guide antimicrobial antifolate development for the inhibition of pathogenic species.

  12. Hybrid polyketide synthases

    SciTech Connect

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  13. Escherichia coli dihydrofolate reductase catalyzed proton and hydride transfers: Temporal order and the roles of Asp27 and Tyr100

    PubMed Central

    Liu, C. Tony; Francis, Kevin; Layfield, Joshua P.; Huang, Xinyi; Hammes-Schiffer, Sharon; Kohen, Amnon; Benkovic, Stephen J.


    The reaction catalyzed by Escherichia coli dihydrofolate reductase (ecDHFR) has become a model for understanding enzyme catalysis, and yet several details of its mechanism are still unresolved. Specifically, the mechanism of the chemical step, the hydride transfer reaction, is not fully resolved. We found, unexpectedly, the presence of two reactive ternary complexes [enzyme:NADPH:7,8-dihydrofolate (E:NADPH:DHF)] separated by one ionization event. Furthermore, multiple kinetic isotope effect (KIE) studies revealed a stepwise mechanism in which protonation of the DHF precedes the hydride transfer from the nicotinamide cofactor (NADPH) for both reactive ternary complexes of the WT enzyme. This mechanism was supported by the pH- and temperature-independent intrinsic KIEs for the C-H→C hydride transfer between NADPH and the preprotonated DHF. Moreover, we showed that active site residues D27 and Y100 play a synergistic role in facilitating both the proton transfer and subsequent hydride transfer steps. Although D27 appears to have a greater effect on the overall rate of conversion of DHF to tetrahydrofolate, Y100 plays an important electrostatic role in modulating the pKa of the N5 of DHF to enable the preprotonation of DHF by an active site water molecule. PMID:25453098

  14. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. T...

  15. Induction of methotrexate resistance by retroviral-mediated transfer of a mutant dihydrofolate reductase gene

    SciTech Connect

    Ricciardone, M.D.


    Methotrexate (MTX), a folate analog which inhibits the enzyme dihydrofolate reductase (DHFR), is an effective antineoplastic drug. However, MTX-induced myelosuppression limits the effectiveness of this agent. Selective induction of MTX resistance in bone marrow stem cells, prior to treatment with MTX, might prevent this toxicity and improve the therapeutic index of the drug. In these studies drug resistance was transferred to mouse and human bone marrow stem cells by retroviral expression vectors containing coding sequences of a mutant DHFR with a decreased affinity for MTX. Three retroviral expression vectors were analyzed. The CIS DR vector contained the mutant DHFR gene inserted into the replication-defective amphotropic 4070 virus, Cistor. The other vectors contained the mutant DHFR inserted into either the env region (SDHT1) or gag-pol region (SDHT2) of a replication-defective spleen focus-forming virus. All three constructs induced approximately a 200-fold resistance to MTX when transfected into NIH3T3 cells. Amphotropic infectious retroviruses were obtained by transfecting the mutant DHFR vectors into a packaging cell line, which supplied the gag, pol, and env proteins for virus production. Virus titers of 4.5 x 10/sup 3/ colony-forming units (CFU)/ml (CIS DR), 1.5 x 10/sup 4/ CFU/ml (SDHT2), and 5 x 10/sup 5/ CFU/ml (SDHT1) were measured by the transfer of MTX resistance to NIH3T3 cells. The amphotropic SDHT1 virus efficiently induced MTX resistance in cells of several species, including mouse NIH3T3 cells (5 x 10/sup 5/ CFU/ml), monkey CV1 cells (4 x 10/sup 3/ CFU/ml), and human MCF-7 cells (6 x 10/sup 4/ CFU/ml). When cocultured with SDHT1 virus-producing cells, both mouse and human bone marrow cells could be infected and rendered resistant to MTX. Mouse cytotoxic T lymphocytes and mouse helper T lymphocytes can also be made resistant to MTX.

  16. Mammalian ceramide synthases.


    Levy, Michal; Futerman, Anthony H


    In mammals, ceramide, a key intermediate in sphingolipid metabolism and an important signaling molecule, is synthesized by a family of six ceramide synthases (CerS), each of which synthesizes ceramides with distinct acyl chain lengths. There are a number of common biochemical features between the CerS, such as their catalytic mechanism, and their structure and intracellular localization. Different CerS also display remarkable differences in their biological properties, with each of them playing distinct roles in processes as diverse as cancer and tumor suppression, in the response to chemotherapeutic drugs, in apoptosis, and in neurodegenerative diseases.

  17. Monoterpene synthases from common sage (Salvia officinalis)


    Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan


    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  18. Microscale synthesis of isotopically labeled R-[6-xH]N5,N10-methylene-5,6,7,8-tetrahydrofolate as a cofactor for thymidylate synthase.


    Agrawal, Nitish; Mihai, Cornelia; Kohen, Amnon


    A one-pot synthesis of isotopically labeled R-[6-xH]N5,N10-methylene-5,6,7,8-tetrahydrofolate (CH2H4F) is presented, where x=1, 2, or 3 represents hydrogen, deuterium, or tritium, respectively. The current procedure offers high-yield, high-purity, and microscale-quantity synthesis. In this procedure, two enzymes were used simultaneously in the reaction mixture. The first was Thermoanaerobium brockii alcohol dehydrogenase, which stereospecifically catalyzed a hydride transfer from C-2-labeled isopropanol to the re face of oxidized nicotinamide adenine dinucleotide phosphate to form R-[4-xH]-labeled reduced nicotinamide adenine dinucleotide phosphate. The second enzyme, Escherichia coli dihydrofolate reductase, used the xH to reduce 7,8-dihydrofolate (H2F) to form S-[6-xH]5,6,7,8-tetrahydrofolate (S-[6-xH]H4F). The enzymatic reactions were followed by chemical trapping of S-[6-xH]H4F with formaldehyde to form the final product. Product purification was carried out in a single step by reverse phase high-pressure liquid chromatography separation followed by lyophilization. Two analytical methods were developed to follow the reaction progress. Finally, the utility of the labeled cofactor in mechanistic studies of thymidylate synthase is demonstrated by measuring the tritium kinetic isotope effect on the enzyme's second order rate constant.

  19. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase

    SciTech Connect

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris


    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structure reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.

  20. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase


    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; ...


    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structuremore » reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.« less

  1. Evidence that a ‘dynamic knockout’ in Escherichia coli dihydrofolate reductase does not affect the chemical step of catalysis

    NASA Astrophysics Data System (ADS)

    Loveridge, E. Joel; Behiry, Enas M.; Guo, Jiannan; Allemann, Rudolf K.


    The question of whether protein motions play a role in the chemical step of enzymatic catalysis has generated much controversy in recent years. Debate has recently reignited over possible dynamic contributions to catalysis in dihydrofolate reductase, following conflicting conclusions from studies of the N23PP/S148A variant of the Escherichia coli enzyme. By investigating the temperature dependence of kinetic isotope effects, we present evidence that the reduction in the hydride transfer rate constants in this variant is not a direct result of impairment of conformational fluctuations. Instead, the conformational state of the enzyme immediately before hydride transfer, which determines the electrostatic environment of the active site, affects the rate constant for the reaction. Although protein motions are clearly important for binding and release of substrates and products, there appears to be no detectable dynamic coupling of protein motions to the hydride transfer step itself.

  2. Mycobacterium tuberculosis dihydrofolate reductase reveals two conformational states and a possible low affinity mechanism to antifolate drugs.


    Dias, Marcio Vinicius Bertacine; Tyrakis, Petros; Domingues, Romenia Ramos; Paes Leme, Adriana Franco; Blundell, Tom L


    Inhibition of the biosynthesis of tetrahydrofolate (THF) has long been a focus in the treatment of both cancer and infectious diseases. Dihydrofolate reductase (DHFR), which catalyzes the last step, is one of the most thoroughly explored targets of this pathway, but there are no DHFR inhibitors used for tuberculosis treatment. Here, we report a structural, site-directed mutagenesis and calorimetric analysis of Mycobacterium tuberculosis DHFR (MtDHFR) in complex with classical DHFR inhibitors. Our study provides insights into the weak inhibition of MtDHFR by trimethoprim and other antifolate drugs, such as pyrimethamine and cycloguanil. The construction of the mutant Y100F, together with calorimetric studies, gives insights into low affinity of MtDHFR for classical DHFR inhibitors. Finally, the structures of MtDHFR in complex with pyrimethamine and cycloguanil define important interactions in the active site and provide clues to the more effective design of antibiotics targeted against MtDHFR.

  3. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  4. Effects of Point Mutations in Plasmodium falciparum Dihydrofolate Reductase and Dihydropterate Synthase Genes on Clinical Outcomes and In Vitro Susceptibility to Sulfadoxine and Pyrimethamine

    DTIC Science & Technology


    Alejandro Llanos-Cuentas4, Coralith Garcia4, Lelv Solari4, Dennis Kyle5, Alan J. Magill3 1 Parasitology Program, Naval Medical Research Center...5]. PLoS ONE | 1 August 2009 | Volume 4 | Issue 8 | e6762 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting...burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing

  5. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography

    PubMed Central

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris


    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to a lack of consensus regarding the catalytic mechanism involved. To resolve this ambiguity, we conducted neutron and ultrahigh-resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of Escherichia coli DHFR with folate and NADP+. The neutron data were collected to 2.0-Å resolution using a 3.6-mm3 crystal with the quasi-Laue technique. The structure reveals that the N3 atom of folate is protonated, whereas Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer owing to protonation of the N3 atom, suggesting that tautomerization is unnecessary for catalysis. In the 1.05-Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa value of the N5 atom of DHF by Asp27, and protonation of N5 by water that gains access to the active site through fluctuation of the Met20 side chain even though the Met20 loop is closed. PMID:25453083

  6. Structural comparison of chromosomal and exogenous dihydrofolate reductase from Staphylococcus aureus in complex with the potent inhibitor trimethoprim

    SciTech Connect

    Heaslet, Holly; Harris, Melissa; Fahnoe, Kelly; Sarver, Ronald; Putz, Henry; Chang, Jeanne; Subramanyam, Chakrapani; Barreiro, Gabriela; Miller, J. Richard; Pfizer


    Dihydrofolate reductase (DHFR) is the enzyme responsible for the NADPH-dependent reduction of 5,6-dihydrofolate to 5,6,7,8-tetrahydrofolate, an essential cofactor in the synthesis of purines, thymidylate, methionine, and other key metabolites. Because of its importance in multiple cellular functions, DHFR has been the subject of much research targeting the enzyme with anticancer, antibacterial, and antimicrobial agents. Clinically used compounds targeting DHFR include methotrexate for the treatment of cancer and diaminopyrimidines (DAPs) such as trimethoprim (TMP) for the treatment of bacterial infections. DAP inhibitors of DHFR have been used clinically for >30 years and resistance to these agents has become widespread. Methicillin-resistant Staphylococcus aureus (MRSA), the causative agent of many serious nosocomial and community acquired infections, and other gram-positive organisms can show resistance to DAPs through mutation of the chromosomal gene or acquisition of an alternative DHFR termed 'S1 DHFR.' To develop new therapies for health threats such as MRSA, it is important to understand the molecular basis of DAP resistance. Here, we report the crystal structure of the wild-type chromosomal DHFR from S. aureus in complex with NADPH and TMP. We have also solved the structure of the exogenous, TMP resistant S1 DHFR, apo and in complex with TMP. The structural and thermodynamic data point to important molecular differences between the two enzymes that lead to dramatically reduced affinity of DAPs to S1 DHFR. These differences in enzyme binding affinity translate into reduced antibacterial activity against strains of S. aureus that express S1 DHFR.

  7. Biosynthetic incorporation of telluromethionine into dihydrofolate reductase and crystallographic analysis of the distribution of tellurium atoms in the protein molecule

    SciTech Connect

    Kunkle, M.G.; Lewinski, K.; Boles, J.O.; Dunlap, R.B.; Odom, J.D.; Lebioda, L.


    Recent successes in crystallographic studies of proteins with methionine (Met) residues replaced with SeMet, pioneered by Hendrickson and coworkers, inspired us to replace Met with TeMet in Escherichia coli dihydrofolate reductase (DHFR). E. coli DHFR, which catalyzes the NADPH-dependent reduction of dihydrofolate to tetrahydrofolate, consists of 159 residues, 5 of which are Met. TeMet was incorporated into DHFR using the Met auxotroph, E. coli DL41, carrying the expression vector pWT8 with an IPTG inducible promoter and ampicillin resistance gene. The enzyme was purified by successive chromatography on Q-Sepharose and PHenyl Sepharose resins, yielding milligram quantities of homogeneous enzyme with a specific activity of 40 units/mg. TeMet DHFR exhibits kinetic properties similar to those of wt DHFR. Amino acid analysis indicated 3 authentic Met residues in TeMet DHFR, whereas atomic absorption spectroscopy detected 2 Te per protein molecule. Amino acid sequence analysis results suggested that only authentic Met was present in the first three Met positions (1,16,and 20). Crystals of Te-DHFR were grown in the presence of methotrexate from PEG 4000 and were isomorphous with wt-DHFR crystals grown from ethanol. Difference Fourier maps and restrained least-squares refinement show very little, if any, Te in the first three Met positions: Met{sup 1}, Met{sup 16}, and Met{sup 20}, whereas the occupancy of Te in positions 42 and 92 is 0.64. Apparently, the process of folding, subsequent purification, and crystallization select DHFR molecules with Te in Met{sup 42} and Met{sup 92}. Replacing Met with TeMet provides an internal probe that should facilitate structural and mechanistic studies of proteins.

  8. Mechanisms of acetohydroxyacid synthases.


    Chipman, David M; Duggleby, Ronald G; Tittmann, Kai


    Acetohydroxyacid synthases are thiamin diphosphate- (ThDP-) dependent biosynthetic enzymes found in all autotrophic organisms. Over the past 4-5 years, their mechanisms have been clarified and illuminated by protein crystallography, engineered mutagenesis and detailed single-step kinetic analysis. Pairs of catalytic subunits form an intimate dimer containing two active sites, each of which lies across a dimer interface and involves both monomers. The ThDP adducts of pyruvate, acetaldehyde and the product acetohydroxyacids can be detected quantitatively after rapid quenching. Determination of the distribution of intermediates by NMR then makes it possible to calculate individual forward unimolecular rate constants. The enzyme is the target of several herbicides and structures of inhibitor-enzyme complexes explain the herbicide-enzyme interaction.

  9. sup 13 C and sup 15 N nuclear magnetic resonance evidence of the ionization state of substrates bound to bovine dihydrofolate reductase

    SciTech Connect

    Selinsky, B.S.; Perlman, M.E.; London, R.E. ); Unkefer, C.J. ); Mitchell, J. ); Blakley, R.L. Univ. of Tennessee, Memphis )


    The state of protonation of substrates bound to mammalian dihydrofolate reductase (DHFR) has significance for the mechanism of catalysis. To investigate this, dihydrofolate and dihydropteroylpentaglutamate have been synthesized with {sup 15}N enrichment at N-5. {sup 15}N NMR studies have been performed on the binary complexes formed by bovine DHFR with these compounds and with (5-{sup 15}N)dihydrobiopterin. The results indicate that there is no protonation at N-5 in the binary complexes, and this was confirmed by {sup 13}C NMR studies with folate and dihydrofolate synthesized with {sup 13}C enrichment at C-6. The chemical shift displacements produced by complex formation are in the same direction as those which result from deprotonation of the N-3/C-4-O amide group and are consistent with at least partial loss of the proton from N-3. This would be possible if, as crystallographic data indicate, there is interaction of N-3 and the 2-amino group of the bound ligands with the carboxylate of the active site glutamate residue (Glu{sup 30}).

  10. Functional nucleotide excision repair is required for the preferential removal of N-ethylpurines from the transcribed strand of the dihydrofolate reductase gene of Chinese hamster ovary cells.

    PubMed Central

    Sitaram, A; Plitas, G; Wang, W; Scicchitano, D A


    Transcription-coupled repair of DNA adducts is an essential factor that must be considered when one is elucidating biological endpoints resulting from exposure to genotoxic agents. Alkylating agents comprise one group of chemical compounds which modify DNA by reacting with oxygen and nitrogen atoms in the bases of the double helix. To discern the role of transcription-coupled DNA repair of N-ethylpurines present in discrete genetic domains, Chinese hamster ovary cells were exposed to N-ethyl-N-nitrosourea, and the clearance of the damage from the dihydrofolate reductase gene was investigated. The results indicate that N-ethylpurines were removed from the dihydrofolate reductase gene of nucleotide excision repair-proficient Chinese hamster ovary cells; furthermore, when repair rates in the individual strands were determined, a statistically significant bias in the removal of ethyl-induced, alkali-labile sites was observed, with clearance occurring 30% faster from the transcribed strand than from its nontranscribed counterpart at early times after exposure. In contrast, removal of N-ethylpurines was observed in the dihydrofolate reductase locus in cells that lacked nucleotide excision repair, but both strands were repaired at the same rate, indicating that transcription-coupled clearance of these lesions requires the presence of active nucleotide excision repair. PMID:9001209

  11. Phosphanilic Acid Inhibits Dihydropteroate Synthase

    DTIC Science & Technology


    dihydropteroate synthases of P. aeruginosa and E . coli were about equally susceptible to inhibition by PA. These results suggest that cells of P. aeruginosa...are more permeable to PA than cells of E . coli . Although a weak inhibitor, PA acted on dihydropteroate synthase in the same manner as the sulfonamides...with which PA is structurally related. Inhibition of E . coli by PA in a basal salts-glucose medium was prevented by p-aminobenzoic acid (pABA). However

  12. Bacterial nitric oxide synthases.


    Crane, Brian R; Sudhamsu, Jawahar; Patel, Bhumit A


    Nitric oxide synthases (NOSs) are multidomain metalloproteins first identified in mammals as being responsible for the synthesis of the wide-spread signaling and protective agent nitric oxide (NO). Over the past 10 years, prokaryotic proteins that are homologous to animal NOSs have been identified and characterized, both in terms of enzymology and biological function. Despite some interesting differences in cofactor utilization and redox partners, the bacterial enzymes are in many ways similar to their mammalian NOS (mNOS) counterparts and, as such, have provided insight into the structural and catalytic properties of the NOS family. In particular, spectroscopic studies of thermostable bacterial NOSs have revealed key oxyheme intermediates involved in the oxidation of substrate L-arginine (Arg) to product NO. The biological functions of some bacterial NOSs have only more recently come to light. These studies disclose new roles for NO in biology, such as taking part in toxin biosynthesis, protection against oxidative stress, and regulation of recovery from radiation damage.

  13. Molecular cloning of Chinese hamster dihydrofolate reductase-specific cDNA and the identification of multiple dihydrofolate reductase mRNAs in antifolate-resistant Chinese hamster lung fibroblasts.

    PubMed Central

    Lewis, J A; Kurtz, D T; Melera, P W


    ds cDNA from antifolate-resistant Chinese hamster lung fibroblast subline DC-3F/MQ19 was ligated to Eco RI and Sal I oligonucleotide linkers and cloned into Eco RI and Sal I digested pBR322. Transformed colonies containing dihydrofolate reductase (DHFR)-specific recombinant plasmid were identified by Grunstein Hogness assay using a Chinese hamster DHFR-specific cDNA probe. A recombinant plasmid, pDHFR6, containing a 650 bp HFR insert was isolated and analyzed. This plasmid was used as a molecular probe in a Northern blot analysis of both cytoplasmic and polysomal DHFR, poly A+ mRNAs of the DC-3F/MQ19 subline, which over-produces a 20,000d DHFR 150-fold, and DC-3F/A3 subline, which over-produces a 21,000d DHFR 170-fold. This analysis revealed the presence of three DHFR mRNA species of 1350, 2200, and 3300 nucleotides in both independently-derived cell lines. The relative abundance of each species however varied strikingly between the two cell lines. Images PMID:6262725

  14. Study on Folate Binding Domain of Dihydrofolate Reductase in Different Plant species and Human beings.


    Samanta, Aveek; Datta, Animesh Kumar; Datta, Siraj


    Data base (NCBI and TIGR) searches are made to retrieve protein sequences of different plant species namely Medicago truncatula, Pisum sativum, Ricinus communis, Arabidopsis thaliana, Vitis vinifera, Glycine max, Daucus carota, Oryza sativa Japonica Group, Arabidopsis lyrata subsp. lyrata, Brachypodium distachyon, Oryza sativa Indica Group, Zea mays and careful alignment of derived sequences shows 95% or higher identity. Similarly, DHFR sequence of human being is also retrieved from NCBI. A phylogenetic tree is constructed from different plant and human DHFR domain using the Neighbour - Joining method in MEGA 5.05. Conservation score is performed by using PARALINE. Result suggests that folate binding domain of dihydrofolare reductase is conserved (score 8.06) and excepting some minor variations the basic structure of the domain in both plant species and human being is rather similar. Human DHFR domain contains PEKN sequence near active site, though proline is common for all the selected organisms but the other sequences are different in plants. The plant domain is always associated with TS (Thymidylate synthase). Plant based system is predicted to be an effective model for assessment of MTX (Methotrexate) and other antifolate drugs.

  15. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine.


    Naithani, Manisha; Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti


    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus.

  16. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine

    PubMed Central

    Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti


    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus. PMID:27064332

  17. Comparative study on dihydrofolate reductases from Shewanella species living in deep-sea and ambient atmospheric-pressure environments.


    Murakami, Chiho; Ohmae, Eiji; Tate, Shin-ichi; Gekko, Kunihiko; Nakasone, Kaoru; Kato, Chiaki


    To examine whether dihydrofolate reductase (DHFR) from deep-sea bacteria has undergone molecular evolution to adapt to high-pressure environments, we cloned eight DHFRs from Shewanella species living in deep-sea and ambient atmospheric-pressure environments, and subsequently purified six proteins to compare their structures, stabilities, and functions. The DHFRs showed 74-90% identity in primary structure to DHFR from S. violacea, but only 55% identity to DHFR from Escherichia coli (ecDHFR). Far-ultraviolet circular dichroism and fluorescence spectra suggested that the secondary and tertiary structures of these DHFRs were similar. In addition, no significant differences were found in structural stability as monitored by urea-induced unfolding and the kinetic parameters, K(m) and k(cat); although the DHFRs from Shewanella species were less stable and more active (2- to 4-fold increases in k(cat)/K(m)) than ecDHFR. Interestingly, the pressure effects on enzyme activity revealed that DHFRs from ambient-atmospheric species are not necessarily incompatible with high pressure, and DHFRs from deep-sea species are not necessarily tolerant of high pressure. These results suggest that the DHFR molecule itself has not evolved to adapt to high-pressure environments, but rather, those Shewanella species with enzymes capable of retaining functional activity under high pressure migrated into the deep-sea.

  18. Towards the Understanding of Resistance Mechanisms in Clinically Isolated Trimethoprim-resistant, Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase

    SciTech Connect

    Frey, K.; Lombardo, M; Wright, D; Anderson, A


    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  19. Computation of affinity and selectivity: Binding of 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors to dihydrofolate reductases

    NASA Astrophysics Data System (ADS)

    Marelius, John; Graffner-Nordberg, Malin; Hansson, Tomas; Hallberg, Anders; Åqvist, Johan


    Binding energy calculations for complexes of mutant and wild-type human dihydrofolate reductases with 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors are reported. Quantitative insight into binding energetics of these molecules is obtained from calculations based on force field energy evaluation and thermal sampling by molecular dynamics simulations. The calculated affinity of methotrexate for wild-type and mutant enzymes is reasonably well reproduced. Truncation of the methotrexate glutamate tail results in a loss of affinity by several orders of magnitude. No major difference in binding strength is predicted between the pteridines and the quinazolines, while the N-methyl group present in methotrexate appears to confer significantly stronger binding. The recent improvement, which is used here, of our linear interaction energy method for binding affinity prediction, as well as problems with treating charged and flexible ligands are discussed. This approach should be suitable in a drug discovery context for prediction of binding energies of new inhibitors prior to their synthesis, when some information about the binding mode is available.

  20. Modified 2,4-diaminopyrimidine-based dihydrofolate reductase inhibitors as potential drug scaffolds against Bacillus anthracis

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Wakeham, Nancy; Bourne, Philip C.; Barrow, Esther W.; Muddala, N. Prasad; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.


    The current paper describes the synthesis and biological evaluation of dihydrophthalazine-appended 2,4-diaminopyrimidine (DAP) inhibitors (1) oxidized at the methylene bridge linking the DAP ring to the central aromatic ring and (2) modified at the central ring ether groups. Structures 4a-b incorporating an oxidized methylene bridge showed a decrease in activity, while slightly larger alkyl groups (CH2CH3 versus CH3) on the central ring oxygen atoms (R2 and R3) had a minimal impact on the inhibition. Comparison of the potency data for previously reported RAB1 and BN-53 with the most potent of the new derivatives (19b and 20a-b) showed similar values for inhibition of cellular growth and direct enzymatic inhibition (MICs 0.5-2 μg/mL). Compounds 29-34 with larger ester and ether groups containing substituted aromatic rings at R3 exhibited slightly reduced activity (MICs 2-16 μg/mL). One explanation for this attenuated activity could be encroachment of the extended R3 into the neighboring NADPH co-factor. These results indicate that modest additions to the central ring oxygen atoms are well tolerated, while larger modifications have the potential to act as dual-site inhibitors of dihydrofolate reductase (DHFR). PMID:25435253

  1. Simulations of Remote Mutants of Dihydrofolate Reductase Reveal the Nature of a Network of Residues Coupled to Hydride Transfer

    PubMed Central

    Roston, Daniel; Kohen, Amnon; Doron, Dvir; Major, Dan T.


    Recent experimental and theoretical studies have proposed that enzymes involve networks of coupled residues throughout the protein that participate in motions accompanying chemical barrier crossing. Here we have examined portions of a proposed network in dihydrofolate reductase (DHFR) using quantum mechanics/molecular mechanics simulations. The simulations employ a hybrid quantum mechanics-molecular mechanics approach with a recently developed semi-empirical AM1-SRP Hamiltonian that provides accurate results for this reaction. The simulations reproduce experimentally determined catalytic rates for the wild type and distant mutants of E. coli DHFR, underscoring the accuracy of the simulation protocol. Additionally the simulations provide detailed insight into how residues remote from the active site affect the catalyzed chemistry, through changes in the thermally averaged properties along the reaction coordinate. The mutations do not greatly affect the structure of the transition state near the bond activation, but we observe differences somewhat removed from the point of C-H cleavage that affect the rate. The mutations have global effects on the thermally averaged structure that propagate throughout the enzyme and the current simulations highlight several interactions that appear to be particularly important. PMID:24798860

  2. Survival and risk of relapse of acute lymphoblastic leukemia in a Mexican population is affected by dihydrofolate reductase gene polymorphisms

    PubMed Central



    Dihydrofolate reductase (DHFR) is the major target of methotrexate, a key component in childhood acute lymphoblastic leukemia (ALL) treatment. Polymorphisms in the gene coding for DHFR have been associated with adverse event treatment. This study evaluated the effect of the -A317G and C829T polymorphisms in the DHFR gene on survival and risk of relapse of ALL. Seventy patients with ALL and 100 healthy individuals were genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. An association between the polymorphisms and the risk of relapse was found (p<0.05); patients with the -317G/G genotype were found to have an 8.55 (95% CI 1.84–39.70) higher chance of relapse and carriers of the 829T/T genotype had a 14.0 (95% CI 1.13–172.63) higher chance of relapse. Other variables, such as age and leukocyte count, were associated (p<0.05) with the risk of relapse of the disease. Individuals with the G/G and T/T genotype of the -A317G and C829T polymorphisms had poorer survival compared to other genotype groups (log-rank test; p<0.05). Although preliminary, these data seem to suggest a role for the DHFR polymorphisms in the risk of relapse of ALL and the mortality risk in these patients. PMID:22969948

  3. Sucrose Synthase: Expanding Protein Function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sucrose synthase (SUS: EC, a key enzyme in plant sucrose catabolism, is uniquely able to mobilize sucrose into multiple pathways involved in metabolic, structural, and storage functions. Our research indicates that the biological function of SUS may extend beyond its catalytic activity. Th...

  4. 2,4-Diaminothieno[2,3-d]pyrimidine lipophilic antifolates as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.


    Rosowsky, A; Papoulis, A T; Queener, S F


    Ten previously unreported 2,4-diaminothieno[2,3-d]pyrimidine lipophilic dihydrofolate reductase inhibitors were synthesized as potential inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase. Pivaloylation of 2,4-diamino-5-methylthieno[2,3-d]pyrimidine followed by dibromination with N-bromosuccinimide in the presence of benzoyl peroxide gave 2,4-bis(pivaloylamino)-6-bromo-5-(bromomethyl)thieno[2,3-d]pyrimid ine, which after condensation with substituted anilines or N-methylanilines and deprotection with base yielded 2,4-diamino-6-bromo-5-[(substituted anilino)methyl]thieno[2,3-d]pyrimidines. Removal of the 6-bromo substituent was accomplished with sodium borohydride and palladium chloride. The reaction yields were generally good to excellent. The products were tested as inhibitors of dihydrofolate reductase (DHFR) from P. carinii, T. gondii, and rat liver. Although the IC50 could not be reached for the 6-unsubstituted compounds because of their extremely poor solubility, three of the five 6-bromo derivatives were soluble enough to allow the IC50 to be determined against all three enzymes. 2,4-Diamino-5-[3,5-dichloro-4-(1-pyrrolo)anilino]methyl]- 6-bromothieno[2,3-d]pyrimidine was the most active of the 6-bromo derivatives, with an IC50 of 7.5 microM against P. carinii DHFR, but showed no selectivity for either P. carinii or T. gondii DHFR relative to the enzyme from rat liver.

  5. The structure and competitive substrate inhibition of dihydrofolate reductase from Enterococcus faecalis reveal restrictions to cofactor docking.


    Bourne, Christina R; Wakeham, Nancy; Webb, Nicole; Nammalwar, Baskar; Bunce, Richard A; Berlin, K Darrell; Barrow, William W


    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMP(R) sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics.

  6. Cloning and characterization of a novel, plasmid-encoded trimethoprim-resistant dihydrofolate reductase from Staphylococcus haemolyticus MUR313.


    Dale, G E; Langen, H; Page, M G; Then, R L; Stüber, D


    In recent years resistance to the antibacterial agent trimethoprim (Tmp) has become more widespread, and several trimethoprim-resistant (Tmpr) dihydrofolate reductases (DHFRs) have been described from gram-negative bacteria. In staphylococci, only one Tmpr DHFR has been described, the type S1 DHFR, which is encoded by the dfrA gene found on transposon Tn4003. In order to investigate the coincidence of high-level Tmp resistance and the presence of dfrA, we analyzed the DNAs from various Tmpr staphylococci for the presence of dfrA sequences by PCR with primers specific for the thyE-dfrA genes from Tn4003. We found that 30 or 33 isolates highly resistant to Tmp (MICs, > or = 512 micrograms/ml) contained dfrA sequences, whereas among the Tmpr (MICs, < or = 256 micrograms/ml) and Tmps isolates only the Staphylococcus epidermidis isolates (both Tmpr and Tmps) seemed to contain the dfrA gene. Furthermore, we have cloned and characterized a novel, plasmid-encoded Tmpr DHFR from Staphylococcus haemolyticus MUR313. The dfrD gene of plasmid pABU17 is preceded by two putative Shine-Dalgarno sequences potentially allowing for the start of translation at two triplets separated by nine nucleotides. The predicted protein of 166 amino acids, designated S2DHFR, encoded by the longer open reading frame was overproduced in Escherichia coli, purified, and characterized. The molecular size of the recombinant S2DHFR was determined by ion spray mass spectrometry to be 19,821.2 +/- 2 Da, which is in agreement with the theoretical value of 19,822 Da. In addition, the recombinant S2DHFR was shown to exhibit DHFR activity and to be highly resistant to Tmp.

  7. Free energy force field (FEFF) 3D-QSAR analysis of a set of Plasmodium falciparum dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo A.; Mishra, Rama K.; Hopfinger, A. J.


    Free energy force field (FEFF) 3D-QSAR analysis was used to construct ligand-receptor binding models for a set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines. The molecular target (`receptor') used was a 3D-homology model of a specific mutant type of Plasmodium falciparum (Pf) dihydrofolate reductase (DHFR). The dependent variable of the 3D-QSAR models is the IC50 inhibition constant for the specific mutant type of PfDHFR. The independent variables of the 3D-QSAR models (the descriptors) are scaled energy terms of a modified first-generation AMBER force field combined with a hydration shell aqueous solvation model and a collection of 2D-QSAR descriptors often used in QSAR studies. Multiple temperature molecular dynamics simulation (MDS) and the genetic function approximation (GFA) were employed using partial least square (PLS) and multidimensional linear regressions as the fitting functions to develop FEFF 3D-QSAR models for the binding process. The significant FEFF energy terms in the best 3D-QSAR models include energy contributions of the direct ligand-receptor interaction. Some changes in conformational energy terms of the ligand due to binding to the enzyme are also found to be important descriptors. The FEFF 3D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the PfDHFR to current antimalarials. The FEFF 3D-QSAR models are also compared to receptor-independent (RI) 4D-QSAR models developed in an earlier study and subsequently refined using recently developed generalized alignment rules.

  8. Mapping and characterization of mutations induced by benzo[a]pyrene diol epoxide at dihydrofolate reductase locus in CHO cells.


    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A


    Chinese hamster ovary cells were mutagenized with benzo[a]pyrene diol epoxide (BPDE), an aromatic hydrocarbon carcinogen, and mutants at the dihydrofolate reductase (dhfr) locus were isolated. Of 15 mutants analyzed by Southern blotting, one contained a large deletion that spanned all six exons of the 25-kb dhfr gene; the remaining mutants exhibited no detectable changes. Three of these putative point mutations were localized by the loss of a restriction site: a SacI site in exon III, an MspI site in exon III, and a KpnI site in exon VI. The affected regions in two of these mutants were cloned and sequenced. The SacI- mutant was caused by a G:C----T:A transversion resulting in an amber termination codon. In the MspI- mutant, the deletion of a single C:G resulted in a frameshift and a downstream ochre termination codon. On the basis of overlapping restriction site sequences, the KpnI- mutant was deduced to be a splicing mutant involving the most 3' G in intron V. The location of these and the remaining 11 putative point mutations was sought using RNA heteroduplex mapping. Mismatched bases between riboprobes complementary to wild-type dhfr mRNA and mutant mRNA molecules were detected in 10 of the 14 mutants analyzed. These mutations mapped to four of the six exons or exon splice sites. Surprisingly, over half of these mutants exhibited greatly reduced (approximately 10-fold) steady-state levels of dhfr mRNA.

  9. Organization and genesis of dihydrofolate reductase amplicons in the genome of a methotrexate-resistant Chinese hamster ovary cell line.


    Ma, C; Looney, J E; Leu, T H; Hamlin, J L


    We have recently isolated overlapping recombinant cosmids that represent the equivalent of two complete dihydrofolate reductase (dhfr) amplicon types from the methotrexate-resistant Chinese hamster ovary (CHO) cell line CHOC 400. In the work described in this report, we used pulse-field gradient gel electrophoresis to analyze large SfiI restriction fragments arising from the amplified dhfr domains. The junction between the 260-kilobase type I amplicons (which are arranged in head-to-tail configurations in the genome) has been localized, allowing the construction of a linear map of the parental dhfr locus. We also show that the 220-kilobase type II amplicons are arranged as inverted repeat structures in the CHOC 400 genome and arose from the type I sequence relatively early in the amplification process. Our data indicate that there are a number of minor amplicon types in the CHOC 400 cell line that were not detected in previous studies; however, the type II amplicons represent ca. 75% of all the amplicons in the CHOC 400 genome. Both the type I and type II amplicons are shown to be composed entirely of sequences that were present in the parental dhfr locus. Studies of less resistant cell lines show that initial amplicons can be larger than those observed in CHOC 400. Once established, a given amplicon type appears to be relatively stable throughout subsequent amplification steps. We also present a modification of an in-gel renaturation method that gives a relatively complete picture of the size and variability of amplicons in the genome.

  10. Molecular epidemiology of malaria in Cameroon. XXII. Geographic mapping and distribution of Plasmodium falciparum dihydrofolate reductase (dhfr) mutant alleles.


    Tahar, Rachida; Basco, Leonardo K


    Sulfadoxine-pyrimethamine (SP) is still a useful drug to combat chloroquine-resistant Plasmodium falciparum malaria in Cameroon. Because of several disadvantages of the in vivo test and in vitro drug sensitivity assays, molecular assays are an alternative laboratory tool to monitor the evolution of antifolate resistance, especially over the entire country that is characterized by several epidemiologic strata and malaria transmission patterns. In this study, 1,430 blood samples from either symptomatic children or asymptomatic carriers were collected from 14 sites throughout the country between 1999 and 2003 for the analysis of dihydrofolate reductase (dhfr) sequence. Of 1,368 samples (95.7%) that were successfully amplified, 1,180 were analyzed by direct sequencing of the polymerase chain reaction product, and 188 were analyzed by restriction enzymes. The prevalences of the wild-type, single Asn-108 mutation, double Arg-59/Asn-108 mutations, double Ile-51/Asn-108 mutations, triple Ile-51/Arg-59/Asn-108 mutations, and mixed alleles were 20.8%, 2.8%, 5.7%, 0.8%, 62.2%, and 7.6%, respectively. The proportions of triple dhfr mutations were > 60% at all study sites, with the exception of the eastern province (42% triple mutants in Bertoua in 1999) and the northern provinces (11-35% triple mutants in Ngaoundere, Garoua, and Maroua). In these two provinces, the proportion of mutant parasites increased significantly (P < 0.05) over the period of 2-4 years. Furthermore, there was a higher proportion (P < 0.05) of wild-type parasites in the northern provinces, compared with the rest of the country. The geographic mapping of molecular markers offers a novel tool for monitoring the epidemiology of drug-resistant malaria.

  11. The Structure and Competitive Substrate Inhibition of Dihydrofolate Reductase from Enterococcus faecalis Reveal Restrictions to Cofactor Docking

    PubMed Central


    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMPR sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics. PMID:24495113

  12. Construction of a modular dihydrofolate reductase cDNA gene: Analysis of signals utilized for efficient expression

    SciTech Connect

    Kaufman, J.; Sharp, P.A.


    Dihydrofolate reductase (DHFR) modular genes have been constructed with segments containing the adenovirus major late promoter, a 3' splice site from a variable region immunoglobulin gene, a DHFR cDNA, and portions of the simian virus 40 (SV40) genome, DNA-mediated transfer of these genes transformed Chinese hamster ovary DHFR/sup -/ cells to the DHFR/sup +/ phenotype. Transformants contained one to several copies of the transfected DNA integrated into the host genome. Clones subjected to growth in increasing concentrations of methotrexate eventually gave rise to lines containing several hundred copies of the transforming DNA. Analysis of the DHFr mRNA produced in amplified lines indicated the following: (i) All clones utilize the adenovirus major late promoter for transcription initiation. (ii) A hybrid intron formed by the 5' splice site of the adenovirus major late leader and a 3' splice site from a variable-region immunoglobulin gene is properly excised. (iii) The mRNA is not efficiently polyadenylated at sequences in the 3' end of the DHFR cDNA but rather uses polyadenylation signals downstream from the DHFR cDNA. Three independent clones produce a DHFR mRNA containing SV40 or pBR322 and SV40 sequences, and the RNA is polyadenylated at the SV40 late polyadenylation site. Another clone has recombined into cellular DNA and apparently uses a cellular sequence for polyadenylation. Introduction of a segment containing the SV40 early polyadenylation signal into the 3' end of the DHFR cDNA generated a recombinant capable of transforming cells to the DHFR/sup +/ phenotype with at least a 10-fold increase in efficiency, demonstrating the necessity for an efficient polyadenylation signal. Attachment of a DNA segment containing the transcription enhancer 72-base pair repeat) of SV40 further increased the biological activity of the modular DHFR gene 50- to 100-fold.

  13. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line

    SciTech Connect

    Foreman, P.K.; Hamlin, J.L. . School of Medicine)


    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, the authors have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Their initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from DHFr domain shows that 2BE2121 is encoded by a gene --34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon injection. The 3' end of the 2BE2121 gene lies --75 kb downstream from the DHFR gene and --25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork.

  14. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line.

    PubMed Central

    Foreman, P K; Hamlin, J L


    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, we have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Our initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from the DHFR domain shows that 2BE2121 is encoded by a gene approximately 34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon junction. The 3' end of the 2BE2121 gene lies approximately 75 kb downstream from the DHFR gene and approximately 25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork. Images PMID:2725490

  15. Incorporation of β-amino acids into dihydrofolate reductase by ribosomes having modifications in the peptidyltransferase center.


    Maini, Rumit; Nguyen, Dan T; Chen, Shengxi; Dedkova, Larisa M; Chowdhury, Sandipan Roy; Alcala-Torano, Rafael; Hecht, Sidney M


    Ribosomes containing modifications in three regions of 23S rRNA, all of which are in proximity to the ribosomal peptidyltransferase center (PTC), were utilized previously as a source of S-30 preparations for in vitro protein biosynthesis experiments. When utilized in the presence of mRNAs containing UAG codons at predetermined positions+β-alanyl-tRNA(CUA), the modified ribosomes produced enhanced levels of full length proteins via UAG codon suppression. In the present study, these earlier results have been extended by the use of substituted β-amino acids, and direct evidence for β-amino acid incorporation is provided. Presently, five of the clones having modified ribosomes are used in experiments employing four substituted β-amino acids, including α-methyl-β-alanine, β,β-dimethyl-β-alanine, β-phenylalanine, and β-(p-bromophenyl)alanine. The β-amino acids were incorporated into three different positions (10, 18 and 49) of Escherichia coli dihydrofolate reductase (DHFR) and their efficiencies of suppression of the UAG codons were compared with those of β-alanine and representative α-l-amino acids. The isolated proteins containing the modified β-amino acids were subjected to proteolytic digestion, and the derived fragments were characterized by mass spectrometry, establishing that the β-amino acids had been incorporated into DHFR, and that they were present exclusively in the anticipated peptide fragments. DHFR contains glutamic acid in position 17, and it has been shown previously that Glu-C endoproteinase can hydrolyze DHFR between amino acids residues 17 and 18. The incorporation of β,β-dimethyl-β-alanine into position 18 of DHFR prevented this cleavage, providing further evidence for the position of incorporation of the β-amino acid.

  16. Increased thymidylate synthase in L1210 cells possessing acquired resistance to N10-propargyl-5,8-dideazafolic acid (CB3717): development, characterization, and cross-resistance studies

    SciTech Connect

    Jackman, A.L.; Alison, D.L.; Calvert, A.H.; Harrap, K.R.


    The properties are described of a mutant L1210 cell line (L1210:C15) with acquired resistance (greater than 200-fold) to the thymidylate synthase (TS) inhibitor N10-propargyl-5,8-dideazafolic acid. TS was overproduced 45-fold and was accompanied by a small increase in the activity of dihydrofolate reductase (2.6-fold). Both the level of resistance and enzyme activities were maintained in drug-free medium (greater than 300 generations). Failure of N10-propargyl-5,8-dideazafolic acid to suppress the (/sup 3/H)-2'-deoxyuridine incorporation into the acid-precipitable material of the resistant line supported the evidence that TS overproduction was the mechanism of resistance; consequently the L1210:C15 cells were largely cross-resistant to another (but weaker) TS inhibitor, 5,8-dideazafolic acid. Minimal cross-resistance was observed to the dihydrofolate reductase inhibitors methotrexate and 5-methyl-5,8-dideazaaminopterin (5- and 2-fold, respectively). L1210 and L1210:C15 cells were, however, equally sensitive to 5-fluorodeoxyuridine (FdUrd), an unexpected finding since a metabolite, 5-fluorodeoxyuridine monophosphate, is a potent TS inhibitor; however, this cytotoxicity against the L1210:C15 cells was antagonized by coincubation with 5 microM folinic acid although folinic acid potentiated the cytotoxicity of FdUrd to the N10-propargyl-5,8-dideazafolic acid-sensitive L1210 line. Thymidine was much less effective as a FdUrd protecting agent in the L1210:C15 when compared with the L1210 cells; however, a combination of thymidine plus hypoxanthine was without any additional effect (compared with thymidine alone) against the sensitive line but effectively protected L1210:C15 cells.

  17. SIRT3 Deacetylates Ceramide Synthases

    PubMed Central

    Novgorodov, Sergei A.; Riley, Christopher L.; Keffler, Jarryd A.; Yu, Jin; Kindy, Mark S.; Macklin, Wendy B.; Lombard, David B.; Gudz, Tatyana I.


    Experimental evidence supports the role of mitochondrial ceramide accumulation as a cause of mitochondrial dysfunction and brain injury after stroke. Herein, we report that SIRT3 regulates mitochondrial ceramide biosynthesis via deacetylation of ceramide synthase (CerS) 1, 2, and 6. Reciprocal immunoprecipitation experiments revealed that CerS1, CerS2, and CerS6, but not CerS4, are associated with SIRT3 in cerebral mitochondria. Furthermore, CerS1, -2, and -6 are hyperacetylated in the mitochondria of SIRT3-null mice, and SIRT3 directly deacetylates the ceramide synthases in a NAD+-dependent manner that increases enzyme activity. Investigation of the SIRT3 role in mitochondrial response to brain ischemia/reperfusion (IR) showed that SIRT3-mediated deacetylation of ceramide synthases increased enzyme activity and ceramide accumulation after IR. Functional studies demonstrated that absence of SIRT3 rescued the IR-induced blockade of the electron transport chain at the level of complex III, attenuated mitochondrial outer membrane permeabilization, and decreased reactive oxygen species generation and protein carbonyls in mitochondria. Importantly, Sirt3 gene ablation reduced the brain injury after IR. These data support the hypothesis that IR triggers SIRT3-dependent deacetylation of ceramide synthases and the elevation of ceramide, which could inhibit complex III, leading to increased reactive oxygen species generation and brain injury. The results of these studies highlight a novel mechanism of SIRT3 involvement in modulating mitochondrial ceramide biosynthesis and suggest an important role of SIRT3 in mitochondrial dysfunction and brain injury after experimental stroke. PMID:26620563

  18. Photoaffinity analogues of methotrexate as folate antagonist binding probes. 1. Photoaffinity labeling of murine L1210 dihydrofolate reductase and amino acid sequence of the binding region

    SciTech Connect

    Price, E.M.; Smith, P.L.; Klein, T.E.; Freisheim, J.H.


    N/sup ..cap alpha../-(4-Amino-4-deoxy-10-methylpteroyl)-N/sup epsilon/-(4-azido-5-(/sup 125/I)iodosalicylyl)-L-lysine, a photoaffinity analogue of methotrexate, is only 2-fold less potent than methotrexate in the inhibition of murine L1210 dihydrofolate reductase. Irradiation of the enzyme in the presence of an equimolar concentration of the /sup 125/I-labeled analogue ultimately leads to an 8% incorporation of the photoprobe. A 100-fold molar excess of methotrexate essentially blocks this incorporation. Cyanogen bromide digestion of the labeled enzyme, followed by high-pressure liquid chromatography purification of the generated peptides, indicates that greater than 85% of the total radioactivity is incorporated into a single cyanogen bromide peptide. Sequence analysis revealed this peptide to be residues 53-111, with a majority of the radioactivity centered around residues 63-65 (Lys-Asn-Arg). These data demonstrate that the photoaffinity analogue specifically binds to dihydrofolate reductase and covalently modifies the enzyme following irradiation and is therefore a photolabeling agent useful for probing the inhibitor binding domain of the enzyme.

  19. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    PubMed Central

    Pyne, C; Bognar, A L


    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products. Images PMID:1548226

  20. Partial sup 1 H NMR assignments of the Escherichia coli dihydrofolate reductase complex with folate: Evidence for a unique conformation of bound folate

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )


    Sequence-specific {sup 1}H assignments have been made for over 25% of the amino acid side chains of Escherichia coli dihydrofolate reductase complexed with folate by using a variety of two-dimensional techniques. Proton resonances were assigned by using a combination of site-directed mutagenesis and a knowledge of the X-ray crystal structure. Unique sets of NOE connectivities present in hydrophobic pockets were matched with the X-ray structure and used to assign many of the residues. Other residues, particularly those near or in the active site, were assigned by site-directed mutagenesis. The ability to assign unambiguosly the proton resonances of these catalytically important residues allowed for extensive networks of NOE connectivities to follow from these assignments. As a consequence of these assignments, the orientation of the pterin ring of folate could be determined, and its conformation is similar to that of the productive dihydrofolate complex. Under these experimental conditions, only one bound form of the pterin ring could be detected.

