DOE Office of Scientific and Technical Information (OSTI.GOV)
Gabelli,S.; McLellan, J.; Montalvetti, A.
2006-01-01
Typanosoma cruzi, the causative agent of Chagas disease, has recently been shown to be sensitive to the action of the bisphosphonates currently used in bone resorption therapy. These compounds target the mevalonate pathway by inhibiting farnesyl diphosphate synthase (farnesyl pyrophosphate synthase, FPPS), the enzyme that condenses the diphosphates of C{sub 5} alcohols (isopentenyl and dimethylallyl) to form C{sub 10} and C{sub 15} diphosphates (geranyl and farnesyl). The structures of the T. cruzi FPPS (TcFPPS) alone and in two complexes with substrates and inhibitors reveal that following binding of the two substrates and three Mg2+ ions, the enzyme undergoes a conformationalmore » change consisting of a hinge-like closure of the binding site. In this conformation, it would be possible for the enzyme to bind a bisphosphonate inhibitor that spans the sites usually occupied by dimethylallyl diphosphate (DMAPP) and the homoallyl moiety of isopentenyl diphosphate. This observation may lead to the design of new, more potent anti-trypanosomal bisphosphonates, because existing FPPS inhibitors occupy only the DMAPP site. In addition, the structures provide an important mechanistic insight: after its formation, geranyl diphosphate can swing without leaving the enzyme, from the product site to the substrate site to participate in the synthesis of farnesyl diphosphate.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Chun-Liang; Mermoud, James C.; Paul, Lake N.
The mevalonate pathway produces isopentenyl diphosphate (IPP), a building block for polyisoprenoid synthesis, and is a crucial pathway for growth of the human bacterial pathogen Enterococcus faecalis. The final enzyme in this pathway, mevalonate diphosphate decarboxylase (MDD), acts on mevalonate diphosphate (MVAPP) to produce IPP while consuming ATP. This essential enzyme has been suggested as a therapeutic target for the treatment of drug-resistant bacterial infections. Here, we report functional and structural studies on the mevalonate diphosphate decarboxylase from E. faecalis (MDDEF). The MDDEF crystal structure in complex with ATP (MDDEF–ATP) revealed that the phosphate-binding loop (amino acids 97–105) is notmore » involved in ATP binding and that the phosphate tail of ATP in this structure is in an outward-facing position pointing away from the active site. This suggested that binding of MDDEF to MVAPP is necessary to guide ATP into a catalytically favorable position. Enzymology experiments show that the MDDEF performs a sequential ordered bi-substrate reaction with MVAPP as the first substrate, consistent with the isothermal titration calorimetry (ITC) experiments. On the basis of ITC results, we propose that this initial prerequisite binding of MVAPP enhances ATP binding. In summary, our findings reveal a substrate-induced substrate-binding event that occurs during the MDDEF-catalyzed reaction. The disengagement of the phosphate-binding loop concomitant with the alternative ATP-binding configuration may provide the structural basis for antimicrobial design against these pathogenic enterococci.« less
Yamaguchi, Takayoshi; Iida, Ken-Ichiro; Shiota, Susumu; Nakayama, Hiroaki; Yoshida, Shin-Ichi
2015-12-01
FtsZ, a protein essential for prokaryotic cell division, forms a ring structure known as the Z-ring at the division site. FtsZ has a GTP binding site and is assembled into linear structures in a GTP-dependent manner in vitro. We assessed whether guanosine 5'-diphosphate 3'-diphosphate (ppGpp), a global regulator of gene expression in starved bacteria, affects cell division in Salmonella Paratyphi A. Elevation of intracellular ppGpp levels by using the relA expression vector induced repression of bacterial growth and incorrect FtsZ assembly. We found that FtsZ forms helical structures in the presence of ppGpp by using the GTP binding site; however, ppGpp levels required to form helical structures were at least 20-fold higher than the required GTP levels in vitro. Furthermore, once formed, helical structures did not change to the straight form even after GTP addition. Our data indicate that elevation of the ppGpp level leads to inhibition of bacterial growth and interferes with FtsZ assembly. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Gennadios, Heather A; Christianson, David W
2006-12-26
LpxC is a zinc metalloenzyme that catalyzes the first committed step in the biosynthesis of lipid A, a vital component of the outer membrane of Gram-negative bacteria. Accordingly, the inhibition of LpxC is an attractive strategy for the treatment of Gram-negative bacterial infections. Here, we report the 2.7 A resolution X-ray crystal structure of LpxC from Aquifex aeolicus complexed with uridine 5'-diphosphate (UDP), and the 3.1 A resolution structure of LpxC complexed with pyrophosphate. The X-ray crystal structure of the LpxC-UDP complex provides the first view of interactions likely to be exploited by the substrate UDP group in the "basic patch" of the active site. The diphosphate group of UDP makes hydrogen bond interactions with strictly conserved residue K239 as well as solvent molecules. The ribose moiety of UDP interacts with partially conserved residue E197. The UDP uracil group hydrogen bonds with both the backbone NH group and the backbone carbonyl group of E160, and with the backbone NH group of K162 through an intervening water molecule. Finally, the alpha-phosphate and uracil groups of UDP interact with R143 and R262 through intervening water molecules. The structure of LpxC complexed with pyrophosphate reveals generally similar intermolecular interactions in the basic patch. Unexpectedly, diphosphate binding in both complexes is accompanied by coordination to an additional zinc ion, resulting in the identification of a new metal-binding site termed the E-site. The structures of the LpxC-UDP and LpxC-pyrophosphate complexes provide new insights with regard to substrate recognition in the basic patch and metal ion coordination in the active site of LpxC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Chuan-Hsiang; Gabelli, Sandra B.; Oldfield, Eric
Bisphosphonates (BPs) are a class of compounds that have been used extensively in the treatment of osteoporosis and malignancy-related hypercalcemia. Some of these compounds act through inhibition of farnesyl diphosphate synthase (FPPS), a key enzyme in the synthesis of isoprenoids. Recently, nitrogen-containing bisphosphonates (N-BPs) used in bone resorption therapy have been shown to be active against Trypanosoma cruzi, the parasite that causes American trypanosomiasis (Chagas disease), suggesting that they may be used as anti-trypanosomal agents. The crystal structures of TcFPPS in complex with substrate (isopentenyl diphosphate, IPP) and five N-BP inhibitors show that the C-1 hydroxyl and the nitrogen-containing groupsmore » of the inhibitors alter the binding of IPP and the conformation of two TcFPPS residues, Tyr94 and Gln167. Isothermal titration calorimetry experiments suggest that binding of the first N-BPs to the homodimeric TcFPPS changes the binding properties of the second site. This mechanism of binding of N-BPs to TcFPPS is different to that reported for the binding of the same compounds to human FPPS.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barta, Michael L.; McWhorter, William J.; Miziorko, Henry M.
2012-09-17
Mevalonate diphosphate decarboxylase (MDD) catalyzes the final step of the mevalonate pathway, the Mg{sup 2+}-ATP dependent decarboxylation of mevalonate 5-diphosphate (MVAPP), producing isopentenyl diphosphate (IPP). Synthesis of IPP, an isoprenoid precursor molecule that is a critical intermediate in peptidoglycan and polyisoprenoid biosynthesis, is essential in Gram-positive bacteria (e.g., Staphylococcus, Streptococcus, and Enterococcus spp.), and thus the enzymes of the mevalonate pathway are ideal antimicrobial targets. MDD belongs to the GHMP superfamily of metabolite kinases that have been extensively studied for the past 50 years, yet the crystallization of GHMP kinase ternary complexes has proven to be difficult. To further ourmore » understanding of the catalytic mechanism of GHMP kinases with the purpose of developing broad spectrum antimicrobial agents that target the substrate and nucleotide binding sites, we report the crystal structures of wild-type and mutant (S192A and D283A) ternary complexes of Staphylococcus epidermidis MDD. Comparison of apo, MVAPP-bound, and ternary complex wild-type MDD provides structural information about the mode of substrate binding and the catalytic mechanism. Structural characterization of ternary complexes of catalytically deficient MDD S192A and D283A (k{sub cat} decreased 10{sup 3}- and 10{sup 5}-fold, respectively) provides insight into MDD function. The carboxylate side chain of invariant Asp{sup 283} functions as a catalytic base and is essential for the proper orientation of the MVAPP C3-hydroxyl group within the active site funnel. Several MDD amino acids within the conserved phosphate binding loop ('P-loop') provide key interactions, stabilizing the nucleotide triphosphoryl moiety. The crystal structures presented here provide a useful foundation for structure-based drug design.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aripirala, Srinivas; Gonzalez-Pacanowska, Dolores; Oldfield, Eric
Structural insights into L. major farnesyl diphosphate synthase, a key enzyme in the mevalonate pathway, are described. Farnesyl diphosphate synthase (FPPS) is an essential enzyme involved in the biosynthesis of sterols (cholesterol in humans and ergosterol in yeasts, fungi and trypanosomatid parasites) as well as in protein prenylation. It is inhibited by bisphosphonates, a class of drugs used in humans to treat diverse bone-related diseases. The development of bisphosphonates as antiparasitic compounds targeting ergosterol biosynthesis has become an important route for therapeutic intervention. Here, the X-ray crystallographic structures of complexes of FPPS from Leishmania major (the causative agent of cutaneousmore » leishmaniasis) with three bisphosphonates determined at resolutions of 1.8, 1.9 and 2.3 Å are reported. Two of the inhibitors, 1-(2-hydroxy-2,2-diphosphonoethyl)-3-phenylpyridinium (300B) and 3-butyl-1-(2,2-diphosphonoethyl)pyridinium (476A), co-crystallize with the homoallylic substrate isopentenyl diphosphate (IPP) and three Ca{sup 2+} ions. A third inhibitor, 3-fluoro-1-(2-hydroxy-2,2-diphosphonoethyl)pyridinium (46I), was found to bind two Mg{sup 2+} ions but not IPP. Calorimetric studies showed that binding of the inhibitors is entropically driven. Comparison of the structures of L. major FPPS (LmFPPS) and human FPPS provides new information for the design of bisphosphonates that will be more specific for inhibition of LmFPPS. The asymmetric structure of the LmFPPS–46I homodimer indicates that binding of the allylic substrate to both monomers of the dimer results in an asymmetric dimer with one open and one closed homoallylic site. It is proposed that IPP first binds to the open site, which then closes, opening the site on the other monomer, which closes after binding the second IPP, leading to the symmetric fully occupied FPPS dimer observed in other structures.« less
Overexpression of an archaeal geranylgeranyl diphosphate synthase in Escherichia coli cells.
Ohto, C; Nakane, H; Hemmi, H; Ohnuma, S; Obata, S; Nishino, T
1998-06-01
An archaeal geranylgeranyl diphosphate synthase was overexpressed in Escherichia coli cells as fusion proteins. These fusion proteins retained their thermostability and had higher specific activity than did a partially purified native enzyme Previously reported. We purified 24.3 mg of MBP (maltose-binding protein)-fusion protein and 5.4 mg of GST (glutathione S-transferase)-fusion protein from a one-liter culture of E. coli. The MBP-fusion proteins existed in dimer, tetramer, octamer, or dodecamer form, and their product specificities were altered according to the oligomerization. The MBP-fusion protein has protease-sensitive sites in the portion corresponding to geranylgeranyl diphosphate synthase.
Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families.
Garcia, Mario D; Nouwens, Amanda; Lonhienne, Thierry G; Guddat, Luke W
2017-02-14
Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted "S"-shaped conformation when bound to A. thaliana AHAS ( At AHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors.
Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families
Nouwens, Amanda; Lonhienne, Thierry G.; Guddat, Luke W.