  1. Genistein ameliorated endothelial nitric oxidase synthase uncoupling by stimulating sirtuin-1 pathway in ox-LDL-injured HUVECs.


    Zhang, Hua-ping; Zhao, Jia-hui; Yu, Hai-xia; Guo, Dong-xing


    Endothelial nitric oxidase synthase (eNOS) uncoupling plays a causal role in endothelial dysfunction in atherosclerosis. Genistein consumption has been associated with the prevention of atherosclerosis. However, the effect of genistein on eNOS uncoupling has not been reported. A model of oxidized low-density lipoprotein (ox-LDL)-induced injury on human umbilical vein endothelial cells (HUVECs) was established to evaluate the effect of genistein on eNOS uncoupling. We investigated the effect of genistein on NADPH oxidase-dependent superoxide production, NOX4 expression, BH4 synthesis and oxidation, the expression of GTP cyclohydrolase 1 (GCH1) and dihydrofolate reductase (DHFR). The results showed that genistein decreased superoxide production and NOX4 expression, enhanced the ratio of BH4/BH2, augmented the expressions of GCH1 and DHFR. Accompanied with genistein ameliorating eNOS uncoupling, genistein elevated the expression of sirtuin-1; furthermore, the effects of genistein on eNOS uncoupling were blunted with sirtuin-1 siRNA. The present study indicated that genistein ameliorated eNOS uncoupling was concerned with sirtuin-1 pathway in ox-LDL-injured HUVECs.

  2. Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.


    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A


    Point mutants induced with a variety of mutagens at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary (CHO) cells were screened for aberrantly spliced dhfr mRNA by RNase protection and/or reverse transcriptase coupled with cDNA amplification by the polymerase chain reaction (PCR). Of 115 mutants screened, 28 were found to be affected in splicing. All exhibited less than 1% correct splicing, probably because the selection procedure was stringent. All 26 unique mutations were located within the consensus splice sequences; changes were found at 9 of 10 possible sites in this 25-kb six-exon gene. Mutations at the sites flanking the first and last exons resulted in the efficient recruitment of a cryptic site within each exon. In contrast, mutations bordering internal exons caused predominantly exon skipping. In many cases, multiple exons were skipped, suggesting the clustering of adjacent exons prior to actual splicing. Six mutations fell outside the well-conserved GU and AG dinucleotides. All but one were donor site single-base substitutions that decreased the agreement with the consensus and resulted in little or no correct splicing. Starting with five of these donor site mutants, we isolated 31 DHFR+ revertants. Most revertants carried a single-base substitution at a site other than that of the original mutation, and most had only partially regained the ability to splice correctly. The second-site suppression occurred through a variety of mechanisms: (i) a second change within the consensus sequence that produced a better agreement with the consensus; (ii) a change close to but beyond the consensus boundaries, as far as 8 bases upstream in the exon or 28 bases downstream in the intron; (iii) mutations in an apparent pseudo 5' site in the intron, 84 and 88 bases downstream of a donor site; and (iv) mutations that improved the upstream acceptor site of the affected exon. Taken together, these second-site suppressor mutations extend the definition of a

  3. Acetohydroxyacid synthases: evolution, structure, and function.


    Liu, Yadi; Li, Yanyan; Wang, Xiaoyuan


    Acetohydroxyacid synthase, a thiamine diphosphate-dependent enzyme, can condense either two pyruvate molecules to form acetolactate for synthesizing L-valine and L-leucine or pyruvate with 2-ketobutyrate to form acetohydroxybutyrate for synthesizing L-isoleucine. Because the key reaction catalyzed by acetohydroxyacid synthase in the biosynthetic pathways of branched-chain amino acids exists in plants, fungi, archaea, and bacteria, but not in animals, acetohydroxyacid synthase becomes a potential target for developing novel herbicides and antimicrobial compounds. In this article, the evolution, structure, and catalytic mechanism of acetohydroxyacid synthase are summarized.

  4. Folic Acid Promotes Recycling of Tetrahydrobiopterin and Protects Against Hypoxia-Induced Pulmonary Hypertension by Recoupling Endothelial Nitric Oxide Synthase

    PubMed Central

    Chalupsky, Karel; Kračun, Damir; Kanchev, Ivan; Bertram, Katharina


    Abstract Aims: Nitric oxide (NO) derived from endothelial NO synthase (eNOS) has been implicated in the adaptive response to hypoxia. An imbalance between 5,6,7,8-tetrahydrobiopterin (BH4) and 7,8-dihydrobiopterin (BH2) can result in eNOS uncoupling and the generation of superoxide instead of NO. Dihydrofolate reductase (DHFR) can recycle BH2 to BH4, leading to eNOS recoupling. However, the role of DHFR and eNOS recoupling in the response to hypoxia is not well understood. We hypothesized that increasing the capacity to recycle BH4 from BH2 would improve NO bioavailability as well as pulmonary vascular remodeling (PVR) and right ventricular hypertrophy (RVH) as indicators of pulmonary hypertension (PH) under hypoxic conditions. Results: In human pulmonary artery endothelial cells and murine pulmonary arteries exposed to hypoxia, eNOS was uncoupled as indicated by reduced superoxide production in the presence of the nitric oxide synthase inhibitor, L-(G)-nitro-L-arginine methyl ester (L-NAME). Concomitantly, NO levels, BH4 availability, and expression of DHFR were diminished under hypoxia. Application of folic acid (FA) restored DHFR levels, NO bioavailability, and BH4 levels under hypoxia. Importantly, FA prevented the development of hypoxia-induced PVR, right ventricular pressure increase, and RVH. Innovation: FA-induced upregulation of DHFR recouples eNOS under hypoxia by improving BH4 recycling, thus preventing hypoxia-induced PH. Conclusion: FA might serve as a novel therapeutic option combating PH. Antioxid. Redox Signal. 23, 1076–1091. PMID:26414244

  5. Producing biofuels using polyketide synthases


    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D


    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  6. Polyester synthases: natural catalysts for plastics.

    PubMed Central

    Rehm, Bernd H A


    Polyhydroxyalkanoates (PHAs) are biopolyesters composed of hydroxy fatty acids, which represent a complex class of storage polyesters. They are synthesized by a wide range of different Gram-positive and Gram-negative bacteria, as well as by some Archaea, and are deposited as insoluble cytoplasmic inclusions. Polyester synthases are the key enzymes of polyester biosynthesis and catalyse the conversion of (R)-hydroxyacyl-CoA thioesters to polyesters with the concomitant release of CoA. These soluble enzymes turn into amphipathic enzymes upon covalent catalysis of polyester-chain formation. A self-assembly process is initiated resulting in the formation of insoluble cytoplasmic inclusions with a phospholipid monolayer and covalently attached polyester synthases at the surface. Surface-attached polyester synthases show a marked increase in enzyme activity. These polyester synthases have only recently been biochemically characterized. An overview of these recent findings is provided. At present, 59 polyester synthase structural genes from 45 different bacteria have been cloned and the nucleotide sequences have been obtained. The multiple alignment of the primary structures of these polyester synthases show an overall identity of 8-96% with only eight strictly conserved amino acid residues. Polyester synthases can been assigned to four classes based on their substrate specificity and subunit composition. The current knowledge on the organization of the polyester synthase genes, and other genes encoding proteins related to PHA metabolism, is compiled. In addition, the primary structures of the 59 PHA synthases are aligned and analysed with respect to highly conserved amino acids, and biochemical features of polyester synthases are described. The proposed catalytic mechanism based on similarities to alpha/beta-hydrolases and mutational analysis is discussed. Different threading algorithms suggest that polyester synthases belong to the alpha/beta-hydrolase superfamily, with

  7. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.


    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong


    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  8. 2,4-Diamino-6,7-dihydro-5H-cyclopenta[d]pyrimidine analogues of trimethoprim as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.


    Rosowsky, A; Papoulis, A T; Queener, S F


    Three previously unreported (R,S)-2,4-diamino-5-[(3,4,5-trimethoxyphenyl) alkyl]-6,7-dihydro-5H-cyclopenta[d]pyrimidines 15a-c were synthesized as analogues of trimethoprim (TMP) and were tested as inhibitors of Pneumocystis carinii, Toxoplasma gondii, and rat liver dihydrofolate reductase (DHFR). The length of the alkyl bridge between the cyclopenta[d]pyrimidine and trimethoxyphenyl moiety ranged from one in 15a to three carbons in 15c. The products were tested as competitive inhibitors of the reduction of dihydrofolate by Pneumocystis carinii, Toxoplasma gondii, and rat liver DHFR. Compounds 15a-c had IC50 values of > 32, 1.8 and 1.3 microM, respectively, against P. carinii DHFR, as compared to 12 microM for TMP. Against the T. gondii enzyme, 15a-c had IC50 values of 21, 0.14 and 0.14 microM, respectively, as compared to 2.7 microM for TMP. Inhibitors 15b and 15c with two- and three-carbon bridges were significantly more potent than 15a against all three enzymes. Unlike TMP, 15b and 15c were better inhibitors of the rat liver enzyme than of the microbial enzymes. The potency of 15b and 15c against rat liver DHFR was less than has been reported for the corresponding 6,7-dihydro-5H-cyclopenta[d]pyrimidines with a classical p-aminobenzoyl-L-glutamate side chain as inhibitors of bovine, murine, and human DHFR.

  9. Kinetics of the inhibition of bovine liver dihydrofolate reductase by tea catechins: origin of slow-binding inhibition and pH studies.


    Navarro-Perán, Enma; Cabezas-Herrera, Juan; Hiner, Alexander N P; Sadunishvili, Tinatin; García-Cánovas, Francisco; Rodríguez-López, José Neptuno


    Dihydrofolate reductase (DHFR) is the subject of intensive investigation since it appears to be the primary target enzyme for "antifolate" drugs, such as methotrexate and trimethoprim. Fluorescence quenching and stopped-flow fluorimetry show that the ester bond-containing tea polyphenols (-)-epigallocatechin gallate (EGCG) and (-)-epicatechin gallate (ECG) are potent and specific inhibitors of DHFR with inhibition constants (K(I)) of 120 and 82 nM, respectively. Both tea compounds showed the characteristics of slow-binding inhibitors of bovine liver DHFR. In this work, we have determined a complete kinetic scheme to explain the slow-binding inhibition and the pH effects observed during the inhibition of bovine liver DHFR by these tea polyphenols. Experimental data, based on fluorimetric titrations, and transient phase and steady-state kinetic studies confirm that EGCG and ECG are competitive inhibitors with respect to 7,8-dihydrofolate, which bind preferentially to the free form of the enzyme. The origin of their slow-binding inhibition is proposed to be the formation of a slow dissociation ternary complex by the reaction of NADPH with the enzyme-inhibitor complex. The pH controls both the ionization of critical catalytic residues of the enzyme and the protonation state of the inhibitors. At acidic pH, EGCG and ECG are mainly present as protonated species, whereas near neutrality, they evolve toward deprotonated species due to ionization of the ester-bonded gallate moiety (pK = 7.8). Although DHFR exhibits different affinities for the protonated and deprotonated forms of EGCG and ECG, it appears that the ionization state of Glu-30 in DHFR is critical for its inhibition. The physiological implications of these pH dependencies are also discussed.

  10. Momentum Distribution as a Fingerprint of Quantum Delocalization in Enzymatic Reactions: Open-Chain Path-Integral Simulations of Model Systems and the Hydride Transfer in Dihydrofolate Reductase.


    Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas


    The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.

  11. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat


    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  12. Crystal structure of riboflavin synthase

    SciTech Connect

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B.


    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  13. Genetics Home Reference: GM3 synthase deficiency


    ... GM3 synthase deficiency is characterized by recurrent seizures (epilepsy) and problems with brain development. Within the first ... Testing (1 link) Genetic Testing Registry: Amish infantile epilepsy syndrome Other Diagnosis and Management Resources (2 links) ...

  14. Chitin synthase inhibitors as antifungal agents.


    Chaudhary, Preeti M; Tupe, Santosh G; Deshpande, Mukund V


    Increased risk of fungal diseases in immunocompromised patients, emerging fungal pathogens, limited repertoire of antifungal drugs and resistance development against the drugs demands for development of new and effective antifungal agents. With greater knowledge of fungal metabolism efforts are being made to inhibit specific enzymes involved in different biochemical pathways for the development of antifungal drugs. Chitin synthase is one such promising target as it is absent in plants and mammals. Nikkomycin Z, a chitin synthase inhibitor is under clinical development. Chitin synthesis in fungi, chitin synthase as a target for antifungal agent development, different chitin synthase inhibitors isolated from natural sources, randomly synthesized and modified from nikkomycin and polyoxin are discussed in this review.

  15. Terpene synthases from Cannabis sativa

    PubMed Central

    Booth, Judith K.; Page, Jonathan E.


    Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety ‘Finola’ revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of ‘Finola’ resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties. PMID:28355238

  16. Inhibitors of specific ceramide synthases.


    Schiffmann, Susanne; Hartmann, Daniela; Fuchs, Sina; Birod, Kerstin; Ferreiròs, Nerea; Schreiber, Yannick; Zivkovic, Aleksandra; Geisslinger, Gerd; Grösch, Sabine; Stark, Holger


    Ceramide synthases (CerSs) are key enzymes in the biosynthesis of ceramides and display a group of at least six different isoenzymes (CerS1-6). Ceramides itself are bioactive molecules. Ceramides with different N-acyl side chains (C(14:0)-Cer - C(26:0)-Cer) possess distinct roles in cell signaling. Therefore, the selective inhibition of specific CerSs which are responsible for the formation of a specific ceramide holds promise for a number of new clinical treatment strategies, e.g., cancer. Here, we identified four of hitherto unknown functional inhibitors of CerSs derived from the FTY720 (Fingolimod) lead structure and showed their inhibitory effectiveness by two in vitro CerS activity assays. Additionally, we tested the substances in two cell lines (HCT-116 and HeLa) with different ceramide patterns. In summary, the in vitro activity assays revealed out that ST1058 and ST1074 preferentially inhibit CerS2 and CerS4, while ST1072 inhibits most potently CerS4 and CerS6. Importantly, ST1060 inhibits predominately CerS2. First structure-activity relationships and the potential biological impact of these compounds are discussed.

  17. Malate synthase a membrane protein

    SciTech Connect

    Chapman, K.D.; Turley, R.B.; Hermerath, C.A.; Carrapico, F.; Trelease, R.N.


    Malate synthase (MS) is generally regarded as a peripheral membrane protein, and believed by some to be ontogenetically associated with ER. However, immuno- and cyto-chemical in situ localizations show MS throughout the matrix of cotton (and cucumber) glyoxysomes, not specifically near their boundary membranes, nor in ER. Only a maximum of 50% MS can be solubilized from cotton glyoxysomes with 1% Triton X-100, 2mM Zwittergen 14, or 10mM DOC +/- salts. Cotton MS does not incorporate /sup 3/H-glucosamine in vivo, nor does it react with Con A on columns or blots. Cotton MS banded with ER in sucrose gradients (20-40%) in Tricine after 3h, but not after 22h in Tricine or Hepes, or after 3h in Hepes or K-phosphate. Collectively the authors data are inconsistent with physiologically meaningful MS-membrane associations in ER or glyoxysomes. It appears that experimentally-induced aggregates of MS migrate in ER gradients and occur in isolated glyoxysomes. These data indicate that ER is not involved in synthesis or modification of cottonseed MS prior to its import into the glyoxysomal matrix.

  18. Dihydrofolate Reductase Deficiency Due to a Homozygous DHFR Mutation Causes Megaloblastic Anemia and Cerebral Folate Deficiency Leading to Severe Neurologic Disease

    PubMed Central

    Cario, Holger; Smith, Desirée E.C.; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus


    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. PMID:21310277

  19. Short hairpin RNA targeted to dihydrofolate reductase enhances the immunoglobulin G expression in gene-amplified stable Chinese hamster ovary cells.


    Wu, Suh-Chin; Hong, Willy W L; Liu, Jin-Hwang


    The dihydrofolate reductase (dhfr)/methotrexate (MTX) selection is a common method to conduct gene amplification in stable clones of Chinese hamster ovary (CHO) cells. We previously reported the use of a short hairpin RNA (shRNA) vector targeted to the dhfr gene resulted in improving the intracellular antigen expression in gene-amplified stable CHO cells [Hong, W.W., Wu, S.C., 2007. A novel RNA silencing vector to improve antigen expression and stability in Chinese hamster ovary cells. Vaccine 25 (20), 4103-4111]. Here we investigated the use of the dhfr-targeted shRNA vector for immunoglobulin G (IgG) expression in gene-amplified stable CHO cells. With the use of the dhfr-targeted shRNA vector, the gene-amplified CHO/dhFr(-) cells were found to increase IgG expression at 1.0 microM MTX by more than 100% and to improve the genomic stability of IgG expression in MTX-free cultures by approximately 30%. The use of the dhfr-targeted shRNA vector can enhance the IgG expression in the gene-amplified stable CHO cells and uphold the IgG expression in MTX-free cultures. Utilizing the dhfr-targeted shRNA vector may provide an alternative way to maneuver CHO cell factories for IgG production in cultures.

  20. Increased incidence of cycloguanil resistance in malaria cases entering France from Africa, determined as point mutations in the parasites' dihydrofolate-reductase genes.


    Durand, R; di Piazza, J P; Longuet, C; Sécardin, Y; Clain, J; le Bras, J


    The incidence of cycloguanil resistance in 501 Plasmodium falciparum isolates from individuals entering France from Africa was estimated by a method based on PCR-restriction-fragment-length polymorphisms. None of the subjects had taken antifol prophylaxis. Annual incidence of the resistance, detected as a point mutation at codon 108 in the parasite's dihydrofolate-reductase gene, increased from 19.8% in 1995 to 43.6% in 1997 (P < 0.001). The proportion of isolates found to be susceptible (i.e. wild-type) among travellers returning from the African countries known as Group 2 in France (i.e. Burkina Faso, Côte d'Ivoire, Gambia, Ghana, Guinea, Liberia, Madagascar, Mali, Mauritania, Niger, Senegal, Sierra Leone, Tchad and Togo) was reasonably high (62.9%) and much higher than in the other subjects returning from other identifiable countries in Africa (35.3%). The antimalarial prophylaxis recommended in France to those travelling to Group-2 countries, chloroquine-proguanil, therefore still seems reasonable, although cycloguanil resistance may seriously undermine the efficacy of this drug combination in the future.

  1. Study of reactivity of cyanoacetohydrazonoethyl-N-ethyl-N-methyl benzenesulfonamide: preparation of novel anticancer and antimicrobial active heterocyclic benzenesulfonamide derivatives and their molecular docking against dihydrofolate reductase.


    Debbabi, Khaled F; Al-Harbi, Sami A; Al-Saidi, Hamed M; Aljuhani, Enas H; Abd El-Gilil, Shimaa M; Bashandy, Mahmoud S


    This article describes the synthesis of some novel heterocyclic sulfonamides having biologically active thiophene 3, 4, 5, 6, coumarin 8, benzocoumarin 9, thiazole 7, piperidine 10, pyrrolidine 11, pyrazole 14 and pyridine 12, 13. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. The structures of the newly synthesized compounds were confirmed by elemental analysis, IR, (1)H NMR, (13)C NMR, (19)F NMR and MS spectral data. All the newly synthesized heterocyclic sulfonamides were evaluated as in-vitro anti-breast cancer cell line (MCF7) and as in-vitro antimicrobial agents. Compounds 8, 5 and 11 were more active than MTX reference drug and compounds 12, 7, 4, 14, 5 and 8 were highly potent against Klebsiella pneumonia. Molecular operating environment performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some prepared compounds are suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDBSD:4DFR) with further modification.

  2. A search for sources of drug resistance by the 4D-QSAR analysis of a set of antimalarial dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo Andrade; Hopfinger, Anton J.


    A set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines were studied using four-dimensional quantitative structure-activity relationship (4D-QSAR) analysis. The corresponding biological activities of these compounds include IC50 inhibition constants for both the wild type, and a specific mutant type of Plasmodium falciparum dihydrofolate reductase (DHFR). Two thousand conformations of each analog were sampled to generate a conformational ensemble profile (CEP) from a molecular dynamics simulation (MDS) of 100,000 conformer trajectory states. Each sampled conformation was placed in a 1 Å cubic grid cell lattice for each of five trial alignments. The frequency of occupation of each grid cell was computed for each of six types of pharmacophore groups of atoms of each compound. These grid cell occupancy descriptors (GCODs) were then used as a descriptor pool to construct 4D-QSAR models. Models for inhibition of both the `wild' type and the mutant enzyme were generated which provide detailed spatial pharmacophore requirements for inhibition in terms of atom types and their corresponding relative locations in space. The 4D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the Plasmodium falciparum DHFR to current antimalarials. One feature identified is a slightly different binding alignment of the ligands to the mutant form of the enzyme as compared to the wild type.

  3. Orientation and structure-building role of the water molecules bound at the contact surface of the dihydrofolate reductase-methotrexate complex

    NASA Astrophysics Data System (ADS)

    Nagy, P.


    Orientation of ten water molecules bound strongly at the contact surface of the dihydrofolate reductase-methotrexate enzyme-inhibitor complex was determined theoretically. To optimize the orientation of the water molecules, a recent method based on a simple electrostatic model was applied. The electrostatic complementarity in the binary complex was investigated using the lock-and-key model, considering the effect of the water molecules as well. The strongly bound water molecules improve the electrostatic fit in the pteridine region of methotrexate. Their role in the benzoic amide and γ-glutamate region is to decrease the internal energy by creating water bridges among remote polar sites making it possible to form H-bonds. Some modifications in the inhibitor structure were proposed for achieving greater inhibitor potency. The presumably enhanced effect is ascribed to the free energy gain in repelling the water molecules from the contact surface to the bulk of the solvent, and, in other cases, to internal energy decreases due to better electrostatic fit in the enzyme-inhibitor complex.

  4. The Chinese hamster dihydrofolate reductase replication origin decision point follows activation of transcription and suppresses initiation of replication within transcription units.


    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S; Gilbert, David M


    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP.

  5. Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.


    Anachkova, B; Hamlin, J L


    To study initiation of DNA replication in mammalian chromosomes, we have established a methotrexate-resistant Chinese hamster ovary cell line (CHOC 400) that contains approximately 1,000 copies of the early replicating dihydrofolate reductase (DHFR) domain. We have previously shown that DNA replication in the prevalent 243-kilobase (kb) amplicon type in this cell line initiates somewhere within a 28-kb region located downstream from the DHFR gene. In an attempt to localize the origin of replication with more precision, we blocked the progress of replication forks emanating from origins at the beginning of the S phase by the introduction of trioxsalen cross-links at 1- to 5-kb intervals in the parental double-stranded DNA. The small DNA fragments synthesized under these conditions (which should be centered around replication origins) were then used as hybridization probes on digests of cosmids and plasmids from the DHFR domain. These studies suggested that in cells synchronized by this regimen, DNA replication initiates at two separate sites within the previously defined 28-kb replication initiation locus, in general agreement with results described in the accompanying paper (T.-H. Leu and J. L. Hamlin, Mol. Cell. Biol. 9:523-531, 1989). One of these sites contains a repeated DNA sequence element that is found at or near many other initiation sites in the genome, since it was also highly enriched in the early replicating DNA isolated from cross-linked CHO cells that contain only two copies of the DHFR domain.

  6. The Chinese Hamster Dihydrofolate Reductase Replication Origin Decision Point Follows Activation of Transcription and Suppresses Initiation of Replication within Transcription Units

    PubMed Central

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S.; Gilbert, David M.


    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP. PMID:16428457

  7. Molecular epidemiology of malaria in Cameroon. XI. Geographic distribution of Plasmodium falciparum isolates with dihydrofolate reductase gene mutations in southern and central Cameroon.


    Basco, Leonardo K; Ndounga, Mathieu; Tejiokem, Mathurin; Ngane, Vincent Foumane; Youmba, Jean-Christian; Ringwald, Pascal; Soula, Georges


    The DNA sequence of the dihydrofolate reductase (dhfr) gene, a molecular marker for pyrimethamine resistance, was determined for 178 field isolates of Plasmodium falciparum collected along the east-west axis in southern Cameroon. The proportion of isolates having the wild-type dhfr allele varied from 48.1% in the east (city of Bertoua) to 11.3-15.7% in central provinces (Yaounde and Eseka) and 0% in the littoral region (port city of Douala). Isolates with a single Asn-108 mutation or double mutations (Ile-51 or Arg-59 and Asn-108) constituted approximately 10% of the samples. Isolates with triple mutations (Ile-51, Arg-59, and Asn-108) were present in an equal proportion (48.1%) as the wild-type isolates in the east (Bertoua), while triple mutations predominated in Yaounde (62.3%), Eseka (62.7%), and Douala (78.9%). The distribution of triple dhfr mutations along the east-west axis in southern Cameroon suggests the presence of a decreasing gradient from the west coastal region to the central region and then to the east towards the interior of the country.

  8. Towards understanding the origins of the different specificities of binding the reduced (NADPH) and oxidised (NADP +) forms of nicotinamide adenine dinucleotide phosphate coenzyme to dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Polshakov, Vladimir I.; Biekofsky, Rodolfo R.; Birdsall, Berry; Feeney, James


    Lactobacillus casei dihydrofolate reductase (DHFR) binds more than a thousand times tighter to NADPH than to NADP +. The origins of the difference in binding affinity to DHFR between NADPH and NADP + are investigated in the present study using experimental NMR data and hybrid density functional, B3LYP, calculations. Certain protein residues (Ala 6, Gln 7, Ile 13 and Gly 14) that are directly involved in hydrogen bonding with the nicotinamide carboxamide group show consistent differences in 1H and 15N chemical shift between NADPH and NADP + in a variety of ternary complexes. B3LYP calculations in model systems of protein-coenzyme interactions show differences in the H-bond geometry and differences in charge distribution between the oxidised and reduced forms of the nicotinamide ring. GIAO isotropic nuclear shieldings calculated for nuclei in these systems reproduce the experimentally observed trends in magnitudes and signs of the chemical shifts. The experimentally observed reduction in binding of NADP + compared with NADPH results partly from NADP + having to change its nicotinamide amide group from a cis- to a trans-conformation on binding and partly from the oxidised nicotinamide ring of NADP + being unable to take up its optimal hydrogen bonding geometry in its interactions with protein residues.

  9. Dihydrofolate reductase deficiency due to a homozygous DHFR mutation causes megaloblastic anemia and cerebral folate deficiency leading to severe neurologic disease.


    Cario, Holger; Smith, Desirée E C; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus


    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate.

  10. Identification of novel sesterterpene/triterpene synthase from Bacillus clausii.


    Sato, Tsutomu; Yamaga, Hiroaki; Kashima, Shoji; Murata, Yusuke; Shinada, Tetsuro; Nakano, Chiaki; Hoshino, Tsutomu


    Basic enzyme: The tetraprenyl-β-curcumene synthase homologue from the alkalophilic Bacillus clausii catalyses conversions of a geranylfarnesyl diphosphate and a hexaprenyl diphosphate into novel head-to-tail acyclic sesterterpene and triterpene. Tetraprenyl-β-curcumene synthase homologues represent a new family of terpene synthases that form not only sesquarterpene but also sesterterpene and triterpene.

  11. Producing dicarboxylic acids using polyketide synthases


    Katz, Leonard; Fortman, Jeffrey L.; Keasling, Jay D.


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  12. Lessons from 455 Fusarium polyketide synthases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In fungi, polyketide synthases (PKSs) synthesize a structurally diverse array of secondary metabolites (SMs) with a range of biological activities. The most studied SMs are toxic to animals and/or plants, alter plant growth, have beneficial pharmaceutical activities, and/or are brightly colored pigm...

  13. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  14. A clinically-identified emergent source of antibiotic resistance: the integron-associated DfrB4, a previously uncharacterized member of the trimethoprim-resistant dihydrofolate reductase B family.


    Toulouse, Jacynthe L; Edens, Thaddeus J; Alejaldre, Lorea; Manges, Amee R; Pelletier, Joelle N


    Whole genome sequencing of trimethoprim-resistant E. coli clinical isolates has identified a member of the trimethoprim-resistant type II dihydrofolate reductase gene family (dfrB). The dfrB4 gene was located within a class I integron flanked by multiple resistance genes. This arrangement was previously reported in a 130.6 kb multi-resistance plasmid. The DfrB4 protein conferred a > 2,000-fold increased trimethoprim resistance upon overexpression in E. coli Our results are consistent with dfrB4 contributing to clinical trimethoprim resistance.

  15. Changes in dihydrofolate reductase (DHFR) mRNA levels can account fully for changes in DHFR synthesis rates during terminal differentiation in a highly amplified myogenic cell line.

    PubMed Central

    Schmidt, E E; Merrill, G F


    Dihydrofolate reductase (DHFR) enzyme is preferentially synthesized in proliferative cells. A mouse muscle cell line resistant to 300 microM methotrexate was developed to investigate the molecular levels at which DHFR is down-regulated during myogenic withdrawal from the cell cycle. H- alpha R300T cells contained 540 copies of the endogenous DHFR gene and overexpressed DHFR mRNA and DHFR protein. Despite DHFR gene amplification, the cells remained diploid. As H- alpha R300T myoblasts withdrew from the cell cycle and committed to terminal differentiation, DHFR mRNA levels and DHFR synthesis rates decreased with closely matched kinetics. After 15 to 24 h, committed cells contained 5% the proliferative level of DHFR mRNA (80 molecules per committed cell) and synthesized DHFR protein at 6% the proliferative rate. At no point during the commitment process did the decrease in DHFR synthesis rate exceed the decrease in DHFR message. The decrease in DHFR mRNA levels during commitment was sufficient to account fully for the decrease in rates of DHFR synthesis. Furthermore, DHFR mRNA remained polysomal, and the average number of ribosomes per message remained constant (five to six ribosomes per DHFR mRNA). The constancy of polysome size, along with the uniform rate of DHFR synthesis per message, indicated that DHFR mRNA was efficiently translated in postreplicative cells. The results support a model wherein replication-dependent changes in DHFR synthesis rates are determined exclusively by changes in DHFR mRNA levels. Images PMID:2046674

  16. Synthesis and molecular docking against dihydrofolate reductase of novel pyridin-N-ethyl-N-methylbenzenesulfonamides as efficient anticancer and antimicrobial agents

    NASA Astrophysics Data System (ADS)

    Debbabi, Khaled F.; Bashandy, Mahmoud S.; Al-Harbi, Sami A.; Aljuhani, Enas H.; Al-Saidi, Hamed M.


    This article describes the synthesis of some novel sulfonamides having biologically active pyridine 21-28. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. Interaction of compound 2 with different aldehydes namely 4-fluorobenzaldehyde, 4-hydroxybenzaldehyde and 4-N,N-dimethylbenzaldehyde afforded the corresponding hydrazono-ethyl-N-ethyl-N-methylbenzene sulfonamides 18-20 respectively, which when reacted with malononitrile and ethyl cyanoacetate afforded compounds 21-26 respectively. These compounds 21-26 can be prepared by another reaction route by interaction of compounds 2 with arylidine malononitrile and arylidine ethyl cyanoacetate in refluxing dioxane in the presence of trimethylamine as catalyst. Interaction of compound 2 with malononitrile and ethyl cyanoacetate afforded oxopyridine derivatives 27 and 28 respectively. All the new prepared compounds were evaluated for their antitumor activities against the cell lines MCF-7 in comparison with the reference drug Doxorubicin using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colorimetric assay. Compounds 25, 21, 23 with SI values of 9.72, 9.71, 8.81 respectively, exhibited better activity than doxorubicin (Dox) as a reference drug with SI value of 8.49. In addition, compounds 25, 27 and 22 exhibited anti-bacterial activity against gram-negative bacteria (Klebsiella pneumoniae) with inhibition zones 22.6, 20.3 and 19.3 mm respectively, which were more active than gentamicin as a reference drug with inhibition zone 17.3 mm. Molecular Operating Environment (MOE) performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some synthesized compounds suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDB SD: 4DFR) with further modification.

  17. X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

    SciTech Connect

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Langan, Paul; Dealwis, Chris G.


    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.

  18. Preliminary in vitro studies on two potent, water-soluble trimethoprim analogues with exceptional species selectivity against dihydrofolate reductase from Pneumocystis carinii and Mycobacterium avium.


    Forsch, Ronald A; Queener, Sherry F; Rosowsky, Andre


    2,4-Diamino-5-[3',4'-dimethoxy-5'-(5-carboxy-1-pentynyl)]benzylpyrimidine (6) and 2,4-diamino-5-[3',4'-dimethoxy-5'-(4-carboxyphenylethynyl)benzylpyrimidine (7) were synthesized from 2,4-diamino-5-(5'-iodo-3',4'-dimethoxybenzyl)pyrimidine (9) via a Sonogashira reaction with appropriate acetylenic esters followed by saponification, and were tested as inhibitors of dihydrofolate reductase (DHFR) from Pneumocystis carinii (Pc), Toxoplasma gondii (Tg), Mycobacterium avium (Ma), and rat in comparison with the widely used antibacterial agent 2,4-diamino-5-(3',4',5'-trimethoxybenzyl)pyrimidine (trimethoprim, TMP). The selectivity index (SI) for each compound was calculated by dividing its 50% inhibitory concentration (IC(50)) against rat DHFR by its IC(50) against Pc, Tg, or Ma DHFR. The IC(50) of 6 against Pc DHFR was 1.0 nM, with an SI of 5000. Compound 7 had an IC(50) of 8.2 nM against Ma DHFR, with an SI of 11000. By comparison, the IC(50) of TMP was 12000 nM against Pc, 300 nM against Ma, and 180000 against rat DHFR. The potency and selectivity values of 6 and 7 were not as high against Tg as they were against Pc or Ma DHFR, but nonetheless exceeded those of TMP. Because of the outstanding selectivity of 6 against Pc and of 7 against Ma DHFR, these novel analogues may be viewed as promising leads for further structure-activity optimization.

  19. Crystal Structures of Wild-type and Mutant Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase Reveal an Alternative Conformation of NADPH that may be Linked to Trimethoprim Resistance

    SciTech Connect

    Frey, K.; Liu, J; Lombardo, M; Bolstad, D; Wright, D; Anderson, A


    Both hospital- and community-acquired Staphylococcus aureus infections have become major health concerns in terms of morbidity, suffering and cost. Trimethoprim-sulfamethoxazole (TMP-SMZ) is an alternative treatment for methicillin-resistant S. aureus (MRSA) infections. However, TMP-resistant strains have arisen with point mutations in dihydrofolate reductase (DHFR), the target for TMP. A single point mutation, F98Y, has been shown biochemically to confer the majority of this resistance to TMP. Using a structure-based approach, we have designed a series of novel propargyl-linked DHFR inhibitors that are active against several trimethoprim-resistant enzymes. We screened this series against wild-type and mutant (F98Y) S. aureus DHFR and found that several are active against both enzymes and specifically that the meta-biphenyl class of these inhibitors is the most potent. In order to understand the structural basis of this potency, we determined eight high-resolution crystal structures: four each of the wild-type and mutant DHFR enzymes bound to various propargyl-linked DHFR inhibitors. In addition to explaining the structure-activity relationships, several of the structures reveal a novel conformation for the cofactor, NADPH. In this new conformation that is predominantly associated with the mutant enzyme, the nicotinamide ring is displaced from its conserved location and three water molecules complete a network of hydrogen bonds between the nicotinamide ring and the protein. In this new position, NADPH has reduced interactions with the inhibitor. An equilibrium between the two conformations of NADPH, implied by their occupancies in the eight crystal structures, is influenced both by the ligand and the F98Y mutation. The mutation induced equilibrium between two NADPH-binding conformations may contribute to decrease TMP binding and thus may be responsible for TMP resistance.

  20. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate.


    Kalmbach, Renee D; Choumenkovitch, Silvina F; Troen, Aron P; Jacques, Paul F; D'Agostino, Ralph; Selhub, Jacob


    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. The functional impact of this polymorphism has not yet been demonstrated. The objective of this research was to determine the effects of the DHFR mutation with respect to folate status and assess influence of folic acid intake on these relations. The relationship between DHFR genotype and plasma concentrations of circulating folic acid, total folate, total homocysteine, and concentrations of RBC folate was determined in 1215 subjects from the Framingham Offspring Study. There was a significant interaction between DHFR genotype and folic acid intake with respect to the prevalence of high circulating unmetabolized folic acid (defined as >85th percentile). Folic acid intake of >or=500 microg/d increased the prevalence of high circulating unmetabolized folic acid in subjects with the deletion (del/del genotype (47.0%) compared with the wild type (WT)/del (21.4%) and wild type (WT)/WT genotypes (24.4%) (P for interaction = 0.03). Interaction between the DHFR polymorphism and folic acid intake was also seen with respect to RBC folate (P for interaction = 0.01). When folic acid intake was <250 microg/d, the del/del genotype was associated with significantly lower RBC folate (732.3 nmol/L) compared with the WT/WT genotype (844.4 nmol/L). Our results suggest the del/del polymorphism in DHFR is a functional polymorphism, because it limits assimilation of folic acid into cellular folate stores at high and low folic acid intakes.

  1. X-ray structure of the ternary MTX•NADPH complex of the anthrax dihydrofolate reductase: a pharmacophore for dual-site inhibitor design

    PubMed Central

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Dealwis, Chris G.


    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90° and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3Å resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low μM concentrations. The apparent Kd for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 μM. PMID:19374017

  2. Expression, Purification and Characterization of Recombinant Mouse Translation Initiation factor eIF-4E as a Dihydrofolate Reductase (DHFR) Fusion Protein

    PubMed Central

    Ghosh, Phalguni; Cheng, Jilin; Chou, Tsui-Fen; Jia, Yan; Avdulov, Svetlana; Bitterman, Peter B.; Polunovsky, Vitaly A.; Wagner, Carston R.


    One of the earliest steps in translation initiation is recognition of the mRNA cap structure (m7GpppX) by the initiation factor eIF4E. Studies of interactions between purified eIF4E and its binding partners provide important information for understanding mechanisms underlying translational control in normal and cancer cells. Numerous impediments of the available methods used for eIF4E purification led us to develop a novel methodology for obtaining fractions of eIF4E free from undesired by-products. Herein we report methods for bacterial expression of eIF4E tagged with mutant dihydrofolate reductase (DHFR) followed by isolation and purification of the DHFR-eIF4E protein by using affinity and anion-exchange chromatography. Fluorescence quenching experiments indicated the cap analogue, 7MeGTP, bound to DHFR-eIF4E and eIF4E with a dissociation constant (Kd) of 6±5 and 10±3 nM, respectively. Recombinant eIF4E and DHFR-eIF4E were both shown to significantly enhance in vitro translation in dose dependent manner by 75% at 0.5 uM. Nevertheless increased concentrations of eIF4E and DHFR-eIF4E significantly inhibited translation in a dose dependent manner by a maximum at 2 uM of 60% and 90%, respectively. Thus, we have demonstrated that we have developed an expression system for fully functional recombinant eIF4E. We have also shown that the fusion protein DHFR-eIF4E is functional and thus may be useful for cell based affinity tag studies with fluorescently labeled trimethoprim analogs. PMID:18479935

  3. Geranyl diphosphate synthase large subunit, and methods of use


    Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.


    A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.

  4. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR), methionine synthase reductase (MTRR), and thymidylate synthase (TYMS) in multiple myeloma risk.


    Lima, Carmen S P; Ortega, Manoela M; Ozelo, Margareth C; Araujo, Renato C; De Souza, Cármino A; Lorand-Metze, Irene; Annichino-Bizzacchi, Joyce M; Costa, Fernando F


    We tested whether the polymorphisms of the methylenetetrahydrofolate reductase gene, MTHFR C677T and A1298C, the methionine synthase gene, MTR A2756G, the methionine synthase reductase gene, MTRR A66G, and the thymidylate synthase gene, TYMS 2R-->3R, involved in folate and methionine metabolism, altered the risk for multiple myeloma (MM). Genomic DNA from 123MM patients and 188 controls was analysed by polymerase chain reaction and restriction digestion for the polymorphism analyses. The frequency of the MTR 2756 AG plus GG genotype was higher in patients than in controls (39.8% versus 23.4%, P=0.001). Individual carriers of the variant allele G had a 2.31 (95% CI: 1.38-3.87)-fold increased risk for MM compared with others. In contrast, similar frequencies of the MTHFR, the MTRR and the TYMS genotypes were seen in patients and controls. These results suggest, for the first time, a role for the MTR A2756G polymorphism in MM risk in our country, but should be confirmed by large-scale epidemiological studies with patients and controls age matched.

  5. Caffeine synthase and related methyltransferases in plants.


    Misako, Kato; Kouichi, Mizuno


    Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in high concentrations in tea and coffee and it is also found in a number of beverages such as coca cola. It is necessary to elucidate the caffeine biosynthetic pathway and to clone the genes related to the production of caffeine not only to determine the metabolism of the purine alkaloid but also to control the content of caffeine in tea and coffee. The available data support the operation of a xanthosine-->7-methylxanthosine-->7-methylxanthine-->theobromine-->caffeine pathway as the major route to caffeine. Since the caffeine biosynthetic pathway contains three S-adenosyl-L-methionine (SAM) dependent methylation steps, N-methyltransferases play important roles. This review focuses on the enzymes and genes involved in the methylation of purine ring. Caffeine synthase, the SAM-dependent methyltransferase involved in the last two steps of caffeine biosynthesis, was originally purified from young tea leaves (Camellia sinensis). The isolated cDNA, termed TCS1, consists of 1,483 base pairs and encodes a protein of 369 amino acids. Subsequently, the homologous genes that encode caffeine biosynthetic enzymes from coffee (Coffea arabica) were isolated. The recombinant proteins are classified into the three types on the basis of their substrate specificity i.e. 7-methylxanthosine synthase, theobromine synthase and caffeine synthase. The predicted amino acid sequences of caffeine biosynthetic enzymes derived from C. arabica exhibit more than 80% homology with those of the clones and but show only 40% homology with TCS1 derived from C. sinensis. In addition, they share 40% homology with the amino acid sequences of salicylic carboxyl methyltransferase, benzoic acid carboxyl methyltransferase and jasmonic acid carboxyl methyltransferase which belong to a family of motif B' methyltransferases which are novel plant methyltransferases with motif B' instead of motif B as the conserved region.

  6. Chrysanthemyl Diphosphate Synthase Operates in Planta as a Bifunctional Enzyme with Chrysanthemol Synthase Activity*

    PubMed Central

    Yang, Ting; Gao, Liping; Hu, Hao; Stoopen, Geert; Wang, Caiyun; Jongsma, Maarten A.


    Chrysanthemyl diphosphate synthase (CDS) is the first pathway-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate (CPP). Three proteins are known to catalyze this cyclopropanation reaction of terpene precursors. Two of them, phytoene and squalene synthase, are bifunctional enzymes with both prenyltransferase and terpene synthase activity. CDS, the other member, has been reported to perform only the prenyltransferase step. Here we show that the NDXXD catalytic motif of CDS, under the lower substrate conditions prevalent in plants, also catalyzes the next step, converting CPP into chrysanthemol by hydrolyzing the diphosphate moiety. The enzymatic hydrolysis reaction followed conventional Michaelis-Menten kinetics, with a Km value for CPP of 196 μm. For the chrysanthemol synthase activity, DMAPP competed with CPP as substrate. The DMAPP concentration required for half-maximal activity to produce chrysanthemol was ∼100 μm, and significant substrate inhibition was observed at elevated DMAPP concentrations. The N-terminal peptide of CDS was identified as a plastid-targeting peptide. Transgenic tobacco plants overexpressing CDS emitted chrysanthemol at a rate of 0.12–0.16 μg h−1 g−1 fresh weight. We propose that CDS should be renamed a chrysanthemol synthase utilizing DMAPP as substrate. PMID:25378387

  7. Structure of a modular polyketide synthase

    PubMed Central

    Dutta, Somnath; Whicher, Jonathan R.; Hansen, Douglas A.; Hale, Wendi A.; Chemler, Joseph A.; Congdon, Grady R.; Narayan, Alison R.; Håkansson, Kristina; Sherman, David H.; Smith, Janet L.


    Polyketide natural products constitute a broad class of compounds with diverse structural features and biological activities. Their biosynthetic machinery, represented by type I polyketide synthases, has an architecture in which successive modules catalyze two-carbon linear extensions and keto group processing reactions on intermediates covalently tethered to carrier domains. We employed electron cryo-microscopy to visualize a full-length module and determine sub-nanometer resolution 3D reconstructions that revealed an unexpectedly different architecture compared to the homologous dimeric mammalian fatty acid synthase. A single reaction chamber provides access to all catalytic sites for the intra-module carrier domain. In contrast, the carrier from the preceding module uses a separate entrance outside the reaction chamber to deliver the upstream polyketide intermediate for subsequent extension and modification. This study reveals for the first time the structural basis for both intra-module and inter-module substrate transfer in polyketide synthases, and establishes a new model for molecular dissection of these multifunctional enzyme systems. PMID:24965652

  8. Threonine Synthase of Lemna paucicostata Hegelm. 6746

    PubMed Central

    Giovanelli, John; Veluthambi, K.; Thompson, Gregory A.; Mudd, S. Harvey; Datko, Anne H.


    Threonine synthase (TS) was purified approximately 40-fold from Lemna paucicostata, and some of its properties determined by use of a sensitive and specific assay. During the course of its purification, TS was separated from cystathionine γ-synthase, establishing the separate identity of these enzymes. Compared to cystathionine γ-synthase, TS is relatively insensitive to irreversible inhibition by propargylglycine (both in vitro and in vivo) and to gabaculine, vinylglycine, or cysteine in vitro. TS is highly specific for O-phospho-l-homoserine (OPH) and water (hydroxyl ion). Nucleophilic attack by hydroxyl ion is restricted to carbon-3 of OPH and proceeds sterospecifically to form threonine rather than allo-threonine. The Km for OPH, determined at saturating S-adenosylmethionine (AdoMet), is 2.2 to 6.9 micromolar, two orders of magnitude less than values reported for TS from other plant tissues. AdoMet markedly stimulates the enzyme in a reversible and cooperative manner, consistent with its proposed role in regulation of methionine biosynthesis. Cysteine (1 millimolar) caused a slight (26%) reversible inhibition of the enzyme. Activities of TS isolated from Lemna were inversely related to the methionine nutrition of the plants. Down-regulation of TS by methionine may help to limit the overproduction of threonine that could result from allosteric stimulation of the enzyme by AdoMet. No evidence was obtained for feedback inhibition, repression, or covalent modification of TS by threonine and/or isoleucine. PMID:16663833

  9. Oligosaccharide Binding in Escherichia coli Glycogen Synthase

    SciTech Connect

    Sheng, Fang; Yep, Alejandra; Feng, Lei; Preiss, Jack; Geiger, James H.


    Glycogen/starch synthase elongates glucan chains and is the key enzyme in the synthesis of glycogen in bacteria and starch in plants. Cocrystallization of Escherichia coli wild-type glycogen synthase (GS) with substrate ADPGlc and the glucan acceptor mimic HEPPSO produced a closed form of GS and suggests that domain-domain closure accompanies glycogen synthesis. Cocrystallization of the inactive GS mutant E377A with substrate ADPGlc and oligosaccharide results in the first oligosaccharide-bound glycogen synthase structure. Four bound oligosaccharides are observed, one in the interdomain cleft (G6a) and three on the N-terminal domain surface (G6b, G6c, and G6d). Extending from the center of the enzyme to the interdomain cleft opening, G6a mostly interacts with the highly conserved N-terminal domain residues lining the cleft of GS. The surface-bound oligosaccharides G6c and G6d have less interaction with enzyme and exhibit a more curled, helixlike structural arrangement. The observation that oligosaccharides bind only to the N-terminal domain of GS suggests that glycogen in vivo probably binds to only one side of the enzyme to ensure unencumbered interdomain movement, which is required for efficient, continuous glucan-chain synthesis.