2017-01-01
Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted “S”-shaped conformation when bound to A. thaliana AHAS (AtAHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors. PMID:28137884
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterialmore » origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.« less
2016-01-01
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs. PMID:27490479
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy; Sax, Martin; Brunskill, Andrew; Nemeria, Natalia; Jordan, Frank; Furey, William
2004-03-09
Thiamin thiazolone diphosphate (ThTDP), a potent inhibitor of the E1 component from the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDHc), binds to the enzyme with greater affinity than does the cofactor thiamin diphosphate (ThDP). To identify what determines this difference, the crystal structure of the apo PDHc E1 component complex with ThTDP and Mg(2+) has been determined at 2.1 A and compared to the known structure of the native holoenzyme, PDHc E1-ThDP-Mg(2+) complex. When ThTDP replaces ThDP, reorganization occurs in the protein structure in the vicinity of the active site involving positional and conformational changes in some amino acid residues, a change in the V coenzyme conformation, addition of new hydration sites, and elimination of others. These changes culminate in an increase in the number of hydrogen bonds to the protein, explaining the greater affinity of the apoenzyme for ThTDP. The observed hydrogen bonding pattern is not an invariant feature of ThDP-dependent enzymes but rather specific to this enzyme since the extra hydrogen bonds are made with nonconserved residues. Accordingly, these sequence-related hydrogen bonding differences likewise explain the wide variation in the affinities of different thiamin-dependent enzymes for ThTDP and ThDP. The sequence of each enzyme determines its ability to form hydrogen bonds to the inhibitor or cofactor. Mechanistic roles are suggested for the aforementioned reorganization and its reversal in PDHc E1 catalysis: to promote substrate binding and product release. This study also provides additional insight into the role of water in enzyme inhibition and catalysis.
Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.
1991-03-11
The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shishova,E.; Di Costanzo, L.; Cane, D.
2007-01-01
Aristolochene synthase from Aspergillus terreus catalyzes the cyclization of the universal sesquiterpene precursor, farnesyl diphosphate, to form the bicyclic hydrocarbon aristolochene. The 2.2 {angstrom} resolution X-ray crystal structure of aristolochene synthase reveals a tetrameric quaternary structure in which each subunit adopts the {alpha}-helical class I terpene synthase fold with the active site in the 'open', solvent-exposed conformation. Intriguingly, the 2.15 {angstrom} resolution crystal structure of the complex with Mg{sup 2+}{sub 3}-pyrophosphate reveals ligand binding only to tetramer subunit D, which is stabilized in the 'closed' conformation required for catalysis. Tetramer assembly may hinder conformational changes required for the transition frommore » the inactive open conformation to the active closed conformation, thereby accounting for the attenuation of catalytic activity with an increase in enzyme concentration. In both conformations, but especially in the closed conformation, the active site contour is highly complementary in shape to that of aristolochene, and a catalytic function is proposed for the pyrophosphate anion based on its orientation with regard to the presumed binding mode of aristolochene. A similar active site contour is conserved in aristolochene synthase from Penicillium roqueforti despite the substantial divergent evolution of these two enzymes, while strikingly different active site contours are found in the sesquiterpene cyclases 5-epi-aristolochene synthase and trichodiene synthase. Thus, the terpenoid cyclase active site plays a critical role as a template in binding the flexible polyisoprenoid substrate in the proper conformation for catalysis. Across the greater family of terpenoid cyclases, this template is highly evolvable within a conserved {alpha}-helical fold for the synthesis of terpene natural products of diverse structure and stereochemistry.« less
Im, Young Jun; Kim, Jeong-Il; Shen, Yu; Na, Young; Han, Yun-Jeong; Kim, Seong-Hee; Song, Pill-Soon; Eom, Soo Hyun
2004-10-22
In plants, nucleoside diphosphate kinases (NDPKs) play a key role in the signaling of both stress and light. However, little is known about the structural elements involved in their function. Of the three NDPKs (NDPK1-NDPK3) expressed in Arabidopsis thaliana, NDPK2 is involved in phytochrome-mediated signal transduction. In this study, we found that the binding of dNDP or NTP to NDPK2 strengthens the interaction significantly between activated phytochrome and NDPK2. To better understand the structural basis of the phytochrome-NDPK2 interaction, we determined the X-ray structures of NDPK1, NDPK2, and dGTP-bound NDPK2 from A.thaliana at 1.8A, 2.6A, and 2.4A, respectively. The structures showed that nucleotide binding caused a slight conformational change in NDPK2 that was confined to helices alphaA and alpha2. This suggests that the presence of nucleotide in the active site and/or the evoked conformational change contributes to the recognition of NDPK2 by activated phytochrome. In vitro binding assays showed that only NDPK2 interacted specifically with the phytochrome and the C-terminal regulatory domain of phytochrome is involved in the interaction. A domain swap experiment between NDPK1 and NDPK2 showed that the variable C-terminal region of NDPK2 is important for the activation by phytochrome. The structure of Arabidopsis NDPK1 and NDPK2 showed that the isoforms share common electrostatic surfaces at the nucleotide-binding site, but the variable C-terminal regions have distinct electrostatic charge distributions. These findings suggest that the binding of nucleotide to NDPK2 plays a regulatory role in phytochrome signaling and that the C-terminal extension of NDPK2 provides a potential binding surface for the specific interaction with phytochromes.
Reaction of uridine diphosphate galactose 4-epimerase with a suicide inactivator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Flentke, G.R.; Frey, P.A.
UDPgalactose 4-epimerase from Escherichia coli is rapidly inactivated by the compounds uridine 5{prime}-diphosphate chloroacetol (UDC) and uridine 5{prime}-diphosphate bromoacetol (UCB). Both UDC and UDB inactivate the enzyme in neutral solution concomitant with the appearance of chromophores absorbing maximally at 325 and 328 nm, respectively. The reaction of UDC with the enzyme follows saturation kinetics characterized by a K{sub D} of 0.110 mM and k{sub inact} of 0.84 min{sup {minus}1} at pH 8.5 and ionic strength 0.2 M. The inactivation by UDC is competitively inhibited by competitive inhibitors of UDPgalactose 4-epimerase, and it is accompanied by the tight but noncovalent bindingmore » of UDC to the enzyme in a stoichiometry of 1 mol of UDC/mol of enzyme dimer, corresponding to 1 mol of UDC/mol of enzyme-bound NAD{sup +}. The inactivation of epimerase by uridine 5{prime}-diphosphate ({sup 2}H{sub 2})chloroacetol proceeds with a primary kinetic isotope effect (k{sub H}/k{sub D}) of 1.4. The inactivation mechanism is proposed to involve a minimum of three steps: (a) reversible binding of UDC to the active site of UDPgalactose 4-epimerase; (b) enolization of the chloroacetol moiety of enzyme-bound UDC, catalyzed by an enzymic general base at the active site; (c) alkylation of the nicotinamide ring of NAD{sup +} at the active site by the chloroacetol enolate. The resulting adduct between UDC and NAD{sup +} is proposed to be the chromophore with {lambda}{sub max} at 325 nm. The enzymic general base required to facilitate proton transfer in redox catalysis by this enzyme may be the general base that facilitates enolization of the chloroacetol moiety of UDC in the inactivation reaction.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Dowd, Bing; Williams, Sarah; Wang, Hongxin
Isoprenoid biosynthesis is an important area for anti-infective drug development. One isoprenoid target described is (E)-1-hydroxy-2-methyl-but-2-enyl 4-diphosphate (HMBPP) reductase (IspH), which forms isopentenyl diphosphate and dimethylallyl diphosphate from HMBPP in a 2H + /2e - reduction. IspH contains a 4 Fe-4 S cluster, and in this work, we first investigated how small molecules bound to the cluster by using HYSCORE and NRVS spectroscopies. The results of these, as well as other structural and spectroscopic investigations, led to the conclusion that, in most cases, ligands bound to IspH 4 Fe-4 S clusters by η 1 coordination, forming tetrahedral geometries at themore » unique fourth Fe, ligand side chains preventing further ligand (e.g., H 2 O, O 2 ) binding. Based on these ideas, we used in silico methods to find drug-like inhibitors that might occupy the HMBPP substrate binding pocket and bind to Fe, leading to the discovery of a barbituric acid analogue with a K i value of ≈500 nm against Pseudomonas aeruginosa IspH.« less
Adams, Kristie M; Marzilli, Patricia A; Marzilli, Luigi G
2007-10-29
Products formed between monoester diphosphates (MDPs) and fac-[Re(CO)3(H2O)3]OTf at pH 3.6 were examined. Such adducts of the fac-[Re(CO)3]+ moiety have an uncommon combination of properties for an "inert" metal center in that sharp NMR signals can be observed, yet the products are equilibrating at rates allowing NMR EXSY cross-peaks to be observed. Thiamine diphosphate (TDP) and uridine 5'-diphosphate (5'-UDP) form 1:1 bidentate {Palpha,Pbeta} chelates, in which the MDP binds Re(I) via Palpha and Pbeta phosphate groups. Asymmetric centers are created at Re(I) (RRe/SRe) and Palpha (Delta/Lambda), leading to four diastereomers. The two mirror pairs of diastereomers (RReDelta/SReLambda) and (RReLambda/SReDelta) for TDP (no ribose) and for all four diastereomers (RReDelta, RReLambda, SReDelta, SReLambda) for 5'-UDP (asymmetric ribose) gave two and four sets of NMR signals for the bound MDP, respectively. 31Palpha-31Palpha EXSY cross-peaks indicate that the fac-[Re(CO)3(H2O)({Palpha,Pbeta}MDP)]- isomers interchange slowly on the NMR time scale, with an average k approximately equal to 0.8 s(-1) at 32 degrees C; the EXSY cross-peaks could arise from chirality changes at only Re(I) or at only Palpha. Guanosine 5'-diphosphate (5'-GDP), with a ribose moiety and a Re(I)-binding base, formed both possible diastereomers (RRe and SRe) of the fac-[Re(CO)3(H2O)({N7,Pbeta}GDP)]- macrochelate, with one slightly more abundant diastereomer suggested to be RRe by Mn2+ ion 1H NMR signal line-broadening combined with distances from molecular models. Interchange of the diastereomers requires that the coordination site of either N7 or Pbeta move to the H2O site. 31Palpha-31Palpha EXSY cross-peaks indicate a k approximately equal to 0.5 s(-1) at 32 degrees C for RRe-to-SRe interchange. The similarity of the rate constants for interchange of fac-[Re(CO)3(H2O)({Palpha,Pbeta}MDP)]- and fac-[Re(CO)3(H2O)({N7,Pbeta}GDP)]- adducts suggest strongly that interchange of Pbeta and H2O coordination positions accounts for the EXSY cross-peaks present in the spectra of all adducts.
Catalytic site interactions in yeast OMP synthase.
Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R
2014-01-15
The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.
Pyrrole-indolinone SU11652 targets the nucleoside diphosphate kinase from Leishmania parasites.
Vieira, Plínio Salmazo; Souza, Tatiana de Arruda Campos Brasil; Honorato, Rodrigo Vargas; Zanphorlin, Letícia Maria; Severiano, Kelven Ulisses; Rocco, Silvana Aparecida; de Oliveira, Arthur Henrique Cavalcante; Cordeiro, Artur Torres; Oliveira, Paulo Sérgio Lopes; de Giuseppe, Priscila Oliveira; Murakami, Mário Tyago
2017-07-01
Nucleoside diphosphate kinases (NDKs) are key enzymes in the purine-salvage pathway of trypanosomatids and have been associated with the maintenance of host-cell integrity for the benefit of the parasite, being potential targets for rational drug discovery and design. The NDK from Leishmania major (LmNDK) and mutants were expressed and purified to homogeneity. Thermal shift assays were employed to identify potential inhibitors for LmNDK. Calorimetric experiments, site-directed mutagenesis and molecular docking analysis were performed to validate the interaction and to evaluate the structural basis of ligand recognition. Furthermore, the anti-leishmanial activity of the newly identified and validated compound was tested in vitro against different Leishmania species. The molecule SU11652, a Sunitinib analog, was identified as a potential inhibitor for LmNDK and structural studies indicated that this molecule binds to the active site of LmNDK in a similar conformation to nucleotides, mimicking natural substrates. Isothermal titration calorimetry experiments combined with site-directed mutagenesis revealed that the residues H50 and H117, considered essential for catalysis, play an important role in ligand binding. In vitro cell studies showed that SU11652 had similar efficacy to Amphotericin b against some Leishmania species. Together, our results indicate the pyrrole-indolinone SU11652 as a promising scaffold for the rational design of new drugs targeting the enzyme NDK from Leishmania parasites. Copyright © 2017 Elsevier Inc. All rights reserved.
Kumar, Ramasamy P; Morehouse, Benjamin R; Matos, Jason O; Malik, Karan; Lin, Hongkun; Krauss, Isaac J; Oprian, Daniel D
2017-03-28
The stereochemical course of monoterpene synthase reactions is thought to be determined early in the reaction sequence by selective binding of distinct conformations of the geranyl diphosphate (GPP) substrate. We explore here formation of early Michaelis complexes of the (+)-limonene synthase [(+)-LS] from Citrus sinensis using monofluorinated substrate analogues 2-fluoro-GPP (FGPP) and 2-fluoroneryl diphosphate (FNPP). Both are competitive inhibitors for (+)-LS with K I values of 2.4 ± 0.5 and 39.5 ± 5.2 μM, respectively. The K I values are similar to the K M for the respective nonfluorinated substrates, indicating that fluorine does not significantly perturb binding of the ligand to the enzyme. FGPP and FNPP are also substrates, but with dramatically reduced rates (k cat values of 0.00054 ± 0.00005 and 0.00024 ± 0.00002 s -1 , respectively). These data are consistent with a stepwise mechanism for (+)-LS involving ionization of the allylic GPP substrate to generate a resonance-stabilized carbenium ion in the rate-limiting step. Crystals of apo-(+)-LS were soaked with FGPP and FNPP to obtain X-ray structures at 2.4 and 2.2 Å resolution, respectively. The fluorinated analogues are found anchored in the active site through extensive interactions involving the diphosphate, three metal ions, and three active-site Asp residues. Electron density for the carbon chains extends deep into a hydrophobic pocket, while the enzyme remains mostly in the open conformation observed for the apoprotein. While FNPP was found in multiple conformations, FGPP, importantly, was in a single, relatively well-defined, left-handed screw conformation, consistent with predictions for the mechanism of stereoselectivity in the monoterpene synthases.
Active-site-directed irreversible inhibitors of isopentenyl diphosphate isomerase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muhlbacher, M.
1987-01-01
Seven analogues of isopentenyl diphosphate, containing fluorine, epoxy, or ammonium functionalities were found to irreversibly inhibit isopentenyl diphosphate:dimethylallyl diphosphate isomerase isolated from the mold Claviceps purpurea. The mechanism of their inhibition of isomerase was studied. Syntheses of 3-(fluoromethyl)-3-buten-1-yl diphosphate, 2-dimethylamino-1-ethyl diphosphate, 3,4-epoxy-3-methyl-1-butyl diphosphate, 3,4,-epoxy-1-butyl diphosphate, and 2,3-epoxy-3-methyl-1-butyl diphosphate were developed and carried out in high overall yield affording 100 mg quantities of the triammonium diphosphate salts. Radiolabeled materials of these analogues with {sup 3}H, {sup 14}C, and {sup 32}P at appropriate positions were also prepared. Inactivation kinetics, substrate protection studies, and labeling experiments demonstrated that the analogues interact stoichiometrically withmore » the active-site of isomerase. Radioactive enzyme-inactivator complexes were isolated, that are stable to extended dialysis and chaotropic reagents. The complexes resulting from inactivation of the enzyme by 3-(fluoromethyl)-3-buten-1-yl diphosphate and 3,4-epoxy-3-methyl-1-butyl diphosphate are stable to ion exchange chromatography and gel electrophoresis. Stoichiometric fluoride ion release occurs during inactivation of isomerase with 3-(fluoromethyl)-3-buten-1-yl diphosphate. The complexes are not stable to high concentrations of mixtures of 2-mercaptoethanol-sodium dodecyl sulfate. The radiolabeled 2-dimethylamino-1-ethyl diphosphate isomerase complex loses radioactivity almost instantaneously when treated with base. Partial fragmentation of the inactivator molecule was observed.« less
Koike-Takeshita, A; Koyama, T; Ogura, K
1998-10-01
Among prenyltransferases that catalyze the sequential condensation of isopentenyl diphosphate with allylic diphosphate to produce prenyl diphosphates with various chain lengths and stereochemistries, medium-chain prenyl diphosphate synthases are exceptional in that they comprise two dissociable heteromeric protein components. These components exist without binding with each other under physiological conditions, and neither of them has any prenyltransferase activity by itself. In order to elucidate the precise molecular mechanism underlying expression of the catalytic function by such a unique two-component system, we examined the possibility of forming a hybrid between two of the components of three different medium-chain prenyl diphosphate synthases, components I and II of heptaprenyl diphosphate synthase from Bacillus subtilis, components I' and II' of heptaprenyl diphosphate synthase from Bacillus stearothermophilus, and components A and B of hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26. As a result, only the hybrid-type combination of component I and component II' gave distinct prenyltransferase activity. The hybrid-type enzyme catalyzed the synthesis of heptaprenyl diphosphate and showed moderate heat stability, which lay between those of the natural enzymes from B. subtilis and B. stearothermophilus. There is no possibility of forming a hybrid between the heptaprenyl and hexaprenyl diphosphate synthases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barta, Michael L.; Skaff, D. Andrew; McWhorter, William J.
The polyisoprenoid compound undecaprenyl phosphate is required for biosynthesis of cell wall peptidoglycans in Gram-positive bacteria, including pathogenic Enterococcus, Streptococcus, and Staphylococcus spp. In these organisms, the mevalonate pathway is used to produce the precursor isoprenoid, isopentenyl 5-diphosphate. Mevalonate diphosphate decarboxylase (MDD) catalyzes formation of isopentenyl 5-diphosphate in an ATP-dependent irreversible reaction and is therefore an attractive target for inhibitor development that could lead to new antimicrobial agents. To facilitate exploration of this possibility, we report the crystal structure of Staphylococcus epidermidis MDD (1.85 {angstrom} resolution) and, to the best of our knowledge, the first structures of liganded MDD. Thesemore » structures include MDD bound to the mevalonate 5-diphosphate analogs diphosphoglycolyl proline (2.05 {angstrom} resolution) and 6-fluoromevalonate diphosphate (FMVAPP; 2.2 {angstrom} resolution). Comparison of these structures provides a physical basis for the significant differences in K{sub i} values observed for these inhibitors. Inspection of enzyme/inhibitor structures identified the side chain of invariant Ser{sup 192} as making potential contributions to catalysis. Significantly, Ser {yields} Ala substitution of this side chain decreases k{sub cat} by {approx}10{sup 3}-fold, even though binding interactions between FMVAPP and this mutant are similar to those observed with wild type MDD, as judged by the 2.1 {angstrom} cocrystal structure of S192A with FMVAPP. Comparison of microbial MDD structures with those of mammalian counterparts reveals potential targets at the active site periphery that may be exploited to selectively target the microbial enzymes. These studies provide a structural basis for previous observations regarding the MDD mechanism and inform future work toward rational inhibitor design.« less
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brandt, Gabriel S.; Nemeria, Natalia; Chakraborty, Sumit
2008-07-28
Benzaldehyde lyase (BAL) catalyzes the reversible cleavage of (R)-benzoin to benzaldehyde utilizing thiamin diphosphate and Mg{sup 2+} as cofactors. The enzyme is important for the chemoenzymatic synthesis of a wide range of compounds via its carboligation reaction mechanism. In addition to its principal functions, BAL can slowly decarboxylate aromatic amino acids such as benzoylformic acid. It is also intriguing mechanistically due to the paucity of acid-base residues at the active center that can participate in proton transfer steps thought to be necessary for these types of reactions. Here methyl benzoylphosphonate, an excellent electrostatic analogue of benzoylformic acid, is used tomore » probe the mechanism of benzaldehyde lyase. The structure of benzaldehyde lyase in its covalent complex with methyl benzoylphosphonate was determined to 2.49 {angstrom} (Protein Data Bank entry 3D7K) and represents the first structure of this enzyme with a compound bound in the active site. No large structural reorganization was detected compared to the complex of the enzyme with thiamin diphosphate. The configuration of the predecarboxylation thiamin-bound intermediate was clarified by the structure. Both spectroscopic and X-ray structural studies are consistent with inhibition resulting from the binding of MBP to the thiamin diphosphate in the active centers. We also delineated the role of His29 (the sole potential acid-base catalyst in the active site other than the highly conserved Glu50) and Trp163 in cofactor activation and catalysis by benzaldehyde lyase.« less
Brandt, Gabriel S.; Nemeria, Natalia; Chakraborty, Sumit; McLeish, Michael J.; Yep, Alejandra; Kenyon, George L.; Petsko, Gregory A.; Jordan, Frank; Ringe, Dagmar
2009-01-01
Benzaldehyde lyase (BAL) catalyzes the reversible cleavage of (R)-benzoin to benzaldehyde utilizing thiamin diphosphate and Mg2+ as cofactors. The enzyme is important for the chemoenzymatic synthesis of a wide range of compounds via its carboligation reaction mechanism. In addition to its principal functions, BAL can slowly decarboxylate aromatic amino acids such as benzoylformic acid. It is also intriguing mechanistically due to the paucity of acid-base residues at the active center that can participate in proton transfer steps thought to be necessary for these type of reactions. Here methyl benzoylphosphonate, an excellent electrostatic analog of benzoylformic acid, is used to probe the mechanism of benzaldehyde lyase. The structure of benzaldehyde lyase in its covalent complex with methyl benzoylphosphonate was determined to 2.49 Å (PDB ID: 3D7K) and represents the first structure of this enzyme with a compound bound in the active site. No large structural reorganization was detected compared to the complex of the enzyme with thiamin diphosphate. The configuration of the predecarboxylation thiamin-bound intermediate was clarified by the structure. Both spectroscopic and X-ray structural studies are consistent with inhibition resulting from the binding of MBP to the thiamin diphosphate in the active centers. We also delineated the role of His29 (the sole potential acid-base catalyst in the active site other than the highly conserved Glu50) and Trp163 in cofactor activation and catalysis by benzaldehyde lyase. PMID:18570438
Hagemann, H; Marcillat, O; Buchet, R; Vial, C
2000-08-08
Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.
Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi
2009-01-01
Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes. PMID:19158086
Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-Ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi
2009-04-03
Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes.