  10. Progress towards clinically useful aldosterone synthase inhibitors.


    Cerny, Matthew A


    Owing to the high degree of similarity between aldosterone synthase (CYP11B2) and cortisol synthase (CYP11B1), the design of selective inhibitors of one or the other of these two enzymes was, at one time, thought to be impossible. Through development of novel enzyme screening assays and significant medicinal chemistry efforts, highly potent inhibitors of CYP11B2 have been identified with selectivities approaching 1000-fold between the two enzymes. Many of these molecules also possess selectivity against other steroidogenic cytochromes P450 (e.g. CYP17A1 and CYP19A1) as well as hepatic drug metabolizing P450s. Though not as well developed or explored, inhibitors of CYP11B1, with selectivities approaching 50-fold, have also been identified. The therapeutic benefits of affecting the renin-angiotensin-aldosterone system have been well established with the therapeutically useful angiotensin-converting enzymes inhibitors, angiotensin receptor blockers, and mineralocorticoid receptor antagonists. Data regarding the additional benefits of an aldosterone synthase inhibitor (ASi) are beginning to emerge from animal models and human clinical trials. Despite great promise and much progress, additional challenges still exist in the path towards development of a therapeutically useful ASi.

  11. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    SciTech Connect

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long


    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  12. Mutational analysis of a monoterpene synthase reaction: altered catalysis through directed mutagenesis of (-)-pinene synthase from Abies grandis.


    Hyatt, David C; Croteau, Rodney


    Two monoterpene synthases, (-)-pinene synthase and (-)-camphene synthase, from grand fir (Abies grandis) produce different product mixtures despite having highly homologous amino acid sequences and, presumably, very similar three-dimensional structures. The major product of (-)-camphene synthase, (-)-camphene, and the major products of (-)-pinene synthase, (-)-alpha-pinene, and (-)-beta-pinene, arise through distinct mechanistic variations of the electrophilic reaction cascade that is common to terpenoid synthases. Structural modeling followed by directed mutagenesis in (-)-pinene synthase was used to replace selected amino acid residues with the corresponding residues from (-)-camphene synthase in an effort to identify the amino acids responsible for the catalytic differences. This approach produced an enzyme in which more than half of the product was channeled through an alternative pathway. It was also shown that several (-)-pinene synthase to (-)-camphene synthase amino acid substitutions were necessary before catalysis was significantly altered. The data support a model in which the collective action of many key amino acids, located both in and distant from the active site pocket, regulate the course of the electrophilic reaction cascade.

  13. Structure-based design of selective inhibitors of dihydrofolate reductase: synthesis and antiparasitic activity of 2, 4-diaminopteridine analogues with a bridged diarylamine side chain.


    Rosowsky, A; Cody, V; Galitsky, N; Fu, H; Papoulis, A T; Queener, S F


    As part of a larger search for potent as well as selective inhibitors of dihydrofolate reductase (DHFR) enzymes from opportunistic pathogens found in patients with AIDS and other immune disorders, N-[(2,4-diaminopteridin-6-yl)methyl]dibenz[b,f]azepine (4a) and the corresponding dihydrodibenz[b,f]azepine, dihydroacridine, phenoxazine, phenothiazine, carbazole, and diphenylamine analogues were synthesized from 2, 4-diamino-6-(bromomethyl)pteridine in 50-75% yield by reaction with the sodium salts of the amines in dry tetrahydrofuran at room temperature. The products were tested for the ability to inhibit DHFR from Pneumocystis carinii (pcDHFR), Toxoplasma gondii (tgDHFR), Mycobacterium avium (maDHFR), and rat liver (rlDHFR). The member of the series with the best combination of potency and species selectivity was 4a, with IC(50) values against the four enzymes of 0. 21, 0.043, 0.012, and 4.4 microM, respectively. The dihydroacridine, phenothiazine, and carbazole analogues were also potent, but nonselective. Of the compounds tested, 4a was the only one to successfully combine the potency of trimetrexate with the selectivity of trimethoprim. Molecular docking simulations using published 3D structural coordinates for the crystalline ternary complexes of pcDHFR and hDHFR suggested a possible structural interpretation for the binding selectivity of 4a and the lack of selectivity of the other compounds. According to this model, 4a is selective because of a unique propensity of the seven-membered ring in the dibenz[b,f]azepine moiety to adopt a puckered orientation that allows it to fit more comfortably into the active site of the P. carinii enzyme than into the active site of the human enzyme. Compound 4a was also evaluated for the ability to be taken up into, and retard the growth of, P. carinii and T. gondii in culture. The IC(50) of 4a against P. carinii trophozoites after 7 days of continuous drug treatment was 1.9 microM as compared with previously observed IC(50

  14. Dihydrofolate reductase 19-bp deletion polymorphism modifies the association of folate status with memory in a cross-sectional multi-ethnic study of adults123

    PubMed Central

    Philip, Dana; Buch, Assaf; Moorthy, Denish; Scott, Tammy M; Parnell, Laurence D; Lai, Chao-Qiang; Ordovás, José M; Selhub, Jacob; Rosenberg, Irwin H; Tucker, Katherine L; Troen, Aron M


    Background: Folate status has been positively associated with cognitive function in many studies; however, some studies have observed associations of poor cognitive outcomes with high folate. In search of an explanation, we hypothesized that the association of folate with cognition would be modified by the interaction of high-folate status with a common 19-bp deletion polymorphism in the dihydrofolate reductase (DHFR) gene. To our knowledge, the cognitive effects of this gene have not been studied previously. Objective: We examined the association between cognitive outcomes with the 19-bp deletion DHFR polymorphism, folate status, and their interaction with high or normal plasma folate. Design: This was a pooled cross-sectional study of the following 2 Boston-based cohorts of community living adults: the Boston Puerto Rican Health Study and the Nutrition, Aging, and Memory in Elders study. Individuals were genotyped for the DHFR 19-bp deletion genotype, and plasma folate status was determined. Cognitive outcomes included the Mini-Mental State Examination, Center for Epidemiologic Studies Depression Scale, and factor scores for the domains of memory, executive function, and attention from a set of cognitive tests. Results: The prevalence of the homozygous deletion (del/del) genotype was 23%. In a multivariable analysis, high folate status (>17.8 ng/mL) was associated with better memory scores than was normal-folate status (fourth–fifth quintiles compared with first–third quintiles: β ± SE = −0.22 ± 0.06, P < 0.01). Carriers of the DHFR del/del genotype had worse memory scores (β ± SE = −0.24 ± 0.10, P < 0.05) and worse executive scores (β = −0.19, P < 0.05) than did those with the del/ins and ins/ins genotypes. Finally, we observed an interaction such that carriers of the del/del genotype with high folate had significantly worse memory scores than those of both noncarriers with high-folate and del/del carriers with normal-folate (β-interaction = 0

  15. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same


    Croteau, Rodney Bruce; Burke, Charles Cullen


    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  16. Divinyl ether synthase gene, and protein and uses thereof


    Howe, Gregg A.; Itoh, Aya


    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  17. Divinyl ether synthase gene and protein, and uses thereof


    Howe, Gregg A.; Itoh, Aya


    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  18. Cellulose synthase interacting protein: a new factor in cellulose synthesis.


    Gu, Ying; Somerville, Chris


    Cellulose is the most abundant biopolymer on earth. The great abundance of cellulose places it at the forefront as a primary source of biomass for renewable biofuels. However, the knowledge of how plant cells make cellulose remains very rudimentary. Cellulose microfibrils are synthesized at the plasma membrane by hexameric protein complexes, also known as cellulose synthase complexes. The only known components of cellulose synthase complexes are cellulose synthase (CESA) proteins until the recent identification of a novel component. CSI1, which encodes CESA interacting protein 1 (CSI1) in Arabidopsis. CSI1, as the first non-CESA proteins associated with cellulose synthase complexes, opens up many opportunities.

  19. Low prevalence of Pneumocystis pneumonia (PCP) but high prevalence of pneumocystis dihydropteroate synthase (dhps) gene mutations in HIV-infected persons in Uganda.


    Taylor, Steve M; Meshnick, Steven R; Worodria, William; Andama, Alfred; Cattamanchi, Adithya; Davis, J Lucian; Yoo, Samuel D; Byanyima, Patrick; Kaswabuli, Sylvia; Goodman, Carol D; Huang, Laurence


    Pneumocystis jirovecii pneumonia (PCP) is an important opportunistic infection in patients infected with HIV, but its burden is incompletely characterized in those areas of sub-Saharan Africa where HIV is prevalent. We explored the prevalence of both PCP in HIV-infected adults admitted with pneumonia to a tertiary-care hospital in Uganda and of putative P. jirovecii drug resistance by mutations in fungal dihydropteroate synthase (dhps) and dihydrofolate reductase (dhfr). In 129 consecutive patients with sputum smears negative for mycobacteria, 5 (3.9%) were diagnosed with PCP by microscopic examination of Giemsa-stained bronchoalveolar lavage fluid. Concordance was 100% between Giemsa stain and PCR (dhps and dhfr). PCP was more prevalent in patients newly-diagnosed with HIV (11.4%) than in patients with known HIV (1.1%; p = 0.007). Mortality at 2 months after discharge was 29% overall: 28% among PCP-negative patients, and 60% (3 of 5) among PCP-positive patients. In these 5 fungal isolates and an additional 8 from consecutive cases of PCP, all strains harbored mutant dhps haplotypes; all 13 isolates harbored the P57S mutation in dhps, and 3 (23%) also harbored the T55A mutation. No non-synonymous dhfr mutations were detected. PCP is an important cause of pneumonia in patients newly-diagnosed with HIV in Uganda, is associated with high mortality, and putative molecular evidence of drug resistance is prevalent. Given the reliability of field diagnosis in our cohort, future studies in sub-Saharan Africa can investigate the clinical impact of these genotypes.

  20. Novel family of terpene synthases evolved from trans-isoprenyl diphosphate synthases in a flea beetle

    PubMed Central

    Beran, Franziska; Rahfeld, Peter; Luck, Katrin; Nagel, Raimund; Vogel, Heiko; Wielsch, Natalie; Irmisch, Sandra; Ramasamy, Srinivasan; Gershenzon, Jonathan; Heckel, David G.; Köllner, Tobias G.


    Sesquiterpenes play important roles in insect communication, for example as pheromones. However, no sesquiterpene synthases, the enzymes involved in construction of the basic carbon skeleton, have been identified in insects to date. We investigated the biosynthesis of the sesquiterpene (6R,7S)-himachala-9,11-diene in the crucifer flea beetle Phyllotreta striolata, a compound previously identified as a male-produced aggregation pheromone in several Phyllotreta species. A (6R,7S)-himachala-9,11-diene–producing sesquiterpene synthase activity was detected in crude beetle protein extracts, but only when (Z,E)-farnesyl diphosphate [(Z,E)-FPP] was offered as a substrate. No sequences resembling sesquiterpene synthases from plants, fungi, or bacteria were found in the P. striolata transcriptome, but we identified nine divergent putative trans-isoprenyl diphosphate synthase (trans-IDS) transcripts. Four of these putative trans-IDSs exhibited terpene synthase (TPS) activity when heterologously expressed. Recombinant PsTPS1 converted (Z,E)-FPP to (6R,7S)-himachala-9,11-diene and other sesquiterpenes observed in beetle extracts. RNAi-mediated knockdown of PsTPS1 mRNA in P. striolata males led to reduced emission of aggregation pheromone, confirming a significant role of PsTPS1 in pheromone biosynthesis. Two expressed enzymes showed genuine IDS activity, with PsIDS1 synthesizing (E,E)-FPP, whereas PsIDS3 produced neryl diphosphate, (Z,Z)-FPP, and (Z,E)-FPP. In a phylogenetic analysis, the PsTPS enzymes and PsIDS3 were clearly separated from a clade of known coleopteran trans-IDS enzymes including PsIDS1 and PsIDS2. However, the exon–intron structures of IDS and TPS genes in P. striolata are conserved, suggesting that this TPS gene family evolved from trans-IDS ancestors. PMID:26936952

  1. Novel family of terpene synthases evolved from trans-isoprenyl diphosphate synthases in a flea beetle.


    Beran, Franziska; Rahfeld, Peter; Luck, Katrin; Nagel, Raimund; Vogel, Heiko; Wielsch, Natalie; Irmisch, Sandra; Ramasamy, Srinivasan; Gershenzon, Jonathan; Heckel, David G; Köllner, Tobias G


    Sesquiterpenes play important roles in insect communication, for example as pheromones. However, no sesquiterpene synthases, the enzymes involved in construction of the basic carbon skeleton, have been identified in insects to date. We investigated the biosynthesis of the sesquiterpene (6R,7S)-himachala-9,11-diene in the crucifer flea beetle Phyllotreta striolata, a compound previously identified as a male-produced aggregation pheromone in several Phyllotreta species. A (6R,7S)-himachala-9,11-diene-producing sesquiterpene synthase activity was detected in crude beetle protein extracts, but only when (Z,E)-farnesyl diphosphate [(Z,E)-FPP] was offered as a substrate. No sequences resembling sesquiterpene synthases from plants, fungi, or bacteria were found in the P. striolata transcriptome, but we identified nine divergent putative trans-isoprenyl diphosphate synthase (trans-IDS) transcripts. Four of these putative trans-IDSs exhibited terpene synthase (TPS) activity when heterologously expressed. Recombinant PsTPS1 converted (Z,E)-FPP to (6R,7S)-himachala-9,11-diene and other sesquiterpenes observed in beetle extracts. RNAi-mediated knockdown of PsTPS1 mRNA in P. striolata males led to reduced emission of aggregation pheromone, confirming a significant role of PsTPS1 in pheromone biosynthesis. Two expressed enzymes showed genuine IDS activity, with PsIDS1 synthesizing (E,E)-FPP, whereas PsIDS3 produced neryl diphosphate, (Z,Z)-FPP, and (Z,E)-FPP. In a phylogenetic analysis, the PsTPS enzymes and PsIDS3 were clearly separated from a clade of known coleopteran trans-IDS enzymes including PsIDS1 and PsIDS2. However, the exon-intron structures of IDS and TPS genes in P. striolata are conserved, suggesting that this TPS gene family evolved from trans-IDS ancestors.

  2. Acetylation of prostaglandin synthase by aspirin.

    PubMed Central

    Roth, G J; Stanford, N; Majerus, P W


    When microsomes of sheep or bovine seminal vesicles are incubated with [acetyl-3H]aspirin (acetyl salicylic acid), 200 Ci/mol, we observe acetylation of a single protein, as measured by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. The protein has a molecular weight of 85,000 and corresponds to a similar acetylated protein found in the particulate fraction of aspirin-treated human platelets. The aspirin-mediated acetylation reaction proceeds with the same time course and at the same concentration as does the inhibition of prostaglandin synthase (cyclo-oxygenase) (EC; 8,11,14-eicosatrienoate, hydrogen-donor:oxygen oxidoreductase) by the drug. At 100 muM aspirin, 50% inhibition of prostaglandin synthase and 50% of maximal acetylation are observed after 15 min at 37 degrees. Furthermore, the substrate for cyclo-oxygenase, arachidonic acid, inhibits protein acetylation by aspirin at concentrations (50% inhibition at 10-30 muM) which correlate with the Michaelis constant of arachidonic acid as a substrate for cyclooxygenase. Arachidonic acid analogues and indomethacin inhibit the acetylation reaction in proportion to their effectiveness as cyclo-oxygenase inhibitors. The results suggest that aspirin acts as an active-site acetylating agent for the enzyme cyclo-oxygenase. This action of aspirin may account for its anti-inflammatory and anti-platelet action. PMID:810797

  3. Activities and regulation of peptidoglycan synthases.


    Egan, Alexander J F; Biboy, Jacob; van't Veer, Inge; Breukink, Eefjan; Vollmer, Waldemar


    Peptidoglycan (PG) is an essential component in the cell wall of nearly all bacteria, forming a continuous, mesh-like structure, called the sacculus, around the cytoplasmic membrane to protect the cell from bursting by its turgor. Although PG synthases, the penicillin-binding proteins (PBPs), have been studied for 70 years, useful in vitro assays for measuring their activities were established only recently, and these provided the first insights into the regulation of these enzymes. Here, we review the current knowledge on the glycosyltransferase and transpeptidase activities of PG synthases. We provide new data showing that the bifunctional PBP1A and PBP1B from Escherichia coli are active upon reconstitution into the membrane environment of proteoliposomes, and that these enzymes also exhibit DD-carboxypeptidase activity in certain conditions. Both novel features are relevant for their functioning within the cell. We also review recent data on the impact of protein-protein interactions and other factors on the activities of PBPs. As an example, we demonstrate a synergistic effect of multiple protein-protein interactions on the glycosyltransferase activity of PBP1B, by its cognate lipoprotein activator LpoB and the essential cell division protein FtsN.

  4. Subcellular localization and regulation of coenzyme A synthase.


    Zhyvoloup, Alexander; Nemazanyy, Ivan; Panasyuk, Ganna; Valovka, Taras; Fenton, Tim; Rebholz, Heike; Wang, Mong-Lien; Foxon, Richard; Lyzogubov, Valeriy; Usenko, Vasylij; Kyyamova, Ramziya; Gorbenko, Olena; Matsuka, Genadiy; Filonenko, Valeriy; Gout, Ivan T


    CoA synthase mediates the last two steps in the sequence of enzymatic reactions, leading to CoA biosynthesis. We have recently identified cDNA for CoA synthase and demonstrated that it encodes a bifunctional enzyme possessing 4'-phosphopantetheine adenylyltransferase and dephospho-CoA kinase activities. Molecular cloning of CoA synthase provided us with necessary tools to study subcellular localization and the regulation of this bifunctional enzyme. Transient expression studies and confocal microscopy allowed us to demonstrate that full-length CoA synthase is associated with the mitochondria, whereas the removal of the N-terminal region relocates the enzyme to the cytosol. In addition, we showed that the N-terminal sequence of CoA synthase (amino acids 1-29) exhibits a hydrophobic profile and targets green fluorescent protein exclusively to mitochondria. Further analysis, involving subcellular fractionation and limited proteolysis, indicated that CoA synthase is localized on the mitochondrial outer membrane. Moreover, we demonstrate for the first time that phosphatidylcholine and phosphatidylethanolamine, which are the main components of the mitochondrial outer membrane, are potent activators of both enzymatic activities of CoA synthase in vitro. Taken together, these data provide the evidence that the final stages of CoA biosynthesis take place on mitochondria and the activity of CoA synthase is regulated by phospholipids.

  5. Argininosuccinate synthase: at the center of arginine metabolism.


    Haines, Ricci J; Pendleton, Laura C; Eichler, Duane C


    The levels of L-arginine, a cationic, semi-essential amino acid, are often controlled within a cell at the level of local availability through biosynthesis. The importance of this temporal and spatial control of cellular L-arginine is highlighted by the tissue specific roles of argininosuccinate synthase (argininosuccinate synthetase) (EC, as the rate-limiting step in the conversion of L-citrulline to L-arginine. Since its discovery, the function of argininosuccinate synthase has been linked almost exclusively to hepatic urea production despite the fact that alternative pathways involving argininosuccinate synthase were defined, such as its role in providing arginine for creatine and for polyamine biosynthesis. However, it was the discovery of nitric oxide that meaningfully extended our understanding of the metabolic importance of non-hepatic argininosuccinate synthase. Indeed, our knowledge of the number of tissues that manage distinct pools of arginine under the control of argininosuccinate synthase has expanded significantly.

  6. A Comparative Analysis of Acyl-Homoserine Lactone Synthase Assays.


    Shin, Daniel; Frane, Nicole D; Brecht, Ryan M; Keeler, Jesse; Nagarajan, Rajesh


    Quorum sensing is cell-to-cell communication that allows bacteria to coordinate attacks on their hosts by inducing virulent gene expression, biofilm production, and other cellular functions, including antibiotic resistance. AHL synthase enzymes synthesize N-acyl-l-homoserine lactones, commonly referred to as autoinducers, to facilitate quorum sensing in Gram-negative bacteria. Studying the synthases, however, has proven to be a difficult road. Two assays, including a radiolabeled assay and a colorimetric (DCPIP) assay are well-documented in literature to study AHL synthases. In this paper, we describe additional methods that include an HPLC-based, C-S bond cleavage and coupled assays to investigate this class of enzymes. In addition, we compare and contrast each assay for both acyl-CoA- and acyl-ACP-utilizing synthases. The expanded toolkit described in this study should facilitate mechanistic studies on quorum sensing signal synthases and expedite discovery of antivirulent compounds.

  7. Ubiquitination and filamentous structure of cytidine triphosphate synthase

    PubMed Central

    Pai, Li-Mei; Wang, Pei-Yu; Lin, Wei-Cheng; Chakraborty, Archan; Yeh, Chau-Ting; Lin, Yu-Hung


    ABSTRACT Living organisms respond to nutrient availability by regulating the activity of metabolic enzymes. Therefore, the reversible post-translational modification of an enzyme is a common regulatory mechanism for energy conservation. Recently, cytidine-5′-triphosphate (CTP) synthase was discovered to form a filamentous structure that is evolutionarily conserved from flies to humans. Interestingly, induction of the formation of CTP synthase filament is responsive to starvation or glutamine depletion. However, the biological roles of this structure remain elusive. We have recently shown that ubiquitination regulates CTP synthase activity by promoting filament formation in Drosophila ovaries during endocycles. Intriguingly, although the ubiquitination process was required for filament formation induced by glutamine depletion, CTP synthase ubiquitination was found to be inversely correlated with filament formation in Drosophila and human cell lines. In this article, we discuss the putative dual roles of ubiquitination, as well as its physiological implications, in the regulation of CTP synthase structure. PMID:27116391

  8. Functional Contribution of Chorismate Synthase, Anthranilate Synthase, and Chorismate Mutase to Penetration Resistance in Barley-Powdery Mildew Interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant processes resulting from primary or secondary metabolism have been hypothesized to contribute to defense against microbial attack. Barley chorismate synthase (HvCS), anthranilate synthase alpha subunit 2 (HvASa2) and chorismate mutase 1 (HvCM1) occupy pivotal branch-points downstream of the s...

  9. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage.


    Gokay, Nevzat Selim; Yilmaz, Ibrahim; Komur, Baran; Demiroz, Ahu Senem; Gokce, Alper; Dervisoglu, Sergülen; Gokay, Banu Vural


    The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg), inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg), or nitric oxide precursor L-arginine (200 mg/kg). After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P = 0.044) positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  10. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    PubMed Central

    Gokay, Nevzat Selim; Yilmaz, Ibrahim; Demiroz, Ahu Senem; Gokce, Alper; Dervisoglu, Sergülen; Gokay, Banu Vural


    The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg), inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg), or nitric oxide precursor L-arginine (200 mg/kg). After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P = 0.044) positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders. PMID:27382570

  11. Conversion of anthranilate synthase into isochorismate synthase: implications for the evolution of chorismate-utilizing enzymes.


    Plach, Maximilian G; Löffler, Patrick; Merkl, Rainer; Sterner, Reinhard


    Chorismate-utilizing enzymes play a vital role in the biosynthesis of metabolites in plants as well as free-living and infectious microorganisms. Among these enzymes are the homologous primary metabolic anthranilate synthase (AS) and secondary metabolic isochorismate synthase (ICS). Both catalyze mechanistically related reactions by using ammonia and water as nucleophiles, respectively. We report that the nucleophile specificity of AS can be extended from ammonia to water by just two amino acid exchanges in a channel leading to the active site. The observed ICS/AS bifunctionality demonstrates that a secondary metabolic enzyme can readily evolve from a primary metabolic enzyme without requiring an initial gene duplication event. In a general sense, these findings add to our understanding how nature has used the structurally predetermined features of enzyme superfamilies to evolve new reactions.

  12. Identification of cystathionine γ-synthase and threonine synthase from Cicer arietinum and Lens culinaris.


    Morneau, Dominique J K; Jaworski, Allison F; Aitken, Susan M


    In plants, cystathionine γ-synthase (CGS) and threonine synthase (TS) compete for the branch-point metabolite O-phospho-L-homoserine. These enzymes are potential targets for metabolic engineering studies, aiming to alter the flux through the competing methionine and threonine biosynthetic pathways, with the goal of increasing methionine production. Although CGS and TS have been characterized in the model organisms Escherichia coli and Arabidopsis thaliana, little information is available on these enzymes in other, particularly plant, species. The functional CGS and TS coding sequences from the grain legumes Cicer arietinum (chickpea) and Lens culinaris (lentil) identified in this study share approximately 80% amino acid sequence identity with the corresponding sequences from Glycine max. At least 7 active-site residues of grain legume CGS and TS are conserved in the model bacterial enzymes, including the catalytic base. Putative processing sites that remove the targeting sequence and result in functional TS were identified in the target species.

  13. Heterologous expression in Saccharopolyspora erythraea of a pentaketide synthase derived from the spinosyn polyketide synthase.


    Martin, Christine J; Timoney, Máire C; Sheridan, Rose M; Kendrew, Steven G; Wilkinson, Barrie; Staunton, James C; Leadlay, Peter F


    A truncated version of the spinosyn polyketide synthase comprising the loading module and the first four extension modules fused to the erythromycin thioesterase domain was expressed in Saccharopolyspora erythraea. A novel pentaketide lactone product was isolated, identifying cryptic steps of spinosyn biosynthesis and indicating the potential of this approach for the biosynthetic engineering of spinosyn analogues. A pathway for the formation of the tetracyclic spinosyn aglycone is proposed.

  14. The Rotary Mechanism of the ATP Synthase

    PubMed Central

    Nakamoto, Robert K.; Scanlon, Joanne A. Baylis; Al-Shawi, Marwan K.


    The FOF1 ATP synthase is a large complex of at least 22 subunits, more than half of which are in the membranous FO sector. This nearly ubiquitous transporter is responsible for the majority of ATP synthesis in oxidative and photo-phosphorylation, and its overall structure and mechanism have remained conserved throughout evolution. Most examples utilize the proton motive force to drive ATP synthesis except for a few bacteria, which use a sodium motive force. A remarkable feature of the complex is the rotary movement of an assembly of subunits that plays essential roles in both transport and catalytic mechanisms. This review addresses the role of rotation in catalysis of ATP synthesis/hydrolysis and the transport of protons or sodium. PMID:18515057

  15. Nitric Oxide Synthases and Atrial Fibrillation

    PubMed Central

    Bonilla, Ingrid M.; Sridhar, Arun; Györke, Sandor; Cardounel, Arturo J.; Carnes, Cynthia A.


    Oxidative stress has been implicated in the pathogenesis of atrial fibrillation. There are multiple systems in the myocardium which contribute to redox homeostasis, and loss of homeostasis can result in oxidative stress. Potential sources of oxidants include nitric oxide synthases (NOS), which normally produce nitric oxide in the heart. Two NOS isoforms (1 and 3) are normally expressed in the heart. During pathologies such as heart failure, there is induction of NOS 2 in multiple cell types in the myocardium. In certain conditions, the NOS enzymes may become uncoupled, shifting from production of nitric oxide to superoxide anion, a potent free radical and oxidant. Multiple lines of evidence suggest a role for NOS in the pathogenesis of atrial fibrillation. Therapeutic approaches to reduce atrial fibrillation by modulation of NOS activity may be beneficial, although further investigation of this strategy is needed. PMID:22536189

  16. Endothelial nitric oxide synthase in the microcirculation

    PubMed Central

    Shu, Xiaohong; Keller, T.C. Stevenson; Begandt, Daniela; Butcher, Joshua T.; Biwer, Lauren; Keller, Alexander S.; Columbus, Linda; Isakson, Brant E.


    Endothelial nitric oxide synthase (eNOS, NOS3) is responsible for producing nitric oxide (NO) - a key molecule that can directly (or indirectly) act as a vasodilator and anti-inflammatory mediator. In this review, we examine the structural effects of regulation of the eNOS enzyme, including post-translational modifications and subcellular localization. After production, NO diffuses to surrounding cells with a variety of effects. We focus on the physiological role of NO and NO-derived molecules, including microvascular effects on vessel tone and immune response. Regulation of eNOS and NO action is complicated; we address endogenous and exogenous mechanisms of NO regulation with a discussion of pharmacological agents used in clinical and laboratory settings and a proposed role for eNOS in circulating red blood cells. PMID:26390975

  17. Endothelial nitric oxide synthase in the microcirculation.


    Shu, Xiaohong; Keller, T C Stevenson; Begandt, Daniela; Butcher, Joshua T; Biwer, Lauren; Keller, Alexander S; Columbus, Linda; Isakson, Brant E


    Endothelial nitric oxide synthase (eNOS, NOS3) is responsible for producing nitric oxide (NO)--a key molecule that can directly (or indirectly) act as a vasodilator and anti-inflammatory mediator. In this review, we examine the structural effects of regulation of the eNOS enzyme, including post-translational modifications and subcellular localization. After production, NO diffuses to surrounding cells with a variety of effects. We focus on the physiological role of NO and NO-derived molecules, including microvascular effects on vessel tone and immune response. Regulation of eNOS and NO action is complicated; we address endogenous and exogenous mechanisms of NO regulation with a discussion of pharmacological agents used in clinical and laboratory settings and a proposed role for eNOS in circulating red blood cells.

  18. A Single Amino Acid Substitution Converts Benzophenone Synthase into Phenylpyrone Synthase*

    PubMed Central

    Klundt, Tim; Bocola, Marco; Lütge, Maren; Beuerle, Till; Liu, Benye; Beerhues, Ludger


    Benzophenone metabolism provides a number of plant natural products with fascinating chemical structures and intriguing pharmacological activities. Formation of the carbon skeleton of benzophenone derivatives from benzoyl-CoA and three molecules of malonyl-CoA is catalyzed by benzophenone synthase (BPS), a member of the superfamily of type III polyketide synthases. A point mutation in the active site cavity (T135L) transformed BPS into a functional phenylpyrone synthase (PPS). The dramatic change in both substrate and product specificities of BPS was rationalized by homology modeling. The mutation may open a new pocket that accommodates the phenyl moiety of the triketide intermediate but limits polyketide elongation to two reactions, resulting in phenylpyrone formation. 3-Hydroxybenzoyl-CoA is the second best starter molecule for BPS but a poor substrate for PPS. The aryl moiety of the triketide intermediate may be trapped in the new pocket by hydrogen bond formation with the backbone, thereby acting as an inhibitor. PPS is a promising biotechnological tool for manipulating benzoate-primed biosynthetic pathways to produce novel compounds. PMID:19710020

  19. CLYBL is a polymorphic human enzyme with malate synthase and β-methylmalate synthase activity

    PubMed Central

    Strittmatter, Laura; Li, Yang; Nakatsuka, Nathan J.; Calvo, Sarah E.; Grabarek, Zenon; Mootha, Vamsi K.


    CLYBL is a human mitochondrial enzyme of unknown function that is found in multiple eukaryotic taxa and conserved to bacteria. The protein is expressed in the mitochondria of all mammalian organs, with highest expression in brown fat and kidney. Approximately 5% of all humans harbor a premature stop polymorphism in CLYBL that has been associated with reduced levels of circulating vitamin B12. Using comparative genomics, we now show that CLYBL is strongly co-expressed with and co-evolved specifically with other components of the mitochondrial B12 pathway. We confirm that the premature stop polymorphism in CLYBL leads to a loss of protein expression. To elucidate the molecular function of CLYBL, we used comparative operon analysis, structural modeling and enzyme kinetics. We report that CLYBL encodes a malate/β-methylmalate synthase, converting glyoxylate and acetyl-CoA to malate, or glyoxylate and propionyl-CoA to β-methylmalate. Malate synthases are best known for their established role in the glyoxylate shunt of plants and lower organisms and are traditionally described as not occurring in humans. The broader role of a malate/β-methylmalate synthase in human physiology and its mechanistic link to vitamin B12 metabolism remain unknown. PMID:24334609

  20. Enhanced gastric nitric oxide synthase activity in duodenal ulcer patients.

    PubMed Central

    Rachmilewitz, D; Karmeli, F; Eliakim, R; Stalnikowicz, R; Ackerman, Z; Amir, G; Stamler, J S


    Nitric oxide, the product of nitric oxide synthase in inflammatory cells, may have a role in tissue injury through its oxidative metabolism. Nitric oxide may have a role in the pathogenesis of duodenal ulcer and may be one of the mechanisms responsible for the association between gastric infection with Helicobacter pylori and peptic disease. In this study, calcium independent nitric oxide synthase activity was detected in human gastric mucosa suggesting expression of the inducible isoform. In 17 duodenal ulcer patients gastric antral and fundic nitric oxide synthase activity was found to be two and 1.5-fold respectively higher than its activity in the antrum and fundus of 14 normal subjects (p < 0.05). H pylori was detected in the antrum of 15 of 17 duodenal ulcer patients and only in 7 of 14 of the control subjects. Antral nitric oxide synthase activity in H pylori positive duodenal ulcer patients was twofold higher than in H pylori positive normal subjects (p < 0.05). In duodenal ulcer patients antral and fundic nitric oxide synthase activity resumed normal values after induction of ulcer healing with ranitidine. Eradication of H pylori did not further affect gastric nitric oxide synthase activity. These findings suggest that in duodenal ulcer patients stimulated gastric mucosal nitric oxide synthase activity, though independent of the H pylori state, may contribute to the pathogenesis of the disease. PMID:7525417

  1. Purification and Characterization of Chorismate Synthase from Euglena gracilis 1

    PubMed Central

    Schaller, Andreas; van Afferden, Manfred; Windhofer, Volker; Bülow, Sven; Abel, Gernot; Schmid, Jürg; Amrhein, Nikolaus


    Chorismate synthase was purified 1200-fold from Euglena gracilis. The molecular mass of the native enzyme is in the range of 110 to 138 kilodaltons as judged by gel filtration. The molecular mass of the subunit was determined to be 41.7 kilodaltons by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Purified chorismate synthase is associated with an NADPH-dependent flavin mononucleotide reductase that provides in vivo the reduced flavin necessary for catalytic activity. In vitro, flavin reduction can be mediated by either dithionite or light. The enzyme obtained from E. gracilis was compared with chorismate synthases purified from a higher plant (Corydalis sempervirens), a bacterium (Escherichia coli), and a fungus (Neurospora crassa). These four chorismate synthases were found to be very similar in terms of cofactor specificity, kinetic properties, isoelectric points, and pH optima. All four enzymes react with polyclonal antisera directed against chorismate synthases from C. sempervirens and E. coli. The closely associated flavin mononucleotide reductase that is present in chorismate synthase preparations from E. gracilis and N. crassa is the main difference between those synthases and the monofunctional enzymes from C. sempervirens and E. coli. ImagesFigure 2Figure 3 PMID:16668543

  2. Regulation of phosphatidylserine synthase from Saccharomyces cerevisiae by phospholipid precursors.

    PubMed Central

    Poole, M A; Homann, M J; Bae-Lee, M S; Carman, G M


    The addition of ethanolamine or choline to inositol-containing growth medium of Saccharomyces cerevisiae wild-type cells resulted in a reduction of membrane-associated phosphatidylserine synthase (CDPdiacylglycerol:L-serine O-phosphatidyltransferase, EC activity in cell extracts. The reduction of activity did not occur when inositol was absent from the growth medium. Under the growth conditions where a reduction of enzyme activity occurred, there was a corresponding qualitative reduction of enzyme subunit as determined by immunoblotting with antiserum raised against purified phosphatidylserine synthase. Water-soluble phospholipid precursors did not effect purified phosphatidylserine synthase activity. Phosphatidylserine synthase (activity and enzyme subunit) was not regulated by the availability of water-soluble phospholipid precursors in S. cerevisiae VAL2C(YEp CHO1) and the opi1 mutant. VAL2C(YEp CHO1) is a plasmid-bearing strain that over produces phosphatidylserine synthase activity, and the opi1 mutant is an inositol biosynthesis regulatory mutant. The results of this study suggest that the regulation of phosphatidylserine synthase by the availability of phospholipid precursors occurs at the level of enzyme formation and not at the enzyme activity level. Furthermore, the regulation of phosphatidylserine synthase is coupled to inositol synthesis. Images PMID:3023284

  3. Subcellular localization of the homocitrate synthase in Penicillium chrysogenum.


    Bañuelos, O; Casqueiro, J; Steidl, S; Gutiérrez, S; Brakhage, A; Martín, J F


    There are conflicting reports regarding the cellular localization in Saccharomyces cerevisiae and filamentous fungi of homocitrate synthase, the first enzyme in the lysine biosynthetic pathway. The homocitrate synthase (HS) gene (lys1) of Penicillium chrysogenum was disrupted in three transformants (HS(-)) of the Wis 54-1255 pyrG strain. The three mutants named HS1(-), HS2(-) and HS3(-) all lacked homocitrate synthase activity and showed lysine auxotrophy, indicating that there is a single gene for homocitrate synthase in P. chrysogenum. The lys1 ORF was fused in frame to the gene for the green fluorescent protein (GFP) gene of the jellyfish Aequorea victoria. Homocitrate synthase-deficient mutants transformed with a plasmid containing the lys1-GFP fusion recovered prototrophy and showed similar levels of homocitrate synthase activity to the parental strain Wis 54-1255, indicating that the hybrid protein retains the biological function of wild-type homocitrate synthase. Immunoblotting analysis revealed that the HS-GFP fusion protein is maintained intact and does not release the GFP moiety. Fluorescence microscopy analysis of the transformants showed that homocitrate synthase was mainly located in the cytoplasm in P. chrysogenum; in S. cerevisiae the enzyme is targeted to the nucleus. The control nuclear protein StuA was properly targeted to the nucleus when the StuA (targeting domain)-GFP hybrid protein was expressed in P. chrysogenum. The difference in localization of homocitrate synthase between P. chrysogenum and S. cerevisiae suggests that this protein may play a regulatory function, in addition to its catalytic function, in S. cerevisiae but not in P. chrysogenum.

  4. Peroxisomal and mitochondrial citrate synthase in CAM plants.


    Zafra, M F; Segovia, J L; Alejandre, M J; García-Peregrín, E


    Citrate synthase wa studied for the first time in peroxisomes and mitochondria of crassulacean acid metabolism plants. Cellular organelles were isolated from Agave americana leaves by sucrose density gradient centrifugation and characterized by the use of catalase and cytochrome oxidase as marker enzymes, respectively. 48,000 X g centrifugation caused the breakdown of the cellular organelles. The presence of a glyoxylate cycle enzyme (citrate synthase) and a glycollate pathway enzyme (catalase) in the same organelles, besides the absence of another glyoxalate cycle enzyme (malate synthase) is reported for the first time, suggesting that peroxisomal and glyoxysomal proteins are synthesized at the same time and housed in he same organelle.

  5. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    SciTech Connect

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi


    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  6. O-Nucleoside, S-Nucleoside, and N-Nucleoside Probes of Lumazine Synthase and Riboflavin Synthase

    PubMed Central

    Talukdar, Arindam; Zhao, Yujie; Lv, Wei; Bacher, Adelbert; Illarionov, Boris; Fischer, Markus; Cushman, Mark


    Lumazine synthase catalyzes the penultimate step in the biosynthesis of riboflavin, while riboflavin synthase catalyzes the last step. O-Nucleoside, S-nucleoside and N-nucleoside analogues of hypothetical lumazine biosynthetic intermediates have been synthesized in order to obtain structure and mechanism probes of these two enzymes, as well as inhibitors of potential value as antibiotics. Methods were devised for the selective cleavage of benzyl protecting groups in the presence of other easily reduced functionality by controlled hydrogenolysis over Lindlar catalyst. The deprotection reaction was performed in the presence of other reactive functionality including nitro groups, alkenes, and halogens. The target compounds were tested as inhibitors of lumazine synthase and riboflavin synthase obtained from a variety of microorganisms. In general, the S-nucleosides and N-nucleosides were more potent than the corresponding O-nucleosides as lumazine synthase and riboflavin synthase inhibitors, while the C-nucleosides were the least potent. A series of molecular dynamics simulations followed by free energy calculations using the Poisson-Boltzmann/surface area (MM-PBSA) method were carried out in order to rationalize the results of ligand binding to lumazine synthase, and the results provide insight into the dynamics of ligand binding as well as the molecular forces stabilizing the intermediates in the enzyme-catalyzed reaction. PMID:22780198

  7. Thymoquinone Inhibits Escherichia coli ATP Synthase and Cell Growth.


    Ahmad, Zulfiqar; Laughlin, Thomas F; Kady, Ismail O


    We examined the thymoquinone induced inhibition of purified F1 or membrane bound F1FO E. coli ATP synthase. Both purified F1 and membrane bound F1FO were completely inhibited by thymoquinone with no residual ATPase activity. The process of inhibition was fully reversible and identical in both membrane bound F1Fo and purified F1 preparations. Moreover, thymoquinone induced inhibition of ATP synthase expressing wild-type E. coli cell growth and non-inhibition of ATPase gene deleted null control cells demonstrates that ATP synthase is a molecular target for thymoquinone. This also links the beneficial dietary based antimicrobial and anticancer effects of thymoquinone to its inhibitory action on ATP synthase.

  8. Thymoquinone Inhibits Escherichia coli ATP Synthase and Cell Growth

    PubMed Central

    Ahmad, Zulfiqar; Laughlin, Thomas F.; Kady, Ismail O.


    We examined the thymoquinone induced inhibition of purified F1 or membrane bound F1FO E. coli ATP synthase. Both purified F1 and membrane bound F1FO were completely inhibited by thymoquinone with no residual ATPase activity. The process of inhibition was fully reversible and identical in both membrane bound F1Fo and purified F1 preparations. Moreover, thymoquinone induced inhibition of ATP synthase expressing wild-type E. coli cell growth and non-inhibition of ATPase gene deleted null control cells demonstrates that ATP synthase is a molecular target for thymoquinone. This also links the beneficial dietary based antimicrobial and anticancer effects of thymoquinone to its inhibitory action on ATP synthase. PMID:25996607

  9. Rare structural variants of human and murine uroporphyrinogen I synthase

    SciTech Connect

    Meisler, M.H.; Carter, M.L.C.


    An isoelectric focusing method for detection of structural variants of the enzyme uroporphyrinogen I synthase (porphobilinogen ammonia-lyase (polymerizing), EC in mammalian tissues has been developed. Mouse and human erythrocytes contain one or two major isozymes of uroporphyrinogen I synthase, respectively. Other tissues contain a set of more acidic isozymes that are encoded by the same structural gene as the erythrocyte isozymes. Mouse populations studied with this method were monomorphic for uroporphyrinogen I synthase, with the exception of one feral mouse population. The pedigree of a human family with a rare structural variant is consistent with autosomal linkage of the structural gene. This system provides a convenient isozyme marker for genetic studies and will facilitate determination of the chromosomal location of the uroporphyrinogen I synthase locus.

  10. Biosynthesis of riboflavin: an unusual riboflavin synthase of Methanobacterium thermoautotrophicum.

    PubMed Central

    Eberhardt, S; Korn, S; Lottspeich, F; Bacher, A


    Riboflavin synthase was purified by a factor of about 1,500 from cell extract of Methanobacterium thermoautotrophicum. The enzyme had a specific activity of about 2,700 nmol mg(-1) h(-1) at 65 degrees C, which is relatively low compared to those of riboflavin synthases of eubacteria and yeast. Amino acid sequences obtained after proteolytic cleavage had no similarity with known riboflavin synthases. The gene coding for riboflavin synthase (designated ribC) was subsequently cloned by marker rescue with a ribC mutant of Escherichia coli. The ribC gene of M. thermoautotrophicum specifies a protein of 153 amino acid residues. The predicted amino acid sequence agrees with the information gleaned from Edman degradation of the isolated protein and shows 67% identity with the sequence predicted for the unannotated reading frame MJ1184 of Methanococcus jannaschii. The ribC gene is adjacent to a cluster of four genes with similarity to the genes cbiMNQO of Salmonella typhimurium, which form part of the cob operon (this operon contains most of the genes involved in the biosynthesis of vitamin B12). The amino acid sequence predicted by the ribC gene of M. thermoautotrophicum shows no similarity whatsoever to the sequences of riboflavin synthases of eubacteria and yeast. Most notably, the M. thermoautotrophicum protein does not show the internal sequence homology characteristic of eubacterial and yeast riboflavin synthases. The protein of M. thermoautotrophicum can be expressed efficiently in a recombinant E. coli strain. The specific activity of the purified, recombinant protein is 1,900 nmol mg(-1) h(-1) at 65 degrees C. In contrast to riboflavin synthases from eubacteria and fungi, the methanobacterial enzyme has an absolute requirement for magnesium ions. The 5' phosphate of 6,7-dimethyl-8-ribityllumazine does not act as a substrate. The findings suggest that riboflavin synthase has evolved independently in eubacteria and methanobacteria. PMID:9139911

  11. Alendronate is a specific, nanomolar inhibitor of farnesyl diphosphate synthase.


    Bergstrom, J D; Bostedor, R G; Masarachia, P J; Reszka, A A; Rodan, G


    Alendronate, a nitrogen-containing bisphosphonate, is a potent inhibitor of bone resorption used for the treatment and prevention of osteoporosis. Recent findings suggest that alendronate and other N-containing bisphosphonates inhibit the isoprenoid biosynthesis pathway and interfere with protein prenylation, as a result of reduced geranylgeranyl diphosphate levels. This study identified farnesyl disphosphate synthase as the mevalonate pathway enzyme inhibited by bisphosphonates. HPLC analysis of products from a liver cytosolic extract narrowed the potential targets for alendronate inhibition (IC(50) = 1700 nM) to isopentenyl diphosphate isomerase and farnesyl diphosphate synthase. Recombinant human farnesyl diphosphate synthase was inhibited by alendronate with an IC(50) of 460 nM (following 15 min preincubation). Alendronate did not inhibit isopentenyl diphosphate isomerase or GGPP synthase, partially purified from liver cytosol. Recombinant farnesyl diphosphate synthase was also inhibited by pamidronate (IC(50) = 500 nM) and risedronate (IC(50) = 3.9 nM), negligibly by etidronate (IC50 = 80 microM), and not at all by clodronate. In osteoclasts, alendronate inhibited the incorporation of [(3)H]mevalonolactone into proteins of 18-25 kDa and into nonsaponifiable lipids, including sterols. These findings (i) identify farnesyl diphosphate synthase as the selective target of alendronate in the mevalonate pathway, (ii) show that this enzyme is inhibited by other N-containing bisphosphonates, such as risendronate, but not by clodronate, supporting a different mechanism of action for different bisphosphonates, and (iii) document in purified osteoclasts alendronate inhibition of prenylation and sterol biosynthesis.

  12. Human Isoprenoid Synthase Enzymes as Therapeutic Targets

    NASA Astrophysics Data System (ADS)

    Park, Jaeok; Matralis, Alexios; Berghuis, Albert; Tsantrizos, Youla


    The complex biochemical network known as the mevalonate pathway is responsible for the biosynthesis of all isoprenoids in the human body, which consists of a vast array of metabolites that are vital for proper cellular functions. Two key isoprenoids, farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) are responsible for the post-translational prenylation of small GTP-binding proteins, and serve as the biosynthetic precursors to numerous other biomolecules. The down-stream metabolite of FPP and GGPP is squalene, the precursor to steroids, bile acids, lipoproteins and vitamin D. In the past, interest in prenyl synthase inhibitors focused mainly on the role of the FPP in lytic bone diseases. More recently, pre-clinical and clinical studies have strongly implicated high levels of protein prenylation in a plethora of human diseases, including non-skeletal cancers, the progression of neurodegenerative diseases and cardiovascular diseases. In this review, we focus mainly on the potential therapeutic value of down-regulating the biosynthesis of FPP, GGPP and squalene. We summarize the most recent drug discovery efforts and the structural data available that support the current on-going studies.

  13. Human isoprenoid synthase enzymes as therapeutic targets

    PubMed Central

    Park, Jaeok; Matralis, Alexios N.; Berghuis, Albert M.; Tsantrizos, Youla S.