Varela Chavez, Carolina; Haustant, Georges Michel; Baron, Bruno; England, Patrick; Chenal, Alexandre; Pauillac, Serge; Blondel, Arnaud; Popoff, Michel-Robert
2016-01-01
Clostridium sordellii lethal toxin (TcsL) is a powerful virulence factor responsible for severe toxic shock in man and animals. TcsL belongs to the large clostridial glucosylating toxin (LCGT) family which inactivates small GTPases by glucosylation with uridine-diphosphate (UDP)-glucose as a cofactor. Notably, TcsL modifies Rac and Ras GTPases, leading to drastic alteration of the actin cytoskeleton and cell viability. TcsL enters cells via receptor-mediated endocytosis and delivers the N-terminal glucosylating domain (TcsL-cat) into the cytosol. TcsL-cat was found to preferentially bind to phosphatidylserine (PS)-containing membranes and to increase the glucosylation of Rac anchored to the lipid membrane. We have previously reported that the N-terminal four helical bundle structure (1–93 domain) recognizes a broad range of lipids, but that TcsL-cat specifically binds to PS and phosphatidic acid. Here, we show using mutagenesis that the PS binding site is localized on the tip of the four-helix bundle which is rich in positively-charged amino acids. Residues Y14, V15, F17, and R18 on loop 1, between helices 1 and 2, in coordination with R68 from loop 3, between helices 3 and 4, form a pocket which accommodates L-serine. The functional PS-binding site is required for TcsL-cat binding to the plasma membrane and subsequent cytotoxicity. TcsL-cat binding to PS facilitates a high enzymatic activity towards membrane-anchored Ras by about three orders of magnitude as compared to Ras in solution. The PS-binding site is conserved in LCGTs, which likely retain a common mechanism of binding to the membrane for their full activity towards membrane-bound GTPases. PMID:27023605
Balakrishnan, Anand; Gao, Yuhong; Moorjani, Prerna; Nemeria, Natalia S.; Tittmann, Kai; Jordan, Frank
2012-01-01
Thiamin diphosphate (ThDP) dependent enzymes perform crucial C-C bond forming and breaking reactions in sugar and amino acid metabolism and in biosynthetic pathways via a sequence of ThDP-bound covalent intermediates. A member of this superfamily, yeast pyruvate decarboxylase (YPDC) carries out the non-oxidative decarboxylation of pyruvate and is mechanistically a simpler ThDP enzyme. YPDC variants created by substitution at the active center (D28A, E51X, E477Q) and on the substrate activation pathway (E91D and C221E) display varying activity, suggesting that they stabilize different covalent intermediates. To test the role of both rings of ThDP in YPDC catalysis (the 4′-aminopyrimidine as acid-base, and thiazolium as electrophilic covalent catalyst), we applied a combination of steady state and time-resolved circular dichroism experiments (assessing the state of ionization and tautomerization of enzyme-bound ThDP-related intermediates), and chemical quench of enzymatic reaction mixtures followed by NMR characterization of the ThDP-bound intermediates released from YPDC (assessing occupancy of active centers by these intermediates and rate-limiting steps). Results suggest that: (1) Pyruvate and analogs induce active site asymmetry in YPDC and variants. (2) The rare 1′,4′-iminopyrimidine ThDP tautomer participates in formation of ThDP-bound intermediates. (3) Propionylphosphinate also binds at the regulatory site and its binding is reflected by catalytic events at the active site 20Å away. (4) YPDC stabilizes an electrostatic model for the 4′-aminopyrimidinium ionization state, an important contribution of the protein to catalysis. The combination of tools used provides time-resolved details about individual events during ThDP catalysis; the methods are transferable to other ThDP superfamily members. PMID:22300533
Pathan, Akbar Ali Khan; Panthi, Bhavana; Khan, Zahid; Koppula, Purushotham Reddy; Alanazi, Mohammed Saud; Sachchidanand; Parine, Narasimha Reddy; Chourasia, Mukesh
2016-01-01
Objective Kirsten rat sarcoma (K-Ras) protein is a member of Ras family belonging to the small guanosine triphosphatases superfamily. The members of this family share a conserved structure and biochemical properties, acting as binary molecular switches. The guanosine triphosphate-bound active K-Ras interacts with a range of effectors, resulting in the stimulation of downstream signaling pathways regulating cell proliferation, differentiation, and apoptosis. Efforts to target K-Ras have been unsuccessful until now, placing it among high-value molecules against which developing a therapy would have an enormous impact. K-Ras transduces signals when it binds to guanosine triphosphate by directly binding to downstream effector proteins, but in case of guanosine diphosphate-bound conformation, these interactions get disrupted. Methods In the present study, we targeted the nucleotide-binding site in the “on” and “off” state conformations of the K-Ras protein to find out suitable lead compounds. A structure-based virtual screening approach has been used to screen compounds from different databases, followed by a combinatorial fragment-based approach to design the apposite lead for the K-Ras protein. Results Interestingly, the designed compounds exhibit a binding preference for the “off” state over “on” state conformation of K-Ras protein. Moreover, the designed compounds’ interactions are similar to guanosine diphosphate and, thus, could presumably act as a potential lead for K-Ras. The predicted drug-likeness properties of these compounds suggest that these compounds follow the Lipinski’s rule of five and have tolerable absorption, distribution, metabolism, excretion and toxicity values. Conclusion Thus, through the current study, we propose targeting only “off” state conformations as a promising strategy for the design of reversible inhibitors to pharmacologically inhibit distinct conformations of K-Ras protein. PMID:27217775
Autoradiography of P2x ATP receptors in the rat brain.
Balcar, V. J.; Li, Y.; Killinger, S.; Bennett, M. R.
1995-01-01
1. Binding of a P2x receptor specific radioligand, [3H]-alpha,beta-methylene adenosine triphosphate ([3H]-alpha,beta-MeATP) to sections of rat brain was reversible and association/dissociation parameters indicated that it consisted of two saturable components. Non-specific binding was very low (< 7% at 10 nM ligand concentration). 2. The binding was completely inhibited by suramin (IC50 approximately 14-26 microM) but none of the ligands specific for P2y receptors such as 2-methylthio-adenosine triphosphate (2-methyl-S-ATP) and 2-chloro-adenosine triphosphate (2-C1-ATP) nor 2-methylthio-adenosine diphosphate (2-methyl-S-ADP) a ligand for the P2 receptor on blood platelets ('P2T' type) produced strong inhibitions except for P1,P4-di(adenosine-5')tetraphosphate (Ap4A). 3. Inhibitors of Na+,K(+)-dependent adenosine triphosphatase (ATPase) ouabain, P1-ligand adenosine and an inhibitor of transport of, respectively, adenosine and cyclic nucleotides, dilazep, had no effect. 4. The highest density of P2x binding sites was found to be in the cerebellar cortex but the binding sites were present in all major brain regions, especially in areas known to receive strong excitatory innervation. Images Figure 2 PMID:7670731
Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen; Christoffersen, Stig; Poulsen, Jens-Christian Navarro; Mølgaard, Anne; Kadziola, Anders
2015-04-14
The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2 was subjected to crystallographic, kinetic, and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5-phosphoribosyl-α-1-pyrophosphate (PRPP) and adenine or the product adenosine monophosphate (AMP) or the inhibitor adenosine diphosphate (ADP) in each active site. The individual subunit adopts an overall structure that resembles a 6-oxopurine phosphoribosyltransferase (PRTase) more than known APRTases implying that APRT functionality in Crenarchaeotae has its evolutionary origin in this family of PRTases. Only the N-terminal two-thirds of the polypeptide chain folds as a traditional type I PRTase with a five-stranded β-sheet surrounded by helices. The C-terminal third adopts an unusual three-helix bundle structure that together with the nucleobase-binding loop undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor ADP binds like the product AMP with both the α- and β-phosphates occupying the 5'-phosphoribosyl binding site. The enzyme shows activity over a wide pH range, and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme, may be facilitated by elements in the C-terminal three-helix bundle part of the protein.
Nguyen, Khiem; Li, Jin; Puthenveetil, Robbins; Lin, Xiaochen; Poe, Michael M; Hsiao, Chia-Hung Christine; Vinogradova, Olga; Wiemer, Andrew J
2017-11-01
Small isoprenoid diphosphates, such as ( E )-4-hydroxy-3-methyl-but-2-enyl diphosphate (HMBPP), are ligands of the internal domain of BTN3A1. Ligand binding in target cells promotes activation of Vγ9Vδ2 T cells. We demonstrate by small-angle X-ray scattering (SAXS) that HMBPP binding to the internal domain of BTN3A1 induces a conformational change in the position of the B30.2 domain relative to the juxtamembrane (JM) region. To better understand the molecular details of this conformational rearrangement, NMR spectroscopy was used to discover that the JM region interacts with HMBPP, specifically at the diphosphate. The spectral location of the affected amide peaks, partial NMR assignments, and JM mutants (ST 296 AA or T 304 A) investigated, confirm that the backbone amide of at least one Thr (Thr 304 ), adjacent to conserved Ser, comes close to the HMBPP diphosphate, whereas double mutation of nonconserved residues (Ser/Thr 296/297 ) may perturb the local fold. Cellular mutation of either of the identified Thr residues reduces the activation of Vγ9Vδ2 T cells by HMBPP, zoledronate, and POM 2 -C-HMBP, but not by a partial agonist BTN3 antibody. Taken together, our results show that ligand binding to BTN3A1 induces a conformational change within the intracellular domain that involves the JM region and is required for full activation.-Nguyen, K., Li, J., Puthenveetil, R., Lin, X., Poe, M. M., Hsiao, C.-H. C., Vinogradova, O., Wiemer, A. J. The butyrophilin 3A1 intracellular domain undergoes a conformational change involving the juxtamembrane region. © FASEB.
Lima, Juliana Maria; Salmazo Vieira, Plínio; Cavalcante de Oliveira, Arthur Henrique; Cardoso, Carmen Lúcia
2016-08-07
Nucleoside diphosphate kinase from Leishmania spp. (LmNDKb) has recently been described as a potential drug target to treat leishmaniasis disease. Therefore, screening of LmNDKb ligands requires methodologies that mimic the conditions under which LmNDKb acts in biological systems. Here, we compare two label-free methodologies that could help screen LmNDKb ligands and measure NDKb activity: an offline LC-UV assay for soluble LmNDKb and an online two-dimensional LC-UV system based on LmNDKb immobilised on a silica capillary. The target enzyme was immobilised on the silica capillary via Schiff base formation (to give LmNDKb-ICER-Schiff) or affinity attachment (to give LmNDKb-ICER-His). Several aspects of the ICERs resulting from these procedures were compared, namely kinetic parameters, stability, and procedure steps. Both the LmNDKb immobilisation routes minimised the conformational changes and preserved the substrate binding sites. However, considering the number of steps involved in the immobilisation procedure, the cost of reagents, and the stability of the immobilised enzyme, immobilisation via Schiff base formation proved to be the optimal procedure.
Wypijewska, Anna; Bojarska, Elzbieta; Lukaszewicz, Maciej; Stepinski, Janusz; Jemielity, Jacek; Davis, Richard E; Darzynkiewicz, Edward
2012-10-09
Decapping scavenger (DcpS) enzymes catalyze the cleavage of a residual cap structure following 3' → 5' mRNA decay. Some previous studies suggested that both m(7)GpppG and m(7)GDP were substrates for DcpS hydrolysis. Herein, we show that mononucleoside diphosphates, m(7)GDP (7-methylguanosine diphosphate) and m(3)(2,2,7)GDP (2,2,7-trimethylguanosine diphosphate), resulting from mRNA decapping by the Dcp1/2 complex in the 5' → 3' mRNA decay, are not degraded by recombinant DcpS proteins (human, nematode, and yeast). Furthermore, whereas mononucleoside diphosphates (m(7)GDP and m(3)(2,2,7)GDP) are not hydrolyzed by DcpS, mononucleoside triphosphates (m(7)GTP and m(3)(2,2,7)GTP) are, demonstrating the importance of a triphosphate chain for DcpS hydrolytic activity. m(7)GTP and m(3)(2,2,7)GTP are cleaved at a slower rate than their corresponding dinucleotides (m(7)GpppG and m(3)(2,2,7)GpppG, respectively), indicating an involvement of the second nucleoside for efficient DcpS-mediated digestion. Although DcpS enzymes cannot hydrolyze m(7)GDP, they have a high binding affinity for m(7)GDP and m(7)GDP potently inhibits DcpS hydrolysis of m(7)GpppG, suggesting that m(7)GDP may function as an efficient DcpS inhibitor. Our data have important implications for the regulatory role of m(7)GDP in mRNA metabolic pathways due to its possible interactions with different cap-binding proteins, such as DcpS or eIF4E.
Taban, A Huma; Tittiger, Claus; Blomquist, Gary J; Welch, William H
2009-06-01
Farnesyl diphosphate synthase (FPPS) catalyzes the consecutive condensation of two molecules of isopentenyl diphosphate with dimethylallyl diphosphate to form farnesyl diphosphate (FPP). In insects, FPP is used for the synthesis of ubiquinones, dolicols, protein prenyl groups, and juvenile hormone. A full-length cDNA of FPPS was cloned from the cotton boll weevil, Anthonomus grandis (AgFPPS). AgFPPS cDNA consists of 1,835 nucleotides and encodes a protein of 438 amino acids. The deduced amino acid sequence has high similarity to previously isolated insect FPPSs and other known FPPSs. Recombinant AgFPPS expressed in E. coli converted labeled isopentenyl diphosphate in the presence of dimethylallyl diphosphate to FPP. Southern blot analysis indicated the presence of a single copy gene. Using molecular modeling, the three-dimensional structure of coleopteran FPPS was determined and compared to the X-ray crystal structure of avian FPPS. The alpha-helical fold is conserved in AgFPPS and the size of the active site cavity is consistent with the enzyme being a FPPS. (c) 2009 Wiley Periodicals, Inc.
Binding of the Ras activator son of sevenless to insulin receptor substrate-1 signaling complexes.
Baltensperger, K; Kozma, L M; Cherniack, A D; Klarlund, J K; Chawla, A; Banerjee, U; Czech, M P
1993-06-25
Signal transmission by insulin involves tyrosine phosphorylation of a major insulin receptor substrate (IRS-1) and exchange of Ras-bound guanosine diphosphate for guanosine triphosphate. Proteins containing Src homology 2 and 3 (SH2 and SH3) domains, such as the p85 regulatory subunit of phosphatidylinositol-3 kinase and growth factor receptor-bound protein 2 (GRB2), bind tyrosine phosphate sites on IRS-1 through their SH2 regions. Such complexes in COS cells were found to contain the heterologously expressed putative guanine nucleotide exchange factor encoded by the Drosophila son of sevenless gene (dSos). Thus, GRB2, p85, or other proteins with SH2-SH3 adapter sequences may link Sos proteins to IRS-1 signaling complexes as part of the mechanism by which insulin activates Ras.
Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T
2011-07-01
Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; Robinson, Howard; Marsing, Gregory C.
2004-11-01
1. Introduction Enzymes in the non-mevalonate pathway for isoprenoid synthesis have gained recent attention because of their potential value as targets for antibiotic drug development. 2C-methyl-D-erythritol-2,4 cyclophosphate (MECDP) synthase is the fifth enzyme in the seven enzyme non-mevalonate pathway for synthesis of isopentenyl diphosphate. Four groups have published structures of MECDP synthase at resolutions varying from 1.6Å to 2.8Å, either in the presence or absence of substrate from Escherichia coli (Richard et al., 2002; Kemp et al., 2002; Steinbacher et al., 2002) or from Thermus thermophilus (Kishida et al., 2003). Among these structures, the protein always exists as a homotrimermore » either with a crystallographic or a non-crystallographic three-fold symmetry axis and an active site formed in a cleft between adjacent monomers. While the overall shape of the proteins is highly similar among these structures, each of the four reported structures contain different combinations of metal ions in the active site including a Zn2+ ion only (Steinbacher et al., 2002), a Mn2+ ion only (Richard et al., 2002), Zn2+ and Mn2+ ions (Kemp et al., 2002) or two Mg2+ ions (Kishida et al., 2003). Furthermore, two of the structures are reported to contain a hydrophobic channel along the three-fold symmetry axis that is capped by a cluster of three arginine side chains (one from each monomer) at one end of the cavity and a cluster of three glutamic acid side chains (one from each monomer) at the other side of the cavity. In a 1.8Å resolution structure, Kemp et al. (2002) reported a sulfate ion coordinated to the arginine cap and solvent trapped in a hydrophobic cavity. In a lower 2.8Å resolution structure, Richard et al. (2002) concluded that geranyl diphosphate, GPP, was most likely trapped by the arginine cap and hydrophobic cavity (Richard et al., 2002), however, the low resolution of the data together with the presence of the crystallographic symmetry axis prohibited a definitive analysis of the identity and mode of binding of the bound molecule. Kishida et al. (2003) reported that no cavity existed in a 1.6Å structure of the SO3437 homolog from Thermus thermophilus, presumably due to tighter packing of the protein from the thermophilic organism. Steinbacher et al. (2002) make no description of a hydrophobic cavity in a lower resolution (2.5-3.2Å) of the Escherichia coli protein. Here, we report a high-resolution (1.6Å) structure of MECDP synthase from Shewanella oneidensis in the absence of substrate in the active site. We provide unambiguous data that confirms the presence of Zn2+ in one of the metal binding sites and observe what appears to be farnesyl diphosphate (FPP) bound in the hydrophobic cavity along the non-crystallographic three-fold symmetry axis of the homotrimer. The high-resolution structure clarifies the mode of binding of the pyrophosphate of FPP in the arginine cluster that caps the hydrophobic cavity.« less
Grimm, Fabian A.; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W.
2013-01-01
Background: The displacement of l-thyroxine (T4) from binding sites on transthyretin (TTR) is considered a significant contributing mechanism in polychlorinated biphenyl (PCB)-induced thyroid disruption. Previous research has discovered hydroxylated PCB metabolites (OH-PCBs) as high-affinity ligands for TTR, but the binding potential of conjugated PCB metabolites such as PCB sulfates has not been explored. Objectives: We evaluated the binding of five lower-chlorinated PCB sulfates to human TTR and compared their binding characteristics to those determined for their OH-PCB precursors and for T4. Methods: We used fluorescence probe displacement studies and molecular docking simulations to characterize the binding of PCB sulfates to TTR. The stability of PCB sulfates and the reversibility of these interactions were characterized by HPLC analysis of PCB sulfates after their binding to TTR. The ability of OH-PCBs to serve as substrates for human cytosolic sulfotransferase 1A1 (hSULT1A1) was assessed by OH-PCB–dependent formation of adenosine-3´,5´-diphosphate, an end product of the sulfation reaction. Results: All five PCB sulfates were able to bind to the high-affinity binding site of TTR with equilibrium dissociation constants (Kd values) in the low nanomolar range (4.8–16.8 nM), similar to that observed for T4 (4.7 nM). Docking simulations provided corroborating evidence for these binding interactions and indicated multiple high-affinity modes of binding. All OH-PCB precursors for these sulfates were found to be substrates for hSULT1A1. Conclusions: Our findings show that PCB sulfates are high-affinity ligands for human TTR and therefore indicate, for the first time, a potential relevance for these metabolites in PCB-induced thyroid disruption. PMID:23584369
Yamaguchi, Nobuo; Yoshinaga, Masafumi; Kamino, Kei; Ueki, Tatsuya
2016-06-01
Polychaete fan worms and ascidians accumulate high levels of vanadium ions. Several vanadiumbinding proteins, known as vanabins, have been found in ascidians. However, no vanadium-binding factors have been isolated from the fan worm. In the present study, we sought to identify vanadiumbinding proteins in the branchial crown of the fan worm using immobilized metal ion affinity chromatography. A nucleoside diphosphate kinase (NDK) homolog was isolated and determined to be a vanadium-binding protein. Kinase activity of the NDK homologue, PoNDK, was suppressed by the addition of V(IV), but was unaffected by V(V). The effect of V(IV) on PoNDK precedes its activation by Mg(II). This is the first report to describe the relationship between NDK and V(IV). PoNDK is located in the epidermis of the branchial crown, and its distribution is very similar to that of vanadium. These results suggest that PoNDK is associated with vanadium accumulation and metabolism in P. occelata.
Di Marino, Daniele; Oteri, Francesco; della Rocca, Blasco Morozzo; D'Annessa, Ilda; Falconi, Mattia
2012-06-01
The mitochondrial adenosine diphosphate/adenosine triphosphate (ADP/ATP) carrier-AAC-was crystallized in complex with its specific inhibitor carboxyatractyloside (CATR). The protein consists of a six-transmembrane helix bundle that defines the nucleotide translocation pathway, which is closed towards the matrix side due to sharp kinks in the odd-numbered helices. In this paper, we describe the interaction between the matrix side of the AAC transporter and the ATP(4-) molecule using carrier structures obtained through classical molecular dynamics simulation (MD) and a protein-ligand docking procedure. Fifteen structures were extracted from a previously published MD trajectory through clustering analysis, and 50 docking runs were carried out for each carrier conformation, for a total of 750 runs ("MD docking"). The results were compared to those from 750 docking runs performed on the X-ray structure ("X docking"). The docking procedure indicated the presence of a single interaction site in the X-ray structure that was conserved in the structures extracted from the MD trajectory. MD docking showed the presence of a second binding site that was not found in the X docking. The interaction strategy between the AAC transporter and the ATP(4-) molecule was analyzed by investigating the composition and 3D arrangement of the interaction pockets, together with the orientations of the substrate inside them. A relationship between sequence repeats and the ATP(4-) binding sites in the AAC carrier structure is proposed.
The Mesomeric Effect of Thiazolium on non-Kekulé Diradicals in Pichia stipitis Transketolase.
Hsu, Ning-Shian; Wang, Yung-Lin; Lin, Kuan-Hung; Chang, Chi-Fon; Lyu, Syue-Yi; Hsu, Li-Jen; Liu, Yu-Chen; Chang, Chin-Yuan; Wu, Chang-Jer; Li, Tsung-Lin
2018-02-12
It is theoretically plausible that thiazolium mesomerizes to congeners other than carbene in a low effective dielectric binding site; especially given the energetics and uneven electronegativity of carbene groups. However, such a phenomenon has never been reported. Nine crystal structures of transketolase obtained from Pichia stipitis (TKps) are reported with subatomic resolution, where thiazolium displays an extraordinary ring-bending effect. The bent thiazolium congeners correlate with non-Kekulé diradicals because there is no gain or loss of electrons. In conjunction with biophysical and biochemical analyses, it is concluded that ring bending is a result of tautomerization of thiazolium with its non- Kekulé diradicals, exclusively in the binding site of TKps. The chemophysical properties of these thiazolium mesomers may account for the great variety of reactivities carried out by thiamine-diphosphate-containing (ThDP) enzymes. The stability of ThDP in living systems can be regulated by the levels of substrates, and hydration and dehydration, as well as diradical-mediated oxidative degradation. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hsieh, Wei-Yu; Sung, Tzu-Ying; Wang, Hsin-Tzu; Hsieh, Ming-Hsiun
2014-09-01
The plant 4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE (HDR) catalyzes the last step of the methylerythritol phosphate pathway to synthesize isopentenyl diphosphate and its allyl isomer dimethylallyl diphosphate, which are common precursors for the synthesis of plastid isoprenoids. The Arabidopsis (Arabidopsis thaliana) genomic HDR transgene-induced gene-silencing lines are albino, variegated, or pale green, confirming that HDR is essential for plants. We used Escherichia coli isoprenoid synthesis H (Protein Data Bank code 3F7T) as a template for homology modeling to identify key amino acids of Arabidopsis HDR. The predicted model reveals that cysteine (Cys)-122, Cys-213, and Cys-350 are involved in iron-sulfur cluster formation and that histidine (His)-152, His-241, glutamate (Glu)-242, Glu-243, threonine (Thr)-244, Thr-312, serine-379, and asparagine-381 are related to substrate binding or catalysis. Glu-242 and Thr-244 are conserved only in cyanobacteria, green algae, and land plants, whereas the other key amino acids are absolutely conserved from bacteria to plants. We used site-directed mutagenesis and complementation assay to confirm that these amino acids, except His-152 and His-241, were critical for Arabidopsis HDR function. Furthermore, the Arabidopsis HDR contains an extra amino-terminal domain following the transit peptide that is highly conserved from cyanobacteria, and green algae to land plants but not existing in the other bacteria. We demonstrated that the amino-terminal conserved domain was essential for Arabidopsis and cyanobacterial HDR function. Further analysis of conserved amino acids in the amino-terminal conserved domain revealed that the tyrosine-72 residue was critical for Arabidopsis HDR. These results suggest that the structure and reaction mechanism of HDR evolution have become specific for oxygen-evolving photosynthesis organisms and that HDR probably evolved independently in cyanobacteria versus other prokaryotes. © 2014 American Society of Plant Biologists. All Rights Reserved.