    In the human body, the complex biochemical network known as the mevalonate pathway is responsible for the biosynthesis of all isoprenoids, which consists of a vast array of metabolites that are vital for proper cellular functions. Two key isoprenoids, farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) are responsible for the post-translational prenylation of small GTP-binding proteins, and serve as the biosynthetic precursors to numerous other biomolecules. The down-stream metabolite of FPP and GGPP is squalene, the precursor to steroids, bile acids, lipoproteins, and vitamin D. In the past, interest in prenyl synthase inhibitors focused mainly on the role of the FPP in lytic bone diseases. More recently pre-clinical and clinical studies have strongly implicated high levels of protein prenylation in a plethora of human diseases, including non-skeletal cancers, the progression of neurodegenerative diseases and cardiovascular diseases. In this review, we focus mainly on the potential therapeutic value of down-regulating the biosynthesis of FPP, GGPP, and squalene. We summarize the most recent drug discovery efforts and the structural data available that support the current on-going studies. PMID:25101260

  14. Concerted versus Stepwise Mechanism in Thymidylate Synthase

    PubMed Central


    Thymidylate synthase (TSase) catalyzes the intracellular de novo formation of thymidylate (a DNA building block) in most living organisms, making it a common target for chemotherapeutic and antibiotic drugs. Two mechanisms have been proposed for the rate-limiting hydride transfer step in TSase catalysis: a stepwise mechanism in which the hydride transfer precedes the cleavage of the covalent bond between the enzymatic cysteine and the product and a mechanism where both happen concertedly. Striking similarities between the enzyme-bound enolate intermediates formed in the initial and final step of the reaction supported the first mechanism, while QM/MM calculations favored the concerted mechanism. Here, we experimentally test these two possibilities using secondary kinetic isotope effect (KIE), mutagenesis study, and primary KIEs. The findings support the concerted mechanism and demonstrate the critical role of an active site arginine in substrate binding, activation of enzymatic nucleophile, and the hydride transfer studied here. The elucidation of this reduction/substitution sheds light on the critical catalytic step in TSase and may aid future drug or biomimetic catalyst design. PMID:24949852

  15. Nitric oxide synthase in the pineal gland.


    López-Figueroa, M O; Møller, M


    The recent discovery of nitric oxide (NO) as a biological messenger molecule with unique characteristics has opened a new field in pineal research. This free radical gas is synthesized by the enzyme nitric oxide synthase (NOS) from L-arginine. The activation of adrenoreceptors in the membrane of the pinealocytes mediates the increase in NO through a mechanism that involves G proteins. In the pinealocyte, NO stimulates guanylyl cyclase resulting in an increased intracellular content of cGMP. The role of cGMP in pineal metabolism, however, is still enigmatic. Using enzyme histochemistry and immunohistochemistry, the presence of NOS has been confirmed in the pineal gland of some species. In the rat and especially in the sheep, NOS is located in nerve fibres innervating the gland. These nerve fibres also contain the neuropeptides vasoactive intestinal peptide (VIP) and peptide histidine isoleucine (PHI), and are probably of parasympathetic origin. In cell cultures and tissue sections NOS immunoreactivity has been shown to be present in pinealocytes of the rat and bovine but not in the sheep. Finally, NOS is also present in the endothelial cells of the blood vessels of the pineal gland. Accordingly, in the mammalian pineal gland, NO is synthesized in both presynaptic nerve fibers and pinealocytes, as well as in blood vessels. However, the anatomical location of NO synthesis varies considerably among species. NO released in the pineal gland, might influence both the pineal metabolism and the blood flow of the gland.

  16. Electric Field Driven Torque in ATP Synthase

    PubMed Central

    Miller, John H.; Rajapakshe, Kimal I.; Infante, Hans L.; Claycomb, James R.


    FO-ATP synthase (FO) is a rotary motor that converts potential energy from ions, usually protons, moving from high- to low-potential sides of a membrane into torque and rotary motion. Here we propose a mechanism whereby electric fields emanating from the proton entry and exit channels act on asymmetric charge distributions in the c-ring, due to protonated and deprotonated sites, and drive it to rotate. The model predicts a scaling between time-averaged torque and proton motive force, which can be hindered by mutations that adversely affect the channels. The torque created by the c-ring of FO drives the γ-subunit to rotate within the ATP-producing complex (F1) overcoming, with the aid of thermal fluctuations, an opposing torque that rises and falls with angular position. Using the analogy with thermal Brownian motion of a particle in a tilted washboard potential, we compute ATP production rates vs. proton motive force. The latter shows a minimum, needed to drive ATP production, which scales inversely with the number of proton binding sites on the c-ring. PMID:24040370

  17. Nitric Oxide Synthases in Heart Failure

    PubMed Central

    Carnicer, Ricardo; Crabtree, Mark J.; Sivakumaran, Vidhya


    Abstract Significance: The regulation of myocardial function by constitutive nitric oxide synthases (NOS) is important for the maintenance of myocardial Ca2+ homeostasis, relaxation and distensibility, and protection from arrhythmia and abnormal stress stimuli. However, sustained insults such as diabetes, hypertension, hemodynamic overload, and atrial fibrillation lead to dysfunctional NOS activity with superoxide produced instead of NO and worse pathophysiology. Recent Advances: Major strides in understanding the role of normal and abnormal constitutive NOS in the heart have revealed molecular targets by which NO modulates myocyte function and morphology, the role and nature of post-translational modifications of NOS, and factors controlling nitroso-redox balance. Localized and differential signaling from NOS1 (neuronal) versus NOS3 (endothelial) isoforms are being identified, as are methods to restore NOS function in heart disease. Critical Issues: Abnormal NOS signaling plays a key role in many cardiac disorders, while targeted modulation may potentially reverse this pathogenic source of oxidative stress. Future Directions: Improvements in the clinical translation of potent modulators of NOS function/dysfunction may ultimately provide a powerful new treatment for many hearts diseases that are fueled by nitroso-redox imbalance. Antioxid. Redox Signal. 18, 1078–1099. PMID:22871241

  18. Inducible nitric oxide synthase in the myocard.


    Buchwalow, I B; Schulze, W; Karczewski, P; Kostic, M M; Wallukat, G; Morwinski, R; Krause, E G; Müller, J; Paul, M; Slezak, J; Luft, F C; Haller, H


    Recognition of significance of nitric oxide synthases (NOS) in cardiovascular regulations has led to intensive research and development of therapies focused on NOS as potential therapeutic targets. However, the NOS isoform profile of cardiac tissue and subcellular localization of NOS isoforms remain a matter of debate. The aim of this study was to investigate the localization of an inducible NOS isoform (NOS2) in cardiomyocytes. Employing a novel immunocytochemical technique of a catalyzed reporter deposition system with tyramide and electron microscopical immunocytochemistry complemented with Western blotting and RT-PCR, we detected NOS2 both in rat neonatal and adult cultured cardiomyocytes and in the normal myocard of adult rats as well as in the human myocard of patients with dilative cardiomyopathy. NOS2 was targeted predominantly to a particulate component of the cardiomyocyte--along contractile fibers, in the plasma membrane including T-tubules, as well as in the nuclear envelope, mitochondria and Golgi complex. Our results point to an involvement of NOS2 in maintaining cardiac homeostasis and contradict to the notion that NOS2 is expressed in cardiac tissue only in response to various physiological and pathogenic factors. NOS2 targeting to mitochondria and contractile fibers suggests a relationship of NO with contractile function and energy production in the cardiac muscle.

  19. Undecaprenyl diphosphate synthase inhibitors: antibacterial drug leads.


    Sinko, William; Wang, Yang; Zhu, Wei; Zhang, Yonghui; Feixas, Ferran; Cox, Courtney L; Mitchell, Douglas A; Oldfield, Eric; McCammon, J Andrew


    There is a significant need for new antibiotics due to the rise in drug resistance. Drugs such as methicillin and vancomycin target bacterial cell wall biosynthesis, but methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococci (VRE) have now arisen and are of major concern. Inhibitors acting on new targets in cell wall biosynthesis are thus of particular interest since they might also restore sensitivity to existing drugs, and the cis-prenyl transferase undecaprenyl diphosphate synthase (UPPS), essential for lipid I, lipid II, and thus, peptidoglycan biosynthesis, is one such target. We used 12 UPPS crystal structures to validate virtual screening models and then assayed 100 virtual hits (from 450,000 compounds) against UPPS from S. aureus and Escherichia coli. The most promising inhibitors (IC50 ∼2 μM, Ki ∼300 nM) had activity against MRSA, Listeria monocytogenes, Bacillus anthracis, and a vancomycin-resistant Enterococcus sp. with MIC or IC50 values in the 0.25-4 μg/mL range. Moreover, one compound (1), a rhodanine with close structural similarity to the commercial diabetes drug epalrestat, exhibited good activity as well as a fractional inhibitory concentration index (FICI) of 0.1 with methicillin against the community-acquired MRSA USA300 strain, indicating strong synergism.

  20. Structures of human constitutive nitric oxide synthases

    PubMed Central

    Li, Huiying; Jamal, Joumana; Plaza, Carla; Pineda, Stephanie Hai; Chreifi, Georges; Jing, Qing; Cinelli, Maris A.; Silverman, Richard B.; Poulos, Thomas L.


    Mammals produce three isoforms of nitric oxide synthase (NOS): neuronal NOS (nNOS), inducible NOS (iNOS) and endothelial NOS (eNOS). The overproduction of NO by nNOS is associated with a number of neurodegenerative disorders; therefore, a desirable therapeutic goal is the design of drugs that target nNOS but not the other isoforms. Crystallography, coupled with computational approaches and medicinal chemistry, has played a critical role in developing highly selective nNOS inhibitors that exhibit exceptional neuroprotective properties. For historic reasons, crystallography has focused on rat nNOS and bovine eNOS because these were available in high quality; thus, their structures have been used in structure–activity–relationship studies. Although these constitutive NOSs share more than 90% sequence identity across mammalian species for each NOS isoform, inhibitor-binding studies revealed that subtle differences near the heme active site in the same NOS isoform across species still impact enzyme–inhibitor interactions. Therefore, structures of the human constitutive NOSs are indispensible. Here, the first structure of human neuronal NOS at 2.03 Å resolution is reported and a different crystal form of human endothelial NOS is reported at 1.73 Å resolution. PMID:25286850

  1. Structure of Leishmania major cysteine synthase

    PubMed Central

    Fyfe, Paul K.; Westrop, Gareth D.; Ramos, Tania; Müller, Sylke; Coombs, Graham H.; Hunter, William N.


    Cysteine biosynthesis is a potential target for drug development against parasitic Leishmania species; these protozoa are responsible for a range of serious diseases. To improve understanding of this aspect of Leishmania biology, a crystallographic and biochemical study of L. major cysteine synthase has been undertaken, seeking to understand its structure, enzyme activity and modes of inhibition. Active enzyme was purified, assayed and crystallized in an orthorhombic form with a dimer in the asymmetric unit. Diffraction data extending to 1.8 Å resolution were measured and the structure was solved by molecular replacement. A fragment of γ-poly-d-glutamic acid, a constituent of the crystallization mixture, was bound in the enzyme active site. Although a d-­glutamate tetrapeptide had insignificant inhibitory activity, the enzyme was competitively inhibited (K i = 4 µM) by DYVI, a peptide based on the C-­terminus of the partner serine acetyltransferase with which the enzyme forms a complex. The structure surprisingly revealed that the cofactor pyridoxal phosphate had been lost during crystallization. PMID:22750854

  2. Anthranilate synthase subunit organization in Chromobacterium violaceum.


    Carminatti, C A; Oliveira, I L; Recouvreux, D O S; Antônio, R V; Porto, L M


    Tryptophan is an aromatic amino acid used for protein synthesis and cellular growth. Chromobacterium violaceum ATCC 12472 uses two tryptophan molecules to synthesize violacein, a secondary metabolite of pharmacological interest. The genome analysis of this bacterium revealed that the genes trpA-F and pabA-B encode the enzymes of the tryptophan pathway in which the first reaction is the conversion of chorismate to anthranilate by anthranilate synthase (AS), an enzyme complex. In the present study, the organization and structure of AS protein subunits from C. violaceum were analyzed using bioinformatics tools available on the Web. We showed by calculating molecular masses that AS in C. violaceum is composed of alpha (TrpE) and beta (PabA) subunits. This is in agreement with values determined experimentally. Catalytic and regulatory sites of the AS subunits were identified. The TrpE and PabA subunits contribute to the catalytic site while the TrpE subunit is involved in the allosteric site. Protein models for the TrpE and PabA subunits were built by restraint-based homology modeling using AS enzyme, chains A and B, from Salmonella typhimurium (PDB ID 1I1Q).

  3. Effect of chronologic age on induction of cystathionine synthase, uroporphyrinogen I synthase, and glucose-6-phosphate dehydrogenase activities in lymphocytes.

    PubMed Central

    Gartler, S M; Hornung, S K; Motulsky, A G


    The activities of cystathionine synthase [L-serine hydro-lyase (adding homocysteine), EC], uroporphyrinogen I synthase [porphobilinogen ammonia-lyase (polymerizing), EC], and glucose-6-phosphate dehydrogenase (D-glucose-6-phosphate:NADP+ 1-oxidoreductase, EC have been measured in phytohemagglutinin-stimulated lymphocytes of young and old human subjects. A significant decrease in activity with age was observed for cystathionine synthase and uroporphyrinogen I synthase but not for glucose-6-phosphate dehydrogenase. These changes could not be related to declining phytohemagglutinin response with aging. Age-related decreases in activity of some enzymes may be relevant for an understanding of the biology of aging. False assignment of heterozygosity, and even homozygosity, for certain genetic disorders, such as homocystinuria, may result when low enzyme levels are detected in the lymphocytes of older people. PMID:6940198

  4. Functional analysis of sucrose phosphate synthase (SPS) and sucrose synthase (SS) in sugarcane (Saccharum) cultivars.


    Verma, A K; Upadhyay, S K; Verma, P C; Solomon, S; Singh, S B


    Sucrose phosphate synthase (SPS; EC and sucrose synthase (SS; EC are key enzymes in the synthesis and breakdown of sucrose in sugarcane. The activities of internodal SPS and SS, as well as transcript expression were determined using semi-quantitative RT-PCR at different developmental stages of high and low sucrose accumulating sugarcane cultivars. SPS activity and transcript expression was higher in mature internodes compared with immature internodes in all the studied cultivars. However, high sugar cultivars showed increased transcript expression and enzyme activity of SPS compared to low sugar cultivars at all developmental stages. SS activity was higher in immature internodes than in mature internodes in all cultivars; SS transcript expression showed a similar pattern. Our studies demonstrate that SPS activity was positively correlated with sucrose and negatively correlated with hexose sugars. However, SS activity was negatively correlated with sucrose and positively correlated with hexose sugars. The present study opens the possibility for improvement of sugarcane cultivars by increasing expression of the respective enzymes using transgene technology.

  5. Cloning and characterization of squalene synthase and cycloartenol synthase from Siraitia grosvenorii.


    Zhao, Huan; Tang, Qi; Mo, Changming; Bai, Longhua; Tu, Dongping; Ma, Xiaojun


    Mogrosides and steroid saponins are tetracyclic triterpenoids found in Siraitia grosvenorii. Squalene synthase (SQS) and cycloartenol synthase (CAS) are key enzymes in triterpenoid and steroid biosynthesis. In this study, full-length cDNAs of SgSQS and SgCAS were cloned by a rapid amplification of cDNA-ends with polymerase chain reaction (RACE-PCR) approach. The SgSQS cDNA has a 1254 bp open reading frame (ORF) encoding 417 amino acids, and the SgCAS cDNA contains a 2298 bp ORF encoding 765 amino acids. Bioinformatic analysis showed that the deduced SgSQS protein has two transmembrane regions in the C-terminal. Both SgSQS and SgCAS have significantly higher levels in fruits than in other tissues, suggesting that steroids and mogrosides are competitors for the same precursors in fruits. Combined in silico prediction and subcellular localization, experiments in tobacco indicated that SgSQS was probably in the cytoplasm or on the cytoskeleton, and SgCAS was likely located in the nucleus or cytosol. These results will provide a foundation for further study of SgSQS and SgCAS gene functions in S. grosvenorii, and may facilitate improvements in mogroside content in fruit by regulating gene expression.

  6. Binding modes of zaragozic acid A to human squalene synthase and staphylococcal dehydrosqualene synthase.


    Liu, Chia-I; Jeng, Wen-Yih; Chang, Wei-Jung; Ko, Tzu-Ping; Wang, Andrew H-J


    Zaragozic acids (ZAs) belong to a family of fungal metabolites with nanomolar inhibitory activity toward squalene synthase (SQS). The enzyme catalyzes the committed step of sterol synthesis and has attracted attention as a potential target for antilipogenic and antiinfective therapies. Here, we have determined the structure of ZA-A complexed with human SQS. ZA-A binding induces a local conformational change in the substrate binding site, and its C-6 acyl group also extends over to the cofactor binding cavity. In addition, ZA-A effectively inhibits a homologous bacterial enzyme, dehydrosqualene synthase (CrtM), which synthesizes the precursor of staphyloxanthin in Staphylococcus aureus to cope with oxidative stress. Size reduction at Tyr(248) in CrtM further increases the ZA-A binding affinity, and it reveals a similar overall inhibitor binding mode to that of human SQS/ZA-A except for the C-6 acyl group. These structures pave the way for further improving selectivity and development of a new generation of anticholesterolemic and antimicrobial inhibitors.

  7. Identification of a Dolabellane Type Diterpene Synthase and other Root-Expressed Diterpene Synthases in Arabidopsis

    PubMed Central

    Wang, Qiang; Jia, Meirong; Huh, Jung-Hyun; Muchlinski, Andrew; Peters, Reuben J.; Tholl, Dorothea


    Arabidopsis thaliana maintains a complex metabolism for the production of secondary or specialized metabolites. Such metabolites include volatile and semivolatile terpenes, which have been associated with direct and indirect defensive activities in flowers and leaves. In comparison, the structural diversity and function of terpenes in Arabidopsis roots has remained largely unexplored despite a substantial number of root-expressed genes in the Arabidopsis terpene synthase (TPS) gene family. We show that five root-expressed TPSs of an expanded subfamily-a type clade in the Arabidopsis TPS family function as class I diterpene synthases that predominantly convert geranylgeranyl diphosphate (GGPP) to different semi-volatile diterpene products, which are in part detectable at low levels in the ecotypes Columbia (Col) and Cape Verde Island (Cvi). The enzyme TPS20 produces a macrocyclic dolabellane diterpene alcohol and a dolabellane-related diterpene olefin named dolathaliatriene with a so far unknown C6-C11 bicyclic scaffold besides several minor olefin products. The TPS20 compounds occur in all tissues of Cvi but are absent in the Col ecotype because of deletion and substitution mutations in the Col TPS20 sequence. The primary TPS20 diterpene products retard the growth of the root rot pathogen Pythium irregulare but only at concentrations exceeding those in planta. Together, our results demonstrate that divergence and pseudogenization in the Arabidopsis TPS gene family allow for structural plasticity in diterpene profiles of above- and belowground tissues. PMID:27933080

  8. The rice ent-KAURENE SYNTHASE LIKE 2 encodes a functional ent-beyerene synthase.


    Tezuka, Daisuke; Ito, Akira; Mitsuhashi, Wataru; Toyomasu, Tomonobu; Imai, Ryozo


    The rice genome contains a family of kaurene synthase-like (OsKSL) genes that are responsible for the biosynthesis of various diterpenoids, including gibberellins and phytoalexins. While many OsKSL genes have been functionally characterized, the functionality of OsKSL2 is still unclear and it has been proposed to be a pseudogene. Here, we found that OsKSL2 is drastically induced in roots by methyl jasmonate treatment and we successfully isolated a full-length cDNA for OsKSL2. Sequence analysis of the OsKSL2 cDNA revealed that the open reading frame of OsKSL2 is mispredicted in the two major rice genome databases, IRGSP-RAP and MSU-RGAP. In vitro conversion assay indicated that recombinant OsKSL2 catalyzes the cyclization of ent-CDP into ent-beyerene as a major and ent-kaurene as a minor product. ent-Beyerene is an antimicrobial compound and OsKSL2 is induced by methyl jasmonate; these data suggest that OsKSL2 is a functional ent-beyerene synthase that is involved in defense mechanisms in rice roots.

  9. Modulation of ceramide synthase activity via dimerization.


    Laviad, Elad L; Kelly, Samuel; Merrill, Alfred H; Futerman, Anthony H


    Ceramide, the backbone of all sphingolipids, is synthesized by a family of ceramide synthases (CerS) that each use acyl-CoAs of defined chain length for N-acylation of the sphingoid long chain base. CerS mRNA expression and enzymatic activity do not always correlate with the sphingolipid acyl chain composition of a particular tissue, suggesting post-translational mechanism(s) of regulation of CerS activity. We now demonstrate that CerS activity can be modulated by dimer formation. Under suitable conditions, high M(r) CerS complexes can be detected by Western blotting, and various CerS co-immunoprecipitate. CerS5 activity is inhibited in a dominant-negative fashion by co-expression with catalytically inactive CerS5, and CerS2 activity is enhanced by co-expression with a catalytically active form of CerS5 or CerS6. In a constitutive heterodimer comprising CerS5 and CerS2, the activity of CerS2 depends on the catalytic activity of CerS5. Finally, CerS dimers are formed upon rapid stimulation of ceramide synthesis by curcumin. Together, these data demonstrate that ceramide synthesis can be regulated by the formation of CerS dimers and suggest a novel way to generate the acyl chain composition of ceramide (and downstream sphingolipids), which may depend on the interaction of CerS with each other.

  10. Nitric oxide synthases: structure, function and inhibition.

    PubMed Central

    Alderton, W K; Cooper, C E; Knowles, R G


    This review concentrates on advances in nitric oxide synthase (NOS) structure, function and inhibition made in the last seven years, during which time substantial advances have been made in our understanding of this enzyme family. There is now information on the enzyme structure at all levels from primary (amino acid sequence) to quaternary (dimerization, association with other proteins) structure. The crystal structures of the oxygenase domains of inducible NOS (iNOS) and vascular endothelial NOS (eNOS) allow us to interpret other information in the context of this important part of the enzyme, with its binding sites for iron protoporphyrin IX (haem), biopterin, L-arginine, and the many inhibitors which interact with them. The exact nature of the NOS reaction, its mechanism and its products continue to be sources of controversy. The role of the biopterin cofactor is now becoming clearer, with emerging data implicating one-electron redox cycling as well as the multiple allosteric effects on enzyme activity. Regulation of the NOSs has been described at all levels from gene transcription to covalent modification and allosteric regulation of the enzyme itself. A wide range of NOS inhibitors have been discussed, interacting with the enzyme in diverse ways in terms of site and mechanism of inhibition, time-dependence and selectivity for individual isoforms, although there are many pitfalls and misunderstandings of these aspects. Highly selective inhibitors of iNOS versus eNOS and neuronal NOS have been identified and some of these have potential in the treatment of a range of inflammatory and other conditions in which iNOS has been implicated. PMID:11463332

  11. Tertiary model of a plant cellulose synthase

    PubMed Central

    Sethaphong, Latsavongsakda; Haigler, Candace H.; Kubicki, James D.; Zimmer, Jochen; Bonetta, Dario; DeBolt, Seth; Yingling, Yaroslava G.


    A 3D atomistic model of a plant cellulose synthase (CESA) has remained elusive despite over forty years of experimental effort. Here, we report a computationally predicted 3D structure of 506 amino acids of cotton CESA within the cytosolic region. Comparison of the predicted plant CESA structure with the solved structure of a bacterial cellulose-synthesizing protein validates the overall fold of the modeled glycosyltransferase (GT) domain. The coaligned plant and bacterial GT domains share a six-stranded β-sheet, five α-helices, and conserved motifs similar to those required for catalysis in other GT-2 glycosyltransferases. Extending beyond the cross-kingdom similarities related to cellulose polymerization, the predicted structure of cotton CESA reveals that plant-specific modules (plant-conserved region and class-specific region) fold into distinct subdomains on the periphery of the catalytic region. Computational results support the importance of the plant-conserved region and/or class-specific region in CESA oligomerization to form the multimeric cellulose–synthesis complexes that are characteristic of plants. Relatively high sequence conservation between plant CESAs allowed mapping of known mutations and two previously undescribed mutations that perturb cellulose synthesis in Arabidopsis thaliana to their analogous positions in the modeled structure. Most of these mutation sites are near the predicted catalytic region, and the confluence of other mutation sites supports the existence of previously undefined functional nodes within the catalytic core of CESA. Overall, the predicted tertiary structure provides a platform for the biochemical engineering of plant CESAs. PMID:23592721

  12. Nitric oxide synthase in cardiac sarcoplasmic reticulum.


    Xu, K Y; Huso, D L; Dawson, T M; Bredt, D S; Becker, L C


    NO. is a free radical that modulates heart function and metabolism. We report that a neuronal-type NO synthase (NOS) is located on cardiac sarcoplasmic reticulum (SR) membrane vesicles and that endogenous NO. produced by SR-associated NOS inhibits SR Ca2+ uptake. Ca2+-dependent biochemical conversion of L-arginine to L-citrulline was observed from isolated rabbit cardiac SR vesicles in the presence of NOS substrates and cofactors. Endogenous NO. was generated from the vesicles and detected by electron paramagnetic resonance spin-trapping measurements. Immunoelectron microscopy demonstrated labeling of cardiac SR vesicles by using anti-neuronal NOS (nNOS), but not anti-endothelial NOS (eNOS) or anti-inducible NOS (iNOS) antibodies, whereas skeletal muscle SR vesicles had no nNOS immunoreactivity. The nNOS immunoreactivity also displayed a pattern consistent with SR localization in confocal micrographs of sections of human myocardium. Western blotting demonstrated that cardiac SR NOS is larger than brain NOS (160 vs. 155 kDa). No immunodetection was observed in cardiac SR vesicles from nNOS knockout mice or with an anti-nNOS mu antibody, suggesting the possibility of a new nNOS-type isoform. 45Ca uptake by cardiac SR vesicles, catalyzed by Ca2+-ATPase, was inhibited by NO. produced endogenously from cardiac SR NOS, and 7-nitroindazole, a selective nNOS inhibitor, completely prevented this inhibition. These results suggest that a cardiac muscle nNOS isoform is located on SR of cardiac myocytes, where it may respond to intracellular Ca2+ concentration and modulate SR Ca2+ ion active transport in the heart.

  13. Nitric oxide synthase in cardiac sarcoplasmic reticulum

    PubMed Central

    Xu, Kai Y.; Huso, David L.; Dawson, Ted M.; Bredt, David S.; Becker, Lewis C.


    NO⋅ is a free radical that modulates heart function and metabolism. We report that a neuronal-type NO synthase (NOS) is located on cardiac sarcoplasmic reticulum (SR) membrane vesicles and that endogenous NO⋅ produced by SR-associated NOS inhibits SR Ca2+ uptake. Ca2+-dependent biochemical conversion of l-arginine to l-citrulline was observed from isolated rabbit cardiac SR vesicles in the presence of NOS substrates and cofactors. Endogenous NO⋅ was generated from the vesicles and detected by electron paramagnetic resonance spin-trapping measurements. Immunoelectron microscopy demonstrated labeling of cardiac SR vesicles by using anti-neuronal NOS (nNOS), but not anti-endothelial NOS (eNOS) or anti-inducible NOS (iNOS) antibodies, whereas skeletal muscle SR vesicles had no nNOS immunoreactivity. The nNOS immunoreactivity also displayed a pattern consistent with SR localization in confocal micrographs of sections of human myocardium. Western blotting demonstrated that cardiac SR NOS is larger than brain NOS (160 vs. 155 kDa). No immunodetection was observed in cardiac SR vesicles from nNOS knockout mice or with an anti-nNOSμ antibody, suggesting the possibility of a new nNOS-type isoform. 45Ca uptake by cardiac SR vesicles, catalyzed by Ca2+-ATPase, was inhibited by NO⋅ produced endogenously from cardiac SR NOS, and 7-nitroindazole, a selective nNOS inhibitor, completely prevented this inhibition. These results suggest that a cardiac muscle nNOS isoform is located on SR of cardiac myocytes, where it may respond to intracellular Ca2+ concentration and modulate SR Ca2+ ion active transport in the heart. PMID:9892689

  14. In vivo enzyme immobilization by use of engineered polyhydroxyalkanoate synthase.


    Peters, Verena; Rehm, Bernd H A


    This study demonstrated that engineered polyhydroxyalkanoate (PHA) synthases can be employed as molecular tools to covalently immobilize enzymes at the PHA granule surface. The beta-galactosidase was fused to the N terminus of the class II PHA synthase from Pseudomonas aeruginosa. The open reading frame was confirmed to encode the complete fusion protein by T7 promoter-dependent overexpression. Restoration of PHA biosynthesis in the PHA-negative mutant of P. aeruginosa PAO1 showed a PHA synthase function of the fusion protein. PHA granules were isolated and showed beta-galactosidase activity. PHA granule attached proteins were analyzed and confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and matrix-assisted laser desorption ionization-time of flight mass spectrometry. Surprisingly, the beta-galactosidase-PHA synthase fusion protein was detectable at a high copy number at the PHA granule, compared with PHA synthase alone, which was barely detectable at PHA granules. Localization of the beta-galactosidase at the PHA granule surface was confirmed by enzyme-linked immunosorbent assay using anti-beta-galactosidase antibodies. Treatment of these beta-galactosidase-PHA granules with urea suggested a covalent binding of the beta-galactosidase-PHA synthase to the PHA granule. The immobilized beta-galactosidase was enzymologically characterized, suggesting a Michaelis-Menten reaction kinetics. A Km of 630 microM and a Vmax of 17.6 nmol/min for orthonitrophenyl-beta-D-galactopyranoside as a substrate was obtained. The immobilized beta-galactosidase was stable for at least several months under various storage conditions. This study demonstrated that protein engineering of PHA synthase enables the manufacture of PHA granules with covalently attached enzymes, suggesting an application in recycling of biocatalysts, such as in fine-chemical production.

  15. Expression and characterization of glycogen synthase kinase-3 mutants and their effect on glycogen synthase activity in intact cells.

    PubMed Central

    Eldar-Finkelman, H; Argast, G M; Foord, O; Fischer, E H; Krebs, E G


    In these studies we expressed and characterized wild-type (WT) GSK-3 (glycogen synthase kinase-3) and its mutants, and examined their physiological effect on glycogen synthase activity. The GSK-3 mutants included mutation at serine-9 either to alanine (S9A) or glutamic acid (S9E) and an inactive mutant, K85,86MA. Expression of WT and the various mutants in a cell-free system indicated that S9A and S9E exhibit increased kinase activity as compared with WT. Subsequently, 293 cells were transiently transfected with WT GSK-3 and mutants. Cells expressing the S9A mutant exhibited higher kinase activity (2.6-fold of control cells) as compared with cells expressing WT and S9E (1.8- and 2.0-fold, respectively, of control cells). Combined, these results suggest serine-9 as a key regulatory site of GSK-3 inactivation, and indicate that glutamic acid cannot mimic the function of the phosphorylated residue. The GSK-3-expressing cell system enabled us to examine whether GSK-3 can induce changes in the endogenous glycogen synthase activity. A decrease in glycogen synthase activity (50%) was observed in cells expressing the S9A mutant. Similarly, glycogen synthase activity was suppressed in cells expressing WT and the S9E mutant (20-30%, respectively). These studies indicate that activation of GSK-3 is sufficient to inhibit glycogen synthase in intact cells, and provide evidence supporting a physiological role for GSK-3 in regulating glycogen synthase and glycogen metabolism. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8816781

  16. Insulin stimulation of glycogen synthase in cultured human diploid fibroblasts.


    Hidaka, H; Howard, B V; Kosmakos, F C; Fields, R M; Craig, J W; Bennett, P H; Larner, J


    The effect of insulin on glycogen synthase activity in human diploid fibroblasts has been studied. As little as 2 X 10(-10) M insulin increased the glycogen synthase / activity without changing the total activity. Stimulation occurred within 5 min and became maximal in 30 min. A half-maximal increase of / activity was achieved at 3 X 10(-9) M insulin. Glucose starvation increased the magnitude of response of glycogen synthase to insulin but did not change the insulin concentration necessary to give a half-maximal stimulation. Glucose increased the basal level of / activity in human diploid fibroblasts; the effect of insulin was additive. During in vitro senescence the total glycogen synthase activity declined, but the concentration of insulin that produced a half-maximal stimulation remained unchanged. These data indicate that regulation of glycogen synthase activity in human diploid fibroblasts is responsive to physiologic insulin levels and that the system provides a useful model for the in vitro study of insulin sensitivity.

  17. Heterologous expression of an active chitin synthase from Rhizopus oryzae.


    Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José


    Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly.

  18. ATP synthases: cellular nanomotors characterized by LILBID mass spectrometry

    PubMed Central

    Hoffmann, Jan; Sokolova, Lucie; Preiss, Laura; Hicks, David B.; Krulwich, Terry A.; Morgner, Nina; Wittig, Ilka; Schägger, Hermann; Meier, Thomas; Brutschy, Bernd


    Mass spectrometry of membrane protein complexes is still a methodological challenge due to hydrophobic and hydrophilic parts of the species and the fact that all subunits are bound non-covalently together. The present study with the novel laser induced liquid bead ion desorption mass spectrometry (LILBID-MS) reports on the determination of the subunit composition of the F1Fo-ATP synthase from Bacillus pseudofirmus OF4, that of both bovine heart and, for the first time, of human heart mitochondrial F1Fo-ATP synthases. Under selected buffer conditions the mass of the intact F1Fo-ATP synthase of B. pseudofirmus OF4 could be measured, allowing the analysis of complex subunit stoichiometry. The agreement with theoretical masses derived from sequence databases is very good. A comparison of the ATP synthase subunit composition of 5 different ATPases reveals differences in the complexity of eukaryotic and bacterial ATP synthases. However, whereas the overall construction of eukaryotic enzymes is more complex than the bacterial ones, functionally important subunits are conserved among all ATPases. PMID:20820587

  19. Identification of two distinct Bacillus subtilis citrate synthase genes.


    Jin, S; Sonenshein, A L


    Two distinct Bacillus subtilis genes (citA and citZ) were found to encode citrate synthase isozymes that catalyze the first step of the Krebs cycle. The citA gene was cloned by genetic complementation of an Escherichia coli citrate synthase mutant strain (W620) and was in a monocistronic transcriptional unit. A divergently transcribed gene, citR, could encode a protein with strong similarity to the bacterial LysR family of regulatory proteins. A null mutation in citA had little effect on citrate synthase enzyme activity or sporulation. The residual citrate synthase activity was purified from a citA null mutant strain, and the partial amino acid sequence for the purified protein (CitZ) was determined. The citZ gene was cloned from B. subtilis chromosomal DNA by using a PCR-generated probe synthesized with oligonucleotide primers derived from the partial amino acid sequence of purified CitZ. The citZ gene proved to be the first gene in a tricistronic cluster that also included citC (coding for isocitrate dehydrogenase) and citH (coding for malate dehydrogenase). A mutation in citZ caused a substantial loss of citrate synthase enzyme activity, glutamate auxotrophy, and a defect in sporulation.

  20. Diversity of sesquiterpene synthases in the basidiomycete Coprinus cinereus

    PubMed Central

    Agger, Sean; Lopez-Gallego, Fernando; Schmidt-Dannert, Claudia


    SUMMARY Fungi are a rich source of bioactive secondary metabolites and mushroom-forming fungi (Agaricomycetes) are especially known for the synthesis of numerous bioactive and often cytotoxic sesquiterpenoid secondary metabolites. Compared to the large number of sesquiterpene synthases identified in plants, less than a handful of unique sesquiterpene synthases have been described from fungi. Here we describe the functional characterization of six sesquiterpene synthases (Cop1 to Cop6) and two terpene oxidizing cytochrome P450 monooxygenases (Cox1 and Cox2) from Coprinus cinereus. The genes were cloned and, except for cop5, functionally expressed in Escherichia coli and/or Saccharomyces cerevisiae. Cop1 and Cop2 each synthesize germacrene A as the major product. Cop3 was identified as a α-muurolene synthase, an enzyme that has not been described previously, while Cop4 synthesizes δ-cadinene as its major product. Cop6 was originally annotated as a trichodiene synthase homolog, but instead was found to catalyze highly specific the synthesis of α-cuprenene. Co-expression of cop6 and the two monooxygenase genes next to it yields oxygenated α-cuprenene derivatives, including cuparophenol, suggesting that these genes encode the enzymes for the biosynthesis of antimicrobial quinone sesquiterpenoids (known as lagopodins) that were previously isolated from C. cinereus and other Coprinus species. PMID:19400802

  1. Diversity of sesquiterpene synthases in the basidiomycete Coprinus cinereus.


    Agger, Sean; Lopez-Gallego, Fernando; Schmidt-Dannert, Claudia


    Fungi are a rich source of bioactive secondary metabolites, and mushroom-forming fungi (Agaricomycetes) are especially known for the synthesis of numerous bioactive and often cytotoxic sesquiterpenoid secondary metabolites. Compared with the large number of sesquiterpene synthases identified in plants, less than a handful of unique sesquiterpene synthases have been described from fungi. Here we describe the functional characterization of six sesquiterpene synthases (Cop1 to Cop6) and two terpene-oxidizing cytochrome P450 monooxygenases (Cox1 and Cox2) from Coprinus cinereus. The genes were cloned and, except for cop5, functionally expressed in Escherichia coli and/or Saccharomyces cerevisiae. Cop1 and Cop2 each synthesize germacrene A as the major product. Cop3 was identified as an alpha-muurolene synthase, an enzyme that has not been described previously, while Cop4 synthesizes delta-cadinene as its major product. Cop6 was originally annotated as a trichodiene synthase homologue but instead was found to catalyse the highly specific synthesis of alpha-cuprenene. Coexpression of cop6 and the two monooxygenase genes next to it yields oxygenated alpha-cuprenene derivatives, including cuparophenol, suggesting that these genes encode the enzymes for the biosynthesis of antimicrobial quinone sesquiterpenoids (known as lagopodins) that were previously isolated from C. cinereus and other Coprinus species.

  2. Comparative hydrogen-deuterium exchange for a mesophilic vs thermophilic dihydrofolate reductase at 25 °C: identification of a single active site region with enhanced flexibility in the mesophilic protein.


    Oyeyemi, Olayinka A; Sours, Kevin M; Lee, Thomas; Kohen, Amnon; Resing, Katheryn A; Ahn, Natalie G; Klinman, Judith P


    The technique of hydrogen-deuterium exchange coupled to mass spectrometry (HDX-MS) has been applied to a mesophilic (E. coli) dihydrofolate reductase under conditions that allow direct comparison to a thermophilic (B. stearothermophilus) ortholog, Ec-DHFR and Bs-DHFR, respectively. The analysis of hydrogen-deuterium exchange patterns within proteolytically derived peptides allows spatial resolution, while requiring a series of controls to compare orthologous proteins with only ca. 40% sequence identity. These controls include the determination of primary structure effects on intrinsic rate constants for HDX as well as the use of existing 3-dimensional structures to evaluate the distance of each backbone amide hydrogen to the protein surface. Only a single peptide from the Ec-DHFR is found to be substantially more flexible than the Bs-DHFR at 25 °C in a region located within the protein interior at the intersection of the cofactor and substrate-binding sites. The surrounding regions of the enzyme are either unchanged or more flexible in the thermophilic DHFR from B. stearothermophilus. The region with increased flexibility in Ec-DHFR corresponds to one of two regions previously proposed to control the enthalpic barrier for hydride transfer in Bs-DHFR [Oyeyemi et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 10074].

  3. An affinity selection-mass spectrometry method for the identification of small molecule ligands from self-encoded combinatorial libraries: Discovery of a novel antagonist of E. coli dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Annis, D. Allen; Athanasopoulos, John; Curran, Patrick J.; Felsch, Jason S.; Kalghatgi, Krishna; Lee, William H.; Nash, Huw M.; Orminati, Jean-Paul A.; Rosner, Kristin E.; Shipps, Gerald W., Jr.; Thaddupathy, G. R. A.; Tyler, Andrew N.; Vilenchik, Lev; Wagner, Carston R.; Wintner, Edward A.


    The NeoGenesis Automated Ligand Identification System (ALIS), an affinity selection-mass spectrometry (AS-MS) process consisting of a rapid size-exclusion chromatography stage integrated with reverse-phase chromatography, electrospray mass spectrometry, and novel data searching algorithms, was used to screen mass-encoded, 2500-member combinatorial libraries, leading to the discovery of a novel, bioactive ligand for the anti-infective target Escherichia coli dihydrofolate reductase (DHFR). Synthesis of the mass-encoded, ligand-containing library, discussion of the deconvolution process for verifying the structure of the ligand through independent synthesis and screening in a small mixture (sub-library) format, and ALIS-MS/MS techniques to assign its regioisomeric connectivity are presented. ALIS-based competition experiments between the newly discovered ligand and other, known DHFR ligands, and biological activity assessments with stereo- and regioisomers of the hit compound confirm its DHFR-specific biological activity. The method described requires no foreknowledge of the structure or biochemistry of the protein target, consumes less than 1 [mu]g protein to screen >2500 compounds in a single experiment, and enables screening of >250,000 compounds per system per day. These advantages highlight the potential of the ALIS method for drug discovery against genomic targets with unknown biological function, as well as validated targets for which traditional discovery efforts have failed.

  4. Methionine synthase and thymidylate synthase gene polymorphisms and colorectal adenoma risk: the self defense forces study.


    Yoshimitsu, Shinichiro; Morita, Makiko; Hamachi, Tadamichi; Tabata, Shinji; Abe, Hiroshi; Tajima, Osamu; Uezono, Kousaku; Ohnaka, Keizo; Kono, Suminori


    Folate-mediated one-carbon metabolism has been implicated in colorectal carcinogenesis. We investigated associations of functional genetic polymorphisms of methionine synthase (MTR), MTR reductase (MTRR), and thymidylate synthase (TS) with colorectal adenomas. The study subjects were 455 cases of colorectal adenomas and 1052 controls with no polyp at colonoscopy. Genotypes were determined for MTR A2756G, MTRR A66G and two polymorphisms in the TS gene, 28-bp tandem repeat polymorphism in the promoter enhancer region (TSER) and 6-bp deletion polymorphism at position 1494 in the 3' untranslated region (TS 1494del6). We also examined the alcohol-genotype and gene-gene interactions on adenoma risk. The GG genotype of MTR A2756G was associated with an increased risk of colorectal adenomas; odds ratios for AG and GG versus AA genotype were 0.99 (95% confidence interval 0.78-1.26) and 1.72 (1.04-2.82), respectively. The increase in the risk associated with MTR 2756GG genotype was evident in men with high alcohol consumption (≥30 mL/d), but not in those with low alcohol consumption (interaction P = 0.03). Men who were homozygous for the TSER double-repeat allele had a slightly decreased risk of colorectal adenomas as compared with those homozygous for the TSER triple-repeat allele. Neither MTRR A66G nor TS 1494del6 was associated with colorectal adenomas. There was no measurable interaction either between MTR A2756G and MTRR A66G or between TSER and TS 1494del6. MTR A2756G appears to be associated with colorectal adenoma risk differently according to alcohol consumption. The MTR-catalyzed reaction may play an important role in the development of colorectal adenomas.

  5. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.


    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric


    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221.

  6. Kinetic characteristics of nitric oxide synthase from rat brain.

    PubMed Central

    Knowles, R G; Palacios, M; Palmer, R M; Moncada, S


    The relationship between the rate of synthesis of nitric oxide (NO) and guanylate cyclase stimulation was used to characterize the kinetics of the NO synthase from rat forebrain and of some inhibitors of this enzyme. The NO synthase had an absolute requirement for L-arginine and NADPH and did not require any other cofactors. The enzyme had a Vmax. of 42 pmol of NO of protein-1 and a Km for L-arginine of 8.4 microM. Three analogues of L-arginine, namely NG-monomethyl-L-arginine, NG-nitro-L-arginine and NG-iminoethyl-L-ornithine inhibited the brain NO synthase. All three compounds were competitive inhibitors of the enzyme with Ki values of 0.7, 0.4 and 1.2 microM respectively. PMID:1695842

  7. Properties of peroxisomal and mitochondrial citrate synthase from Agave americana.


    Segovia, J L; Zafra, M F; Alejandre, M J; García-Peregrín, E


    Adenine nucleotides were tested as effectors of peroxisomal and mitochondrial citrate synthase from Agave americana leaves in the presence of different concentrations of acetyl-CoA and oxalacetate substrates. ATP inhibited both enzyme activities but with a different inhibition profile. 1.0-7.5 mM ADP did not inhibit the peroxisomal citrate synthase in the presence of high substrate concentrations, while the mitochondrial enzyme was strongly inhibited by 1.0 mM ADP in the same conditions. Likewise, a different pattern was obtained with AMP on both peroxisomal and mitochondrial activities. The rate of citrate formation as function of acetyl-CoA and oxalacetate concentration was also studied in both fractions. Maximal velocity was highest in the peroxisomal fraction, whether acetyl-CoA or oxalacetate were the variable substrates. These differences indicate that peroxisomal and mitochondrial citrate synthases seem to be two different isoenzymes.

  8. Synthase-dependent exopolysaccharide secretion in Gram-negative bacteria

    PubMed Central

    Whitney, J.C.; Howell, P.L.


    The biosynthesis and export of bacterial cell-surface polysaccharides is known to occur through several distinct mechanisms. Recent advances in the biochemistry and structural biology of several proteins in synthase-dependent polysaccharide secretion systems have identified key conserved components of this pathway in Gram-negative bacteria. These components include an inner-membrane-embedded polysaccharide synthase, a periplasmic tetratricopeptide repeat (TPR)-containing scaffold protein, and an outer-membrane β-barrel porin. There is also increasing evidence that many synthase-dependent systems are post-translationally regulated by the bacterial second messenger bis-(3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP). Here, we compare these core proteins in the context of the alginate, cellulose, and poly-β-D-N-acetylglucosamine (PNAG) secretion systems. PMID:23117123

  9. The hyaluronate synthase from a eukaryotic cell line.

    PubMed Central

    Klewes, L; Turley, E A; Prehm, P


    The hyaluronate synthase complex was identified in plasma membranes from B6 cells. It contained two subunits of molecular masses 52 kDa and 60 kDa which bound the precursor UDP-GlcA in digitonin solution and partitioned into the aqueous phase, together with nascent hyaluronate upon Triton X-114 phase separation. The 52 kDa protein cross-reacted with poly- and monoclonal antibodies raised against the streptococcal hyaluronate synthase and the 60 kDa protein was recognized by monoclonal antibodies raised against a hyaluronate receptor. The 52 kDa protein was purified to homogeneity by affinity chromatography with monoclonal anti-hyaluronate synthase. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 7 PMID:8457208

  10. SbnG, a Citrate Synthase in Staphylococcus aureus

    PubMed Central

    Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.


    In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653

  11. Utility of Aspergillus niger citrate synthase promoter for heterologous expression.


    Dave, Kashyap; Punekar, Narayan S


    Citrate synthase is a central player in the acidogenic metabolism of Aspergillus niger. The 5' upstream sequence (0.9kb DNA) of citrate synthase gene (citA) from A. niger NCIM 565 was analyzed and its promoter function demonstrated through the heterologous expression of two proteins. The cloned citrate synthase promoter (PcitA) sequence was able to express bar coding sequence thereby conferring phosphinothricin resistance. This sequence was further analyzed by systematic deletions to define an effective but compact functional promoter. The PcitA driven egfp expression showed that PcitA was active in all differentiation cell-stages of A. niger. EGFP expression was highest on non-repressible carbon sources like acetate and glycerol. Mycelial EGFP levels increased during acidogenic growth suggesting that PcitA is functional throughout this cultivation. A. niger PcitA is the first Krebs cycle gene promoter used to express heterologous proteins in filamentous fungi.

  12. Allosteric regulation of glycogen synthase in liver. A physiological dilemma.


    Nuttall, F Q; Gannon, M C


    Glycogen synthase catalyzes the transfer of the glucosyl moiety from UDP-glucose to the terminal branch of the glycogen molecule and is considered to be the rate-limiting enzyme for glycogen synthesis. However, under ideal assay conditions, i.e. 37 degrees C with saturating concentrations of UDP-glucose and the activator, glucose-6-P, the maximal catalytic activity of glycogen synthase was only 78% of the in vivo glycogen synthetic rate. Using concentrations of UDP-glucose and glucose-6-P likely to be present in vivo, the rate was only approximately 30%. This prompted us to reassess a possible role of allosteric effectors on synthase activity. Glycogen synthase was assayed at 37 degrees C using dilute, pH 7.0, buffered extracts, initial rate conditions, and UDP-glucose and glucose-6-P concentrations, which approximate those calculated to be present in total liver cell water. Several allosteric effectors were tested. Magnesium and AMP had little effect on activity. Pi, ADP, ATP, and UTP inhibited activity. When a combination of effectors were added at concentrations approximating those present in cell water, synthase activity could account for only 2% of the glycogen synthetic rate. Thus, although allosteric effectors are likely to be playing a major role in regulating synthase enzymic activity in liver cells, to date, a metabolite that can stimulate activity and/or overcome nucleotide inhibition has yet to be identified. If such a metabolite cannot be identified, an additional or alternative pathway for glycogen synthesis must be considered.