Kumar, Hitesh; Kumar, Sanjay
2013-09-15
The leaves of stevia [Stevia rebaudiana (Bertoni)] are a rich source of steviol glycosides that are used as non-calorific sweetener in many countries around the world. Steviol moiety of steviol glycosides is synthesized via plastidial 2C-methyl-D-erythritol 4-phosphate pathway, where (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) is the key enzyme. HDR catalyzes the simultaneous conversion of (E)-4-hydroxy-3-methylbut-2-enyl diphosphate into five carbon isoprenoid units, isopentenyl diphosphate and dimethylallyl diphosphate. Stevia HDR (SrHDR) successfully rescued HDR lethal mutant strain MG1655 ara<>ispH upon genetic complementation, suggesting SrHDR to encode a functional protein. The gene exhibited diurnal variation in expression. To identify the possible regulatory elements, upstream region of the gene was cloned and putative cis-acting elements were detected by in silico analysis. Electrophoretic mobility shift assay, using a putative light responsive element GATA showed the binding of nuclear proteins (NP) isolated from leaves during light period of the day, but not with the NP from leaves during the dark period. Data suggested the involvement of GATA box in light mediated gene regulation of SrHDR in stevia. Copyright © 2013 Elsevier B.V. All rights reserved.
Kiser, Jennifer J.; Stephensen, Charles B.; Hazra, Rohan; Flynn, Patricia M.; Wilson, Craig M.; Rutledge, Brandy; Bethel, James; Pan, Cynthia G.; Woodhouse, Leslie R.; Van Loan, Marta D.; Liu, Nancy; Lujan-Zilbermann, Jorge; Baker, Alyne; Kapogiannis, Bill G.; Gordon, Catherine M.
2013-01-01
Tenofovir disoproxil fumarate (TDF) causes bone, endocrine, and renal changes by an unknown mechanism(s). Data are limited on tenofovir pharmacokinetics and these effects. Using baseline data from a multicenter study of HIV-infected youth on stable treatment with regimens containing TDF (n = 118) or lacking TDF (n = 85), we measured cross-sectional associations of TDF use with markers of renal function, vitamin D-calcium-parathyroid hormone balance, phosphate metabolism (tubular reabsorption of phosphate and fibroblast growth factor 23 [FGF23]), and bone turnover. Pharmacokinetic-pharmacodynamic associations with plasma tenofovir and intracellular tenofovir diphosphate concentrations were explored among those receiving TDF. The mean age was 20.9 (standard deviation [SD], 2.0) years; 63% were male; and 52% were African American. Compared to the no-TDF group, the TDF group showed lower mean estimated glomerular filtration rates and tubular reabsorption of phosphate, as well as higher parathyroid hormone and 1,25-dihydroxy vitamin D [1,25-OH(2)D] levels. The highest quintile of plasma tenofovir concentrations was associated with higher vitamin D binding protein, lower free 1,25-OH(2)D, higher 25-OH vitamin D, and higher serum calcium. The highest quintile of intracellular tenofovir diphosphate concentration was associated with lower FGF23. Higher plasma tenofovir concentrations were associated with higher vitamin D binding protein and lower free 1,25-OH(2)D, suggesting a functional vitamin D deficiency explaining TDF-associated increased parathyroid hormone. The finding of lower FGF23 accompanying higher intracellular tenofovir diphosphate suggests that different mechanisms mediate TDF-associated changes in phosphate handling. Separate pharmacokinetic properties may be associated with distinct TDF toxicities: tenofovir with parathyroid hormone and altered calcium balance and tenofovir diphosphate with hypophosphatemia and FGF23 regulation. (The clinical trial registration number for this study is NCT00490412 and is available online at http://clinicaltrials.gov/ct2/show/NCT00490412.) PMID:24002093
Thapa, Hem R; Tang, Su; Sacchettini, James C; Devarenne, Timothy P
2017-09-15
Recently, the biosynthetic pathway for lycopadiene, a C 40 tetraterpenoid hydrocarbon, was deciphered from the L race of Botryococcus braunii, an alga that produces hydrocarbon oils capable of being converted into combustible fuels. The lycopadiene pathway is initiated by the squalene synthase (SS)-like enzyme lycopaoctaene synthase (LOS), which catalyzes the head-to-head condensation of two C 20 geranylgeranyl diphosphate (GGPP) molecules to produce C 40 lycopaoctaene. LOS shows unusual substrate promiscuity for SS or SS-like enzymes by utilizing C 15 farnesyl diphosphate (FPP) and C 20 phytyl diphosphate in addition to GGPP as substrates. These three substrates can be combined by LOS individually or in combinations to produce six different hydrocarbons of C 30 , C 35 , and C 40 chain lengths. To understand LOS substrate and product specificity, rational mutagenesis experiments were conducted based on sequence alignment with several SS proteins as well as a structural comparison with the human SS (HSS) crystal structure. Characterization of the LOS mutants in vitro identified Ser276 and Ala288 in the LOS active site as key amino acids responsible for controlling substrate binding, and thus the promiscuity of this enzyme. Mutating these residues to those found in HSS largely converted LOS from lycopaoctaene production to C 30 squalene production. Furthermore, these studies were confirmed in vivo by expressing LOS in E. coli cells metabolically engineered to produce high FPP and GGPP levels. These studies also offer insights into tetraterpene hydrocarbon metabolism in B. braunii and provide a foundation for engineering LOS for robust production of specific hydrocarbons of a desired chain length.
Fujii, Mikio; Kitagawa, Yasuyuki; Iida, Shui; Kato, Keisuke; Ono, Machiko
2015-11-15
The dihedral angle θ of the diphosphate part of NAD(P) were investigated to distinguish the differences in the binding-conformation of NAD(P) to enzymes and to create an enzyme taxonomy. Furthermore, new inhibitors with fixed dihedral angles showed that enzymes could recognize the differences in the dihedral angle θ. We suggest the taxonomy and the dihedral angle θ are important values for chemists to consider when designing inhibitors and drugs that target enzymes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Qiu, Weihua; Zhou, Bingsen; Darwish, Dana; Shao, Jimin; Yen, Yun
2006-02-10
Ribonucleotide reductase (RR) is a highly regulated enzyme in the deoxyribonucleotide synthesis pathway. RR is responsible for the de novo conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates, which are essential for DNA synthesis and repair. Besides two subunits, hRRM1 and hRRM2, p53R2 is a newly identified member of RR family that is induced by ultraviolet light in a p53-dependent manner. To understand the molecular interaction of RR subunits, we employed a eukaryotic expression system to express and purify all three subunits. After in vitro reconstitution, the results of [(3)H]CDP reduction assay showed that both eukaryotic recombinant hRRM2 and p53R2 proteins could interact with hRRM1 to form functional RR holoenzyme. The reconstituted RR activity was time-dependent and the reaction rate reached the plateau phase after 40min incubation. No matter the concentration, RR holoenzyme reconstituted from p53R2 and hRRM1 could only achieve about 40-75% kinetic activity of that from hRRM2 and hRRM1. The synthetic C-terminal heptapeptide competition assays confirmed that hRRM2 and p53R2 share the same binding site on hRRM1, but the binding site on hRRM1 demonstrated higher affinity for hRRM2 than for p53R2. In allosteric regulation assay, the effect of activation or inhibition of hRRM1 with ATP or dATP suggested that these effectors could regulate RR activity independent of different RR small subunits. Taken together, the eukaryotic expression system RR holoenzyme will provide a very useful tool to understand the molecular mechanisms of RR activity and the interactions of its subunits.
Stegemann, Björn; Klebe, Gerhard
2012-02-01
Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Folkers, Gerd; Trumpp-Kallmeyer, Susanne; Gutbrod, Oliver; Krickl, Sabine; Fetzer, Jürgen; Keil, Günther M.
1991-10-01
Thymidine kinase (TK), which is induced by Herpes Simplex Virus 1 (HSV1), plays a key role in the antiviral activity of guanine derivatives such as aciclovir (ACV). In contrast, ACV shows only low affinity to the corresponding host cell enzyme. In order to define the differences in substrate binding of the two enzymes on molecular level, models for the three-dimensional (3-D) structures of the active sites of HSV1-TK and human TK were developed. The reconstruction of the active sites started from primary and secondary structure analysis of various kinases. The results were validated to homologous enzymes with known 3-D structures. The models predict that both enzymes consist of a central core β-sheet structure, connected by loops and α-helices very similar to the overall structure of other nucleotide binding enzymes. The phosphate binding is made up of a highly conserved glycine-rich loop at the N-terminus of the proteins and a conserved region at the C-terminus. The thymidine recognition site was found about 100 amino acids downstream from the phosphate binding loop. The differing substrate specificity of human and HSV1-TK can be explained by amino-acid substitutions in the homologous regions. To achieve a better understanding of the structure of the active site and how the thymidine kinase proteins interact with their substrates, the corresponding complexes of thymidine and dihydroxypropoxyguanine (DHPG) with HSV1 and human TK were built. For the docking of the guanine derivative, the X-ray structure of Elongation Factor Tu (EF-Tu), co-crystallized with guanosine diphosphate, was taken as reference. Fitting of thymidine into the active sites was done with respect to similar interactions found in thymidylate kinase. To complement the analysis of the 3-D structures of the two kinases and the substrate enzyme interactions, site-directed mutagenesis of the thymidine recognition site of HSV1-TK has been undertaken, changing Asp162 in the thymidine recognition site into Asn. First investigations reveal that the enzymatic activity of the mutant protein is destroyed.
Hsiao, Yu-Yun; Jeng, Mei-Fen; Tsai, Wen-Chieh; Chuang, Yu-Chen; Li, Chia-Ying; Wu, Tian-Shung; Kuoh, Chang-Sheng; Chen, Wen-Huei; Chen, Hong-Hwa
2008-09-01
Geranyl diphosphate (GDP) is the precursor of monoterpenes, which are the major floral scent compounds in Phalaenopsis bellina. The cDNA of P. bellina GDP synthase (PbGDPS) was cloned, and its sequence corresponds to the second Asp-rich motif (SARM), but not to any aspartate-rich (Asp-rich) motif. The recombinant PbGDPS enzyme exhibits dual prenyltransferase activity, producing both GDP and farnesyl diphosphate (FDP), and a yeast two-hybrid assay and gel filtration revealed that PbGDPS was able to form a homodimer. Spatial and temporal expression analyses showed that the expression of PbGDPS was flower specific, and that maximal PbGDPS expression was concomitant with maximal emission of monoterpenes on day 5 post-anthesis. Homology modelling of PbGDPS indicated that the Glu-rich motif might provide a binding site for Mg(2+) and catalyze the formation of prenyl products in a similar way to SARM. Replacement of the key Glu residues with alanine totally abolished enzyme activity, whereas their mutation to Asp resulted in a mutant with two-thirds of the activity of the wild-type protein. Phylogenetic analysis indicated that plant GDPS proteins formed four clades: members of both GDPS-a and GDPS-b clades contain Asp-rich motifs, and function as homodimers. In contrast, proteins in the GDPS-c and GDPS-d clades do not contain Asp-rich motifs, but although members of the GDPS-c clade function as heterodimers, PbGDPS, which is more closely related to the GDPS-c clade proteins than to GDPS-a and GDPS-b proteins, and is currently the sole member of the GDPS-d clade, functions as a homodimer.
Interaction of a radiolabeled agonist with cardiac muscarinic cholinergic receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harden, T.K.; Meeker, R.B.; Martin, M.W.
The interaction of a radiolabeled muscarinic cholinergic receptor agonist, (methyl-/sup 3/H)oxotremorine acetate ((/sup 3/H)OXO), with a washed membrane preparation derived from rat heart, has been studied. In binding assays at 4 degrees C, the rate constants for association and dissociation of (/sup 3/H)OXO were 2 X 10(7) M-1 min-1 and 5 X 10(-3) min-1, respectively, Saturation binding isotherms indicated that binding was to a single population of sites with a Kd of approximately 300 pM. The density of (/sup 3/H)OXO binding sites (90-100 fmol/mg of protein) was approximately 75% of that determined for the radiolabeled receptor antagonist (/sup 3/H)quinuclidinyl benzilate.more » Both muscarinic receptor agonists and antagonists inhibited the binding of (/sup 3/H)OXO with high affinity and Hill slopes of approximately one. Guanine nucleotides completely inhibited the binding of (/sup 3/H)OXO. This effect was on the maximum binding (Bmax) of (/sup 3/H)OXO with no change occurring in the Kd; the order of potency for five nucleotides was guanosine 5'-O-(3-thio-triphosphate) greater than 5'-guanylylimidodiphosphate greater than GTP greater than or equal to guanosine/diphosphate greater than GMP. The (/sup 3/H)OXO-induced interaction of muscarinic receptors with a guanine nucleotide binding protein was stable to solubilization. That is, membrane receptors that were prelabeled with (/sup 3/H)OXO could be solubilized with digitonin, and the addition of guanine nucleotides to the soluble, (/sup 3/H)OXO-labeled complex resulted in dissociation of (/sup 3/H)OXO from the receptor. Pretreatment of membranes with relatively low concentrations of N-ethylmaleimide inhibited (/sup 3/H)OXO binding by 85% with no change in the Kd of (/sup 3/H)OXO, and with no effect on (/sup 3/H)quinuclidinyl benzilate binding.« less
Unusual features of a recombinant apple alpha-farnesene synthase.
Green, Sol; Friel, Ellen N; Matich, Adam; Beuning, Lesley L; Cooney, Janine M; Rowan, Daryl D; MacRae, Elspeth
2007-01-01
A recombinant alpha-farnesene synthase from apple (Malus x domestica), expressed in Escherichia coli, showed features not previously reported. Activity was enhanced 5-fold by K(+) and all four isomers of alpha-farnesene, as well as beta-farnesene, were produced from an isomeric mixture of farnesyl diphosphate (FDP). Monoterpenes, linalool, (Z)- and (E)-beta-ocimene and beta-myrcene, were synthesised from geranyl diphosphate (GDP), but at 18% of the optimised rate for alpha-farnesene synthesis from FDP. Addition of K(+) reduced monoterpene synthase activity. The enzyme also produced alpha-farnesene by a reaction involving coupling of GDP and isoprenyl diphosphate but at <1% of the rate with FDP. Mutagenesis of active site aspartate residues removed sesquiterpene, monoterpene and prenyltransferase activities suggesting catalysis through the same active site. Phylogenetic analysis clusters this enzyme with isoprene synthases rather than with other sesquiterpene synthases, suggesting that it has evolved differently from other plant sesquiterpene synthases. This is the first demonstration of a sesquiterpene synthase possessing prenyltransferase activity.
Surfactants reduce platelet-bubble and platelet-platelet binding induced by in vitro air embolism.
Eckmann, David M; Armstead, Stephen C; Mardini, Feras
2005-12-01
The effect of gas bubbles on platelet behavior is poorly characterized. The authors assessed platelet-bubble and platelet-platelet binding in platelet-rich plasma in the presence and absence of bubbles and three surface-active compounds. Platelet-rich plasma was prepared from blood drawn from 16 volunteers. Experimental groups were surfactant alone, sparging (microbubble embolization) alone, sparging with surfactant, and neither sparging nor surfactant. The surfactants were Pluronic F-127 (Molecular Probes, Eugene, OR), Perftoran (OJSC SPC Perftoran, Moscow, Russia), and Dow Corning Antifoam 1510US (Dow Corning, Midland, MI). Videomicroscopy images of specimens drawn through rectangular glass microcapillaries on an inverted microscope and Coulter counter measurements were used to assess platelet-bubble and platelet-platelet binding, respectively, in calcium-free and recalcified samples. Histamine-induced and adenosine diphosphate-induced platelet-platelet binding were measured in unsparged samples. Differences between groups were considered significant for P < 0.05 using analysis of variance and the Bonferroni correction. Sixty to 100 platelets adhered to bubbles in sparged, surfactant-free samples. With sparging and surfactant, few platelets adhered to bubbles. Numbers of platelet singlets and multimers not adherent to bubbles were different (P < 0.05) compared both with unsparged samples and sparged samples without surfactant. No significant platelet-platelet binding occurred in uncalcified, sparged samples, although 20-30 platelets adhered to bubbles. Without sparging, histamine and adenosine diphosphate provoked platelet-platelet binding with and without surfactants present. Sparging causes platelets to bind to air bubbles and each other. Surfactants added before sparging attenuate platelet-bubble and platelet-platelet binding. Surfactants may have a clinical role in attenuating gas embolism-induced platelet-bubble and platelet-platelet binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nemeria, Natalia S; Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy
2010-11-03
Kinetic, spectroscopic, and structural analysis tested the hypothesis that a chain of residues connecting the 4{prime}-aminopyrimidine N1{prime} atoms of thiamin diphosphates (ThDPs) in the two active centers of the Escherichia coli pyruvate dehydrogenase complex E1 component provides a signal transduction pathway. Substitution of the three acidic residues (Glu{sup 571}, Glu{sup 235}, and Glu{sup 237}) and Arg{sup 606} resulted in impaired binding of the second ThDP, once the first active center was filled, suggesting a pathway for communication between the two ThDPs. (1) Steady-state kinetic and fluorescence quenching studies revealed that upon E571A, E235A, E237A, and R606A substitutions, ThDP binding inmore » the second active center was affected. (2) Analysis of the kinetics of thiazolium C2 hydrogen/deuterium exchange of enzyme-bound ThDP suggests half-of-the-sites reactivity for the E1 component, with fast (activated site) and slow exchanging sites (dormant site). The E235A and E571A variants gave no evidence for the slow exchanging site, indicating that only one of two active sites is filled with ThDP. (3) Titration of the E235A and E237A variants with methyl acetylphosphonate monitored by circular dichroism suggested that only half of the active sites were filled with a covalent predecarboxylation intermediate analog. (4) Crystal structures of E235A and E571A in complex with ThDP revealed the structural basis for the spectroscopic and kinetic observations and showed that either substitution affects cofactor binding, despite the fact that Glu{sup 235} makes no direct contact with the cofactor. The role of the conserved Glu{sup 571} residue in both catalysis and cofactor orientation is revealed by the combined results for the first time.« less
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Zerenturk, Eser J; Sharpe, Laura J; Brown, Andrew J
2012-10-01
3β-Hydroxysterol Δ24-reductase (DHCR24) catalyzes a final step in cholesterol synthesis, and has been ascribed diverse functions, such as being anti-apoptotic and anti-inflammatory. How this enzyme is regulated transcriptionally by sterols is currently unclear. Some studies have suggested that its expression is regulated by Sterol Regulatory Element Binding Proteins (SREBPs) while another suggests it is through the Liver X Receptor (LXR). However, these transcription factors have opposing effects on cellular sterol levels, so it is likely that one predominates. Here we establish that sterol regulation of DHCR24 occurs predominantly through SREBP-2, and identify the particular region of the DHCR24 promoter to which SREBP-2 binds. We demonstrate that sterol regulation is mediated by two sterol regulatory elements (SREs) in the promoter of the gene, assisted by two nearby NF-Y binding sites. Moreover, we present evidence that the dual SREs work cooperatively to regulate DHCR24 expression by comparison to two known SREBP target genes, the LDL receptor with one SRE, and farnesyl-diphosphate farnesyltransferase 1, with two SREs. Copyright © 2012 Elsevier B.V. All rights reserved.
Using optical tweezers to relate the chemical and mechanical cross-bridge cycles.
Steffen, Walter; Sleep, John
2004-12-29
In most current models of muscle contraction there are two translational steps, the working stroke, whereby an attached myosin cross-bridge moves relative to the actin filament, and the repriming step, in which the cross-bridge returns to its original orientation. The development of single molecule methods has allowed a more detailed investigation of the relationship of these mechanical steps to the underlying biochemistry. In the normal adenosine triphosphate cycle, myosin.adenosine diphosphate.phosphate (M.ADP.Pi) binds to actin and moves it by ca. 5 nm on average before the formation of the end product, the rigor actomyosin state. All the other product-like intermediate states tested were found to give no net movement indicating that M.ADP.Pi alone binds in a pre-force state. Myosin states with bound, unhydrolysed nucleoside triphosphates also give no net movement, indicating that these must also bind in a post-force conformation and that the repriming, post- to pre-transition during the forward cycle must take place while the myosin is dissociated from actin. These observations fit in well with the structural model in which the working stroke is aligned to the opening of the switch 2 element of the ATPase site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmad, Md. Faiz; Kaushal, Prem Singh; Wan, Qun
2012-11-01
Ribonucleotide reductases (RRs) catalyze the rate-limiting step of de novo deoxynucleotide (dNTP) synthesis. Eukaryotic RRs consist of two proteins, RR1 ({alpha}) that contains the catalytic site and RR2 ({beta}) that houses a diferric-tyrosyl radical essential for ribonucleoside diphosphate reduction. Biochemical analysis has been combined with isothermal titration calorimetry (ITC), X-ray crystallography and yeast genetics to elucidate the roles of two loop 2 mutations R293A and Q288A in Saccharomyces cerevisiae RR1 (ScRR1). These mutations, R293A and Q288A, cause lethality and severe S phase defects, respectively, in cells that use ScRR1 as the sole source of RR1 activity. Compared to the wild-typemore » enzyme activity, R293A and Q288A mutants show 4% and 15%, respectively, for ADP reduction, whereas they are 20% and 23%, respectively, for CDP reduction. ITC data showed that R293A ScRR1 is unable to bind ADP and binds CDP with 2-fold lower affinity compared to wild-type ScRR1. With the Q288A ScRR1 mutant, there is a 6-fold loss of affinity for ADP binding and a 2-fold loss of affinity for CDP compared to the wild type. X-ray structures of R293A ScRR1 complexed with dGTP and AMPPNP-CDP [AMPPNP, adenosine 5-({beta},{gamma}-imido)triphosphate tetralithium salt] reveal that ADP is not bound at the catalytic site, and CDP binds farther from the catalytic site compared to wild type. Our in vivo functional analyses demonstrated that R293A cannot support mitotic growth, whereas Q288A can, albeit with a severe S phase defect. Taken together, our structure, activity, ITC and in vivo data reveal that the arginine 293 and glutamine 288 residues of ScRR1 are crucial in facilitating ADP and CDP substrate selection.« less
Truan, Daphné; Bjelić, Saša; Li, Xiao-Dan; Winkler, Fritz K
2014-07-29
The trimeric PII signal transduction proteins regulate the function of a variety of target proteins predominantly involved in nitrogen metabolism. ATP, ADP and 2-oxoglutarate (2-OG) are key effector molecules influencing PII binding to targets. Studies of PII proteins have established that the 20-residue T-loop plays a central role in effector sensing and target binding. However, the specific effects of effector binding on T-loop conformation have remained poorly documented. We present eight crystal structures of the Azospirillum brasilense PII protein GlnZ, six of which are cocrystallized and liganded with ADP or ATP. We find that interaction with the diphosphate moiety of bound ADP constrains the N-terminal part of the T-loop in a characteristic way that is maintained in ADP-promoted complexes with target proteins. In contrast, the interactions with the triphosphate moiety in ATP complexes are much more variable and no single predominant interaction mode is apparent except for the ternary MgATP/2-OG complex. These conclusions can be extended to most investigated PII proteins of the GlnB/GlnK subfamily. Unlike reported for other PII proteins, microcalorimetry reveals no cooperativity between the three binding sites of GlnZ trimers for any of the three effectors under carefully controlled experimental conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kato, Masato; Wynn, R. Max; Chuang, Jacinta L.
2009-09-11
We report the crystal structures of the phosporylated pyruvate dehydrogenase (E1p) component of the human pyruvate dehydrogenase complex (PDC). The complete phosphorylation at Ser264-{alpha} (site 1) of a variant E1p protein was achieved using robust pyruvate dehydrogenase kinase 4 free of the PDC core. We show that unlike its unmodified counterpart, the presence of a phosphoryl group at Ser264-{alpha} prevents the cofactor thiamine diphosphate-induced ordering of the two loops carrying the three phosphorylation sites. The disordering of these phosphorylation loops is caused by a previously unrecognized steric clash between the phosphoryl group at site 1 and a nearby Ser266-{alpha}, whichmore » nullifies a hydrogen-bonding network essential for maintaining the loop conformations. The disordered phosphorylation loops impede the binding of lipoyl domains of the PDC core to E1p, negating the reductive acetylation step. This results in the disruption of the substrate channeling in the PDC, leading to the inactivation of this catalytic machine.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liang, B.T.