  13. Brucella spp. lumazine synthase: a novel antigen delivery system.


    Sciutto, Edda; Toledo, Andrea; Cruz, Carmen; Rosas, Gabriela; Meneses, Gabriela; Laplagne, Diego; Ainciart, Natalia; Cervantes, Jacquelynne; Fragoso, Gladis; Goldbaum, Fernando A


    Lumazine synthase from Brucella spp. (BLS) was evaluated as a protein carrier to improve antigen delivery of KETc1, one of the peptides of the anti-cysticercosis vaccine. KETc1 becomes antigenic, preserved its immunogenicity and its protective capacity when expressed as a recombinant chimeric protein using Brucella spp. lumazine synthase. KETc1 and BLS-KETc1 were not MHC H-2(d), H-2(k) nor H-2(b) haplotype-restricted albeit KETc1 is preferentially presented in the H-2(b) haplotype. These findings support that BLS is a potent new delivery system for the improvement of subunit vaccines.

  14. Molecular aspects of beta-ketoacyl synthase (KAS) catalysis.


    von Wettstein-Knowles, P; Olsen, J; Arnvig Mcguire, K; Larsen, S


    Crystal structure data for Escherichia coli beta-ketoacyl synthase (KAS) I with C(10) and C(12) fatty acid substrates bound in conjunction with results from mutagenizing residues in the active site leads to a model for catalysis. Differences from and similarities to the other Claisen enzymes carrying out decarboxylations reveal two catalytic mechanisms, one for KAS I and KAS II, the other for KAS III and chalcone synthase. A comparison of the structures of KAS I and KAS II does not reveal the basis of chain-length specificity. The structures of the Arabidopsis thaliana KAS family are compared.

  15. Engineered biosynthesis of plant polyketides: manipulation of chalcone synthase.


    Abe, Ikuro; Watanabe, Tatsuya; Morita, Hiroyuki; Kohno, Toshiyuki; Noguchi, Hiroshi


    [reaction: see text]. Chalcone synthase (CHS) is a plant-specific type III polyketide synthase catalyzing condensation of 4-coumaroyl-CoA with three molecules of malonyl-CoA. Surprisingly, it was demonstrated that S338V mutant of Scutellaria baicalensis CHS produced octaketides SEK4/SEK4b from eight molecules of malonyl-CoA. Further, the octaketides-forming activity was dramatically increased in a CHS triple mutant (T197G/G256L/S338T). The functional conversion is based on the simple steric modulation of a chemically inert residue lining the active-site cavity.

  16. Analysis of the cercosporin polyketide synthase CTB1 reveals a new fungal thioesterase function

    PubMed Central

    Newman, Adam G.; Vagstad, Anna L.; Belecki, Katherine; Scheerer, Jonathan R.


    The polyketide synthase CTB1 is demonstrated to catalyze pyrone formation thereby expanding the known biosynthetic repertoire of thioesterase domains in iterative, non-reducing polyketide synthases. PMID:23108075

  17. Benzophenone Synthase and Chalcone Synthase Accumulate in the Mesophyll of Hypericum perforatum Leaves at Different Developmental Stages.


    Belkheir, Asma K; Gaid, Mariam; Liu, Benye; Hänsch, Robert; Beerhues, Ludger


    The active medicinal constituents in Hypericum perforatum, used to treat depression and skin irritation, include flavonoids and xanthones. The carbon skeletons of these compounds are formed by chalcone synthase (CHS) and benzophenone synthase (BPS), respectively. Polyclonal antisera were raised against the polyketide synthases from Hypericum androsaemum and their IgG fractions were isolated. Immunoblotting and immunotitration were used to test the IgGs for crossreactivity and monospecificity in H. perforatum leaf protein extract. Immunofluorescence localization revealed that both CHS and BPS are located in the mesophyll. The maximum fluorescence levels were observed in approx. 0.5 and 1 cm long leaves, respectively. The fluorescence intensity observed for CHS significantly exceeded that for BPS. Using histochemical staining, flavonoids were detected in the mesophyll, indicating that the sites of biosynthesis and accumulation coincide. Our results help understand the biosynthesis and underlying regulation of active H. perforatum constituents.

  18. Benzophenone Synthase and Chalcone Synthase Accumulate in the Mesophyll of Hypericum perforatum Leaves at Different Developmental Stages

    PubMed Central

    Belkheir, Asma K.; Gaid, Mariam; Liu, Benye; Hänsch, Robert; Beerhues, Ludger


    The active medicinal constituents in Hypericum perforatum, used to treat depression and skin irritation, include flavonoids and xanthones. The carbon skeletons of these compounds are formed by chalcone synthase (CHS) and benzophenone synthase (BPS), respectively. Polyclonal antisera were raised against the polyketide synthases from Hypericum androsaemum and their IgG fractions were isolated. Immunoblotting and immunotitration were used to test the IgGs for crossreactivity and monospecificity in H. perforatum leaf protein extract. Immunofluorescence localization revealed that both CHS and BPS are located in the mesophyll. The maximum fluorescence levels were observed in approx. 0.5 and 1 cm long leaves, respectively. The fluorescence intensity observed for CHS significantly exceeded that for BPS. Using histochemical staining, flavonoids were detected in the mesophyll, indicating that the sites of biosynthesis and accumulation coincide. Our results help understand the biosynthesis and underlying regulation of active H. perforatum constituents. PMID:27446151

  19. Enzymatic proof for the identity of the S-sulfocysteine synthase and cysteine synthase B of Salmonella typhimurium.

    PubMed Central

    Nakamura, T; Iwahashi, H; Eguchi, Y


    S-Sulfocysteine synthase was isolated from Salmonella typhimurium LT-2 to homogeneous form with polyacrylamide gel electrophoresis. The molecular weight of this enzyme was determined to be ca. 55,000. The enzyme consisted of two identically sized subunits, and it contained one pyridoxal phosphate per subunit. The enzyme catalyzed the biosynthesis of cysteine or S-methylcysteine from sulfide or methanethiol and O-acetylserine, respectively, in addition to the formation of S-sulfocysteine from thiosulfate and O-acetylserine. The enzyme is identical to cysteine synthase B. The intracellular level of this enzyme was regulated by lesser extents of the same factors as those effective for cysteine synthase A. Images PMID:6373737

  20. The Remarkable Character of Porphobilinogen Synthase.


    Jaffe, Eileen K


    Porphobilinogen synthase (PBGS), also known as 5-aminolevulinate dehydratase, is an essential enzyme in the biosynthesis of all tetrapyrroles, which function in respiration, photosynthesis, and methanogenesis. Throughout evolution, PBGS adapted to a diversity of cellular niches and evolved to use an unusual variety of metal ions both for catalytic function and to control protein multimerization. With regard to the active site, some PBGSs require Zn(2+); a subset of those, including human PBGS, contain a constellation of cysteine residues that acts as a sink for the environmental toxin Pb(2+). PBGSs that do not require the soft metal ion Zn(2+) at the active site instead are suspected of using the hard metal Mg(2+). The most unexpected property of the PBGS family of enzymes is a dissociative allosteric mechanism that utilizes an equilibrium of architecturally and functionally distinct protein assemblies. The high-activity assembly is an octamer in which intersubunit interactions modulate active-site lid motion. This octamer can dissociate to dimer, the dimer can undergo a hinge twist, and the twisted dimer can assemble to a low-activity hexamer. The hexamer does not have the intersubunit interactions required to stabilize a closed conformation of the active site lid. PBGS active site chemistry benefits from a closed lid because porphobilinogen biosynthesis includes Schiff base formation, which requires deprotonated lysine amino groups. N-terminal and C-terminal sequence extensions dictate whether a specific species of PBGS can sample the hexameric assembly. The bulk of species (nearly all except animals and yeasts) use Mg(2+) as an allosteric activator. Mg(2+) functions allosterically by binding to an intersubunit interface that is present in the octamer but absent in the hexamer. This conformational selection allosteric mechanism is purported to be essential to avoid the untimely accumulation of phototoxic chlorophyll precursors in plants. For those PBGSs that do

  1. Characterization of spermidine synthase and spermine synthase--The polyamine-synthetic enzymes that induce early flowering in Gentiana triflora.


    Imamura, Tomohiro; Fujita, Kohei; Tasaki, Keisuke; Higuchi, Atsumi; Takahashi, Hideyuki


    Polyamines are essential for several living processes in plants. However, regulatory mechanisms of polyamines in herbaceous perennial are almost unknown. Here, we identified homologs of two Arabidopsis polyamine-synthetic enzymes, spermidine synthase (SPDS) and spermine synthase (SPMS) denoted as GtSPDS and GtSPMS, from the gentian plant, Gentiana triflora. Our results showed that recombinant proteins of GtSPDS and GtSPMS possessed SPDS and SPMS activities, respectively. The expression levels of GtSPDS and GtSPMS increased transiently during vegetative to reproductive growth phase and overexpression of the genes hastened flowering, suggesting that these genes are involved in flowering induction in gentian plants.

  2. Benzophenone synthase and chalcone synthase from Hypericum androsaemum cell cultures: cDNA cloning, functional expression, and site-directed mutagenesis of two polyketide synthases.


    Liu, Benye; Falkenstein-Paul, Hildegard; Schmidt, Werner; Beerhues, Ludger


    Benzophenone derivatives, such as polyprenylated benzoylphloroglucinols and xanthones, are biologically active secondary metabolites. The formation of their C13 skeleton is catalyzed by benzophenone synthase (BPS; EC that has been cloned from cell cultures of Hypericum androsaemum. BPS is a novel member of the superfamily of plant polyketide synthases (PKSs), also termed type III PKSs, with 53-63% amino acid sequence identity. Heterologously expressed BPS was a homodimer with a subunit molecular mass of 42.8 kDa. Its preferred starter substrate was benzoyl-CoA that was stepwise condensed with three malonyl-CoAs to give 2,4,6-trihydroxybenzophenone. BPS did not accept activated cinnamic acids as starter molecules. In contrast, recombinant chalcone synthase (CHS; EC from the same cell cultures preferentially used 4-coumaroyl-CoA and also converted CoA esters of benzoic acids. The enzyme shared 60.1% amino acid sequence identity with BPS. In a phylogenetic tree, the two PKSs occurred in different clusters. One cluster was formed by CHSs including the one from H. androsaemum. BPS grouped together with the PKSs that functionally differ from CHS. Site-directed mutagenesis of amino acids shaping the initiation/elongation cavity of CHS yielded a triple mutant (L263M/F265Y/S338G) that preferred benzoyl-CoA over 4-coumaroyl-CoA.

  3. The polymorphisms in methylenetetrahydrofolate reductase, methionine synthase, methionine synthase reductase, and the risk of colorectal cancer.


    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu


    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results.

  4. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    PubMed Central

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu


    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  5. Isoelectric focusing of wound-induced tomato ACC synthase

    SciTech Connect

    White, J.A.; Kende, H. )


    Several techniques of electrofocusing have been used to determine whether 1-aminocyclopropane-1-carboxylate (ACC) synthase isolated from wounded tomato pericarp tissue exists in different isoforms, each with its characteristic isoelectric point (pI). The pI of the native enzyme was found to be 6.0 {plus minus} 0.2. When radiolabeled, denatured ACC synthase was electrofocused by non-equilibrium pH gradient electrophoresis (NEpHGE), the enzyme separated into four discernible spots which, upon reaching equilibrium, ranged in pI from 6.6 to 6.9. Immunopurified ACC synthase from four tomato cultivars (Duke, Cornell, Mountain Pride and Pik Red) migrated in each case as a 50-kDa protein on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE). We propose that native ACC synthase in extracts of tomato pericarp tissue exists in one single form and that the charge heterogeneities observed upon electrofocusing of denatured enzyme result from modifications of preexisting protein.

  6. Substituted 2-aminopyridines as inhibitors of nitric oxide synthases.


    Hagmann, W K; Caldwell, C G; Chen, P; Durette, P L; Esser, C K; Lanza, T J; Kopka, I E; Guthikonda, R; Shah, S K; MacCoss, M; Chabin, R M; Fletcher, D; Grant, S K; Green, B G; Humes, J L; Kelly, T M; Luell, S; Meurer, R; Moore, V; Pacholok, S G; Pavia, T; Williams, H R; Wong, K K


    A series of substituted 2-aminopyridines was prepared and evaluated as inhibitors of human nitric oxide synthases (NOS). 4,6-Disubstitution enhanced both potency and specificity for the inducible NOS with the most potent compound having an IC50 of 28 nM.

  7. Mammalian fatty acid synthase: closure on a textbook mechanism?


    Leadlay, Peter; Baerga-Ortiz, Abel


    Mammalian fatty acid synthase is a classic example of a chain-building multienzyme. A cornerstone of its mechanism has been the obligatory collaboration of two identical subunits, with fatty acyl intermediates transferring between them. Now, fresh evidence has upset this view.

  8. Biosynthesis of polyketides by trans-AT polyketide synthases.


    Helfrich, Eric J N; Piel, Jörn


    This review discusses the biosynthesis of natural products that are generated by trans-AT polyketide synthases, a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  9. Biosynthesis of polyketides by trans-AT polyketide synthases.


    Piel, Jörn


    This review discusses the biosynthesis of natural products that are generated by trans-AT polyketide synthases, a family of catalytically versatile enzymes that have recently been recognized as one of the major group of proteins involved in the production of bioactive polyketides. 436 references are cited.

  10. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    PubMed Central

    Manczak, Tom; Simonsen, Henrik Toft


    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2 was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s−1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s−1 μM−1 for TgTPS2. The kinetic parameters were in agreement with previously published data. PMID:27721652

  11. Genetics Home Reference: N-acetylglutamate synthase deficiency


    ... of reactions that occurs in liver cells. This cycle processes excess nitrogen, generated when protein is used by the body, to make a compound called urea that is excreted by the kidneys. The ... cycle. In people with N-acetylglutamate synthase deficiency , N- ...

  12. Mechanism-oriented redesign of an isomaltulose synthase to an isomelezitose synthase by site-directed mutagenesis.


    Görl, Julian; Timm, Malte; Seibel, Jürgen


    An isomelezitose synthase was redesigned out of the sucrose isomerase from Protaminobacter rubrum for the synthesis of isomelezitose (6-O(F)-glucosylsucrose), a potential nutraceutical. The variants F297A, F297P, R333K, F321A_F319A and E428D catalyze the formation of isomelezitose in up to 70 % yield.

  13. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    SciTech Connect

    Nicholas C Carpita


    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  14. Transgene silencing of sucrose synthase in alfalfa stem vascular tissue by a truncated phosphoenolpyruvate carboxylase: sucrose synthase construct

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An important role of sucrose synthase (SUS, EC in plants is to provide UDP-glucose needed for cellulose synthesis in cell walls. We examined if over-expressing SUS in alfalfa (Medicago sativa L.) would increase cellulose content of stem cell walls. Alfalfa plants were transformed with two ...

  15. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.


    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis


    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  16. Mechanism of Germacradien-4-ol Synthase-Controlled Water Capture

    PubMed Central


    The sesquiterpene synthase germacradiene-4-ol synthase (GdolS) from Streptomyces citricolor is one of only a few known high-fidelity terpene synthases that convert farnesyl diphosphate (FDP) into a single hydroxylated product. Crystals of unliganded GdolS-E248A diffracted to 1.50 Å and revealed a typical class 1 sesquiterpene synthase fold with the active site in an open conformation. The metal binding motifs were identified as D80DQFD and N218DVRSFAQE. Some bound water molecules were evident in the X-ray crystal structure, but none were obviously positioned to quench a putative final carbocation intermediate. Incubations in H218O generated labeled product, confirming that the alcohol functionality arises from nucleophilic capture of the final carbocation by water originating from solution. Site-directed mutagenesis of amino acid residues from both within the metal binding motifs and without identified by sequence alignment with aristolochene synthase from Aspergillus terreus generated mostly functional germacradien-4-ol synthases. Only GdolS-N218Q generated radically different products (∼50% germacrene A), but no direct evidence of the mechanism of incorporation of water into the active site was obtained. Fluorinated FDP analogues 2F-FDP and 15,15,15-F3-FDP were potent noncompetitive inhibitors of GdolS. 12,13-DiF-FDP generated 12,13-(E)-β-farnesene upon being incubated with GdolS, suggesting stepwise formation of the germacryl cation during the catalytic cycle. Incubation of GdolS with [1-2H2]FDP and (R)-[1-2H]FDP demonstrated that following germacryl cation formation a [1,3]-hydride shift generates the final carbocation prior to nucleophilic capture. The stereochemistry of this shift is not defined, and the deuteron in the final product was scrambled. Because no clear candidate residue for binding of a nucleophilic water molecule in the active site and no significant perturbation of product distribution from the replacement of active site residues were

  17. Kinetic mechanism of rabbit muscle glycogen synthase I.


    Gold, A M


    The kinetic mechanism of rabbit muscle glycogen synthase I was investigated by determining isotope-exchange rates at chemical equilibrium between uridine diphosphoglucose (UDPG) and glycogen and between UDPG and uridine 5'-diphosphate (UDP). The rates were followed simultaneously by use of UDPG labeled with 14C in the glucose moiety and with 3H in the uracil group. They were found to be independent of the concentrations of glycogen and the UDPG-UDP pair, averaging 6 X 10(-9) mol min-1 mg-1, with a ratio of UDPG-glycogen exchange to UDPG-UDP exchange of 0.85-0.95. The conclusion is that glycogen synthase has a rapid equilibrium random bi bi mechanism. The previously reported slow activation of glycogen-free synthase in the presence of glycogen was examined kinetically. The activation rate appears to be independent of glycogen concentration over a wide range, while the maximum activation is related to the third or fourth root of the glycogen concentration. This suggest that the slow bimolecular reaction mechanism proposed for human polymorphonuclear leucocyte glycogen synthase I [Sølling, H., & Esmann, V. (1977) Eur. J. Biochem. 81, 129] does not apply to rabbit muscle synthase I. The rate of exchange of glycogen molecules in the complex between glycogen and rabbit muscle synthase I under conditions where the enzyme is catalytically active was estimated by a novel method. The enzyme-glycogen complex was treated with [glucose-14C]UDPG and glycogen of different molecular weight. The distribution of isotope between the two forms of glycogen was determined after their separation by agarose gel chromatography. A rate constant of 0.3 min-1 was estimated for the exchange. It can be calculated, on the basis of the specific activity of the enzyme (20 mumol min-1 mg-1) and its action pattern, that hundreds of individual chains in the glycogen molecule must be available to the enzyme during the average lifetime of the complex. A mechanism is proposed for this process.

  18. Ectopic expression of ceramide synthase 2 in neurons suppresses neurodegeneration induced by ceramide synthase 1 deficiency

    PubMed Central

    Spassieva, Stefka D.; Ji, Xiaojie; Liu, Ye; Gable, Kenneth; Bielawski, Jacek; Dunn, Teresa M.; Bieberich, Erhard; Zhao, Lihong


    Sphingolipids exhibit extreme functional and chemical diversity that is in part determined by their hydrophobic moiety, ceramide. In mammals, the fatty acyl chain length variation of ceramides is determined by six (dihydro)ceramide synthase (CerS) isoforms. Previously, we and others showed that mutations in the major neuron-specific CerS1, which synthesizes 18-carbon fatty acyl (C18) ceramide, cause elevation of long-chain base (LCB) substrates and decrease in C18 ceramide and derivatives in the brain, leading to neurodegeneration in mice and myoclonus epilepsy with dementia in humans. Whether LCB elevation or C18 ceramide reduction leads to neurodegeneration is unclear. Here, we ectopically expressed CerS2, a nonneuronal CerS producing C22–C24 ceramides, in neurons of Cers1-deficient mice. Surprisingly, the Cers1 mutant pathology was almost completely suppressed. Because CerS2 cannot replenish C18 ceramide, the rescue is likely a result of LCB reduction. Consistent with this hypothesis, we found that only LCBs, the substrates common for all of the CerS isoforms, but not ceramides and complex sphingolipids, were restored to the wild-type levels in the Cers2-rescued Cers1 mutant mouse brains. Furthermore, LCBs induced neurite fragmentation in cultured neurons at concentrations corresponding to the elevated levels in the CerS1-deficient brain. The strong association of LCB levels with neuronal survival both in vivo and in vitro suggests high-level accumulation of LCBs is a possible underlying cause of the CerS1 deficiency-induced neuronal death. PMID:27162368

  19. Deficiency of sphingomyelin synthase-1 but not sphingomyelin synthase-2 causes hearing impairments in mice.


    Lu, Mei-Hong; Takemoto, Makoto; Watanabe, Ken; Luo, Huan; Nishimura, Masataka; Yano, Masato; Tomimoto, Hidekazu; Okazaki, Toshiro; Oike, Yuichi; Song, Wen-Jie


    Sphingomyelin (SM) is a sphingolipid reported to function as a structural component of plasma membranes and to participate in signal transduction. The role of SM metabolism in the process of hearing remains controversial. Here, we examined the role of SM synthase (SMS), which is subcategorized into the family members SMS1 and SMS2, in auditory function. Measurements of auditory brainstem response (ABR) revealed hearing impairment in SMS1−/− mice in a low frequency range (4–16 kHz). As a possible mechanism of this impairment, we found that the stria vascularis (SV) in these mice exhibited atrophy and disorganized marginal cells. Consequently, SMS1−/− mice exhibited significantly smaller endocochlear potentials (EPs). As a possible mechanism for EP reduction, we found altered expression patterns and a reduced level of KCNQ1 channel protein in the SV of SMS1−/− mice. These mice also exhibited reduced levels of distortion product otoacoustic emissions. Quantitative comparison of the SV atrophy, KCNQ1 expression, and outer hair cell density at the cochlear apical and basal turns revealed no location dependence, but more macrophage invasion into the SV was observed in the apical region than the basal region, suggesting a role of cochlear location-dependent oxidative stress in producing the frequency dependence of hearing loss in SMS1−/− mice. Elevated ABR thresholds, decreased EPs, and abnormal KCNQ1 expression patterns in SMS1−/− mice were all found to be progressive with age. Mice lacking SMS2, however, exhibited neither detectable hearing loss nor changes in their EPs. Taken together, our results suggest that hearing impairments occur in SMS1−/− but not SMS2−/− mice. Defects in the SV with subsequent reductions in EPs together with hair cell dysfunction may account, at least partially, for hearing impairments in SMS1−/− mice.

  20. Structure of isochorismate synthase DhbC from Bacillus anthracis.


    Domagalski, M J; Tkaczuk, K L; Chruszcz, M; Skarina, T; Onopriyenko, O; Cymborowski, M; Grabowski, M; Savchenko, A; Minor, W


    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg(2+)-dependent catalytic mechanism.

  1. Defining the Product Chemical Space of Monoterpenoid Synthases

    PubMed Central

    Tian, Boxue; Poulter, C. Dale; Jacobson, Matthew P.


    Terpenoid synthases create diverse carbon skeletons by catalyzing complex carbocation rearrangements, making them particularly challenging for enzyme function prediction. To begin to address this challenge, we have developed a computational approach for the systematic enumeration of terpenoid carbocations. Application of this approach allows us to systematically define a nearly complete chemical space for the potential carbon skeletons of products from monoterpenoid synthases. Specifically, 18758 carbocations were generated, which we cluster into 74 cyclic skeletons. Five of the 74 skeletons are found in known natural products; some of the others are plausible for new functions, either in nature or engineered. This work systematizes the description of function for this class of enzymes, and provides a basis for predicting functions of uncharacterized enzymes. To our knowledge, this is the first computational study to explore the complete product chemical space of this important class of enzymes. PMID:27517297

  2. Structure of isochorismate synthase DhbC from Bacillus anthracis

    PubMed Central

    Domagalski, M. J.; Tkaczuk, K. L.; Chruszcz, M.; Skarina, T.; Onopriyenko, O.; Cymborowski, M.; Grabowski, M.; Savchenko, A.; Minor, W.


    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg2+-dependent catalytic mechanism. PMID:23989140

  3. Use of linalool synthase in genetic engineering of scent production


    Pichersky, Eran


    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  4. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).


    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian


    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton.

  5. Use of linalool synthase in genetic engineering of scent production


    Pichersky, E.


    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed. 5 figs.

  6. Piriformospora indica requires kaurene synthase activity for successful plant colonization.


    Li, Liang; Chen, Xi; Ma, Chaoyang; Wu, Hongqing; Qi, Shuting


    Ent-kaurene (KS) synthases and ent-kaurene-like (KSL) synthases are involved in the biosynthesis of phytoalexins and/or gibberellins which play a role in plant immunity and development. The relationship between expression of five synthase genes (HvKSL1, HvKS2, HvKS4, HvKS5, HvKSL4) and plant colonization by the endophytic fungus Piriformospora indica was assessed in barley (Hordeum vulgare). The KS gene family is differently up-regulated at 1, 3 and 7 day after P. indica inoculation. By comparison, the HvKSL4 gene expression pattern is more significantly affected by UV irradiation and P. indica colonization. The characterizations of two silencing lines (HvKSL1-RNAi, HvKSL4-RNAi) also were analyzed. HvKSL1-RNAi and HvKSL4-RNAi lines in the first generation lead to less dark green leaves and slower plant development. Further, reduced spikelet fertility in progenies of RNAi plants heterozygous for HvKSL1 were observed, but not for HvKSL4. T2 generation of HvKSL1-RNAi line showed semi-dwarf phenotype while the wild type phenotype could be restored by applying GA3. Silencing of HvKSL4 and HvKSL1 resulted in reduced colonization by P. indica especially in the HvKSL1-RNAi line. These results probably suggest the presence of two ent-KS synthase in barley, one (HvKSL1) that participates in the biosynthesis of GAs and another (HvKSL4) that is involved in the biosynthesis of phytoalexins.

  7. Screening for latent acute intermittent porphyria: the value of measuring both leucocyte delta-aminolaevulinic acid synthase and erythrocyte uroporphyrinogen-1-synthase activities.

    PubMed Central

    McColl, K E; Moore, M R; Thompson, G G; Goldberg, A


    Acute intermittent porphyria (AIP) is an autosomal dominantly inherited disorder of haem biosynthesis characterised by reduced activity of the enzyme uroporphyrinogen-1-(URO) synthase and compensatory increased activity of the rate controlling enzyme delta-aminolaevulinic acid (ALA) synthase. Subjects with the disorder should be identified as they are at risk of developing severe porphyric attacks if exposed to a variety of drugs or chemicals. We have assessed the value of measuring the activities of ALA synthase and URO synthase in peripheral blood cells as a means of identifying latent cases in affected families. In AIP subjects, ALA synthase activity was increased and URO synthase decreased compared to controls, through there was considerable overlap between the two groups when either enzyme was examined alone. When both enzymes were examined together, all but one of the 19 AIP patients had both increased ALA synthase activity (greater than 250 nmol ALA/g protein/h) and reduced URO synthase activity (less than 25.1 nmol URO/l RBC/h), whereas none of the 62 controls showed this enzyme pattern. Examination of 35 asymptomatic first degree blood relatives of AIP patients showed that 17 (49%) had the porphyric enzyme pattern with no sex bias. The combined study of these two enzymes permits accurate detection of latent cases of AIP and confirms its autosomal dominant inheritance. PMID:7120315

  8. Iterative Polyketide Biosynthesis by Modular Polyketide Synthases in Bacteria

    PubMed Central

    Chen, Haotong; Du, Liangcheng


    Modular polyketide synthases (type I PKSs) in bacteria are responsible for synthesizing a significant percentage of bioactive natural products. This group of synthases has a characteristic modular organization, and each module within a PKS carries out one cycle of polyketide chain elongation; thus each module is “non-iterative” in function. It was possible to predict the basic structure of a polyketide product from the module organization of the PKSs, since there generally existed a co-linearity between the number of modules and the number of chain elongations. However, more and more bacterial modular PKSs fail to conform to the “canonical rules”, and a particularly noteworthy group of non-canonical PKSs is the bacterial iterative type I PKSs. This review covers recent examples of iteratively-used modular PKSs in bacteria. These non-canonical PKSs give rise to a large array of natural products with impressive structural diversity. The molecular mechanism behind the iterations is often unclear, presenting a new challenge to the rational engineering of these PKSs with the goal of generating new natural products. Structural elucidation of these synthase complexes and better understanding of potential PKS-PKS interactions as well as PKS-substrate recognition may provide new prospects and inspirations for the discovery and engineering of new bioactive polyketides. PMID:26549236

  9. The Spatial Distribution of Sucrose Synthase Isozymes in Barley.

    PubMed Central

    Guerin, J.; Carbonero, P.


    The sucrose (Suc) synthase enzyme purified from barley (Hordeum vulgare L.) roots is a homotetramer that is composed of 90-kD type 1 Suc synthase (SS1) subunits. Km values for Suc and UDP were 30 mM and 5 [mu]M, respectively. This enzyme can also utilize ADP at 25% of the UDP rate. Anti-SS1 polyclonal antibodies, which recognized both SS1 and type 2 Suc synthase (SS2) (88-kD) subunits, and antibodies raised against a synthetic peptide, LANGSTDNNFV, which were specific for SS2, were used to study the spatial distribution of these subunits by immunoblot analysis and immunolocalization. Both SS1 and SS2 were abundantly expressed in endosperm, where they polymerize to form the five possible homo- and heterotetramers. Only SS1 homotetramers were detected in young leaves, where they appeared exclusively in phloem cells, and in roots, where expression was associated with cap cells and the vascular bundle. In the seed both SS1 and SS2 were present in endosperm, but only SS1 was apparent in the chalazal region, the nucellar projection, and the vascular bundle. The physiological implications for the difference in expression patterns observed are discussed with respect to the maize (Zea mays L.) model. PMID:12223688

  10. [Progress and application prospects of glutamine synthase in plants].


    Feng, Wanjun; Xing, Guofang; Niu, Xulong; Dou, Chen; Han, Yuanhuai


    Nitrogen is one of the most important nutrient elements for plants and a major limiting factor in plant growth and crop productivity. Glutamine synthase (GS) is a key enzyme involved in the nitrogen assimilation and recycling in plants. So far, members of the glutamine synthase gene family have been characterized in many plants such as Arabidopsis, rice, wheat, and maize. Reports show that GS are involved in the growth and development of plants, in particular its role in seed production. However, the outcome has generally been inconsistent, which are probably derived from the transcriptional and post-translational regulation of GS genes. In this review, we outlined studies on GS gene classification, QTL mapping, the relationship between GS genes and plant growth with nitrogen and the distribution characters, the biological functions of GS genes, as well as expression control at different regulation levels. In addition, we summarized the application prospects of glutamine synthetase genes in enhancing plant growth and yield by improving the nitrogen use efficiency. The prospects were presented on the improvement of nitrogen utility efficiency in crops and plant nitrogen status diagnosis on the basis of glutamine synthase gene regulation.

  11. The structural basis of Erwinia rhapontici isomaltulose synthase.


    Xu, Zheng; Li, Sha; Li, Jie; Li, Yan; Feng, Xiaohai; Wang, Renxiao; Xu, Hong; Zhou, Jiahai


    Sucrose isomerase NX-5 from Erwiniarhapontici efficiently catalyzes the isomerization of sucrose to isomaltulose (main product) and trehalulose (by-product). To investigate the molecular mechanism controlling sucrose isomer formation, we determined the crystal structures of native NX-5 and its mutant complexes E295Q/sucrose and D241A/glucose at 1.70 Å, 1.70 Å and 2.00 Å, respectively. The overall structure and active site architecture of NX-5 resemble those of other reported sucrose isomerases. Strikingly, the substrate binding mode of NX-5 is also similar to that of trehalulose synthase from Pseudomonasmesoacidophila MX-45 (MutB). Detailed structural analysis revealed the catalytic RXDRX motif and the adjacent 10-residue loop of NX-5 and isomaltulose synthase PalI from Klebsiella sp. LX3 adopt a distinct orientation from those of trehalulose synthases. Mutations of the loop region of NX-5 resulted in significant changes of the product ratio between isomaltulose and trehalulose. The molecular dynamics simulation data supported the product specificity of NX-5 towards isomaltulose and the role of the loop(330-339) in NX-5 catalysis. This work should prove useful for the engineering of sucrose isomerase for industrial carbohydrate biotransformations.

  12. The Structural Basis of Erwinia rhapontici Isomaltulose Synthase

    PubMed Central

    Xu, Zheng; Li, Sha; Li, Jie; Li, Yan; Feng, Xiaohai; Wang, Renxiao; Xu, Hong; Zhou, Jiahai


    Sucrose isomerase NX-5 from Erwiniarhapontici efficiently catalyzes the isomerization of sucrose to isomaltulose (main product) and trehalulose (by-product). To investigate the molecular mechanism controlling sucrose isomer formation, we determined the crystal structures of native NX-5 and its mutant complexes E295Q/sucrose and D241A/glucose at 1.70 Å, 1.70 Å and 2.00 Å, respectively. The overall structure and active site architecture of NX-5 resemble those of other reported sucrose isomerases. Strikingly, the substrate binding mode of NX-5 is also similar to that of trehalulose synthase from Pseudomonasmesoacidophila MX-45 (MutB). Detailed structural analysis revealed the catalytic RXDRX motif and the adjacent 10-residue loop of NX-5 and isomaltulose synthase PalI from Klebsiella sp. LX3 adopt a distinct orientation from those of trehalulose synthases. Mutations of the loop region of NX-5 resulted in significant changes of the product ratio between isomaltulose and trehalulose. The molecular dynamics simulation data supported the product specificity of NX-5 towards isomaltulose and the role of the loop330-339 in NX-5 catalysis. This work should prove useful for the engineering of sucrose isomerase for industrial carbohydrate biotransformations. PMID:24069347

  13. Effect of calcofluor white on chitin synthases from Saccharomyces cerevisiae.

    PubMed Central

    Roncero, C; Valdivieso, M H; Ribas, J C; Durán, A


    The growths of Saccharomyces cerevisiae wild-type strain and another strain containing a disrupted structural gene for chitin synthase (chs1::URA3), defective in chitin synthase 1 (Chs1) but showing a new chitin synthase activity (Chs2), were affected by Calcofluor. To be effective, the interaction of Calcofluor with growing cells had to occur at around pH 6. Treatment of growing cells from these strains with the fluorochrome led to an increase in the total levels of Chs1 and Chs2 activities measured on permeabilized cells. During treatment, basal levels (activities expressed in the absence of exogenous proteolytic activation) of Chs1 and Chs2 increased nine- and fourfold, respectively, through a mechanism dependent on protein synthesis, since the effect was abolished by cycloheximide. During alpha-factor treatment, both Chs1 and Chs2 levels increased; however, as opposed to what occurred during the mitotic cell cycle, there was no further increase in Chs1 or Chs2 activities by Calcofluor treatment. Images PMID:2965145

  14. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    SciTech Connect

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield


    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  15. From bacterial to human dihydrouridine synthase: automated structure determination

    SciTech Connect

    Whelan, Fiona Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.


    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  16. Cellulose Microfibril Formation by Surface-Tethered Cellulose Synthase Enzymes.


    Basu, Snehasish; Omadjela, Okako; Gaddes, David; Tadigadapa, Srinivas; Zimmer, Jochen; Catchmark, Jeffrey M


    Cellulose microfibrils are pseudocrystalline arrays of cellulose chains that are synthesized by cellulose synthases. The enzymes are organized into large membrane-embedded complexes in which each enzyme likely synthesizes and secretes a β-(1→4) glucan. The relationship between the organization of the enzymes in these complexes and cellulose crystallization has not been explored. To better understand this relationship, we used atomic force microscopy to visualize cellulose microfibril formation from nickel-film-immobilized bacterial cellulose synthase enzymes (BcsA-Bs), which in standard solution only form amorphous cellulose from monomeric BcsA-B complexes. Fourier transform infrared spectroscopy and X-ray diffraction techniques show that surface-tethered BcsA-Bs synthesize highly crystalline cellulose II in the presence of UDP-Glc, the allosteric activator cyclic-di-GMP, as well as magnesium. The cellulose II cross section/diameter and the crystal size and crystallinity depend on the surface density of tethered enzymes as well as the overall concentration of substrates. Our results provide the correlation between cellulose microfibril formation and the spatial organization of cellulose synthases.

  17. Multi-Substrate Terpene Synthases: Their Occurrence and Physiological Significance

    PubMed Central

    Pazouki, Leila; Niinemets, Ülo


    Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15), and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5), mono- (C10), and diterpenes (C20). Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles. PMID:27462341

  18. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    PubMed Central

    Koo, Hyun Jo; Gang, David R.


    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  19. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases.


    Shibuya, M; Zhang, H; Endo, A; Shishikura, K; Kushiro, T; Ebizuka, Y


    Two new triterpene synthase cDNAs, named as OEW and TRW, were cloned from olive leaves (Olea europaea) and from dandelion roots (Taraxacum officinale), respectively, by the PCR method with primers designed from the conserved sequences found in the known oxidosqualene cyclases. Their ORFs consisted of 2274 bp nucleotides and coded for 758 amino acid long polypeptides. They shared high sequence identity (78%) to each other, while they showed only about 60% identities to the known triterpene synthases LUPI (lupeol synthase clone from Arabidopsis thaliana) and PNY (beta-amyrin synthase clone from Panax ginseng) at amino acid level. To determine the enzyme functions of the translates, they were expressed in an ERG7 deficient yeast mutant. Accumulation of lupeol in the cells of yeast transformants proved both of these clones code for lupeol synthase proteins. An EST (expression sequence tag) clone isolated from Medicago truncatula roots as a homologue of cycloartenol synthase gene, exhibits high sequence identity (75-77%) to these two lupeol synthase cDNAs, suggesting it to be another lupeol synthase clone. Comparatively low identity (approximately 57%) of LUP1 from Arabidopsis thaliana to either one of these clones leaves LUP1 as a distinct clone among lupeol synthases. From these sequence comparisons, now we propose that two branches of lupeol synthase gene have been generated in higher plants during the course of evolution.

  20. CELLULOSE SYNTHASE INTERACTIVE1 Is Required for Fast Recycling of Cellulose Synthase Complexes to the Plasma Membrane in Arabidopsis

    PubMed Central

    Lei, Lei; Bashline, Logan; Li, Shundai


    Plants are constantly subjected to various biotic and abiotic stresses and have evolved complex strategies to cope with these stresses. For example, plant cells endocytose plasma membrane material under stress and subsequently recycle it back when the stress conditions are relieved. Cellulose biosynthesis is a tightly regulated process that is performed by plasma membrane-localized cellulose synthase (CESA) complexes (CSCs). However, the regulatory mechanism of cellulose biosynthesis under abiotic stress has not been well explored. In this study, we show that small CESA compartments (SmaCCs) or microtubule-associated cellulose synthase compartments (MASCs) are critical for fast recovery of CSCs to the plasma membrane after stress is relieved in Arabidopsis thaliana. This SmaCC/MASC-mediated fast recovery of CSCs is dependent on CELLULOSE SYNTHASE INTERACTIVE1 (CSI1), a protein previously known to represent the link between CSCs and cortical microtubules. Independently, AP2M, a core component in clathrin-mediated endocytosis, plays a role in the formation of SmaCCs/MASCs. Together, our study establishes a model in which CSI1-dependent SmaCCs/MASCs are formed through a process that involves endocytosis, which represents an important mechanism for plants to quickly regulate cellulose synthesis under abiotic stress. PMID:26443667

  1. Ligand binding studies, preliminary structure-activity relationship and detailed mechanistic characterization of 1-phenyl-6,6-dimethyl-1,3,5-triazine-2,4-diamine derivatives as inhibitors of Escherichia coli dihydrofolate reductase

    PubMed Central

    Srinivasan, Bharath; Tonddast-Navaei, Sam; Skolnick, Jeffrey


    Gram-negative bacteria are implicated in the causation of life-threatening hospital-acquired infections. They acquire rapid resistance to multiple drugs and available antibiotics. Hence, there is the need to discover new antibacterial agents with novel scaffolds. For the first time, this study explores the 1,3,5-triazine-2,4-diamine and 1,2,4-triazine-2,4-diamine group of compounds as potential inhibitors of E. coli DHFR, a pivotal enzyme in the thymidine and purine synthesis pathway. Using differential scanning fluorimetry, DSF, fifteen compounds with various substitutions on either the 3rd or 4th positions on the benzene group of 6,6-dimethyl-1-(benzene)-1,3,5-triazine-2,4-diamine were shown to bind to the enzyme with varying affinities. Then, the dose dependence of inhibition by these compounds was determined. Preliminary quantitative structure-activity relationship analysis and docking studies implicate the alkyl linker group and the sulfonyl fluoride group in increasing the potency of inhibition. 4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride (NSC120927), the best hit from the study and a molecule with no reported inhibition of E. coli DHFR, potently inhibits the enzyme with a Ki value of 42.50 ± 5.34 nM, followed by 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride(NSC132279), with a Ki value of 100.9 ± 12.7 nM. Detailed kinetic characterization of the inhibition brought about by five small-molecule hits shows that these inhibitors bind to the dihydrofolate binding site with preferential binding to the NADPH-bound binary form of the enzyme. Furthermore, in search of novel diaminotriazine scaffolds, it is shown that lamotrigine, a 1,2,4-triazine-3,5-diamine and a sodium-ion channel blocker class of antiepileptic drug, also inhibits E. coli DHFR. This is the first comprehensive study on the binding and inhibition brought about by diaminotriazines of a gram

  2. Structural analysis of a holoenzyme complex of mouse dihydrofolate reductase with NADPH and a ternary complex with the potent and selective inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine

    SciTech Connect

    Cody, Vivian; Pace, Jim; Rosowsky, Andre


    The structures of mouse DHFR holo enzyme and a ternary complex with NADPH and a potent inhibitor are described. It has been shown that 2, 4-diamino-6-arylmethylpteridines and 2, 4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure–activity profile observed for a series of substituted dibenz[b, f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 Å resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2′-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59–64) by 0.6 Å compared with pcDHFR ternary complexes. These data are consistent with the

  3. Structural Analysis of a Holoenzyme Complex of Mouse Dihydrofolate Reductase With NADPH And a Ternary Complex With the Potent And Selective Inhibitor 2,4-Diamino-6-(2'-Hydroxydibenz[b,F]azepin-5-YI)

    SciTech Connect

    Cody, V.; Pace, J.; Rosowsky, A.


    It has been shown that 2,4-diamino-6-arylmethylpteridines and 2,4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure-activity profile observed for a series of substituted dibenz[b,f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2,4-diamino-6-(2{prime}-hydroxydibenz[b,f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 A resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2{prime}-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59-64) by 0.6 A compared with pcDHFR ternary complexes. These data are consistent with the greater inhibitory potency against pcDHFR.

  4. 4-Hydroxy-2-pyrone formation by chalcone and stilbene synthase with nonphysiological substrates.


    Zuurbier, K W; Leser, J; Berger, T; Hofte, A J; Schröder, G; Verpoorte, R; Schröder, J


    Valerophenone synthase (VPS) is a polyketide synthase that catalyzes the formation of the phloroglucinol derivatives in the synthesis of the bitter acids in hop (Humulus lupulus). The reaction uses isovaleryl-CoA or isobutyryl-CoA, but otherwise it is identical to that of the chalcone synthase in flavonoid biosynthesis. Our study showed that chalcone synthase can perform the function of VPS, but not perfectly, because the majority of the reactions terminated after two condensation reactions (products: 4-hydroxy-2-pyrone derivatives). The same experiments with stilbene synthase yielded exclusively the 4-hydroxy-2-pyrone derivatives, not the products expected from three condensation reactions. The results are discussed in the context of the functional diversity and evolution in the family of CHS-related polyketide synthases.

  5. A stable organic free radical in anaerobic benzylsuccinate synthase of Azoarcus sp. strain T.


    Krieger, C J; Roseboom, W; Albracht, S P; Spormann, A M


    The novel enzyme benzylsuccinate synthase initiates anaerobic toluene metabolism by catalyzing the addition of toluene to fumarate, forming benzylsuccinate. Based primarily on its sequence similarity to the glycyl radical enzymes, pyruvate formate-lyase and anaerobic ribonucleotide reductase, benzylsuccinate synthase was speculated to be a glycyl radical enzyme. In this report we use EPR spectroscopy to demonstrate for the first time that active benzylsuccinate synthase from the denitrifying bacterium Azoarcus sp. strain T harbors an oxygen-sensitive stable organic free radical. The EPR signal of the radical was centered at g = 2.0021 and was characterized by a major 2-fold splitting of about 1.5 millitesla. The strong similarities between the EPR signal of the benzylsuccinate synthase radical and that of the glycyl radicals of pyruvate formate-lyase and anaerobic ribonucleotide reductase provide evidence that the benzylsuccinate synthase radical is located on a glycine residue, presumably glycine 828 in Azoarcus sp. strain T benzylsuccinate synthase.

  6. Purification, Structure and Properties of Escherichia coli tRNA Pseudouridine Synthase 1.

    DTIC Science & Technology


    RD-8193 9" PURIFICATION STRUCTURE AMD PROPERTIES OF ESCNERICHIA 11 COLI TRt4A PSEUDOURIDINE SYNTHASE 1(U) CALIFORNIA UNY OAKLAND NAVAL BIOSCIENCES...Keywo rd S: tN Pseudou ridine Synthase 1, Escherichia Cal i, 03 Plasmid, 19. ABSTRACT (Continue on reverse if necessary and identify by block number...The RNA modification enzyme, tRNA pseudouridine synthase I (PSUI) has been isolated in 95% purity from an Escherichia coli strain harboring a

  7. Inhibition of Fatty Acid Synthase in Prostate Cancer by Orlistat, a Novel Therapeutic

    DTIC Science & Technology


    C.W. Fatty acid synthase inhibitors: new directions for oncology. Expert Opinion on Investigational Drugs (2007) 16(11): 1817-29 (Invited Review...acid synthase inhibitors: new directions for oncology. Expert Opinion on Investigational Drugs (2007) 16(11): 1817-29 (Invited Review) Abstracts...Kuhajda FP: Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000, 16:202-208. 3. Smith S: The animal fatty

  8. Effect of ions of potassium and lithium on NO synthase expression in the human adrenal cortex.


    Kovzun, E I; Lukashenya, O S; Pushkarev, V M; Mikosha, A S; Tron'ko, N D


    The expression of endothelial and inducible NO synthase in the human adrenal glands was studied under a change in the concentration of K(+), which plays a regulatory role in aldosterone secretion. K(+) ions stimulated the expression of both isoforms of NO synthase in the human adrenal cortex. A stimulatory effect of K(+) on NO synthase is probably related to activation of the calmodulin system and potassium-induced translocation of protein kinase C. Lithium produced n inhibitory effect on both isoforms of NO synthase, which suggests that protein kinase C serves a major regulator of expression in the human adrenal glands.

  9. Molecular Diversity of Terpene Synthases in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Zhuang, Xun; Jiang, Zuodong; Jia, Qidong; Babbitt, Patricia C.


    Marchantia polymorpha is a basal terrestrial land plant, which like most liverworts accumulates structurally diverse terpenes believed to serve in deterring disease and herbivory. Previous studies have suggested that the mevalonate and methylerythritol phosphate pathways, present in evolutionarily diverged plants, are also operative in liverworts. However, the genes and enzymes responsible for the chemical diversity of terpenes have yet to be described. In this study, we resorted to a HMMER search tool to identify 17 putative terpene synthase genes from M. polymorpha transcriptomes. Functional characterization identified four diterpene synthase genes phylogenetically related to those found in diverged plants and nine rather unusual monoterpene and sesquiterpene synthase-like genes. The presence of separate monofunctional diterpene synthases for ent-copalyl diphosphate and ent-kaurene biosynthesis is similar to orthologs found in vascular plants, pushing the date of the underlying gene duplication and neofunctionalization of the ancestral diterpene synthase gene family to >400 million years ago. By contrast, the mono- and sesquiterpene synthases represent a distinct class of enzymes, not related to previously described plant terpene synthases and only distantly so to microbial-type terpene synthases. The absence of a Mg2+ binding, aspartate-rich, DDXXD motif places these enzymes in a noncanonical family of terpene synthases. PMID:27650333

  10. Mechanistic studies on class I polyhydroxybutyrate (PHB) synthase from Ralstonia eutropha: class I and III synthases share a similar catalytic mechanism.


    Jia, Y; Yuan, W; Wodzinska, J; Park, C; Sinskey, A J; Stubbe, J


    The Class I and III polyhydroxybutyrate (PHB) synthases from Ralstonia eutropha and Chromatium vinosum, respectively, catalyze the polymerization of beta-hydroxybutyryl-coenzyme A (HBCoA) to generate PHB. These synthases have different molecular weights, subunit composition, and kinetic properties. Recent studies with the C. vinosum synthase suggested that it is structurally homologous to bacterial lipases and allowed identification of active site residues important for catalysis [Jia, Y., Kappock, T. J., Frick, T., Sinskey, A. J., and Stubbe, J. (2000) Biochemistry 39, 3927-3936]. Sequence alignments between the Class I and III synthases revealed similar residues in the R. eutropha synthase. Site-directed mutants of these residues were prepared and examined using HBCoA and a terminally saturated trimer of HBCoA (sT-CoA) as probes. These studies reveal that the R. eutropha synthase possesses an essential catalytic dyad (C319-H508) in which the C319 is involved in covalent catalysis. A conserved Asp, D480, was shown not to be required for acylation of C319 by sT-CoA and is proposed to function as a general base catalyst to activate the hydroxyl of HBCoA for ester formation. Studies of the [(3)H]sT-CoA with wild-type and mutant synthases reveal that 0.5 equiv of radiolabel is covalently bound per monomer of synthase, suggesting that a dimeric form of the enzyme is involved in elongation. These studies, in conjunction with search algorithms for secondary structure, suggest that the Class I and III synthases are mechanistically similar and structurally homologous, despite their physical and kinetic differences.

  11. Phytochelatin synthase genes from Arabidopsis and the yeast Schizosaccharomyces pombe.

    PubMed Central

    Ha, S B; Smith, A P; Howden, R; Dietrich, W M; Bugg, S; O'Connell, M J; Goldsbrough, P B; Cobbett, C S


    Phytochelatins (PCs), a family of heavy metal-inducible peptides important in the detoxification of heavy metals, have been identified in plants and some microorganisms, including Schizosaccharomyces pombe, but not in animals. PCs are synthesized enzymatically from glutathione (GSH) by PC synthase in the presence of heavy metal ions. In Arabidopsis, the CAD1 gene, identified by using Cd-sensitive, PC-deficient cad1 mutants, has been proposed to encode PC synthase. Using a positional cloning strategy, we have isolated the CAD1 gene. Database searches identified a homologous gene in S. pombe, and a mutant with a targeted deletion of this gene was also Cd sensitive and PC deficient. Extracts of Escherichia coli cells expressing a CAD1 cDNA or the S. pombe gene catalyzing GSH-dependent, heavy metal-activated synthesis of PCs in vitro demonstrated that both genes encode PC synthase activity. Both enzymes were activated by a range of metal ions. In contrast, reverse transcription-polymerase chain reaction experiments showed that expression of the CAD1 mRNA is not influenced by the presence of Cd. A comparison of the two predicted amino acid sequences revealed a highly conserved N-terminal region, which is presumed to be the catalytic domain, and a variable C-terminal region containing multiple Cys residues, which is proposed to be involved in activation of the enzyme by metal ions. Interestingly, a similar gene was identified in the nematode, Caenorhabditis elegans, suggesting that PCs may also be expressed in some animal species. PMID:10368185

  12. Assembly Line Polyketide Synthases: Mechanistic Insights and Unsolved Problems

    PubMed Central


    Two hallmarks of assembly line polyketide synthases have motivated an interest in these unusual multienzyme systems, their stereospecificity and their capacity for directional biosynthesis. In this review, we summarize the state of knowledge regarding the mechanistic origins of these two remarkable features, using the 6-deoxyerythronolide B synthase as a prototype. Of the 10 stereocenters in 6-deoxyerythronolide B, the stereochemistry of nine carbon atoms is directly set by ketoreductase domains, which catalyze epimerization and/or diastereospecific reduction reactions. The 10th stereocenter is established by the sequential action of three enzymatic domains. Thus, the problem has been reduced to a challenge in mainstream enzymology, where fundamental gaps remain in our understanding of the structural basis for this exquisite stereochemical control by relatively well-defined active sites. In contrast, testable mechanistic hypotheses for the phenomenon of vectorial biosynthesis are only just beginning to emerge. Starting from an elegant theoretical framework for understanding coupled vectorial processes in biology [Jencks, W. P. (1980) Adv. Enzymol. Relat. Areas Mol. Biol. 51, 75–106], we present a simple model that can explain assembly line polyketide biosynthesis as a coupled vectorial process. Our model, which highlights the important role of domain–domain interactions, not only is consistent with recent observations but also is amenable to further experimental verification and refinement. Ultimately, a definitive view of the coordinated motions within and between polyketide synthase modules will require a combination of structural, kinetic, spectroscopic, and computational tools and could be one of the most exciting frontiers in 21st Century enzymology. PMID:24779441

  13. Synthesis of antifungal glucan synthase inhibitors from enfumafungin.


    Zhong, Yong-Li; Gauthier, Donald R; Shi, Yao-Jun; McLaughlin, Mark; Chung, John Y L; Dagneau, Philippe; Marcune, Benjamin; Krska, Shane W; Ball, Richard G; Reamer, Robert A; Yasuda, Nobuyoshi


    An efficient, new, and scalable semisynthesis of glucan synthase inhibitors 1 and 2 from the fermentation product enfumafungin 3 is described. The highlights of the synthesis include a high-yielding ether bond-forming reaction between a bulky sulfamidate 17 and alcohol 4 and a remarkably chemoselective, improved palladium(II)-mediated Corey-Yu allylic oxidation at the highly congested C-12 position of the enfumafungin core. Multi-hundred gram quantities of the target drug candidates 1 and 2 were prepared, in 12 linear steps with 25% isolated yield and 13 linear steps with 22% isolated yield, respectively.

  14. Modified Deacetylcephalosporin C Synthase for the Biotransformation of Semisynthetic Cephalosporins

    PubMed Central

    Balakrishnan, Nataraj; Ganesan, Sadhasivam; Rajasekaran, Padma; Rajendran, Lingeshwaran; Teddu, Sivaprasad


    ABSTRACT Deacetylcephalosporin C synthase (DACS), a 2-oxoglutarate-dependent oxygenase synthesized by Streptomyces clavuligerus, transforms an inert methyl group of deacetoxycephalosporin C (DAOC) into an active hydroxyl group of deacetylcephalosporin C (DAC) during the biosynthesis of cephalosporin. It is a step which is chemically difficult to accomplish, but its development by use of an enzymatic method with DACS can facilitate a cost-effective technology for the manufacture of semisynthetic cephalosporin intermediates such as 7-amino-cephalosporanic acid (7ACA) and hydroxymethyl-7-amino-cephalosporanic acid (HACA) from cephalosporin G. As the native enzyme showed negligible activity toward cephalosporin G, an unnatural and less expensive substrate analogue, directed-evolution strategies such as random, semirational, rational, and computational methods were used for systematic engineering of DACS for improved activity. In comparison to the native enzyme, several variants with improved catalytic efficiency were found. The enzyme was stable for several days and is expressed in soluble form at high levels with significantly higher kcat/Km values. The efficacy and industrial scalability of one of the selected variants, CefFGOS, were demonstrated in a process showing complete bioconversion of 18 g/liter of cephalosporin G into deacetylcephalosporin G (DAG) in about 80 min and showed reproducible results at higher substrate concentrations as well. DAG could be converted completely into HACA in about 30 min by a subsequent reaction, thus facilitating scalability toward commercialization. The experimental findings with several mutants were also used to rationalize the functional conformation deduced from homology modeling, and this led to the disclosure of critical regions involved in the catalysis of DACS. IMPORTANCE 7ACA and HACA serve as core intermediates for the manufacture of several semisynthetic cephalosporins. As they are expensive, a cost-effective enzyme

  15. Producing a trimethylpentanoic acid using hybrid polyketide synthases


    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

  16. Preliminary crystallographic analysis of a polyadenylate synthase from Megavirus

    PubMed Central

    Lartigue, Audrey; Jeudy, Sandra; Bertaux, Lionel; Abergel, Chantal


    Megavirus chilensis, a close relative of the Mimivirus giant virus, is also the most complex virus sequenced to date, with a 1.26 Mb double-stranded DNA genome encoding 1120 genes. The two viruses share common regulatory elements such as a peculiar palindrome governing the termination/polyadenylation of viral transcripts. They also share a predicted polyadenylate synthase that presents a higher than average percentage of residue conservation. The Megavirus enzyme Mg561 was overexpressed in Escherichia coli, purified and crystallized. A 2.24 Å resolution MAD data set was recorded from a single crystal on the ID29 beamline at the ESRF. PMID:23295487

  17. Structural and functional characterization of Staphylococcus aureus dihydrodipicolinate synthase.


    Girish, Tavarekere S; Sharma, Eshita; Gopal, B


    Lysine biosynthesis is crucial for cell-wall formation in bacteria. Enzymes involved in lysine biosynthesis are thus potential targets for anti-microbial therapeutics. Dihydrodipicolinate synthase (DHDPS) catalyzes the first step of this pathway. Unlike its homologues, Staphylococcus aureus DHDPS is a dimer both in solution and in the crystal and is not feedback inhibited by lysine. The crystal structure of S. aureus DHDPS in the free and substrate bound forms provides a structural rationale for its catalytic mechanism. The structure also reveals unique conformational features of the S. aureus enzyme that could be crucial for the design of specific non-competitive inhibitors.

  18. Antibody-directed enzyme prodrug therapy with the T268G mutant of human carboxypeptidase A1: in vitro and in vivo studies with prodrugs of methotrexate and the thymidylate synthase inhibitors GW1031 and GW1843.


    Wolfe, L A; Mullin, R J; Laethem, R; Blumenkopf, T A; Cory, M; Miller, J F; Keith, B R; Humphreys, J; Smith, G K


    Antibody-directed enzyme prodrug therapy (ADEPT) is a technique to increase antitumor selectivity in cancer chemotherapy. Our approach to this technology has been to design a mutant of human carboxypeptidase A (hCPA1-T268G) which is capable of hydrolyzing in vivo stable prodrugs of MTX and targeting this enzyme to tumors on an Ep-CAM1-specific antibody, ING1. Through the use of this >99% human enzyme which is capable of catalyzing a completely nonhuman reaction, we hope to increase ADEPT selectivity while decreasing overall immunogenicity of the enzyme-antibody conjugate. In the current report, prodrugs of the thymidylate synthase inhibitors GW1031 and GW1843 and the dihydrofolate reductase inhibitor methotrexate were studied for their wild-type and mutant hCPA enzyme hydrolysis, their in vivo stability, and their use in therapy. Prodrugs with high kcat/Km ratios for mutated versus wild-type hCPA1 were examined in vitro for their stability in human pancreatic juice, and in vivo for their stability in mouse plasma and tissues. In addition, targeting and in vivo enzyme activity studies were performed with an ING1 antibody conjugate of the mutant enzyme (ING1-hCPA1-T268G). Finally, in vivo therapy studies were performed with LS174T tumors to demonstrate proof of principle. Results indicate that prodrugs can be synthesized that are selective and efficient substrates of hCPA1-T268G and not substrates of the endogenous CPA activities; this leads to excellent in vivo stability for these compounds. In vivo conjugate targeting studies showed that the antibody-enzyme conjugate was targeted to the tumor and enzyme was initially active in vivo at the site. Unfortunately therapeutic studies did not demonstrate tumor reduction. Experiments to determine reasons for the lack of antitumor activity showed that the enzyme activity decreased as a result of enzyme instability. The results offer encouragement for additional novel mutant enzyme improvements and additional in vivo studies

  19. Fine structure analysis of Salmonella typhimurium glutamate synthase genes.

    PubMed Central

    Madonna, M J; Fuchs, R L; Brenchley, J E


    Glutamate synthase activity is required for the growth of Salmonella typhimurium on media containing a growth-rate-limiting nitrogen source. Mutations that alter glutamate synthase activity had been identified in the gltB gene, but it was not known which of the two nonidentical subunits of the enzyme was altered. To examine the gene-protein relationship of the glt region, two nonsense mutations were identified and used to demonstrate that gltB encodes the large subunit of the enzyme. Six strains with independent Mu cts d1 (lac bla) insertions were isolated, from which a collection of deletion mutations was obtained. The deletions were transduced with the nonsense mutations and 38 other glt point mutations to construct a fine-structure genetic map. Chromosome mobilization studies, mediated by Hfr derivatives of Mu cts d1 lysogens, showed that gltB is transcribed in a clockwise direction, as shown in the S. typhimurium linkage map. Studies of the polar effects of three Mu cts d1 insertions indicated that the gene for the small subunit maps clockwise to gltB and that the two genes are cotranscribed to form a glt operon. Images PMID:3881392

  20. Eugenol synthase genes in floral scent variation in Gymnadenia species.


    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P


    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  1. [Cloning, expression and charaterization of chalcone synthase from Saussurea medusa].


    Xia, Fang; Li, Houhua; Fu, Chunxiang; Yu, Zhenzhen; Xu, Yanjun; Zhao, Dexiu


    A fragment of chalcone synthase gene (SmCHS) was cloned from the cDNA library constructed in Saussurea medusa. The full-length cDNA sequence of SmCHS was obtained by RT-PCR. Sequence analysis showed that the full length of SmCHS was 1313 bp, containing an open reading frame (1170 bp) encoding 389 amino acids. The molecular weight of the protein was estimated to be 43 kDa. The prokaryotic expression plasmids pET28a(+)-SmCHS was constructed and transformed into Escherichia coli BL21(DE3) for expression. SDS-PAGE indicated that the fusion protein was expressed partially in soluble form after induction by IPTG. The recombinant protein was collected and purified by Ni-NTA affinity column. The enzymatic activity assay of the purified recombinant protein showed that the fusion protein had chalcone synthase activity. It could catalyze the condensation of a 4-coumaroyl-CoA with three malonyl-CoAs to produce naringenin chalcone.

  2. Manipulation of pulmonary prostacyclin synthase expression prevents murine lung cancer.


    Keith, Robert L; Miller, York E; Hoshikawa, Yasushi; Moore, Mark D; Gesell, Tracy L; Gao, Bifeng; Malkinson, Alvin M; Golpon, Heiko A; Nemenoff, Raphael A; Geraci, Mark W


    Inhibition of cyclooxygenase (COX) activity decreases eicosanoid production and prevents lung cancer in animal models. Prostaglandin (PG) I(2) (PGI(2), prostacyclin) is a PGH(2) metabolite with anti-inflammatory, antiproliferative, and antimetastatic properties. The instability of PGI(2) has limited its evaluation in animal models of cancer. We hypothesized that pulmonary overexpression of prostacyclin synthase may prevent the development of murine lung tumors. Transgenic mice with selective pulmonary prostacyclin synthase overexpression were exposed to two distinct carcinogenesis protocols: an initiation/promotion model and a simple carcinogen model. The transgenic mice exhibited significantly reduced lung tumor multiplicity (tumor number) in proportion to transgene expression, a dose-response effect. Moreover, the highest expressing mice demonstrated reduced tumor incidence. To investigate the mechanism for protection, we evaluated PG levels and inflammatory responses. At the time of sacrifice following one carcinogenesis model, the transgenics exhibited only an increase in 6-keto-PGF(1alpha), not a decrease in PGE(2). Thus, elevated PGI(2) levels and not decreased PGE(2) levels appear to be necessary for the chemopreventive effects. When exposed to a single dose of butylated hydroxytoluene, transgenic mice exhibited a survival advantage; however, reduction in alveolar inflammatory response was not observed. These studies demonstrate that manipulation of PG metabolism downstream from COX produces even more profound lung cancer reduction than COX inhibition alone and could be the basis for new approaches to understanding the pathogenesis and prevention of lung cancer.

  3. Modulation of hyaluronan synthase activity in cellular membrane fractions.


    Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto


    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.

  4. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.


    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  5. The Role of Nitric Oxide Synthase Uncoupling in Tumor Progression

    PubMed Central

    Rabender, Christopher S.; Alam, Asim; Sundaresan, Gobalakrishnan; Cardnell, Robert J.; Yakovlev, Vasily A.; Mukhopadhyay, Nitai D.; Graves, Paul; Zweit, Jamal; Mikkelsen, Ross B.


    Here evidence suggests that nitric oxide synthases (NOS) of tumor cells, in contrast to normal tissues, synthesize predominantly superoxide and peroxynitrite. Based on HPLC analysis, the underlying mechanism for this uncoupling is a reduced tetrahydrobiopterin: dihydrobiopterin ratio (BH4:BH2) found in breast, colorectal, epidermoid and head and neck tumors compared to normal tissues. Increasing BH4:BH2 and reconstitution of coupled NOS activity in breast cancer cells with the BH4 salvage pathway precursor, sepiapterin, causes significant shifts in downstream signaling including increased cGMP-dependent protein kinase (PKG) activity, decreased β-catenin expression and TCF4 promoter activity, and reduced NF-κB promoter activity. Sepiapterin inhibited breast tumor cell growth in vitro and in vivo as measured by clonogenic assay, Ki67 staining and 18F-deoxyglucose positron emission tomography (FDG-PET). In summary, using diverse tumor types, it is demonstrated that the BH4:BH2 ratio is lower in tumor tissues and as a consequence nitric oxide synthase activity generates more peroxynitrite and superoxide anion than nitric oxide resulting in important tumor growth promoting and anti-apoptotic signaling properties. Implications The synthetic BH4, Kuvan®, is used to elevate BH4:BH2 in some phenylketonuria patients and to treat diseases associated with endothelial dysfunction suggesting a novel, testable approach for correcting an abnormality of tumor metabolism to control tumor growth. PMID:25724429

  6. In vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    PubMed Central

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian; Krucewicz, Katarzyna; Beeren, Sophie R.; Rydhal, Maja G.; Yoshimura, Yayoi; Striebeck, Alexander; Motawia, Mohammed S.; Willats, William G. T.; Palcic, Monica M.


    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates. PMID:26858729

  7. Cooperativity of peptidoglycan synthases active in bacterial cell elongation.


    Banzhaf, Manuel; van den Berg van Saparoea, Bart; Terrak, Mohammed; Fraipont, Claudine; Egan, Alexander; Philippe, Jules; Zapun, André; Breukink, Eefjan; Nguyen-Distèche, Martine; den Blaauwen, Tanneke; Vollmer, Waldemar


    Growth of the bacterial cell wall peptidoglycan sacculus requires the co-ordinated activities of peptidoglycan synthases, hydrolases and cell morphogenesis proteins, but the details of these interactions are largely unknown. We now show that the Escherichia coli peptidoglycan glycosyltrasferase-transpeptidase PBP1A interacts with the cell elongation-specific transpeptidase PBP2 in vitro and in the cell. Cells lacking PBP1A are thinner and initiate cell division later in the cell cycle. PBP1A localizes mainly to the cylindrical wall of the cell, supporting its role in cell elongation. Our in vitro peptidoglycan synthesis assays provide novel insights into the cooperativity of peptidoglycan synthases with different activities. PBP2 stimulates the glycosyltransferase activity of PBP1A, and PBP1A and PBP2 cooperate to attach newly synthesized peptidoglycan to sacculi. PBP2 has peptidoglycan transpeptidase activity in the presence of active PBP1A. Our data also provide a possible explanation for the depletion of lipid II precursors in penicillin-treated cells.

  8. IPC synthase as a useful target for antifungal drugs.


    Sugimoto, Yuichi; Sakoh, Hiroki; Yamada, Koji


    Inositol phosphorylceramide (IPC) synthase is a common and essential enzyme in fungi and plants, which catalyzes the transfer of phosphoinositol to the C-1 hydroxy of ceramide to produce IPC. This reaction is a key step in fungal sphingolipid biosynthesis, therefore the enzyme is a potential target for the development of nontoxic therapeutic antifungal agents. Natural products with a desired biological activity, aureobasidin A (AbA), khafrefungin, and galbonolide A, have been reported. AbA, a cyclic depsipeptide containing 8 amino acids and a hydroxyl acid, is a broad spectrum antifungal with strong activity against many pathogenic fungi such as Candida spp., Cryptococcus neoformans, and some Aspergillus spp. Khafrefungin, an aldonic acid ester with a C22 long alkyl chain, has antifungal activity against C. albicans, Cr. Neoformans, and Saccharomyces cerevisiae. Galbonolide A is a 14-membered macrolide with fungicidal activity against clinically important strains, and is especially potent against Cr. neoformans. These classes of natural products are potent and specific antifungal agents. We review current progress in the development of IPC synthase inhibitors with antifungal activities, and present structure-activity relationships (SAR), physicochemical and structural properties, and synthetic methodology for chemical modification.

  9. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    SciTech Connect

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.


    The R and S enantionmers of S-adenosyl-3-(/sup 2/H)3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with (1,4-/sup 2/H/sub 4/)-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral (/sup 2/H/sub 5/)spermidines were isolated and converted to their N/sub 1/,N/sub 7/-dibocspermidine-N/sub 4/-(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz /sup 1/H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral (/sup 2/H/sub 3/)dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH/sub 3/) in all cases studied to date.

  10. An uncultivated crenarchaeota contains functional bacteriochlorophyll a synthase.


    Meng, Jun; Wang, Fengping; Wang, Feng; Zheng, Yanping; Peng, Xiaotong; Zhou, Huaiyang; Xiao, Xiang


    A fosmid clone 37F10 containing an archaeal 16S rRNA gene was screened out from a metagenomic library of Pearl River sediment, southern China. Sequence analysis of the 35 kb inserted fragment of 37F10 found that it contains a single 16S rRNA gene belonging to Miscellaneous Crenarchaeotal Group (MCG) and 36 open reading frames (ORFs). One ORF (orf11) encodes putative bacteriochlorophyll a synthase (bchG) gene. Bacteriochlorophyll a synthase gene has never been reported in a member of the domain Archaea, in accordance with the fact that no (bacterio)-chlorophyll has ever been detected in any cultivated archaea. The putative archaeal bchG (named as ar-bchG) was cloned and heterologously expressed in Escherichia coli. The protein was found to be capable of synthesizing bacteriochlorophyll a by esterification of bacteriochlorophyllide a with phytyl diphosphate or geranylgeranyl diphosphate. Furthermore, phylogenetic analysis clearly indicates that the ar-bchG diverges before the bacterial bchGs. Our results for the first time demonstrate that a key and functional enzyme for bacteriochlorophyll a biosynthesis does exist in Archaea.

  11. Farnesyl pyrophosphate synthase modulators: a patent review (2006 - 2010)

    PubMed Central

    Sun, Shuting; McKenna, Charles E.


    Introduction Farnesyl pyrophosphosphate synthase (FPPS (also known as farnesyl diphosphate synthase, FDPS)) is one of the key enzymes involved in the mevalonate pathway and as such is widely expressed. FPPS modulators, specifically FPPS inhibitors, are useful in treating a number of diseases, including bone related disorders characterized by excessive bone resorption e.g. osteoporosis, cancer metathesis to bone and infectious diseases caused by certain parasites. Areas covered This review covers structures and applications of novel FPPS modulators described in the patent literature from 2006 to 2010. Patents disclosing new formulations and uses of existing FPPS inhibitors are also reviewed. Thirty-three patents retrieved from the USPTO, EP and WIPO databases are examined with the goal of defining current trends in drug discovery related to FPPS inhibition, and its therapeutic effects. Expert opinion Bisphosphonates continue to dominate in this area, although other types of modulator are making their appearance. Remarkable for their high bone mineral affinity, bisphosphonates are structural mimics of the dimethylallyl pyrophosphate (DMAPP) substrate of FPPS, and constitute the major type of FPPS inhibitor currently used in the clinic for treatment of bone-related diseases. Lipophilic bisphosphonates and new classes of non-bisphosphonate FPPS inhibitors (salicylic acid and quinoline derivatives) have been introduced as possible alternatives for treatment of soft tissue diseases, such as some cancers. Novel formulations, fluorescent diagnostic probes and new therapeutic applications of existing FPPS inhibitors are also areas of significant patent activity, demonstrating growing recognition of the versatility and underdeveloped potential of these drugs. PMID:21702715

  12. From bacterial to human dihydrouridine synthase: automated structure determination

    PubMed Central

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.


    The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr_rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer. PMID:26143927

  13. Tryptophan synthase: a multienzyme complex with an intramolecular tunnel.


    Miles, E W


    Tryptophan synthase is a classic enzyme that channels a metabolic intermediate, indole. The crystal structure of the tryptophan synthase alpha2beta2 complex from Salmonella typhimurium revealed for the first time the architecture of a multienzyme complex and the presence of an intramolecular tunnel. This remarkable hydrophobic tunnel provides a likely passageway for indole from the active site of the alpha subunit, where it is produced, to the active site of the beta subunit, where it reacts with L-serine to form L-tryptophan in a pyridoxal phosphate-dependent reaction. Rapid kinetic studies of the wild type enzyme and of channel-impaired mutant enzymes provide strong evidence for the proposed channeling mechanism. Structures of a series of enzyme-substrate intermediates at the alpha and beta active sites are elucidating enzyme mechanisms and dynamics. These structural results are providing a fascinating picture of loops opening and closing, of domain movements, and of conformational changes in the indole tunnel. Solution studies provide further evidence for ligand-induced conformational changes that send signals between the alpha and beta subunits. The combined results show that the switching of the enzyme between open and closed conformations couples the catalytic reactions at the alpha and beta active sites and prevents the escape of indole.

  14. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.


    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R


    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis.

  15. Cloricromene inhibits the induction of nitric oxide synthase.


    Zingarelli, B; Carnuccio, R; Di Rosa, M


    The effect of cloricromene, a coumarin derivative, was investigated on the lipopolysaccharide-stimulated nitric oxide (NO) synthase induction in intact aortas from endotoxin shocked rats and in the murine macrophage cell line J774. Rings of thoracic aortas from lipopolysaccharide (4 mg/kg, i.v.)-shocked rats, contracted with phenylephrine, showed a progressive decrease in tone, that was of a greater magnitude than that of aortas from naive rats. Moreover, a decreased response to the constrictor effect of phenylephrine was observed in aortas from shocked rats. In vivo treatment with cloricromene (2 mg/kg, i.v.) 30 min before lipopolysaccharide administration partially prevented the loss in tone of aortic rings and improved their reactivity to phenylephrine. Murine J774 macrophages activated with lipopolysaccharide (100 ng/ml) produced significant amounts of nitrites (NO2-; 28.2 +/- 3.5 nmol/10(6) cells per 24 h). Cloricromene (2, 20 or 200 microM) added to the cells concomitantly with lipopolysaccharide inhibited NO2- production in a concentration-dependent manner. Maximum inhibition (84.0 +/- 8.0%) was observed when cloricromene (200 microM) was added to the cells 6 h before lipopolysaccharide, whereas it was ineffective when given 6 h after endotoxin. These results demonstrate that cloricromene inhibits the expression but not the activity of the inducible NO synthase.

  16. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene.


    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma


    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC:; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_000366.1, NM_000375.2]) in evolution by studying the phylogenetic relationship and divergence of this gene using computational methods. The UROS protein sequences from various taxa were retrieved from GenBank database and were compared using Clustal-W (multiple sequence alignment) with defaults and a first-pass phylogenetic tree was built using neighbor-joining method as in DELTA BLAST 2.2.27+ version. A total of 163 BLAST hits were found for the uroporphyrinogen III synthase query sequence and these hits showed putative conserved domain, HemD superfamily (as on 14(th) Nov 2012). We then narrowed down the search by manually deleting the proteins which were not UROS sequences and sequences belonging to phyla other than Chordata were deleted. A repeat phylogenetic analysis of 39 taxa was performed using PhyML and TreeDyn software to confirm that UROS is a highly conserved protein with approximately 85% conserved sequences in almost all chordate taxons emphasizing its importance in heme synthesis.

  17. Inducible nitric oxide synthase as a possible target in hypertension.


    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E


    Nitric oxide (NO) is an important vasodilator produced by vascular endothelium. Its enzymatic formation is derived from three different synthases: neuronal (nNOS), endothelial (eNOS) and inducible (iNOS) synthases. While relatively small amounts of NO produced by eNOS are important to cardiovascular homeostasis, high NO levels produced associated with iNOS activity may have detrimental consequences to the cardiovascular system and contribute to hypertension. In this article, we reviewed current literature and found mounting evidence indicating that increased iNOS expression and activity contribute to the pathogenesis of hypertension and its complications. Excessive amounts of NO produced by iNOS up-regulation can react with superoxide anions forming peroxynitrite, thereby promoting nitrosative stress and endothelial dysfunction. In addition, abnormal iNOS activity can up-regulate arginase activity, allowing it to compete with eNOS for L-arginine, thereby resulting in reduced NO bioavailability. This may also lead to eNOS uncoupling with enhanced production of superoxide anions instead of NO. All these alterations mediated by iNOS apparently contribute to hypertension and its complications. We also reviewed current evidence showing the effects of iNOS inhibitors on different animal models of hypertension. iNOS inhibition apparently exerts antihypertensive effects, decreases oxidative and nitrosative stress, and improves vascular function. Together, these studies highlight the possibility that iNOS is a potential pharmacological target in hypertension.

  18. Transcriptional regulation of Bacillus subtilis citrate synthase genes.


    Jin, S; Sonenshein, A L


    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  19. Structural basis for glucose-6-phosphate activation of glycogen synthase

    SciTech Connect

    Baskaran, Sulochanadevi; Roach, Peter J.; DePaoli-Roach, Anna A.; Hurley, Thomas D.


    Regulation of the storage of glycogen, one of the major energy reserves, is of utmost metabolic importance. In eukaryotes, this regulation is accomplished through glucose-6-phosphate levels and protein phosphorylation. Glycogen synthase homologs in bacteria and archaea lack regulation, while the eukaryotic enzymes are inhibited by protein kinase mediated phosphorylation and activated by protein phosphatases and glucose-6-phosphate binding. We determined the crystal structures corresponding to the basal activity state and glucose-6-phosphate activated state of yeast glycogen synthase-2. The enzyme is assembled into an unusual tetramer by an insertion unique to the eukaryotic enzymes, and this subunit interface is rearranged by the binding of glucose-6-phosphate, which frees the active site cleft and facilitates catalysis. Using both mutagenesis and intein-mediated phospho-peptide ligation experiments, we demonstrate that the enzyme's response to glucose-6-phosphate is controlled by Arg583 and Arg587, while four additional arginine residues present within the same regulatory helix regulate the response to phosphorylation.

  20. Expression, crystallization and preliminary crystallographic studies of a novel bifunctional N-acetylglutamate synthase/kinase from Xanthomonas campestris homologous to vertebrate N-acetylglutamate synthase

    SciTech Connect

    Shi, Dashuang Caldovic, Ljubica; Jin, Zhongmin; Yu, Xiaolin; Qu, Qiuhao; Roth, Lauren; Morizono, Hiroki; Hathout, Yetrib; Allewell, Norma M.; Tuchman, Mendel


    Expression, crystallization and preliminary X-ray diffraction studies of a novel bifunctional N-acetylglutamate synthase/kinase from X. campestris homologous to vertebrate N-acetylglutamate synthase are reported. A novel N-acetylglutamate synthase/kinase bifunctional enzyme of arginine biosynthesis that was homologous to vertebrate N-acetylglutamate synthases was identified in Xanthomonas campestris. The protein was overexpressed, purified and crystallized. The crystals belong to the hexagonal space group P6{sub 2}22, with unit-cell parameters a = b = 134.60, c = 192.11 Å, and diffract to about 3.0 Å resolution. Selenomethionine-substituted recombinant protein was produced and selenomethionine substitution was verified by mass spectroscopy. Multiple anomalous dispersion (MAD) data were collected at three wavelengths at SER-CAT, Advanced Photon Source, Argonne National Laboratory. Structure determination is under way using the MAD phasing method.

  1. Characterization of a chitin synthase encoding gene and effect of diflubenzuron in soybean aphid, Aphis glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chitin synthases are critical enzymes for synthesis of chitin and thus for subsequent growth and development in insects. We have identified and characterized a chitin synthase gene (CHS) from cDNA of Aphis glycines, the soybean aphid, a serious pest of soybean. The full-length cDNA of CHS in A. glyc...

  2. Molecular cloning of an 1-aminocyclopropane-1-carboxylate synthase from senescing carnation flower petals.


    Park, K Y; Drory, A; Woodson, W R


    Synthetic oligonucleotides based on the sequence of 1-aminocyclopropane-1-carboxylate (ACC) synthase from tomato were used to prime the synthesis and amplification of a 337 bp tomato ACC synthase cDNA by polymerase chain reaction (PCR). This PCR product was used to screen a cDNA library prepared from mRNA isolated from senescing carnation flower petals. Two cDNA clones were isolated which represented the same mRNA. The longer of the two clones (CARACC3) contained a 1950 bp insert with a single open reading frame of 516 amino acids encoding a protein of 58 kDa. The predicted protein from the carnation ACC synthase cDNA was 61%, 61%, 64%, and 51% identical to the deduced proteins from zucchini squash, winter squash, tomato, and apple, respectively. Genomic DNA gel blot analysis indicated the presence of at least a second gene in carnation which hybridized to CARACC3 under conditions of low stringency. ACC synthase mRNA accumulates during senescence of carnation flower petals concomitant with the increase in ethylene production and ACC synthase enzyme activity. Ethylene induced the accumulation of ACC synthase mRNA in presenescent petals. Wound-induced ethylene production in leaves was not associated with an increase in ACC synthase mRNA represented by CARACC3. These results indicate that CARACC3 represents an ACC synthase transcript involved in autocatalytic ethylene production in senescing flower petals.

  3. Helical arrays of U-shaped ATP synthase dimers form tubular cristae in ciliate mitochondria

    PubMed Central

    Mühleip, Alexander W.; Joos, Friederike; Wigge, Christoph; Frangakis, Achilleas S.; Kühlbrandt, Werner; Davies, Karen M.


    F1Fo-ATP synthases are universal energy-converting membrane protein complexes that synthesize ATP from ADP and inorganic phosphate. In mitochondria of yeast and mammals, the ATP synthase forms V-shaped dimers, which assemble into rows along the highly curved ridges of lamellar cristae. Using electron cryotomography and subtomogram averaging, we have determined the in situ structure and organization of the mitochondrial ATP synthase dimer of the ciliate Paramecium tetraurelia. The ATP synthase forms U-shaped dimers with parallel monomers. Each complex has a prominent intracrista domain, which links the c-ring of one monomer to the peripheral stalk of the other. Close interaction of intracrista domains in adjacent dimers results in the formation of helical ATP synthase dimer arrays, which differ from the loose dimer rows in all other organisms observed so far. The parameters of the helical arrays match those of the cristae tubes, suggesting the unique features of the P. tetraurelia ATP synthase are directly responsible for generating the helical tubular cristae. We conclude that despite major structural differences between ATP synthase dimers of ciliates and other eukaryotes, the formation of ATP synthase dimer rows is a universal feature of mitochondria and a fundamental determinant of cristae morphology. PMID:27402755

  4. Studies on 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase using chorismate mutase inhibitors.


    Birck, M R; Husain, A; Sheflyan, G Y; Ganem, B; Woodard, R W


    The proposed cyclic mechanism of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase and the mechanism of chorismate mutase share certain structural and electronic similarities. In this report, we examine several inhibitors of chorismate mutase for their efficacy against KDO 8-P synthase.

  5. Starter unit specificity directs genome mining of polyketide synthase pathways in fungi

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Search of the protein database with the aflatoxin pathway polyketide synthase (PKS) revealed putative PKSs in the pathogenic fungi Coccidioides immitis and Coccidioides posadasii that could require partnerships with a pair of fatty acid synthase (FAS) subunits for the biosynthesis of fatty acid-poly...

  6. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  7. Studies of inositol 1-phosphate analogues as inhibitors of the phosphatidylinositol phosphate synthase in mycobacteria.


    Morii, Hiroyuki; Okauchi, Tatsuo; Nomiya, Hiroki; Ogawa, Midori; Fukuda, Kazumasa; Taniguchi, Hatsumi


    We previously reported a novel pathway for the biosynthesis of phosphatidylinositol in mycobacteria via phosphatidylinositol phosphate (PIP) [Morii H., Ogawa, M., Fukuda, K., Taniguchi, H., and Koga, Y (2010) J. Biochem. 148, 593-602]. PIP synthase in the pathway is a promising target for the development of new anti-mycobacterium drugs. In the present study, we evaluated the characteristics of the PIP synthase of Mycobacterium tuberculosis. Four types of compounds were chemically synthesized based on the assumption that structural homologues of inositol 1-phosphate, a PIP synthase substrate, would act as PIP synthase inhibitors, and the results confirmed that all synthesized compounds inhibited PIP synthase activity. The phosphonate analogue of inositol 1-phosphate (Ino-C-P) had the greatest inhibitory effect among the synthesized compounds examined. Kinetic analysis indicated that Ino-C-P acted as a competitive inhibitor of inositol 1-phosphate. The IC(50) value for Ino-C-P inhibition of the PIP synthase activity was estimated to be 2.0 mM. Interestingly, Ino-C-P was utilized in the same manner as the normal PIP synthase substrate, leading to the synthesis of a phosphonate analogue of PIP (PI-C-P), which had a structure similar to that of the natural product, PIP. In addition, PI-C-P had high inhibitory activity against PIP synthase.

  8. Cloning, Expression, and Characterization of cis-Polyprenyl Diphosphate Synthase from the Thermoacidophilic Archaeon Sulfolobus acidocaldarius

    PubMed Central

    Hemmi, Hisashi; Yamashita, Satoshi; Shimoyama, Takefumi; Nakayama, Toru; Nishino, Tokuzo


    cis-polyprenyl diphosphate synthases are involved in the biosynthesis of the glycosyl carrier lipid in most organisms. However, only little is known about this enzyme of archaea. In this report, we isolated the gene of cis-polyprenyl diphosphate synthase from a thermoacidophilic archaeon, Sulfolobus acidocaldarius, and characterized the recombinant enzyme. PMID:11114943

  9. [The influence of inhibitors of neuronal and inducible NO-synthases on experimental hemorrhagic stroke].


    Krushinskiĭ, A L; Kuzenkov, V S; D'iakonova, V E; Reutov, V P


    Objectives. To study the effect of inhibitors of neuronal and inducible NO-synthase on the development of hemorrhagic stroke in rats Krushinsky-Molodkina (KM) without adaptation to hypoxia and with short-term adaptation to hypobaric hypoxia. Material and methods. Ninety rats were included in the study. Experiments with short-term adaptation to hypobaric hypoxia were performed on 48 rats. The inhibitor of inducible NO-synthase (aminoguanidine, "Sigma") or the inhibitor of neuronal NO-synthase (7-nitroindasol, "Sigma") were injected in dosage 2.5 mg/100g intraperitoneally. Results. Selective inhibitors of neuronal and inducible NO-synthase had a protective effect on stress injuries in KM rats. The inhibitor of neuronal NO-synthase was more effective than the inhibitor of inducible NO-synthase in the experiments without adaptation to hypoxia. Markedly greater protective effect was achieved by the simultaneous introduction of inhibitors of neuronal and inducible NO-synthase. The greatest protective effect in the development of stress damage in rats of KM was observed in short-term adaptation to hypobaric hypoxia with simultaneous introduction of both inhibitors. Conclusions. It can be assumed that an excessive amount of NO produced by neuronal and inducible NO-synthases during the acoustic exposure in KM rats leads to stress damage. Use of selective inhibitors reduce the excess NO synthesis and the development of audiogenic stress damage caused by hemorrhagic stroke.

  10. Characterization of the cDNA and gene coding for the biotin synthase of Arabidopsis thaliana.

    PubMed Central

    Weaver, L M; Yu, F; Wurtele, E S; Nikolau, B J


    Biotin, an essential cofactor, is synthesized de novo only by plants and some microbes. An Arabidopsis thaliana expressed sequence tag that shows sequence similarity to the carboxyl end of biotin synthase from Escherichia coli was used to isolate a near-full-length cDNA. This cDNA was shown to code for the Arabidopsis biotin synthase by its ability to complement a bioB mutant of E. coli. Site-specific mutagenesis indicates that residue threonine-173, which is highly conserved in biotin synthases, is important for catalytic competence of the enzyme. The primary sequence of the Arabidopsis biotin synthase is most similar to biotin synthases from E. coli, Serratia marcescens, and Saccharomyces cerevisiae (about 50% sequence identity) and more distantly related to the Bacillus sphaericus enzyme (33% sequence identity). The primary sequence of the amino terminus of the Arabidopsis biotin synthase may represent an organelle-targeting transit peptide. The single Arabidopsis gene coding for biotin synthase, BIO2, was isolated and sequenced. The biotin synthase coding sequence is interrupted by five introns. The gene sequence upstream of the translation start site has several unusual features, including imperfect palindromes and polypyrimidine sequences, which may function in the transcriptional regulation of the BIO2 gene. PMID:8819873

  11. Rational conversion of substrate and product specificity in a Salvia monoterpene synthase: structural insights into the evolution of terpene synthase function.


    Kampranis, Sotirios C; Ioannidis, Daphne; Purvis, Alan; Mahrez, Walid; Ninga, Ederina; Katerelos, Nikolaos A; Anssour, Samir; Dunwell, Jim M; Degenhardt, Jörg; Makris, Antonios M; Goodenough, Peter W; Johnson, Christopher B


    Terpene synthases are responsible for the biosynthesis of the complex chemical defense arsenal of plants and microorganisms. How do these enzymes, which all appear to share a common terpene synthase fold, specify the many different products made almost entirely from one of only three substrates? Elucidation of the structure of 1,8-cineole synthase from Salvia fruticosa (Sf-CinS1) combined with analysis of functional and phylogenetic relationships of enzymes within Salvia species identified active-site residues responsible for product specificity. Thus, Sf-CinS1 was successfully converted to a sabinene synthase with a minimum number of rationally predicted substitutions, while identification of the Asn side chain essential for water activation introduced 1,8-cineole and alpha-terpineol activity to Salvia pomifera sabinene synthase. A major contribution to product specificity in Sf-CinS1 appears to come from a local deformation within one of the helices forming the active site. This deformation is observed in all other mono- or sesquiterpene structures available, pointing to a conserved mechanism. Moreover, a single amino acid substitution enlarged the active-site cavity enough to accommodate the larger farnesyl pyrophosphate substrate and led to the efficient synthesis of sesquiterpenes, while alternate single substitutions of this critical amino acid yielded five additional terpene synthases.

  12. Cloning and Characterization of Inducible Nitric Oxide Synthase from Mouse Macrophages

    NASA Astrophysics Data System (ADS)

    Xie, Qiao-Wen; Cho, Hearn J.; Calaycay, Jimmy; Mumford, Richard A.; Swiderek, Kristine M.; Lee, Terry D.; Ding, Aihao; Troso, Tiffany; Nathan, Carl


    Nitric oxide (NO) conveys a variety of messages between cells, including signals for vasorelaxation, neurotransmission, and cytotoxicity. In some endothelial cells and neurons, a constitutive NO synthase is activated transiently by agonists that elevate intracellular calcium concentrations and promote the binding of calmodulin. In contrast, in macrophages, NO synthase activity appears slowly after exposure of the cells to cytokines and bacterial products, is sustained, and functions independently of calcium and calmodulin. A monospecific antibody was used to clone complementary DNA that encoded two isoforms of NO synthase from immunologically activated mouse macrophages. Liquid chromatography-mass spectrometry was used to confirm most of the amino acid sequence. Macrophage NO synthase differs extensively from cerebellar NO synthase. The macrophage enzyme is immunologically induced at the transcriptional level and closely resembles the enzyme in cytokine-treated tumor cells and inflammatory neutrophils.

  13. Molecular cloning, functional expression and characterization of (E)-beta farnesene synthase from Citrus junos.


    Maruyama, T; Ito, M; Honda, G


    We cloned the gene of the acyclic sesquiterpene synthase, (E)-beta-farnesene synthase (CJFS) from Yuzu (Citrus junos, Rutaceae). The function of CJFS was elucidated by the preparation of recombinant protein and subsequent enzyme assay. CJFS consisted of 1867 nucleotides including 1680 bp of coding sequence encoding a protein of 560 amino acids with a molecular weight of 62 kDa. The deduced amino acid sequence possessed characteristic amino acid residues, such as the DDxxD motif, which are highly conserved among terpene synthases. This is the first report of the cloning of a terpene synthase from a Rutaceous plant. A possible reaction mechanism for terpene biosynthesis is also discussed on the basis of sequence comparison of CJFS with known sesquiterpene synthase genes.

  14. Expression, crystallization and structure elucidation of γ-terpinene synthase from Thymus vulgaris.


    Rudolph, Kristin; Parthier, Christoph; Egerer-Sieber, Claudia; Geiger, Daniel; Muller, Yves A; Kreis, Wolfgang; Müller-Uri, Frieder


    The biosynthesis of γ-terpinene, a precursor of the phenolic isomers thymol and carvacrol found in the essential oil from Thymus sp., is attributed to the activitiy of γ-terpinene synthase (TPS). Purified γ-terpinene synthase from T. vulgaris (TvTPS), the Thymus species that is the most widely spread and of the greatest economical importance, is able to catalyze the enzymatic conversion of geranyl diphosphate (GPP) to γ-terpinene. The crystal structure of recombinantly expressed and purified TvTPS is reported at 1.65 Å resolution, confirming the dimeric structure of the enzyme. The putative active site of TvTPS is deduced from its pronounced structural similarity to enzymes from other species of the Lamiaceae family involved in terpenoid biosynthesis: to (+)-bornyl diphosphate synthase and 1,8-cineole synthase from Salvia sp. and to (4S)-limonene synthase from Mentha spicata.

  15. Evolution of pyrrolizidine alkaloids in Phalaenopsis orchids and other monocotyledons: identification of deoxyhypusine synthase, homospermidine synthase and related pseudogenes.


    Nurhayati, Niknik; Gondé, Daniela; Ober, Dietrich


    In order to study the evolution of pathways of plant secondary metabolism, we use the biosynthesis of pyrrolizidine alkaloids (PAs) as a model system. PAs are regarded as part of the plant's constitutive defense against herbivores. Homospermidine synthase (HSS) is the first specific enzyme of PA biosynthesis. The gene encoding HSS has been recruited from the gene encoding deoxyhypusine synthase (DHS) from primary metabolism at least four times independently during angiosperm evolution. One of these recruitment occurred within the monocot lineage. We have used the PA-producing orchid Phalaenopsis to identify the cDNAs encoding HSS, DHS and the substrate protein for DHS, i.e., the precursor of the eukaryotic initiation factor 5A. A cDNA identified from maize was unequivocally characterized as DHS. From our study of Phalaenopsis, several pseudogenes emerged, of which one was shown to be a "processed pseudogene", and others to be transcribed. Sequence comparison of the HSS- and DHS-encoding sequences from this investigation with those of monocot species taken from the databases suggest that HSS and probably the ability to produce PAs is an old feature within the monocot lineage. This result is discussed with respect to the recent discovery of structural related PAs within grasses.

  16. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.


    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  17. Functional contribution of chorismate synthase, anthranilate synthase, and chorismate mutase to penetration resistance in barley-powdery mildew interactions.


    Hu, Pingsha; Meng, Yan; Wise, Roger P


    Plant processes resulting from primary or secondary metabolism have been hypothesized to contribute to defense against microbial attack. Barley chorismate synthase (HvCS), anthranilate synthase alpha subunit 2 (HvASa2), and chorismate mutase 1 (HvCM1) occupy pivotal branch points downstream of the shikimate pathway leading to the synthesis of aromatic amino acids. Here, we provide functional evidence that these genes contribute to penetration resistance to Blumeria graminis f. sp. hordei, the causal agent of powdery mildew disease. Single-cell transient-induced gene silencing of HvCS and HvCM1 in mildew resistance locus a (Mla) compromised cells resulted in increased susceptibility. Correspondingly, overexpression of HvCS, HvASa2, and HvCM1 in lines carrying mildew resistance locus o (Mlo), a negative regulator of penetration resistance, significantly decreased susceptibility. Barley stripe mosaic virus-induced gene silencing of HvCS, HvASa2, and HvCM1 significantly increased B. graminis f. sp. hordei penetration into epidermal cells, followed by formation of haustoria and secondary hyphae. However, sporulation of B. graminis f. sp. hordei was not detected on the silenced host plants up to 3 weeks after inoculation. Taken together, these results establish a previously unrecognized role for the influence of HvCS, HvASa2, and HvCM1 on penetration resistance and on the rate of B. graminis f. sp. hordei development in Mla-mediated, barley-powdery mildew interactions.

  18. Interaction between DAHP synthase and chorismate mutase endows new regulation on DAHP synthase activity in Corynebacterium glutamicum.


    Li, Pan-Pan; Li, De-Feng; Liu, Di; Liu, Yi-Ming; Liu, Chang; Liu, Shuang-Jiang


    Previous research on Corynebacterium glutamicum revealed that 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DSCg, formerly DS2098) interacts with chorismate mutase (CMCg, formerly CM0819). In this study, we investigated the interaction by means of structure-guided mutation and enzymatic assays. Our results show that the interaction imparted a new mechanism for regulation of DAHP activity: In the absence of CMCg, DSCg activity was not regulated by prephenate, whereas in the presence of CMCg, prephenate markedly inhibited DSCg activity. Prephenate competed with the substrate phosphoenolpyruvate, and the inhibition constant (K i) was determined to be 0.945 mM. Modeling based on the structure of the complex formed between DAHP synthase and chorismate mutase of Mycobacterium tuberculosis predicted the interaction surfaces of the putative DSCg-CMCg complex. The amino acid residues and structural domains that contributed to the interaction surfaces were experimentally identified to be the (212)SPAGARYE(219) sequence of DSCg and the (60)SGGTR(64) loop and C-terminus ((97)RGKLG(101)) of CMCg.

  19. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.


    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You


    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  20. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).


    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un


    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  1. Functional characterization of ent-copalyl diphosphate synthase, kaurene synthase and kaurene oxidase in the Salvia miltiorrhiza gibberellin biosynthetic pathway.


    Su, Ping; Tong, Yuru; Cheng, Qiqing; Hu, Yating; Zhang, Meng; Yang, Jian; Teng, Zhongqiu; Gao, Wei; Huang, Luqi


    Salvia miltiorrhiza Bunge is highly valued in traditional Chinese medicine for its roots and rhizomes. Its bioactive diterpenoid tanshinones have been reported to have many pharmaceutical activities, including antibacterial, anti-inflammatory, and anticancer properties. Previous studies found four different diterpenoid biosynthetic pathways from the universal diterpenoid precursor (E,E,E)-geranylgeranyl diphosphate (GGPP) in S. miltiorrhiza. Here, we describe the functional characterization of ent-copalyl diphosphate synthase (SmCPSent), kaurene synthase (SmKS) and kaurene oxidase (SmKO) in the gibberellin (GA) biosynthetic pathway. SmCPSent catalyzes the cyclization of GGPP to ent-copalyl diphosphate (ent-CPP), which is converted to ent-kaurene by SmKS. Then, SmKO catalyzes the three-step oxidation of ent-kaurene to ent-kaurenoic acid. Our results show that the fused enzyme SmKS-SmCPSent increases ent-kaurene production by several fold compared with separate expression of SmCPSent and SmKS in yeast strains. In this study, we clarify the GA biosynthetic pathway from GGPP to ent-kaurenoic acid and provide a foundation for further characterization of the subsequent enzymes involved in this pathway. These insights may allow for better growth and the improved accumulation of bioactive tanshinones in S. miltiorrhiza through the regulation of the expression of these genes during developmental processes.

  2. Functional characterization of ent-copalyl diphosphate synthase, kaurene synthase and kaurene oxidase in the Salvia miltiorrhiza gibberellin biosynthetic pathway

    PubMed Central

    Su, Ping; Tong, Yuru; Cheng, Qiqing; Hu, Yating; Zhang, Meng; Yang, Jian; Teng, Zhongqiu; Gao, Wei; Huang, Luqi


    Salvia miltiorrhiza Bunge is highly valued in traditional Chinese medicine for its roots and rhizomes. Its bioactive diterpenoid tanshinones have been reported to have many pharmaceutical activities, including antibacterial, anti-inflammatory, and anticancer properties. Previous studies found four different diterpenoid biosynthetic pathways from the universal diterpenoid precursor (E,E,E)-geranylgeranyl diphosphate (GGPP) in S. miltiorrhiza. Here, we describe the functional characterization of ent-copalyl diphosphate synthase (SmCPSent), kaurene synthase (SmKS) and kaurene oxidase (SmKO) in the gibberellin (GA) biosynthetic pathway. SmCPSent catalyzes the cyclization of GGPP to ent-copalyl diphosphate (ent-CPP), which is converted to ent-kaurene by SmKS. Then, SmKO catalyzes the three-step oxidation of ent-kaurene to ent-kaurenoic acid. Our results show that the fused enzyme SmKS-SmCPSent increases ent-kaurene production by several fold compared with separate expression of SmCPSent and SmKS in yeast strains. In this study, we clarify the GA biosynthetic pathway from GGPP to ent-kaurenoic acid and provide a foundation for further characterization of the subsequent enzymes involved in this pathway. These insights may allow for better growth and the improved accumulation of bioactive tanshinones in S. miltiorrhiza through the regulation of the expression of these genes during developmental processes. PMID:26971881

  3. Characterization and localization of phosphatidylglycerophosphate and phosphatidylserine synthases in Rhodobacter sphaeroides.


    Radcliffe, C W; Steiner, F X; Carman, G M; Niederman, R A


    Catalytic properties and membrane associations of the phosphatidylglycerophosphate (PGP) and phosphatidylserine (PS) synthases of Rhodobacter sphaeroides were examined to further characterize sites of phospholipid biosynthesis. In preparations of cytoplasmic membrane (CM) enriched in these activities, apparent Km values of PGP synthase were 90 microM for sn-glycerol-3-phosphate and 60 microM for CDP-diacylglycerol; the apparent Km of PS synthase for L-serine was near 165 microM. Both enzymes required Triton X-100 with optimal PS synthase activity at a detergent/CDP-diacylglycerol (mol/mol) ratio of 7.5:1.0, while for optimal PGP synthase, a range of 10-50:1.0 was observed. Unlike the enzyme in Escherichia coli and several other Gram-negative bacteria, the PS synthase activity had a specific requirement for magnesium and was tightly associated with membranes rather than ribosomes in crude cell extracts. Sedimentation studies suggested that the PGP synthase was distributed uniformly over the CM in both chemoheterotrophically and photoheterotrophically grown cells, while the PS synthase was confined mainly to a vesicular CM fraction. Solubilized PGP synthase activity migrated as a single band with a pI value near 5.5 in a chromato-focusing column and 5.8 on isoelectric focusing; in the latter procedure, the pI was shifted to 5.3 in the presence of CDP-diacylglycerol. The PGP synthase activity gave rise to a single polypeptide band in lithium dodecyl sulfate-polyacrylamide gel electrophoresis at 4 degrees C.

  4. Crystal structures capture three states in the catalytic cycle of a pyridoxal phosphate (PLP) synthase.


    Smith, Amber Marie; Brown, William Clay; Harms, Etti; Smith, Janet L


    PLP synthase (PLPS) is a remarkable single-enzyme biosynthetic pathway that produces pyridoxal 5'-phosphate (PLP) from glutamine, ribose 5-phosphate, and glyceraldehyde 3-phosphate. The intact enzyme includes 12 synthase and 12 glutaminase subunits. PLP synthesis occurs in the synthase active site by a complicated mechanism involving at least two covalent intermediates at a catalytic lysine. The first intermediate forms with ribose 5-phosphate. The glutaminase subunit is a glutamine amidotransferase that hydrolyzes glutamine and channels ammonia to the synthase active site. Ammonia attack on the first covalent intermediate forms the second intermediate. Glyceraldehyde 3-phosphate reacts with the second intermediate to form PLP. To investigate the mechanism of the synthase subunit, crystal structures were obtained for three intermediate states of the Geobacillus stearothermophilus intact PLPS or its synthase subunit. The structures capture the synthase active site at three distinct steps in its complicated catalytic cycle, provide insights into the elusive mechanism, and illustrate the coordinated motions within the synthase subunit that separate the catalytic states. In the intact PLPS with a Michaelis-like intermediate in the glutaminase active site, the first covalent intermediate of the synthase is fully sequestered within the enzyme by the ordering of a generally disordered 20-residue C-terminal tail. Following addition of ammonia, the synthase active site opens and admits the Lys-149 side chain, which participates in formation of the second intermediate and PLP. Roles are identified for conserved Asp-24 in the formation of the first intermediate and for conserved Arg-147 in the conversion of the first to the second intermediate.

  5. Protons, the thylakoid membrane, and the chloroplast ATP synthase.


    Junge, W


    According to the chemiosmotic theory, proton pumps and ATP synthases are coupled by lateral proton flow through aqueous phases. Three long-standing challenges to this concept, all of which have been loosely subsumed under 'localized coupling' in the literature, were examined in the light of experiments carried out with thylakoids: (1) Nearest neighbor interaction between pumps and ATP synthases. Considering the large distances between photosystem II and CFoCF1, in stacked thylakoids this is a priori absent. (2) Enhanced proton diffusion along the surface of the membrane. This could not be substantiated for the outer side of the thylakoid membrane. Even for the interface between pure lipid and water, two laboratories have reported the absence of enhanced diffusion. (3) Localized proton ducts in the membrane. Intramembrane domains that can transiently trap protons do exist in thylakoid membranes, but because of their limited storage capacity for protons, they probably do not matter for photophosphorylation under continuous light. Seemingly in favor of localized proton ducts is the failure of a supposedly permeant buffer to enhance the onset lag of photophosphorylation. However, it was found that failure of some buffers and the ability of others in this respect were correlated with their failure/ability to quench pH transients in the thylakoid lumen, as predicted by the chemiosmotic theory. It was shown that the chemiosmotic concept is a fair approximation, even for narrow aqueous phases, as in stacked thylakoids. These are approximately isopotential, and protons are taken in by the ATP synthase straight from the lumen. The molecular mechanism by which F0F1 ATPases couple proton flow to ATP synthesis is still unknown. The threefold structural symmetry of the headpiece that, probably, finds a corollary in the channel portion of these enzymes appeals to the common wisdom that structural symmetry causes functional symmetry. "Rotation catalysis" has been proposed. It is

  6. Glycogen Synthase Kinase-3 (GSK-3)-Targeted Therapy and Imaging

    PubMed Central

    Pandey, Mukesh K.; DeGrado, Timothy R.


    Glycogen synthase kinase-3 (GSK-3) is associated with various key biological processes, including glucose regulation, apoptosis, protein synthesis, cell signaling, cellular transport, gene transcription, proliferation, and intracellular communication. Accordingly, GSK-3 has been implicated in a wide variety of diseases and specifically targeted for both therapeutic and imaging applications by a large number of academic laboratories and pharmaceutical companies. Here, we review the structure, function, expression levels, and ligand-binding properties of GSK-3 and its connection to various diseases. A selected list of highly potent GSK-3 inhibitors, with IC50 <20 nM for adenosine triphosphate (ATP)-competitive inhibitors and IC50 <5 μM for non-ATP-competitive inhibitors, were analyzed for structure activity relationships. Furthermore, ubiquitous expression of GSK-3 and its possible impact on therapy and imaging are also highlighted. Finally, a rational perspective and possible route to selective and effective GSK-3 inhibitors is discussed. PMID:26941849

  7. Catalysis and Sulfa Drug Resistance in Dihydropteroate Synthase

    SciTech Connect

    Yun, Mi-Kyung; Wu, Yinan; Li, Zhenmei; Zhao, Ying; Waddell, M. Brett; Ferreira, Antonio M.; Lee, Richard E.; Bashford, Donald; White, Stephen W.


    The sulfonamide antibiotics inhibit dihydropteroate synthase (DHPS), a key enzyme in the folate pathway of bacteria and primitive eukaryotes. However, resistance mutations have severely compromised the usefulness of these drugs. We report structural, computational, and mutagenesis studies on the catalytic and resistance mechanisms of DHPS. By performing the enzyme-catalyzed reaction in crystalline DHPS, we have structurally characterized key intermediates along the reaction pathway. Results support an S{sub N}1 reaction mechanism via formation of a novel cationic pterin intermediate. We also show that two conserved loops generate a substructure during catalysis that creates a specific binding pocket for p-aminobenzoic acid, one of the two DHPS substrates. This substructure, together with the pterin-binding pocket, explains the roles of the conserved active-site residues and reveals how sulfonamide resistance arises.

  8. The Interplay between Myc and CTP Synthase in Drosophila

    PubMed Central

    Aughey, Gabriel N.; Grice, Stuart J.; Liu, Ji-Long


    CTP synthase (CTPsyn) is essential for the biosynthesis of pyrimidine nucleotides. It has been shown that CTPsyn is incorporated into a novel cytoplasmic structure which has been termed the cytoophidium. Here, we report that Myc regulates cytoophidium formation during Drosophila oogenesis. We have found that Myc protein levels correlate with cytoophidium abundance in follicle epithelia. Reducing Myc levels results in cytoophidium loss and small nuclear size in follicle cells, while overexpression of Myc increases the length of cytoophidia and the nuclear size of follicle cells. Ectopic expression of Myc induces cytoophidium formation in late stage follicle cells. Furthermore, knock-down of CTPsyn is sufficient to suppress the overgrowth phenotype induced by Myc overexpression, suggesting CTPsyn acts downstream of Myc and is required for Myc-mediated cell size control. Taken together, our data suggest a functional link between Myc, a renowned oncogene, and the essential nucleotide biosynthetic enzyme CTPsyn. PMID:26889675

  9. Catalysis and sulfa drug resistance in dihydropteroate synthase.


    Yun, Mi-Kyung; Wu, Yinan; Li, Zhenmei; Zhao, Ying; Waddell, M Brett; Ferreira, Antonio M; Lee, Richard E; Bashford, Donald; White, Stephen W


    The sulfonamide antibiotics inhibit dihydropteroate synthase (DHPS), a key enzyme in the folate pathway of bacteria and primitive eukaryotes. However, resistance mutations have severely compromised the usefulness of these drugs. We report structural, computational, and mutagenesis studies on the catalytic and resistance mechanisms of DHPS. By performing the enzyme-catalyzed reaction in crystalline DHPS, we have structurally characterized key intermediates along the reaction pathway. Results support an S(N)1 reaction mechanism via formation of a novel cationic pterin intermediate. We also show that two conserved loops generate a substructure during catalysis that creates a specific binding pocket for p-aminobenzoic acid, one of the two DHPS substrates. This substructure, together with the pterin-binding pocket, explains the roles of the conserved active-site residues and reveals how sulfonamide resistance arises.

  10. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.


    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik


    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  11. Sulfa use, dihydropteroate synthase mutations, and Pneumocystis jirovecii pneumonia.


    Stein, Cheryl R; Poole, Charles; Kazanjian, Powel; Meshnick, Steven R


    A systematic review was conducted to examine the associations in Pneumocystis jirovecii pneumonia (PCP) patients between dihydropteroate synthase (DHPS) mutations and sulfa or sulfone (sulfa) prophylaxis and between DHPS mutations and sulfa treatment outcome. Selection criteria included study populations composed entirely of PCP patients and mutation or treatment outcome results for all patients, regardless of exposure status. Based on 13 studies, the risk of developing DHPS mutations is higher for PCP patients receiving sulfa prophylaxis than for PCP patients not receiving sulfa prophylaxis (p < 0.001). Results are too heterogeneous (p < 0.001) to warrant a single summary effect estimate. Estimated effects are weaker after 1996 and stronger in studies that included multiple isolates per patient. Five studies examined treatment outcome. The effect of DHPS mutations on treatment outcome has not been well studied, and the few studies that have been conducted are inconsistent even as to the presence or absence of an association.

  12. Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice

    PubMed Central

    Scherthan, Harry; Horsch, Marion; Beckers, Johannes; Fuchs, Helmut; Gailus-Durner, Valerie; Hrabě de Angelis, Martin; Ford, Steven J.; Burton, Neal C.; Razansky, Daniel; Trümbach, Dietrich; Aichler, Michaela; Walch, Axel Karl; Calzada-Wack, Julia; Neff, Frauke; Wurst, Wolfgang; Hartmann, Tobias; Floss, Thomas


    Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility. PMID:27788151

  13. The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms

    PubMed Central

    Shi, Dashuang; Allewell, Norma M.; Tuchman, Mendel


    N-acetylglutamate synthase (NAGS) catalyzes the production of N-acetylglutamate (NAG) from acetyl-CoA and l-glutamate. In microorganisms and plants, the enzyme functions in the arginine biosynthetic pathway, while in mammals, its major role is to produce the essential co-factor of carbamoyl phosphate synthetase 1 (CPS1) in the urea cycle. Recent work has shown that several different genes encode enzymes that can catalyze NAG formation. A bifunctional enzyme was identified in certain bacteria, which catalyzes both NAGS and N-acetylglutamate kinase (NAGK) activities, the first two steps of the arginine biosynthetic pathway. Interestingly, these bifunctional enzymes have higher sequence similarity to vertebrate NAGS than those of the classical (mono-functional) bacterial NAGS. Solving the structures for both classical bacterial NAGS and bifunctional vertebrate-like NAGS/K has advanced our insight into the regulation and catalytic mechanisms of NAGS, and the evolutionary relationship between the two NAGS groups. PMID:26068232

  14. Structure-function analyses of plant type III polyketide synthases.


    Weng, Jing-Ke; Noel, Joseph P


    Plant type III polyketide synthases (PKSs) form a superfamily of biosynthetic enzymes involved in the production of a plethora of polyketide-derived natural products important for ecological adaptations and the fitness of land plants. Moreover, tremendous interest in bioengineering of type III PKSs to produce high-value compounds is increasing. Compared to type I and type II PKSs, which form either large modular protein complexes or dissociable molecular assemblies, type III PKSs exist as smaller homodimeric proteins, technically more amenable for detailed quantitative biochemical and phylogenetic analyses. In this chapter, we summarize a collection of approaches, including bioinformatics, genetics, protein crystallography, in vitro biochemistry, and mutagenesis, together affording a comprehensive interrogation of the structure-function-evolutionary relationships in the plant type III PKS family.

  15. Natural and engineered production of taxadiene with taxadiene synthase.


    Soliman, Sameh; Tang, Yi


    Taxadiene synthase (TXS) is the rate-limiting enzyme in the biosynthesis of paclitaxel, an important anticancer compound. TXS catalyzes the conversion of the diterpene precursor geranylgeranyl pyrophosphate (GGPP) into the diterpene taxadiene. Due to the importance of taxadiene in the overall biosynthetic pathway of paclitaxel biosynthesis, the enzyme TXS has been the subject of intense scientific and engineering investigations. The crystal structure of TXS was recently elucidated, thereby providing an atomic blueprint for future protein engineering efforts. Metabolic engineering of TXS for taxadiene product in different microbial and plant organisms have also been extensively performed, culminating in the high-titer production in Escherichia coli. Additional aspects of taxadiene production by TXS will be discussed in the review, including metabolic regulation in native host and possible production by endophytic fungal hosts.

  16. Nitric oxide synthase in plants: Where do we stand?


    Santolini, Jérôme; André, François; Jeandroz, Sylvain; Wendehenne, David


    Over the past twenty years, nitric oxide (NO) has emerged as an important player in various plant physiological processes. Although many advances in the understanding of NO functions have been made, the question of how NO is produced in plants is still challenging. It is now generally accepted that the endogenous production of NO is mainly accomplished through the reduction of nitrite via both enzymatic and non-enzymatic mechanisms which remain to be fully characterized. Furthermore, experimental arguments in favour of the existence of plant nitric oxide synthase (NOS)-like enzymes have been reported. However, recent investigations revealed that land plants do not possess animal NOS-like enzymes while few algal species do. Phylogenetic and structural analyses reveals interesting features specific to algal NOS-like proteins.

  17. Commercial Herbicides Can Trigger the Oxidative Inactivation of Acetohydroxyacid Synthase.


    Lonhienne, Thierry; Nouwens, Amanda; Williams, Craig M; Fraser, James A; Lee, Yu-Ting; West, Nicholas P; Guddat, Luke W


    Acetohydroxyacid synthase (AHAS) inhibitors are highly successful commercial herbicides. New kinetic data show that the binding of these compounds leads to reversible accumulative inhibition of AHAS. Crystallographic data (to a resolution of 2.17 Å) for an AHAS-herbicide complex shows that closure of the active site occurs when the herbicidal inhibitor binds, thus preventing exchange with solvent. This feature combined with new kinetic data shows that molecular oxygen promotes an accumulative inhibition leading to the conclusion that the exceptional potency of these herbicides is augmented by subversion of an inherent oxygenase side reaction. The reactive oxygen species produced by this reaction are trapped in the active site, triggering oxidation reactions that ultimately lead to the alteration of the redox state of the cofactor flavin adenine dinucleotide (FAD), a feature that accounts for the observed reversible accumulative inhibition.

  18. Identification of sucrose synthase as an actin-binding protein

    NASA Technical Reports Server (NTRS)

    Winter, H.; Huber, J. L.; Huber, S. C.; Davies, E. (Principal Investigator)


    Several lines of evidence indicate that sucrose synthase (SuSy) binds both G- and F-actin: (i) presence of SuSy in the Triton X-100-insoluble fraction of microsomal membranes (i.e. crude cytoskeleton fraction); (ii) co-immunoprecipitation of actin with anti-SuSy monoclonal antibodies; (iii) association of SuSy with in situ phalloidin-stabilized F-actin filaments; and (iv) direct binding to F-actin, polymerized in vitro. Aldolase, well known to interact with F-actin, interfered with binding of SuSy, suggesting that a common or overlapping binding site may be involved. We postulate that some of the soluble SuSy in the cytosol may be associated with the actin cytoskeleton in vivo.

  19. Plant diterpene synthases: exploring modularity and metabolic diversity for bioengineering.


    Zerbe, Philipp; Bohlmann, Jörg


    Plants produce thousands of diterpenoid natural products; some of which are of significant industrial value as biobased pharmaceuticals (taxol), fragrances (sclareol), food additives (steviosides), and commodity chemicals (diterpene resin acids). In nature, diterpene synthase (diTPS) enzymes are essential for generating diverse diterpene hydrocarbon scaffolds. While some diTPSs also form oxygenated compounds, more commonly, oxygenation is achieved by cytochrome P450-dependent mono-oxygenases. Recent genome-, transcriptome-, and metabolome-guided gene discovery and enzyme characterization identified novel diTPS functions that form the core of complex modular pathway systems. Insights into diterpene metabolism may translate into the development of new bioengineered microbial and plant-based production systems.

  20. Human blood platelets lack nitric oxide synthase activity.


    Böhmer, Anke; Gambaryan, Stepan; Tsikas, Dimitrios


    Reports on expression and functionality of nitric oxide synthase (NOS) activity in human blood platelets and erythrocytes are contradictory. We used a specific gas chromatography-mass spectrometry (GC-MS) method to detect NOS activity in human platelets. The method measures simultaneously [(15)N]nitrite and [(15)N]nitrate formed from oxidized (15)N-labeled nitric oxide ((15)NO) upon its NOS-catalyzed formation from the substrate l-[guanidino-(15)N2]-arginine. Using this GC-MS assay, we did not detect functional NOS in non-stimulated platelets and in intact platelets activated by various agonists (adenosine diphosphate, collagen, thrombin, or von Willebrand factor) or lysed platelets. l-[guanidino-nitro]-Arginine-inhibitable NOS activity was measured after addition of recombinant human endothelial NOS to lysed platelets. Previous and recent studies from our group challenge expression and functionality of NOS in human platelets and erythrocytes.

  1. Nonribosomal peptide synthesis in animals: the cyclodipeptide synthase of Nematostella.


    Seguin, Jérôme; Moutiez, Mireille; Li, Yan; Belin, Pascal; Lecoq, Alain; Fonvielle, Matthieu; Charbonnier, Jean-Baptiste; Pernodet, Jean-Luc; Gondry, Muriel


    Cyclodipeptide synthases (CDPSs) are small enzymes structurally related to class-I aminoacyl-tRNA synthetases (aaRSs). They divert aminoacylated tRNAs from their canonical role in ribosomal protein synthesis, for cyclodipeptide formation. All the CDPSs experimentally characterized to date are bacterial. We show here that a predicted CDPS from the sea anemone Nematostella vectensis is an active CDPS catalyzing the formation of various cyclodipeptides, preferentially containing tryptophan. Our findings demonstrate that eukaryotes encode active CDPSs and suggest that all CDPSs have a similar aminoacyl-tRNA synthetase-like architecture and ping-pong mechanism. They also raise questions about the biological roles of the cyclodipeptides produced in bacteria and eukaryotes.

  2. CTP Synthase Is Required for Optic Lobe Homeostasis in Drosophila

    PubMed Central

    Tastan, Ömür Y.; Liu, Ji-Long


    CTP synthase (CTPsyn) is a metabolic enzyme responsible for the de novo synthesis of the nucleotide CTP. Several recent studies have shown that CTPsyn forms filamentous subcellular structures known as cytoophidia in bacteria, yeast, fruit flies and humans. However, it remains elusive whether and how CTPsyn and cytoophidia play a role during development. Here, we show that cytoophidia are abundant in the neuroepithelial stem cells in Drosophila optic lobes. Optic lobes are underdeveloped in CTPsyn mutants as well as in CTPsyn RNAi. Moreover, overexpressing CTPsyn impairs the development of optic lobes, specifically by blocking the transition from neuroepithelium to neuroblast. Taken together, our results indicate that CTPsyn is critical for optic lobe homeostasis in Drosophila. PMID:26059773

  3. Structural Studies of Pterin-Based Inhibitors of Dihydropteroate Synthase

    SciTech Connect

    Hevener, Kirk E.; Yun, Mi-Kyung; Qi, Jianjun; Kerr, Iain D.; Babaoglu, Kerim; Hurdle, Julian G.; Balakrishna, Kanya; White, Stephan W.; Lee, Richard E.


    Dihydropteroate synthase (DHPS) is a key enzyme in bacterial folate synthesis and the target of the sulfonamide class of antibacterials. Resistance and toxicities associated with sulfonamides have led to a decrease in their clinical use. Compounds that bind to the pterin binding site of DHPS, as opposed to the p-amino benzoic acid (pABA) binding site targeted by the sulfonamide agents, are anticipated to bypass sulfonamide resistance. To identify such inhibitors and map the pterin binding pocket, we have performed virtual screening, synthetic, and structural studies using Bacillus anthracis DHPS. Several compounds with inhibitory activity have been identified, and crystal structures have been determined that show how the compounds engage the pterin site. The structural studies identify the key binding elements and have been used to generate a structure-activity based pharmacophore map that will facilitate the development of the next generation of DHPS inhibitors which specifically target the pterin site.

  4. The chloroplast ATP synthase: structural changes during catalysis.


    Richter, M L; Gao, F


    This article summarizes some of the evidence for the existence of light-driven structural changes in the epsilon and gamma subunits of the chloroplast ATP synthase. Formation of a transmembrane proton gradient results in: (1) a changed in the position of the epsilon subunit such that it becomes exposed to polyclonal antibodies and to reagents which selectively modify epsilon Lys109; (2) enhanced solvent accessibility of several sulfhydryl residues on the gamma subunit; and (3) release/exchange of tightly bound ADP from the enzyme. Theses and related experimental observations can, at least partially, be explained in terms of two different bound conformational states of the epsilon subunit. Evidence for structural changes in the enzyme which are driven by light or nucleotide binding is discussed with special reference to the popular rotational model for catalysis.

  5. Hyperactivity: glycogen synthase kinase-3 as a therapeutic target.


    Mines, Marjelo A


    The diagnosis of hyperactivity-associated disorders has increased within the past few years. The prevalence of hyperactivity-associated disorders is indicative of the need to more fully understand the underlying causes and to develop improved therapeutic interventions. There is increasing evidence that glycogen synthase kinase-3 (GSK3) mediates locomotor hyperactivity in a number of animal models, and therefore may be a potential target for therapeutic intervention in hyperactivity-associated behaviors. In this review, we discuss 1) the effect of manipulations of GSK3 in the absence of drugs and disorders on locomotor activity, 2) the role of GSK3 in drug-induced hyperactivity in rodents, and 3) regulation of locomotor activity by GSK3 in transgenic mouse models related to specific disorders. These studies link GSK3 regulation and activity to hyperactivity-associated behaviors and disease pathologies.

  6. Existence of nitric oxide synthase in rat hippocampal pyramidal cells.

    PubMed Central

    Wendland, B; Schweizer, F E; Ryan, T A; Nakane, M; Murad, F; Scheller, R H; Tsien, R W


    It has been proposed that nitric oxide (NO) serves as a key retrograde messenger during long-term potentiation at hippocampal synapses, linking induction of long-term potentiation in postsynaptic CA1 pyramidal cells to expression of long-term potentiation in presynaptic nerve terminals. However, nitric oxide synthase (NOS), the proposed NO-generating enzyme, has not yet been detected in the appropriate postsynaptic cells. We here demonstrate specific NOS immunoreactivity in the CA1 region of hippocampal sections by using an antibody specific for NOS type I and relatively gentle methods of fixation. NOS immunoreactivity was found in dendrites and cell bodies of CA1 pyramidal neurons. Cultured hippocampal pyramidal cells also displayed specific immunostaining. Control experiments showed no staining with preimmune serum or immune serum that was blocked with purified NOS. These results demonstrate that CA1 pyramidal cells contain NOS, as required were NO involved in retrograde signaling during hippocampal synaptic plasticity. Images PMID:7510887

  7. Leishmania donovani Encodes a Functional Selenocysteinyl-tRNA Synthase*

    PubMed Central

    Manhas, Reetika; Gowri, Venkatraman Subramanian; Madhubala, Rentala


    The synthesis of selenocysteine, the 21st amino acid, occurs on its transfer RNA (tRNA), tRNASec. tRNASec is initially aminoacylated with serine by seryl-tRNA synthetase and the resulting seryl moiety is converted to phosphoserine by O-phosphoseryl-tRNA kinase (PSTK) in eukaryotes. The selenium donor, selenophosphate is synthesized from selenide and ATP by selenophosphate synthetase. Selenocysteinyl-tRNA synthase (SepSecS) then uses the O-phosphoseryl-tRNASec and selenophosphate to form Sec-tRNASec in eukaryotes. Here, we report the characterization of selenocysteinyl-tRNA synthase from Leishmania donovani. Kinetoplastid SepSecS enzymes are phylogenetically closer to worm SepSecS. LdSepSecS was found to exist as a tetramer. Leishmania SepSecS enzyme was found to be active and able to complement the ΔselA deletion in Escherichia coli JS1 strain only in the presence of archaeal PSTK, indicating the conserved nature of the PSTK-SepSecS pathway. LdSepSecS was found to localize in the cytoplasm of the parasite. Gene deletion studies indicate that Leishmania SepSecS is dispensable for the parasite survival. The parasite was found to encode three selenoproteins, which were only expressed in the presence of SepSecS. Selenoproteins of L. donovani are not required for the growth of the promastigotes. Auranofin, a known inhibitor of selenoprotein synthesis showed the same sensitivity toward the wild-type and null mutants suggesting its effect is not through binding to selenoproteins. The three-dimensional structural comparison indicates that human and Leishmania homologs are structurally highly similar but their association modes leading to tetramerization seem different. PMID:26586914

  8. The evolution of function in strictosidine synthase-like proteins.


    Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C


    The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins.

  9. New insight into the catalytic properties of rice sucrose synthase.


    Huang, Yu-Chiao; Hsiang, Erh-Chieh; Yang, Chien-Chih; Wang, Ai-Yu


    Sucrose synthase (SuS), which catalyzes the reversible conversion of sucrose and uridine diphosphate (UDP) into fructose and UDP-glucose, is a key enzyme in sucrose metabolism in higher plants. SuS belongs to family 4 of the glycosyltransferases (GT4) and contains an E-X7-E motif that is conserved in members of GT4 and two other GT families. To gain insight into the roles of this motif in rice sucrose synthase 3 (RSuS3), the two conserved glutamate residues (E678 and E686) in this motif and a phenylalanine residue (F680) that resides between the two glutamate residues were changed by site-directed mutagenesis. All mutant proteins maintained their tetrameric conformation. The mutants E686D and F680Y retained partial enzymatic activity and the mutants E678D, E678Q, F680S, and E686Q were inactive. Substrate binding assays indicated that UDP and fructose, respectively, were the leading substrates in the sucrose degradation and synthesis reactions of RSuS3. Mutations on E678, F680, and E686 affected the binding of fructose, but not of UDP. The results indicated that E678, F680, and E686 in the E-X7-E motif of RSuS3 are essential for the activity of the enzyme and the sequential binding of substrates. The sequential binding of the substrates implied that the reaction catalyzed by RSuS can be controlled by the availability of fructose and UDP, depending on the metabolic status of a tissue.

  10. Novel Nuclear Localization of Fatty Acid Synthase Correlates with Prostate Cancer Aggressiveness

    PubMed Central

    Madigan, Allison A.; Rycyna, Kevin J.; Parwani, Anil V.; Datiri, Yeipyeng J.; Basudan, Ahmed M.; Sobek, Kathryn M.; Cummings, Jessica L.; Basse, Per H.; Bacich, Dean J.; O'Keefe, Denise S.


    Fatty acid synthase is up-regulated in a variety of cancers, including prostate cancer. Up-regulation of fatty acid synthase not only increases production of fatty acids in tumors but also contributes to the transformed phenotype by conferring growth and survival advantages. In addition, increased fatty acid synthase expression in prostate cancer correlates with poor prognosis, although the mechanism(s) by which this occurs are not completely understood. Because fatty acid synthase is expressed at low levels in normal cells, it is currently a major target for anticancer drug design. Fatty acid synthase is normally found in the cytosol; however, we have discovered that it also localizes to the nucleus in a subset of prostate cancer cells. Analysis of the fatty acid synthase protein sequence indicated the presence of a nuclear localization signal, and subcellular fractionation of LNCaP prostate cancer cells, as well as immunofluorescent confocal microscopy of patient prostate tumor tissue and LNCaPs confirmed nuclear localization of this protein. Finally, immunohistochemical analysis of prostate cancer tissue indicated that nuclear localization of fatty acid synthase correlates with Gleason grade, implicating a potentially novel role in prostate cancer progression. Possible clinical implications include improving the accuracy of prostate biopsies in the diagnosis of low- versus intermediate-risk prostate cancer and the uncovering of novel metabolic pathways for the therapeutic targeting of androgen-independent prostate cancer. PMID:24907642

  11. ATP synthase: a molecular therapeutic drug target for antimicrobial and antitumor peptides.


    Ahmad, Zulfiqar; Okafor, Florence; Azim, Sofiya; Laughlin, Thomas F


    In this review we discuss the role of ATP synthase as a molecular drug target for natural and synthetic antimicrobial/ antitumor peptides. We start with an introduction of the universal nature of the ATP synthase enzyme and its role as a biological nanomotor. Significant structural features required for catalytic activity and motor functions of ATP synthase are described. Relevant details regarding the presence of ATP synthase on the surface of several animal cell types, where it is associated with multiple cellular processes making it a potential drug target with respect to antimicrobial peptides and other inhibitors such as dietary polyphenols, is also reviewed. ATP synthase is known to have about twelve discrete inhibitor binding sites including peptides and other inhibitors located at the interface of α/β subunits on the F(1) sector of the enzyme. Molecular interaction of peptides at the β DEELSEED site on ATP synthase is discussed with specific examples. An inhibitory effect of other natural/synthetic inhibitors on ATP is highlighted to explore the therapeutic roles played by peptides and other inhibitors. Lastly, the effect of peptides on the inhibition of the Escherichia coli model system through their action on ATP synthase is presented.

  12. Functional Characterization of Novel Sesquiterpene Synthases from Indian Sandalwood, Santalum album

    PubMed Central

    Srivastava, Prabhakar Lal; Daramwar, Pankaj P.; Krithika, Ramakrishnan; Pandreka, Avinash; Shankar, S. Shiva; Thulasiram, Hirekodathakallu V.


    Indian Sandalwood, Santalum album L. is highly valued for its fragrant heartwood oil and is dominated by a blend of sesquiterpenes. Sesquiterpenes are formed through cyclization of farnesyl diphosphate (FPP), catalyzed by metal dependent terpene cyclases. This report describes the cloning and functional characterization of five genes, which encode two sesquisabinene synthases (SaSQS1, SaSQS2), bisabolene synthase (SaBS), santalene synthase (SaSS) and farnesyl diphosphate synthase (SaFDS) using the transcriptome sequencing of S. album. Using Illumina next generation sequencing, 33.32 million high quality raw reads were generated, which were assembled into 84,094 unigenes with an average length of 494.17 bp. Based on the transcriptome sequencing, five sesquiterpene synthases SaFDS, SaSQS1, SaSQS2, SaBS and SaSS involved in the biosynthesis of FPP, sesquisabinene, β-bisabolene and santalenes, respectively, were cloned and functionally characterized. Novel sesquiterpene synthases (SaSQS1 and SaSQS2) were characterized as isoforms of sesquisabinene synthase with varying kinetic parameters and expression levels. Furthermore, the feasibility of microbial production of sesquisabinene from both the unigenes, SaSQS1 and SaSQS2 in non-optimized bacterial cell for the preparative scale production of sesquisabinene has been demonstrated. These results may pave the way for in vivo production of sandalwood sesquiterpenes in genetically tractable heterologous systems. PMID:25976282

  13. Submitochondrial localization, cell-free synthesis, and mitochondrial import of 2-isopropylmalate synthase of yeast.


    Hampsey, D M; Lewin, A S; Kohlhaw, G B


    2-Isopropylmalate synthase (EC of yeast is a mitochondrial enzyme. We now provide evidence showing that a large part of the 2-isopropylmalate synthase activity that is associated with the mitochondria is located in the mitochondrial matrix. In vitro translation of total yeast RNA followed by immunoprecipitation with anti-2-isopropylmalate synthase antibody yields two polypeptides. The larger of these has an apparent molecular weight identical to that of purified 2-isopropylmalate synthase subunit (ca. 65,000). It is incorporated into isolated yeast mitochondria with no detectable change in molecular weight. The import requires energy. The smaller polypeptide migrates to a position corresponding to a molecular weight of 63,000-64,000. It is not taken up by mitochondria. Both polypeptides, which also can be obtained by immunoprecipitation of crude extracts, become labeled when in vitro translation is performed in the presence of N-formyl[35S]methionyl-tRNAf. Mutants with no detectable 2-isopropylmalate synthase activity are deficient in either one or both synthase-related polypeptides. These results are discussed in the light of recent evidence for two 2-isopropylmalate synthase-encoding genes in yeast.

  14. Nitric Oxide Synthase and Neuronal NADPH Diaphorase are Identical in Brain and Peripheral Tissues

    NASA Astrophysics Data System (ADS)

    Dawson, Ted M.; Bredt, David S.; Fotuhi, Majid; Hwang, Paul M.; Snyder, Solomon H.


    NADPH diaphorase staining neurons, uniquely resistant to toxic insults and neurodegenerative disorders, have been colocalized with neurons in the brain and peripheral tissue containing nitric oxide synthase (EC 1.14.23.-), which generates nitric oxide (NO), a recently identified neuronal messenger molecule. In the corpus striatum and cerebral cortex, NO synthase immunoreactivity and NADPH diaphorase staining are colocalized in medium to large aspiny neurons. These same neurons colocalize with somatostatin and neuropeptide Y immunoreactivity. NO synthase immunoreactivity and NADPH diaphorase staining are colocalized in the pedunculopontine nucleus with choline acetyltransferase-containing cells and are also colocalized in amacrine cells of the inner nuclear layer and ganglion cells of the retina, myenteric plexus neurons of the intestine, and ganglion cells of the adrenal medulla. Transfection of human kidney cells with NO synthase cDNA elicits NADPH diaphorase staining. The ratio of NO synthase to NADPH diaphorase staining in the transfected cells is the same as in neurons, indicating that NO synthase fully accounts for observed NADPH staining. The identity of neuronal NO synthase and NADPH diaphorase suggests a role for NO in modulating neurotoxicity.

  15. Domain loss has independently occurred multiple times in plant terpene synthase evolution

    PubMed Central

    Hillwig, Matthew L.; Xu, Meimei; Toyomasu, Tomonobu; Tiernan, Mollie S.; Wei, Gao; Cui, Guanghong; Huang, Luqi; Peters, Reuben J.


    SUMMARY The extensive family of plant terpene synthases (TPSs) generally has a bi-domain structure, yet phylogenetic analyses consistently indicate that these evolved from larger diterpene synthases. In particular, that duplication of the diterpene synthase genes required for gibberellin phytohormone biosynthesis provided an early predecessor, whose loss of a ~220 amino acid “internal sequence element” (now recognized as the γ domain) gave rise to the precursor of modern mono- and sesqui-TPSs found in all higher plants. Intriguingly, TPSs are conserved by taxonomic relationships rather than function, demonstrating that such functional radiation has occurred both repeatedly and relatively recently, yet phylogenetic analyses assume that “internal/γ” domain loss represents a single evolutionary event. Here we provide evidence that such loss was not a singular event, but rather has occurred multiple times. Specifically, we provide an example of a bi-domain diterpene synthase, from Salvia miltiorrhiza, along with a sesquiterpene synthase from Triticum aestivum (wheat) that is not only closely related to diterpene synthases, but retains the ent-kaurene synthase activity relevant to the ancestral gibberellin metabolic function. Indeed, while the wheat sesquiterpene synthase clearly no longer contains the “internal/γ” domain, it is closely related to rice diterpene synthase genes that retain the ancestral tri-domain structure. Thus, these findings provide examples of key evolutionary intermediates underlying the bi-domain structure observed in the expansive plant TPS gene family, as well as indicating that “internal/γ” domain loss has independently occurred multiple times, highlighting the complex evolutionary history of this important enzymatic family. PMID:21999670

  16. F1F0-ATP synthases of alkaliphilic bacteria: lessons from their adaptations

    PubMed Central

    Hicks, David B.; Liu, Jun; Fujisawa, Makoto; Krulwich, Terry A.


    This review focuses on the ATP synthases of alkaliphilic bacteria and, in particular, those that successfully overcome the bioenergetic challenges of achieving robust H+-coupled ATP synthesis at external pH values > 10. At such pH values the protonmotive force, which is posited to provide the energetic driving force for ATP synthesis, is too low to account for the ATP synthesis observed. The protonmotive force is lowered at very high pH by the need to maintain a cytoplasmic pH well below the pH outside, which results in an energetically adverse pH gradient. Several anticipated solutions to this bioenergetic conundrum have been ruled out. Although the transmembrane sodium motive force is high under alkaline conditions, respiratory alkaliphilic bacteria do not use Na+-instead of H+-coupled ATP synthases. Nor do they offset the adverse pH gradient with a compensatory increase in the transmembrane electrical potential component of the protonmotive force. Moreover, studies of ATP synthase rotors indicate that alkaliphiles cannot fully resolve the energetic problem by using an ATP synthase with a large number of c-subunits in the synthase rotor ring. Increased attention now focuses on delocalized gradients near the membrane surface and H+ transfers to ATP synthases via membrane-associated microcircuits between the H+ pumping complexes and synthases. Microcircuits likely depend upon proximity of pumps and synthases, specific membrane properties and specific adaptations of the participating enzyme complexes. ATP synthesis in alkaliphiles depends upon alkaliphile-specific adaptations of the ATP synthase and there is also evidence for alkaliphile-specific adaptations of respiratory chain components. PMID:20193659

  17. Critical roles of soluble starch synthase SSIIIa and granule-bound starch synthase Waxy in synthesizing resistant starch in rice

    PubMed Central

    Zhou, Hongju; Wang, Lijun; Liu, Guifu; Meng, Xiangbing; Jing, Yanhui; Shu, Xiaoli; Kong, Xiangli; Sun, Jian; Yu, Hong; Smith, Steven M.; Wu, Dianxing; Li, Jiayang


    Changes in human lifestyle and food consumption have resulted in a large increase in the incidence of type-2 diabetes, obesity, and colon disease, especially in Asia. These conditions are a growing threat to human health, but consumption of foods high in resistant starch (RS) can potentially reduce their incidence. Strategies to increase RS in rice are limited by a lack of knowledge of its molecular basis. Through map-based cloning of a RS locus in indica rice, we have identified a defective soluble starch synthase gene (SSIIIa) responsible for RS production and further showed that RS production is dependent on the high expression of the Waxya (Wxa) allele, which is prevalent in indica varieties. The resulting RS has modified granule structure; high amylose, lipid, and amylose–lipid complex; and altered physicochemical properties. This discovery provides an opportunity to increase RS content of cooked rice, especially in the indica varieties, which predominates in southern Asia. PMID:27791174

  18. Phylogenomic analysis of polyketide synthase genes in actinomycetes: structural analysis of KS domains and modules of polyketide synthases.


    Sarwar, Samreen; Ahmed, Mehboob; Hasnain, Shahida


    Polyketides are complex and diverse secondary metabolites, synthesised by large multifunctional enzymes, Polyketide Synthases (PKS). The phylogenomic analysis of β-ketosynthase (KS) domains and PKSs within actinomycetes suggests the contribution of point mutations, gene duplications, horizontal gene transfer and homologous recombination in the evolution of PKSs. PKS genealogy suggested the ancestral module structure with KS-AT-ACP domain composition. KS domains showed similar core and highly variable loop regions at the dimer interface, which seems to affect the selectivity of the primer unit. In PKS modules, the linker regions comprise a significant fraction of the module. The reducing domains (ketoreductase and dehydrogenase) protrude out from the central axis of the module and also responsible for extreme variability in the final products. Thus, phylogenomic and structural analysis of PKSs can assist in the artificial reprogramming of PKSs.

  19. Reduced expression of prostacyclin synthase and nitric oxide synthase in subcutaneous arteries of type 2 diabetic patients.


    Safiah Mokhtar, Siti; M Vanhoutte, Paul; W S Leung, Susan; Imran Yusof, Mohd; Wan Sulaiman, Wan Azman; Zaharil Mat Saad, Arman; Suppian, Rapeah; Ghulam Rasool, Aida Hanum


    Diabetic endothelial dysfunction is characterized by impaired endothelium-dependent relaxation. In this study, we measured the expression of endothelial nitric oxide synthase (eNOS), cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), prostacyclin synthase (PGIS), and prostacyclin receptor (IP) in subcutaneous arteries of type-2 diabetic and non-diabetic patients. Subcutaneous arteries were dissected from tissues from seven diabetics (4 males and 3 females) and seven non-diabetics (5 males and 2 females) aged between 18 to 65 years, who underwent lower limb surgical procedures. Diabetics had higher fasting blood glucose compared to non-diabetics, but there were no differences in blood pressure, body mass index and age. Patients were excluded if they had uncontrolled hypertension, previous myocardial infarction, coronary heart disease, renal or hepatic failure and tumor. The relative expression levels of eNOS, COX-1, COX-2, PGIS and IP receptor were determined by Western blotting analysis, normalized with the β-actin level. Increased expression of COX-2 was observed in subcutaneous arteries of diabetics compared to non-diabetics, whereas the expression levels of eNOS and PGIS were significantly lower in diabetics. There were no significant differences in expression levels of COX-1 and IP receptor between the two groups. Immunohistochemical study of subcutaneous arteries showed that the intensities of eNOS and PGIS staining were lower in diabetics, with higher COX-2 staining. In conclusion, type-2 diabetes is associated with higher COX-2 expression, but lower eNOS and PGIS expression in subcutaneous arteries. These alterations may lead to impaired endothelium-dependent vasodilatation, and thus these proteins may be potential targets for protection against the microvascular complications of diabetes.

  20. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.


    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie


    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  1. Upregulation of Cysteine Synthase and Cystathionine β-Synthase Contributes to Leishmania braziliensis Survival under Oxidative Stress

    PubMed Central

    Téllez, Jair; Romanha, Alvaro José; Steindel, Mario


    Cysteine metabolism is considered essential for the crucial maintenance of a reducing environment in trypanosomatids due to its importance as a precursor of trypanothione biosynthesis. Expression, activity, functional rescue, and overexpression of cysteine synthase (CS) and cystathionine β-synthase (CβS) were evaluated in Leishmania braziliensis promastigotes and intracellular amastigotes under in vitro stress conditions induced by hydrogen peroxide (H2O2), S-nitroso-N-acetylpenicillamine, or antimonial compounds. Our results demonstrate a stage-specific increase in the levels of protein expression and activity of L. braziliensis CS (LbrCS) and L. braziliensis CβS (LbrCβS), resulting in an increment of total thiol levels in response to both oxidative and nitrosative stress. The rescue of the CS activity in Trypanosoma rangeli, a trypanosome that does not perform cysteine biosynthesis de novo, resulted in increased rates of survival of epimastigotes expressing the LbrCS under stress conditions compared to those of wild-type parasites. We also found that the ability of L. braziliensis promastigotes and amastigotes overexpressing LbrCS and LbrCβS to resist oxidative stress was significantly enhanced compared to that of nontransfected cells, resulting in a phenotype far more resistant to treatment with the pentavalent form of Sb in vitro. In conclusion, the upregulation of protein expression and increment of the levels of LbrCS and LbrCβS activity alter parasite resistance to antimonials and may influence the efficacy of antimony treatment of New World leishmaniasis. PMID:26033728

  2. Morphine-induced changes in cerebral and cerebellar nitric oxide synthase activity.


    Leza, J C; Lizasoain, I; San-Martín-Clark, O; Lorenzo, P


    The effect of acute and chronic morphine treatment on nitric oxide (NO) synthase activity (determined by the rate of conversion of [14C]arginine into [14C]citrulline) on mouse brain was studied. Acute morphine treatment induced an increased in Ca2+ -dependent NO synthase in cerebellum. This effect was blocked by coadministration with naloxone. Chronic morphine treatment (by s.c. pellet) also produced an increase in cerebellar NO synthase, with a maximum on the second day of implantation. No significant changes were found in frontal cortex and forebrain during acute or chronic morphine treatment. The relationship between opiate effects and the L-arginine: NO pathway is discussed.

  3. The fused TrpEG from Streptomyces venezuelae is an anthranilate synthase, not a 2-amino-2-deoxyisochorismate [corrected] (ADIC) synthase.


    Ashenafi, Meseret; Carrington, Renee; Collins, Alvin C; Byrnes, W Malcolm


    The chloramphenicol producer Streptomyces venezuelae contains an enzyme, SvTrpEG, that has a high degree of amino acid sequence similarity to the phenazine biosynthetic enzyme PhzE of certain species of Pseudomonas. PhzE has the sequence signature of an anthranilate synthase, but recent evidence indicates that it catalyzes the production of 2-amino-2-deoxyisochorismate [corrected] (ADIC), an intermediate in the two-step anthranilate synthase reaction, not anthranilate. In order to determine if SvTrpEG is likewise an ADIC synthase, we have cloned the gene for SvTrpEG, expressed the recombinant enzyme in Escherichia coli, and purified the enzyme. Analysis of the SvTrpEG-catalyzed reaction mixture using UV-visible spectrophotometry, fluorescence spectrometry, and high-performance liquid chromatography shows that the product of the reaction is anthranilate, not ADIC. Our results therefore reveal that, despite its sequence similarity to PhzE, SvTrpEG is an anthranilate synthase, not an ADIC synthase.

  4. Impaired Wound Induction of 3-Deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) Synthase and Altered Stem Development in Transgenic Potato Plants Expressing a DAHP Synthase Antisense Construct.

    PubMed Central

    Jones, J. D.; Henstrand, J. M.; Handa, A. K.; Herrmann, K. M.; Weller, S. C.


    Potato (Solanum tuberosum L.) cells were transformed with an antisense DNA construct encoding part of 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase (EC, the first enzyme of the shikimate pathway, to examine the role(s) of this protein in plant growth and development. Chimeric DNA constructs contained the transcript start site, the first exon, and part of the first intron of the shkA gene in antisense or sense orientations under the control of the cauliflower mosaic virus 35S promoter. Some, but not all, of the transgenic plants expressing antisense DAHP synthase RNA showed reduced levels of wound-induced DAHP synthase enzyme activity, polypeptide, and mRNA 12 and 24 h after wounding. No alteration in the wound induction of DAHP synthase gene expression was observed in transgenic potato tubers containing the chimeric sense construct. Reduced steady-state levels of DAHP synthase mRNA were observed in stem and shoot tip tissue. Some plants with the chimeric antisense construct had reduced stem length, stem diameter, and reduced stem lignification. PMID:12228551

  5. Fo-driven Rotation in the ATP Synthase Direction against the Force of F1 ATPase in the FoF1 ATP Synthase*

    PubMed Central

    Martin, James; Hudson, Jennifer; Hornung, Tassilo; Frasch, Wayne D.


    Living organisms rely on the FoF1 ATP synthase to maintain the non-equilibrium chemical gradient of ATP to ADP and phosphate that provides the primary energy source for cellular processes. How the Fo motor uses a transmembrane electrochemical ion gradient to create clockwise torque that overcomes F1 ATPase-driven counterclockwise torque at high ATP is a major unresolved question. Using single FoF1 molecules embedded in lipid bilayer nanodiscs, we now report the observation of Fo-dependent rotation of the c10 ring in the ATP synthase (clockwise) direction against the counterclockwise force of ATPase-driven rotation that occurs upon formation of a leash with Fo stator subunit a. Mutational studies indicate that the leash is important for ATP synthase activity and support a mechanism in which residues aGlu-196 and cArg-50 participate in the cytoplasmic proton half-channel to promote leash formation. PMID:25713065

  6. Analysis of Two Polyhydroxyalkanoate Synthases in Bradyrhizobium japonicum USDA 110

    PubMed Central

    Mongiardini, Elías J.; Pérez-Giménez, Julieta; Parisi, Gustavo; Lodeiro, Aníbal R.


    Bradyrhizobium japonicum USDA 110 has five polyhydroxyalkanoate (PHA) synthases (PhaC) annotated in its genome: bll4360 (phaC1), bll6073 (phaC2), blr3732 (phaC3), blr2885 (phaC4), and bll4548 (phaC5). All these proteins possess the catalytic triad and conserved amino acid residues of polyester synthases and are distributed into four different PhaC classes. We obtained mutants in each of these paralogs and analyzed phaC gene expression and PHA production in liquid cultures. Despite the genetic redundancy, only phaC1 and phaC2 were expressed at significant rates, while PHA accumulation in stationary-phase cultures was impaired only in the ΔphaC1 mutant. Meanwhile, the ΔphaC2 mutant produced more PHA than the wild type under this condition, and surprisingly, the phaC3 transcript increased in the ΔphaC2 background. A double mutant, the ΔphaC2 ΔphaC3 mutant, consistently accumulated less PHA than the ΔphaC2 mutant. PHA accumulation in nodule bacteroids followed a pattern similar to that seen in liquid cultures, being prevented in the ΔphaC1 mutant and increased in the ΔphaC2 mutant in relation to the level in the wild type. Therefore, we used these mutants, together with a ΔphaC1 ΔphaC2 double mutant, to study the B. japonicum PHA requirements for survival, competition for nodulation, and plant growth promotion. All mutants, as well as the wild type, survived for 60 days in a carbon-free medium, regardless of their initial PHA contents. When competing for nodulation against the wild type in a 1:1 proportion, the ΔphaC1 and ΔphaC1 ΔphaC2 mutants occupied only 13 to 15% of the nodules, while the ΔphaC2 mutant occupied 81%, suggesting that the PHA polymer is required for successful competitiveness. However, the bacteroid content of PHA did not affect the shoot dry weight accumulation. PMID:23667236

  7. A close look at a ketosynthase from a trans-acyltransferase modular polyketide synthase

    PubMed Central

    Gay, Darren C.; Gay, Glen; Axelrod, Abram J.; Jenner, Matthew; Kohlhaas, Christoph; Kampa, Annette; Oldham, Neil J.; Piel, Jörn; Keatinge-Clay, Adrian T.


    SUMMARY The recently discovered trans-acyltransferase modular polyketide synthases catalyze the biosynthesis of a wide range of bioactive natural products in bacteria. Here we report the structure of the second ketosynthase from the bacillaene trans-acyltransferase polyketide synthase. This 1.95 Å-resolution structure provides the highest resolution view available of a modular polyketide synthase ketosynthase and reveals a flanking subdomain that is homologous to an ordered linker in cis-acyltransferase modular polyketide synthases. The structure of the cysteine-to-serine mutant of the ketosynthase acylated by its natural substrate provides high-resolution details of how a native polyketide intermediate is bound and helps explain the basis of ketosynthase substrate specificity. The substrate range of the ketosynthase was further investigated by mass spectrometry. PMID:24508341

  8. The leaf extract of Siberian Crabapple (Malus baccata (Linn.) Borkh) contains potential fatty acid synthase inhibitors.


    Wei, Xiang; Zhao, Ran; Sun, Ying-Hui; Cong, Jian-Ping; Meng, Fan-Guo; Zhou, Hai-Meng


    The present work focused on the kinetics of the inhibitory effects of the leaf extract of Siberian Crabapple, named Shan jingzi in China, on chicken liver fatty acid synthase. The results showed that this extract had much stronger inhibitory ability on fatty acid synthase than that from green teas described in many previous reports. The inhibitory ability of this extract is closely related to the extracting solvent, and the time of extraction was also an important influencing factor. The inhibitory types of this extract on diffeerent substrates of chicken liver fatty acid synthase, acetyl-CoA, malonyl-CoA and NADPH, were found to be noncompetitive, uncompetitive and mixed, respectively. The studies here shed a new light on the exploration for inhibitors of fatty acid synthase.

  9. In Silico Analysis of Sequence-Structure-Function Relationship of the Escherichia coli Methionine Synthase.


    Kumar, Shiv; Bhagabati, Puja; Sachan, Reena; Kaushik, Aman Chandra; Dwivedi, Vivek Dhar


    The molecular evolution of various metabolic pathways in the organisms can be employed for scrutinizing the molecular aspects behind origin of life. In the present study, we chiefly concerned about the sequence-structure-function relationship between the Escherichia coli methionine synthase and their respective animal homologs by in silico approach. Using homology prediction technique, it was observed that only 79 animal species showed similarity with the E. coli methionine synthase. Also, multiple sequence alignment depicted only 25 conserved patterns between the E. coli methionine synthase and their respective animal homologs. Based on that, Pfam analysis identified the protein families of 22 conserved patterns among the attained 25 conserved patterns. Furthermore, the 3D structure was generated by HHpred and evaluated by corresponding Ramachandran plot specifying 93% of the ϕ and ψ residues angles in the most ideal regions. Hence, the designed structure was established as a good quality model for the full length of E. coli methionine synthase.

  10. The enzyme NBAD-synthase plays diverse roles during the life cycle of Drosophila melanogaster.


    Pérez, Martín M; Schachter, Julieta; Berni, Jimena; Quesada-Allué, Luis A


    This report shows the biochemical characterization and life cycle-dependent expression of Drosophila melanogaster N-beta-alanyldopamine synthase (NBAD-synthase or Ebony protein). This enzyme not only catalyzes the synthesis of NBAD, the main sclerotization and pigmentation precursor of insect brown cuticles, but also plays a role in brain neurotransmitter metabolism. In addition to the epidermis expression our immunodetection experiments show the novel localization of NBAD-synthase in different regions of the adult brain, in the foregut of pharate adult and, surprisingly, in the epidermis of the trachea during embryogenesis. These results demonstrate that NBAD-synthase is a versatile enzyme involved in different, previously unknown, time- and tissue-dependent processes.

  11. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.


    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas


    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  12. The Structure of Sucrose Synthase-1 from Arabidopsis thaliana and Its Functional Implications

    SciTech Connect

    Zheng, Yi; Anderson, Spencer; Zhang, Yanfeng; Garavito, R. Michael


    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. During growth and development, plants control carbon distribution by coordinating sites of sucrose synthesis and cleavage in different plant organs and different cellular locations. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, provides a direct and reversible means to regulate sucrose flux. Depending on the metabolic environment, sucrose synthase alters its cellular location to participate in cellulose, callose, and starch biosynthesis through its interactions with membranes, organelles, and cytoskeletal actin. The x-ray crystal structure of sucrose synthase isoform 1 from Arabidopsis thaliana (AtSus1) has been determined as a complex with UDP-glucose and as a complex with UDP and fructose, at 2.8- and 2.85-{angstrom} resolutions, respectively. The AtSus1 structure provides insights into sucrose catalysis and cleavage, as well as the regulation of sucrose synthase and its interactions with cellular targets.

  13. Architecture of the polyketide synthase module: surprises from electron cryo-microscopy

    PubMed Central

    Smith, Janet L; Skiniotis, Georgios; Sherman, David H


    Modular polyketide synthases produce a vast array of bioactive molecules that are the basis of many highly valued pharmaceuticals. The biosynthesis of these compounds is based on ordered assembly lines of multi-domain modules, each extending and modifying a specific chain-elongation intermediate before transfer to the next module for further processing. The first 3D structures of a full polyketide synthase module in different functional states were obtained recently by electron cryo-microscopy. The unexpected module architecture revealed a striking evolutionary divergence of the polyketide synthase compared to its metazoan fatty acid synthase homolog, as well as remarkable conformational rearrangements dependent on its biochemical state during the full catalytic cycle. The design and dynamics of the module are highly optimized for both catalysis and fidelity in the construction of complex, biologically active natural products. PMID:25791608

  14. Structure and Function of Benzylsuccinate Synthase and Related Fumarate-Adding Glycyl Radical Enzymes.


    Heider, Johann; Szaleniec, Maciej; Martins, Berta M; Seyhan, Deniz; Buckel, Wolfgang; Golding, Bernard T


    The pathway of anaerobic toluene degradation is initiated by a remarkable radical-type enantiospecific addition of the chemically inert methyl group to the double bond of a fumarate cosubstrate to yield (R)-benzylsuccinate as the first intermediate, as catalyzed by the glycyl radical enzyme benzylsuccinate synthase. In recent years, it has become clear that benzylsuccinate synthase is the prototype enzyme of a much larger family of fumarate-adding enzymes, which play important roles in the anaerobic metabolism of further aromatic and even aliphatic hydrocarbons. We present an overview on the biochemical properties of benzylsuccinate synthase, as well as its recently solved structure, and present the results of an initial structure-based modeling study on the reaction mechanism. Moreover, we compare the structure of benzylsuccinate synthase with those predicted for different clades of fumarate-adding enzymes, in particular the paralogous enzymes converting p-cresol, 2-methylnaphthalene or n-alkanes.

  15. Bedaquiline Targets the ε Subunit of Mycobacterial F-ATP Synthase.


    Kundu, Subhashri; Biukovic, Goran; Grüber, Gerhard; Dick, Thomas


    The tuberculosis drug bedaquiline inhibits mycobacterial F-ATP synthase by binding to its c subunit. Using the purified ε subunit of the synthase and spectroscopy, we previously demonstrated that the drug interacts with this protein near its unique tryptophan residue. Here, we show that replacement of ε's tryptophan with alanine resulted in bedaquiline hypersusceptibility of the bacteria. Overexpression of the wild-type ε subunit caused resistance. These results suggest that the drug also targets the ε subunit.

  16. Bedaquiline Targets the ε Subunit of Mycobacterial F-ATP Synthase

    PubMed Central

    Kundu, Subhashri; Biukovic, Goran; Grüber, Gerhard


    The tuberculosis drug bedaquiline inhibits mycobacterial F-ATP synthase by binding to its c subunit. Using the purified ε subunit of the synthase and spectroscopy, we previously demonstrated that the drug interacts with this protein near its unique tryptophan residue. Here, we show that replacement of ε's tryptophan with alanine resulted in bedaquiline hypersusceptibility of the bacteria. Overexpression of the wild-type ε subunit caused resistance. These results suggest that the drug also targets the ε subunit. PMID:27620476

  17. ATP synthase superassemblies in animals and plants: two or more are better.


    Seelert, Holger; Dencher, Norbert A


    ATP synthases are part of the sophisticated cellular metabolic network and therefore multiple interactions have to be considered. As discussed in this review, ATP synthases form various supramolecular structures. These include dimers and homooligomeric species. But also interactions with other proteins, particularly those involved in energy conversion exist. The supramolecular assembly of the ATP synthase affects metabolism, organellar structure, diseases, ageing and vice versa. The most common approaches to isolate supercomplexes from native membranes by use of native electrophoresis or density gradients are introduced. On the one hand, isolated ATP synthase dimers and oligomers are employed for structural studies and elucidation of specific protein-protein interactions. On the other hand, native electrophoresis and other techniques serve as tool to trace changes of the supramolecular organisation depending on metabolic alterations. Upon analysing the structure, dimer-specific subunits can be identified as well as interactions with other proteins, for example, the adenine nucleotide translocator. In the organellar context, ATP synthase dimers and oligomers are involved in the formation of mitochondrial cristae. As a consequence, changes in the amount of such supercomplexes affect mitochondrial structure and function. Alterations in the cellular power plant have a strong impact on energy metabolism and ultimately play a significant role in pathophysiology. In plant systems, dimers of the ATP synthase have been also identified in chloroplasts. Similar to mammals, a correlation between metabolic changes and the amount of the chloroplast ATP synthase dimers exists. Therefore, this review focusses on the interplay between metabolism and supramolecular organisation of ATP synthase in different organisms.

  18. Fatty Acid Synthase Inhibitors Engage the Cell Death Program Through the Endoplasmic Reticulum

    DTIC Science & Technology


    any capacity. The goal of this proposal was two- fold. One was to determine the mechanism by which the ER might initiate death following FAS inhibition...acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202–8. 8. Kuhajda FP, Jenner K, Wood FD, et al. Fatty...flexibility of the acyl carrier protein-thioesterase interdomain linker on functionality of the animal fatty acid synthase . Biochemistry 44, 4100–4107

  19. Enzymatic reactions by five chalcone synthase homologs from hop (Humulus lupulus L.).


    Okada, Yukio; Sano, Yukie; Kaneko, Takafumi; Abe, Ikuro; Noguchi, Hiroshi; Ito, Kazutoshi


    The enzyme activities encoded in five cDNAs for chalcone synthase (CHS) homologs from hop were investigated. Only valerophenone synthase (VPS) and CHS_H1 showed both naringenin-chalcone and phlorisovalerophenone forming activity. Narigenin-chalcone production by VPS was much lower than by CHS_H1. Therefore, it is highly possible that flavonoid depends mainly on CHS_H1, while bitter acid biosynthesis depends mainly on VPS and CHS_H1.

  20. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    PubMed Central

    Göpfert, Jens C; MacNevin, Gillian; Ro, Dae-Kyun; Spring, Otmar


    Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae) which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L.) were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes as well. Conclusion This

  1. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).


    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes


    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  2. Enhanced colonic nitric oxide generation and nitric oxide synthase activity in ulcerative colitis and Crohn's disease.

    PubMed Central

    Rachmilewitz, D; Stamler, J S; Bachwich, D; Karmeli, F; Ackerman, Z; Podolsky, D K


    Recent studies have suggested that nitric oxide (NO.), the product of nitric oxide synthase in inflammatory cells, may play a part in tissue injury and inflammation through its oxidative metabolism. In this study the colonic generation of oxides of nitrogen (NOx) and nitric oxide synthase activity was determined in ulcerative colitis and Crohn's disease. Colonic biopsy specimens were obtained from inflammatory bowel disease patients and from normal controls. Mucosal explants were cultured in vitro for 24 hours and NOx generation was determined. Nitric oxide synthase activity was monitored by the conversion of [3H]-L-arginine to citrulline. Median NOx generation by inflamed colonic mucosa of patients with active ulcerative colitis and Crohn's colitis was 4.2- and 8.1-fold respectively higher than that by normal human colonic mucosa. In ulcerative colitis and Crohn's colitis nitric oxide synthase activity was 10.0- and 3.8-fold respectively higher than in normal subjects. Colonic NOx generation is significantly decreased by methylprednisolone and ketotifen. The decrease in NOx generation by cultured colonic mucosa induced by methylprednisolone suggests that NO synthase activity is induced during the culture and the steroid effect may contribute to its therapeutic effect. Enhanced colonic NOx generation by stimulated nitric oxide synthase activity in ulcerative colitis and Crohn's disease may contribute to tissue injury. PMID:7541008

  3. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )


    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  4. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    SciTech Connect

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S. )


    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-({sup 35}S)methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate.

  5. Effects and mechanism of acid rain on plant chloroplast ATP synthase.


    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua


    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  6. Medicinal Chemistry of ATP Synthase: A Potential Drug Target of Dietary Polyphenols and Amphibian Antimicrobial Peptides

    PubMed Central

    Ahmad, Zulfiqar; Laughlin, Thomas F.


    In this review we discuss the inhibitory effects of dietary polyphenols and amphibian antimicrobial/antitumor peptides on ATP synthase. In the beginning general structural features highlighting catalytic and motor functions of ATP synthase will be described. Some details on the presence of ATP synthase on the surface of several animal cell types, where it is associated with multiple cellular processes making it an interesting drug target with respect to dietary polyphenols and amphibian antimicrobial peptides will also be reviewed. ATP synthase is known to have distinct polyphenol and peptide binding sites at the interface of α/β subunits. Molecular interaction of polyphenols and peptides with ATP synthase at their respective binding sites will be discussed. Binding and inhibition of other proteins or enzymes will also be covered so as to understand the therapeutic roles of both types of molecules. Lastly, the effects of polyphenols and peptides on the inhibition of Escherichia coli cell growth through their action on ATP synthase will also be presented. PMID:20586714

  7. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    SciTech Connect

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.


    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio ((activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)). Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of /sup 125/I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms.

  8. Investigation of potential glycogen synthase kinase 3 inhibitors using pharmacophore mapping and virtual screening.


    Dessalew, Nigus; Bharatam, Prasad V


    Glycogen synthase kinase-3 is a serine/threonine kinase that has attracted significant drug discovery attention in recent years. To investigate the identification of new potential glycogen synthase kinase-3 inhibitors, a pharmacophore mapping study was carried out using a set of 21 structurally diverse glycogen synthase kinase-3 inhibitors. A hypothesis containing four features: two hydrophobic, one hydrogen bond donor and another hydrogen bond acceptor was found to be the best from the 10 common feature hypotheses produced by HipHop module of Catalyst. The best hypothesis has a high cost of 156.592 and higher best fit values were obtained for the 21 inhibitors using this best hypothesis than the other HipHop hypotheses. The best hypothesis was then used to screen electronically the NCI2000 database. The hits obtained were docked into glycogen synthase kinase-3beta active site. A total of five novel potential leads were proposed after: (i) visual examination of how well they dock into the glycogen synthase kinase-3beta-binding site, (ii) comparative analysis of their FlexX, G-Score, PMF-Score, ChemScore and D-Scores values, (iii) comparison of their best fit value with the known inhibitors and (iv) examination of the how the hits retain interactions with the important amino acid residues of glycogen synthase kinase-3beta-binding site.

  9. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    PubMed Central

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq


    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  10. Cell wall polysaccharide synthases are located in detergent-resistant membrane microdomains in oomycetes.


    Briolay, Anne; Bouzenzana, Jamel; Guichardant, Michel; Deshayes, Christian; Sindt, Nicolas; Bessueille, Laurence; Bulone, Vincent


    The pathways responsible for cell wall polysaccharide biosynthesis are vital in eukaryotic microorganisms. The corresponding synthases are potential targets of inhibitors such as fungicides. Despite their fundamental and economical importance, most polysaccharide synthases are not well characterized, and their molecular mechanisms are poorly understood. With the example of Saprolegnia monoica as a model organism, we show that chitin and (1-->3)-beta-d-glucan synthases are located in detergent-resistant membrane microdomains (DRMs) in oomycetes, a phylum that comprises some of the most devastating microorganisms in the agriculture and aquaculture industries. Interestingly, no cellulose synthase activity was detected in the DRMs. The purified DRMs exhibited similar biochemical features as lipid rafts from animal, plant, and yeast cells, although they contained some species-specific lipids. This report sheds light on the lipid environment of the (1-->3)-beta-d-glucan and chitin synthases, as well as on the sterol biosynthetic pathways in oomycetes. The results presented here are consistent with a function of lipid rafts in cell polarization and as platforms for sorting specific sets of proteins targeted to the plasma membrane, such as carbohydrate synthases. The involvement of DRMs in the biosynthesis of major cell wall polysaccharides in eukaryotic microorganisms suggests a function of lipid rafts in hyphal morphogenesis and tip growth.

  11. Genetic structure and regulation of isoprene synthase in Poplar (Populus spp.).


    Vickers, Claudia E; Possell, Malcolm; Nicholas Hewitt, C; Mullineaux, Philip M


    Isoprene is a volatile 5-carbon hydrocarbon derived from the chloroplastic methylerythritol 2-C-methyl-D: -erythritol 4-phosphate isoprenoid pathway. In plants, isoprene emission is controlled by the enzyme isoprene synthase; however, there is still relatively little known about the genetics and regulation of this enzyme. Isoprene synthase gene structure was analysed in three poplar species. It was found that genes encoding stromal isoprene synthase exist as a small gene family, the members of which encode virtually identical proteins and are differentially regulated. Accumulation of isoprene synthase protein is developmentally regulated, but does not differ between sun and shade leaves and does not increase when heat stress is applied. Our data suggest that, in mature leaves, isoprene emission rates are primarily determined by substrate (dimethylallyl diphosphate, DMADP) availability. In immature leaves, where isoprene synthase levels are variable, emission levels are also influenced by the amount of isoprene synthase protein. No thylakoid isoforms could be identified in Populus alba or in Salix babylonica. Together, these data show that control of isoprene emission at the genetic level is far more complicated than previously assumed.

  12. Citrate synthase encoded by the CIT2 gene of Saccharomyces cerevisiae is peroxisomal.

    PubMed Central

    Lewin, A S; Hines, V; Small, G M


    The product of the CIT2 gene has the tripeptide SKL at its carboxyl terminus. This amino acid sequence has been shown to act as a peroxisomal targeting signal in mammalian cells. We examined the subcellular site of this extramitochondrial citrate synthase. Cells of Saccharomyces cerevisiae were grown on oleate medium to induce peroxisome proliferation. A fraction containing membrane-enclosed vesicles and organelles was analyzed by sedimentation on density gradients. In wild-type cells, the major peak of citrate synthase activity was recovered in the mitochondrial fraction, but a second peak of activity cosedimented with peroxisomes. The peroxisomal activity, but not the mitochondrial activity, was inhibited by incubation at pH 8.1, a characteristic of the extramitochondrial citrate synthase encoded by the CIT2 gene. In a strain in which the CIT1 gene encoding mitochondrial citrate synthase had been disrupted, the major peak of citrate synthase activity was peroxisomal, and all of the activity was sensitive to incubation at pH 8.1. Yeast cells bearing a cit2 disruption were unable to mobilize stored lipids and did not form stable peroxisomes in oleate. We conclude that citrate synthase encoded by CIT2 is peroxisomal and participates in the glyoxylate cycle. Images PMID:2181273

  13. Hepatic overexpression of a constitutively active form of liver glycogen synthase improves glucose homeostasis.


    Ros, Susana; Zafra, Delia; Valles-Ortega, Jordi; García-Rocha, Mar; Forrow, Stephen; Domínguez, Jorge; Calbó, Joaquim; Guinovart, Joan J


    In this study, we tested the efficacy of increasing liver glycogen synthase to improve blood glucose homeostasis. The overexpression of wild-type liver glycogen synthase in rats had no effect on blood glucose homeostasis in either the fed or the fasted state. In contrast, the expression of a constitutively active mutant form of the enzyme caused a significant lowering of blood glucose in the former but not the latter state. Moreover, it markedly enhanced the clearance of blood glucose when fasted rats were challenged with a glucose load. Hepatic glycogen stores in rats overexpressing the activated mutant form of liver glycogen synthase were enhanced in the fed state and in response to an oral glucose load but showed a net decline during fasting. In order to test whether these effects were maintained during long term activation of liver glycogen synthase, we generated liver-specific transgenic mice expressing the constitutively active LGS form. These mice also showed an enhanced capacity to store glycogen in the fed state and an improved glucose tolerance when challenged with a glucose load. Thus, we conclude that the activation of liver glycogen synthase improves glucose tolerance in the fed state without compromising glycogenolysis in the postabsorptive state. On the basis of these findings, we propose that the activation of liver glycogen synthase may provide a potential strategy for improvement of glucose tolerance in the postprandial state.

  14. Product variability of the 'cineole cassette' monoterpene synthases of related Nicotiana species.


    Fähnrich, Anke; Krause, Katrin; Piechulla, Birgit


    Nicotiana species of the section Alatae characteristically emit the floral scent compounds of the 'cineole cassette' comprising 1,8-cineole, limonene, myrcene, α-pinene, β-pinene, sabinene, and α-terpineol. We successfully isolated genes of Nicotiana alata and Nicotiana langsdorfii that encoded enzymes, which produced the characteristic monoterpenes of this 'cineole cassette' with α-terpineol being most abundant in the volatile spectra. The amino acid sequences of both terpineol synthases were 99% identical. The enzymes cluster in a monophyletic branch together with the closely related cineole synthase of Nicotiana suaveolens and monoterpene synthase 1 of Solanum lycopersicum. The cyclization reactions (α-terpineol to 1,8-cineole) of the terpineol synthases of N. alata and N. langsdorfii were less efficient compared to the 'cineole cassette' monoterpene synthases of Arabidopsis thaliana, N. suaveolens, Salvia fruticosa, Salvia officinalis, and Citrus unshiu. The terpineol synthases of N. alata and N. langsdorfii were localized in pistils and in the adaxial and abaxial epidermis of the petals. The enzyme activities reached their maxima at the second day after anthesis when flowers were fully opened and the enzyme activity in N. alata was highest at the transition from day to night (diurnal rhythm).

  15. The role of NO synthase isoforms in PDT-induced injury of neurons and glial cells

    NASA Astrophysics Data System (ADS)

    Kovaleva, V. D.; Berezhnaya, E. V.; Uzdensky, A. B.


    Nitric oxide (NO) is an important second messenger, involved in the implementation of various cell functions. It regulates various physiological and pathological processes such as neurotransmission, cell responses to stress, and neurodegeneration. NO synthase is a family of enzymes that synthesize NO from L-arginine. The activity of different NOS isoforms depends both on endogenous and exogenous factors. In particular, it is modulated by oxidative stress, induced by photodynamic therapy (PDT). We have studied the possible role of NOS in the regulation of survival and death of neurons and surrounding glial cells under photo-oxidative stress induced by photodynamic treatment (PDT). The crayfish stretch receptor consisting of a single identified sensory neuron enveloped by glial cells is a simple but informative model object. It was photosensitized with alumophthalocyanine photosens (10 nM) and irradiated with a laser diode (670 nm, 0.4 W/cm2). Antinecrotic and proapoptotic effects of NO on the glial cells were found using inhibitory analysis. We have shown the role of inducible NO synthase in photoinduced apoptosis and involvement of neuronal NO synthase in photoinduced necrosis of glial cells in the isolated crayfish stretch receptor. The activation of NO synthase was evaluated using NADPH-diaphorase histochemistry, a marker of neurons expressing the enzyme. The activation of NO synthase in the isolated crayfish stretch receptor was evaluated as a function of time after PDT. Photodynamic treatment induced transient increase in NO synthase activity and then slowly inhibited this enzyme.

  16. Discovery of two new inhibitors of Botrytis cinerea chitin synthase by a chemical library screening.


    Magellan, Hervé; Boccara, Martine; Drujon, Thierry; Soulié, Marie-Christine; Guillou, Catherine; Dubois, Joëlle; Becker, Hubert F


    Chitin synthases polymerize UDP-GlcNAC to form chitin polymer, a key component of fungal cell wall biosynthesis. Furthermore, chitin synthases are desirable targets for fungicides since chitin is absent in plants and mammals. Two potent Botrytis cinerea chitin synthase inhibitors, 2,3,5-tri-O-benzyl-d-ribose (compound 1) and a 2,5-functionalized imidazole (compound 2) were identified by screening a chemical library. We adapted the wheat germ agglutinin (WGA) test for chitin synthase activity detection to allow miniaturization and robotization of the screen. Both identified compounds inhibited chitin synthases in vitro with IC50 values of 1.8 and 10μM, respectively. Compounds 1 and 2 were evaluated for their antifungal activity and were found to be active against B. cinerea BD90 strain with MIC values of 190 and 100μM, respectively. Finally, we discovered that both compounds confer resistance to plant leaves against the attack of the fungus by reducing the propagation of lesions by 37% and 23%, respectively. Based on the inhibitory properties found in different assays, compounds 1 and 2 can be considered as antifungal hit inhibitors of chitin synthase, allowing further optimization of their pharmacological profile to improve their antifungal properties.

  17. Structure-based design of bacterial nitric oxide synthase inhibitors.


    Holden, Jeffrey K; Kang, Soosung; Hollingsworth, Scott A; Li, Huiying; Lim, Nathan; Chen, Steven; Huang, He; Xue, Fengtian; Tang, Wei; Silverman, Richard B; Poulos, Thomas L


    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial ( Holden , , Proc. Natl. Acad. Sci. U.S.A. 2013 , 110 , 18127 ). Here we present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Together, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors.

  18. Structure-Based Design of Bacterial Nitric Oxide Synthase Inhibitors

    PubMed Central


    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial (Holden, , Proc. Natl. Acad. Sci. U.S.A.2013, 110, 1812724145412). Here we present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Together, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors. PMID:25522110

  19. Glycogen synthase kinase-3 inhibitors: Rescuers of cognitive impairments

    PubMed Central

    King, Margaret K.; Pardo, Marta; Cheng, Yuyan; Downey, Kimberlee; Jope, Richard S.; Beurel, Eléonore


    Impairment of cognitive processes is a devastating outcome of many diseases, injuries, and drugs affecting the central nervous system (CNS). Most often, very little can be done by available therapeutic interventions to improve cognitive functions. Here we review evidence that inhibition of glycogen synthase kinase-3 (GSK3) ameliorates cognitive deficits in a wide variety of animal models of CNS diseases, including Alzheimer's disease, Fragile X syndrome, Down syndrome, Parkinson's disease, spinocerebellar ataxia type 1, traumatic brain injury, and others. GSK3 inhibitors also improve cognition following impairments caused by therapeutic interventions, such as cranial irradiation for brain tumors. These findings demonstrate that GSK3 inhibitors are able to ameliorate cognitive impairments caused by a diverse array of diseases, injury, and treatments. The improvements in impaired cognition instilled by administration of GSK3 inhibitors appear to involve a variety of different mechanisms, such as supporting long-term potentiation and diminishing long-term depression, promotion of neurogenesis, reduction of inflammation, and increasing a number of neuroprotective mechanisms. The potential for GSK3 inhibitors to repair cognitive deficits associated with many conditions warrants further investigation of their potential for therapeutic interventions, particularly considering the current dearth of treatments available to reduce loss of cognitive functions. PMID:23916593

  20. Nitric oxide synthase deficiency and the pathophysiology of muscular dystrophy

    PubMed Central

    Tidball, James G; Wehling-Henricks, Michelle


    The secondary loss of neuronal nitric oxide synthase (nNOS) that occurs in dystrophic muscle is the basis of numerous, complex and interacting features of the dystrophic pathology that affect not only muscle itself, but also influence the interaction of muscle with other tissues. Many mechanisms through which nNOS deficiency contributes to misregulation of muscle development, blood flow, fatigue, inflammation and fibrosis in dystrophic muscle have been identified, suggesting that normalization in NO production could greatly attenuate diverse aspects of the pathology of muscular dystrophy through multiple regulatory pathways. However, the relative importance of the loss of nNOS from the sarcolemma versus the importance of loss of total nNOS from dystrophic muscle remains unknown. Although most current evidence indicates that nNOS localization at the sarcolemma is not required to achieve NO-mediated reductions of pathology in muscular dystrophy, the question remains open concerning whether membrane localization would provide a more efficient rescue from features of the dystrophic phenotype. PMID:25194047

  1. Gelatinization temperature of rice explained by polymorphisms in starch synthase.


    Waters, Daniel L E; Henry, Robert J; Reinke, Russell F; Fitzgerald, Melissa A


    The cooking quality of rice is associated with the starch gelatinization temperature (GT). Rice genotypes with low GT have probably been selected for their cooking quality by humans during domestication. We now report polymorphisms in starch synthase IIa (SSIIa) that explain the variation in rice starch GT. Sequence analysis of the eight exons of SSIIa identified significant polymorphism in only exon 8. These single nucleotide polymorphisms (SNPs) were determined in 70 diverse genotypes of rice. Two SNPs could classify all 70 genotypes into either high GT or low GT types which differed in GT by 8 degrees C. 'A' rather than 'G' at base 2412 determined whether a methionine or valine was present at the corresponding amino acid residue in SSIIa, whilst two adjacent SNPs at bases 2543 and 2544 coded for either leucine (GC) or phenylalanine (TT). Rice varieties with high GT starch had a combination of valine and leucine at these residues. In contrast, rice varieties with low GT starch had a combination of either methionine and leucine or valine and phenylalanine at these same residues. At least two distinct polymorphisms have apparently been selected for their desirable cooking qualities in the domestication of rice.

  2. Neuronal Nitric Oxide Synthase in Vascular Physiology and Diseases

    PubMed Central

    Costa, Eduardo D.; Rezende, Bruno A.; Cortes, Steyner F.; Lemos, Virginia S.


    The family of nitric oxide synthases (NOS) has significant importance in various physiological mechanisms and is also involved in many pathological processes. Three NOS isoforms have been identified: neuronal NOS (nNOS or NOS 1), endothelial NOS (eNOS or NOS 3), and an inducible NOS (iNOS or NOS 2). Both nNOS and eNOS are constitutively expressed. Classically, eNOS is considered the main isoform involved in the control of the vascular function. However, more recent studies have shown that nNOS is present in the vascular endothelium and importantly contributes to the maintenance of the homeostasis of the cardiovascular system. In physiological conditions, besides nitric oxide (NO), nNOS also produces hydrogen peroxide (H2O2) and superoxide (O2•-) considered as key mediators in non-neuronal cells signaling. This mini-review highlights recent scientific releases on the role of nNOS in vascular homeostasis and cardiovascular disorders such as hypertension and atherosclerosis. PMID:27313545

  3. Nitric oxide synthase in experimental autoimmune myocarditis dysfunction.


    Goren, N; Leiros, C P; Sterin-Borda, L; Borda, E


    This study reports the expression of inducible nitric oxide synthase (NOS) in heart from autoimmune myocarditis mice associated with an alteration in their contractile behavior. By mean of the production of [U-14C]citrulline from [U-14C]arginine and immunoblot assay, the expression of iNOS was demonstrated in autoimmune atria that was normally absent. The iNOS activity decreased with administration of dexamethasone and in mice treated with monoclonal anti-interferon-gamma antibody (anti-IFN-gamma mAb). The inhibitors of protein kinase C activity (staurosporine) but not calcium/calmodulin (trifluoperazine) attenuated the iNOS activity. Moreover, autoimmune atria presented contractile alterations (lower values of dF/dt than control). The in vivo treatment with inhibitors of NOS activity or anti-IFN-gamma mAb or dexamethasone improved the contractile activity of autoimmune atria with no change in the contractility of normal atria. The results suggest that the infiltrative cells in myocarditis heart have a potential role in cardiac dysfunction by production of IFN-gamma and subsequent expression of iNOS, that in turn alter the contractile behavior of the heart. The data indicate that cytokines induced activation of L-arginine nitric oxide pathway in myocarditis atria leading to contractile dysfunction.

  4. Endothelial nitric oxide synthase in the amphibian, Xenopus tropicalis.


    Trajanovska, Sofie; Donald, John A


    Nitric oxide (NO) is generated by NO synthase (NOS) of which there are three isoforms: neuronal NOS (nNOS, nos1), inducible NOS (iNOS, nos2), and endothelial NOS (eNOS, nos3). This study utilised the genome of Xenopus tropicalis to sequence a nos3 cDNA and determine if eNOS protein is expressed in blood vessels. A nos3 cDNA was sequenced that encoded a 1177 amino acid protein called XteNOS, which showed closest sequence identity to mammalian eNOS protein. The X. tropicalis nos3 gene and eNOS protein were determined to be an orthologue of mammalian nos3 and eNOS using gene synteny and phylogenetic analyses, respectively. In X. tropicalis, nos3 mRNA expression was highest in lung and skeletal muscle and lower in the liver, gut, kidney, heart and brain. Western analysis of kidney protein using an affinity-purified anti-XteNOS produced a single band at 140kDa. Immunohistochemistry showed XteNOS immunoreactivity in the proximal tubule of the kidney and endocardium of the heart, but not in the endothelium of blood vessels. Thus, X. tropicalis has a nos3 gene that appears not to be expressed in the vascular endothelium.

  5. Mitochondrial nitric oxide synthase regulates mitochondrial matrix pH.


    Ghafourifar, P; Richter, C


    Nitric oxide (nitrogen monoxide, NO) exerts a wide profile of its biological activities via regulation of respiration and respiration-dependent functions. The presence of nitric oxide synthase (NOS) in mitochondria (mtNOS) was recently reported by us (Ghafourifar and Richter, FEBS Lett. 418, 291-296, 1997) and others (Giulivi et al., J. Biol. Chem. 273, 11038-11043, 1998). Here we report that NO, provided by an NO donor as well as by mtNOS stimulation, regulates mitochondrial matrix pH, transmembrane potential and Ca2+ buffering capacity. Exogenously-added NO causes a dose-dependent matrix acidification. Also mtNOS stimulation, induced by loading mitochondria with Ca2+, causes mitochondrial matrix acidification and a drop in mitochondrial transmembrane potential. Inhibition of mtNOS's basal activity causes mitochondrial matrix alkalinization and provides a resistance to the sudden drop of mitochondrial transmembrane potential induced by mitochondrial Ca2+ uptake. We conclude that mtNOS plays a critical role in regulating mitochondrial delta(pH).

  6. Calmodulin is a subunit of nitric oxide synthase from macrophages

    PubMed Central


    A central issue in nitric oxide (NO) research is to understand how NO can act in some settings as a servoregulator and in others as a cytotoxin. To answer this, we have sought a molecular basis for the differential regulation of the two known types of NO synthase (NOS). Constitutive NOS's in endothelium and neurons are activated by agonist- induced elevation of Ca2+ and resultant binding of calmodulin (CaM). In contrast, NOS in macrophages does not require added Ca2+ or CaM, but is regulated instead by transcription. We show here that macrophage NOS contains, as a tightly bound subunit, a molecule with the immunologic reactivity, high performance liquid chromatography retention time, tryptic map, partial amino acid sequence, and exact molecular mass of CaM. In contrast to most CaM-dependent enzymes, macrophage NOS binds CaM tightly without a requirement for elevated Ca2+. This may explain why NOS that is independent of Ca2+ and elevated CaM appears to be activated simply by being synthesized. PMID:1380065

  7. Engineering the acyltransferase substrate specificity of assembly line polyketide synthases.


    Dunn, Briana J; Khosla, Chaitan


    Polyketide natural products act as a broad range of therapeutics, including antibiotics, immunosuppressants and anti-cancer agents. This therapeutic diversity stems from the structural diversity of these small molecules, many of which are produced in an assembly line manner by modular polyketide synthases. The acyltransferase (AT) domains of these megasynthases are responsible for selection and incorporation of simple monomeric building blocks, and are thus responsible for a large amount of the resulting polyketide structural diversity. The substrate specificity of these domains is often targeted for engineering in the generation of novel, therapeutically active natural products. This review outlines recent developments that can be used in the successful engineering of these domains, including AT sequence and structural data, mechanistic insights and the production of a diverse pool of extender units. It also provides an overview of previous AT domain engineering attempts, and concludes with proposed engineering approaches that take advantage of current knowledge. These approaches may lead to successful production of biologically active 'unnatural' natural products.

  8. Human leucocytes in asthenozoospermic patients: endothelial nitric oxide synthase expression.


    Buldreghini, E; Hamada, A; Macrì, M L; Amoroso, S; Boscaro, M; Lenzi, A; Agarwal, A; Balercia, G


    In a basic study at the Andrology Unit, Department of Clinical and Molecular Sciences, Polytechnic University of Marche, Ancona, Italy, we evaluated the pattern of mRNA endothelial nitric oxide synthase (eNOS) expression in human blood leucocytes isolated from normozoospermic fertile and asthenozoospermic infertile men to elucidate any pathogenic involvement in sperm cell motility. Forty infertile men with idiopathic asthenozoospermia and 45 normozoospermic fertile donors, age-matched, were included. Semen parameters were evaluated, and expression analysis of mRNA was performed in human leucocytes using reverse transcription polymerase chain reaction. Sperm volume, count, motility and morphology were determined, and eNOS expression and Western blotting analyses were performed. A positive correlation was observed between the concentrations of NO and the percentage of immotile spermatozoa. The mRNA of eNOS was more expressed in peripheral blood leucocytes isolated from asthenozoospermic infertile men versus those of fertile normozoospermic men (7.46 ± 0.38 versus 7.06 ± 0.56, P = 0.0355). A significant up-regulation of eNOS gene in peripheral blood leucocytes was 1.52-fold higher than that of fertile donors. It is concluded that eNOS expression and activity are enhanced in blood leucocytes in men with idiopathic asthenozoospermia.

  9. Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

    SciTech Connect

    Shams-Eldin, Hosam Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.


    Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups.

  10. Conservation and Role of Electrostatics in Thymidylate Synthase

    NASA Astrophysics Data System (ADS)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C.


    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  11. Glutamate synthase in greening callus of Bouvardia ternifolia Schlecht.


    Murillo, E; Sánchez de Jiménez, E


    The distribution of the two glutamate-synthase (GOGAT) activities known to exist in higher plants (NADH dependent, EC; and ferredoxin dependent, EC was studied in non-chlorophyllous and chlorophyllous cultured tissue as well as in young leaves of Bouvardia ternifolia. The NADH-GOGAT was present in all three tissues. Using a sucrose gradient we found it in both the soluble and the plastid fraction of non-chlorophyllous and chlorophyllous tissue, but exclusively in the chloroplast fraction of the leaves. Ferredoxin-GOGAT was found only in green tissues and was confined to the chloroplasts. Ferredoxin-GOGAT activity increased in parallel with the chlorophyll content of the callus during the greening process in Murashige-Skoog medium (nitrate and ammonium as the nitrogen sources), while NADH-GOGAT was not affected by the greening process in this medium. Furthermore, both activities were differentially affected by either nitrate or ammonium as the sole nitrogen source in the medium during this process. It is suggested that each GOGAT activity is a different entity or is differently regulated.

  12. Engineering the acyltransferase substrate specificity of assembly line polyketide synthases

    PubMed Central

    Dunn, Briana J.; Khosla, Chaitan


    Polyketide natural products act as a broad range of therapeutics, including antibiotics, immunosuppressants and anti-cancer agents. This therapeutic diversity stems from the structural diversity of these small molecules, many of which are produced in an assembly line manner by modular polyketide synthases. The acyltransferase (AT) domains of these megasynthases are responsible for selection and incorporation of simple monomeric building blocks, and are thus responsible for a large amount of the resulting polyketide structural diversity. The substrate specificity of these domains is often targeted for engineering in the generation of novel, therapeutically active natural products. This review outlines recent developments that can be used in the successful engineering of these domains, including AT sequence and structural data, mechanistic insights and the production of a diverse pool of extender units. It also provides an overview of previous AT domain engineering attempts, and concludes with proposed engineering approaches that take advantage of current knowledge. These approaches may lead to successful production of biologically active ‘unnatural’ natural products. PMID:23720536

  13. Substrate Activation in Flavin-Dependent Thymidylate Synthase

    PubMed Central


    Thymidylate is a critical DNA nucleotide that has to be synthesized in cells de novo by all organisms. Flavin-dependent thymidylate synthase (FDTS) catalyzes the final step in this de novo production of thymidylate in many human pathogens, but it is absent from humans. The FDTS reaction proceeds via a chemical route that is different from its human enzyme analogue, making FDTS a potential antimicrobial target. The chemical mechanism of FDTS is still not understood, and the two most recently proposed mechanisms involve reaction intermediates that are unusual in pyrimidine biosynthesis and biology in general. These mechanisms differ in the relative timing of the reaction of the flavin with the substrate. The consequence of this difference is significant: the intermediates are cationic in one case and neutral in the other, an important consideration in the construction of mechanism-based enzyme inhibitors. Here we test these mechanisms via chemical trapping of reaction intermediates, stopped-flow, and substrate hydrogen isotope exchange techniques. Our findings suggest that an initial activation of the pyrimidine substrate by reduced flavin is required for catalysis, and a revised mechanism is proposed on the basis of previous and new data. These findings and the newly proposed mechanism add an important piece to the puzzle of the mechanism of FDTS and suggest a new class of intermediates that, in the future, may serve as targets for mechanism-based design of FDTS-specific inhibitors. PMID:25025487

  14. The role of glycogen synthase kinase-3beta in schizophrenia.