1989-06-01
Adenosine receptors in a spontaneously contracting atrial myocyte culture from 14-day chick embryos were characterized by radioligand binding studies and by examining the involvement of G-protein in coupling these receptors to a high-affinity state and to the adenylate cyclase and the myocyte contractility. Binding of the antagonist radioligand (3H)-8-cyclopentyl-1,3-diproylxanthine ((3H)CPX) was rapid, reversible and saturable and was to a homogeneous population of sites with a Kd value of 2.1 +/- 0.2 nM and an apparent maximum binding of 26.2 +/- 3 fmol/mg of protein (n = 10, +/- S.E.). Guanyl-5-yl-(beta, gamma-imido)diphosphate had no effect on either the Kd or themore » maximum binding and CPX reversed the N6-R-phenyl-2-propyladenosine-induced inhibition of adenylate cyclase activity and contractility, indicating that (3H) CPX is an antagonist radioligand. Competition curves for (3H) CPX binding by a series of reference adenosine agonists were consistent with labeling of an A1 adenosine receptor and were better fit by a two-site model than by a one-site model. ADP-ribosylation of the G-protein by the endogenous NAD+ in the presence of pertussis toxin shifted the competition curves from bi to monophasic with Ki values similar to those of the KL observed in the absence of prior pertussis intoxication. The adenosine agonists were capable of inhibiting both the adenylate cyclase activity and myocyte contractility in either the absence or the presence of isoproterenol. The A1 adenosine receptor-selective antagonist CPX reversed these agonist effects. The order of ability of the reference adenosine receptor agonists in causing these inhibitory effects was similar to the order of potency of the same agonists in inhibiting the specific (3H)CPX binding (N6-R-phenyl-2-propyladenosine greater than N6-S-phenyl-2-propyladenosine or N-ethyladenosine-5'-uronic acid).« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Modolo, Luzia V.; Li, Lenong; Pan, Haiyun
The glycosyltransferase UGT78G1 from Medicago truncatula catalyzes the glycosylation of various (iso)flavonoids such as the flavonols kaempferol and myricetin, the isoflavone formononetin, and the anthocyanidins pelargonidin and cyanidin. It also catalyzes a reverse reaction to remove the sugar moiety from glycosides. The structures of UGT78G1 bound with uridine diphosphate or with both uridine diphosphate and myricetin were determined at 2.1 {angstrom} resolution, revealing detailed interactions between the enzyme and substrates/products and suggesting a distinct binding mode for the acceptor/product. Comparative structural analysis and mutagenesis identify glutamate 192 as a key amino acid for the reverse reaction. This information provides amore » basis for enzyme engineering to manipulate substrate specificity and to design effective biocatalysts with glycosylation and/or deglycosylation activity.« less
Grabińska, Kariona A; Edani, Ban H; Park, Eon Joo; Kraehling, Jan R; Sessa, William C
2017-10-20
cis -Prenyltransferases ( cis -PTs) constitute a large family of enzymes conserved during evolution and present in all domains of life. In eukaryotes and archaea, cis -PT is the first enzyme committed to the synthesis of dolichyl phosphate, an obligate lipid carrier in protein glycosylation reactions. The homodimeric bacterial enzyme, undecaprenyl diphosphate synthase, generates 11 isoprene units and has been structurally and mechanistically characterized in great detail. Recently, we discovered that unlike undecaprenyl diphosphate synthase, mammalian cis -PT is a heteromer consisting of NgBR (Nus1) and hCIT (dehydrodolichol diphosphate synthase) subunits, and this composition has been confirmed in plants and fungal cis -PTs. Here, we establish the first purification system for heteromeric cis -PT and show that both NgBR and hCIT subunits function in catalysis and substrate binding. Finally, we identified a critical R X G sequence in the C-terminal tail of NgBR that is conserved and essential for enzyme activity across phyla. In summary, our findings show that eukaryotic cis -PT is composed of the NgBR and hCIT subunits. The strong conservation of the R X G motif among NgBR orthologs indicates that this subunit is critical for the synthesis of polyprenol diphosphates and cellular function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Jakubík, J; Janíčková, H; El-Fakahany, EE; Doležal, V
2011-01-01
BACKGROUND AND PURPOSE Conventional determination of agonist efficacy at G-protein coupled receptors is measured by stimulation of guanosine-5′-γ−thiotriphosphate (GTPγS) binding. We analysed the role of guanosine diphosphate (GDP) in the process of activation of the M2 muscarinic acetylcholine receptor and provide evidence that negative cooperativity between agonist and GDP binding is an alternative measure of agonist efficacy. EXPERIMENTAL APPROACH Filtration and scintillation proximity assays measured equilibrium binding as well as binding kinetics of [35S]GTPγS and [3H]GDP to a mixture of G-proteins as well as individual classes of G-proteins upon binding of structurally different agonists to the M2 muscarinic acetylcholine receptor. KEY RESULTS Agonists displayed biphasic competition curves with the antagonist [3H]-N-methylscopolamine. GTPγS (1 µM) changed the competition curves to monophasic with low affinity and 50 µM GDP produced a similar effect. Depletion of membrane-bound GDP increased the proportion of agonist high-affinity sites. Carbachol accelerated the dissociation of [3H]GDP from membranes. The inverse agonist N-methylscopolamine slowed GDP dissociation and GTPγS binding without changing affinity for GDP. Carbachol affected both GDP association with and dissociation from Gi/o G-proteins but only its dissociation from Gs/olf G-proteins. CONCLUSIONS AND IMPLICATIONS These findings suggest the existence of a low-affinity agonist-receptor conformation complexed with GDP-liganded G-protein. Also the negative cooperativity between GDP and agonist binding at the receptor/G-protein complex determines agonist efficacy. GDP binding reveals differences in action of agonists versus inverse agonists as well as differences in activation of Gi/o versus Gs/olf G-proteins that are not identified by conventional GTPγS binding. PMID:20958290
Jakubík, J; Janíčková, H; El-Fakahany, E E; Doležal, V
2011-03-01
Conventional determination of agonist efficacy at G-protein coupled receptors is measured by stimulation of guanosine-5'-γ-thiotriphosphate (GTPγS) binding. We analysed the role of guanosine diphosphate (GDP) in the process of activation of the M₂ muscarinic acetylcholine receptor and provide evidence that negative cooperativity between agonist and GDP binding is an alternative measure of agonist efficacy. Filtration and scintillation proximity assays measured equilibrium binding as well as binding kinetics of [³⁵S]GTPγS and [³H]GDP to a mixture of G-proteins as well as individual classes of G-proteins upon binding of structurally different agonists to the M₂ muscarinic acetylcholine receptor. Agonists displayed biphasic competition curves with the antagonist [³H]-N-methylscopolamine. GTPγS (1 µM) changed the competition curves to monophasic with low affinity and 50 µM GDP produced a similar effect. Depletion of membrane-bound GDP increased the proportion of agonist high-affinity sites. Carbachol accelerated the dissociation of [³H]GDP from membranes. The inverse agonist N-methylscopolamine slowed GDP dissociation and GTPγS binding without changing affinity for GDP. Carbachol affected both GDP association with and dissociation from G(i/o) G-proteins but only its dissociation from G(s/olf) G-proteins. These findings suggest the existence of a low-affinity agonist-receptor conformation complexed with GDP-liganded G-protein. Also the negative cooperativity between GDP and agonist binding at the receptor/G-protein complex determines agonist efficacy. GDP binding reveals differences in action of agonists versus inverse agonists as well as differences in activation of G(i/o) versus G(s/olf) G-proteins that are not identified by conventional GTPγS binding. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.
Chang, Chih-Kang; Teng, Kuo-Hsun; Lin, Sheng-Wei; Chang, Tao-Hsin; Liang, Po-Huang
2013-04-23
Previously we showed that yeast geranylgeranyl diphosphate synthase (GGPPS) becomes an inactive monomer when the first N-terminal helix involved in dimerization is deleted. This raises questions regarding why dimerization is required for GGPPS activity and which amino acids in the dimer interface are essential for dimerization-mediated activity. According to the GGPPS crystal structure, three amino acids (N101, N104, and Y105) located in the helix F of one subunit are near the active site of the other subunit. As presented here, when these residues were replaced individually with Ala caused insignificant activity changes, N101A/Y105A and N101A/N104A but not N104A/Y105A showed remarkably decreased k(cat) values (200-250-fold). The triple mutant N101A/N104A/Y105A displayed no detectable activity, although dimer was retained in these mutants. Because N101 and Y105 form H-bonds with H139 and R140 in the other subunit, respectively, we generated H139A/R140A double mutant and found it was inactive and became monomeric. Therefore, the multiple mutations apparently influence the integrity of the catalytic site due to the missing H-bonding network. Moreover, Met111, also on the highly conserved helix F, was necessary for dimer formation and enzyme activity. When Met111 was replaced with Glu, the negative-charged repulsion converted half of the dimer into a monomer. In conclusion, the H-bonds mainly through N101 for maintaining substrate binding stability and the hydrophobic interaction of M111 in dimer interface are essential for activity of yeast GGPPS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, P.M.; Verma, A.; Bredt, D.S.
1990-10-01
To assess the role of phosphatidylinositol turnover in taste transduction we have visualized, in rat tongue, ATP-dependent endoplasmic reticular accumulation of {sup 45}Ca{sup 2+}, inositol 1,4,5-trisphosphate receptor binding sites, and phosphatidylinositol turnover monitored by autoradiography of ({sup 3}H)cytidine diphosphate diacylglycerol formed from ({sup 3}H)cytidine. Accumulated {sup 45}Ca{sup 2+}, inositol 1,4,5-trisphosphate receptors, and phosphatidylinositol turnover are selectively localized to apical areas of the taste buds of circumvallate papillae, which are associated with bitter taste. Further evidence for a role of phosphatidylinositol turnover in bitter taste is our observation of a rapid, selective increase in mass levels of inositol 1,4,5-trisphosphate elicited bymore » low concentrations of denatonium, a potently bitter tastant.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Begley, Darren W.; Hartley, Robert C.; Davies, Douglas R.
As part of the Seattle Structural Genomics Center for Infectious Disease, we seek to enhance structural genomics with ligand-bound structure data which can serve as a blueprint for structure-based drug design. We have adapted fragment-based screening methods to our structural genomics pipeline to generate multiple ligand-bound structures of high priority drug targets from pathogenic organisms. In this study, we report fragment screening methods and structure determination results for 2C-methyl-D-erythritol-2,4-cyclo-diphosphate (MECP) synthase from Burkholderia pseudomallei, the gram-negative bacterium which causes melioidosis. Screening by nuclear magnetic resonance spectroscopy as well as crystal soaking followed by X-ray diffraction led to the identification ofmore » several small molecules which bind this enzyme in a critical metabolic pathway. A series of complex structures obtained with screening hits reveal distinct binding pockets and a range of small molecules which form complexes with the target. Additional soaks with these compounds further demonstrate a subset of fragments to only bind the protein when present in specific combinations. This ensemble of fragment-bound complexes illuminates several characteristics of MECP synthase, including a previously unknown binding surface external to the catalytic active site. These ligand-bound structures now serve to guide medicinal chemists and structural biologists in rational design of novel inhibitors for this enzyme.« less
Structures of Trypanosome Vacuolar Soluble Pyrophosphatases: Anti-Parasitic Drug Targets
Yang, Yunyun; Ko, Tzu-Ping; Chen, Chun-Chi; Huang, Guozhong; Zheng, Yingying; Liu, Weidong; Wang, Iren; Ho, Meng-Ru; Danny Hsu, Shang-Te; O’Dowd, Bing; Huff, Hannah C.; Huang, Chun-Hsiang; Docampo, Roberto; Oldfield, Eric; Guo, Rey-Ting
2016-01-01
Trypanosomatid parasites are the causative agents of many neglected tropical diseases including the leishmaniases, Chagas disease, and human African trypanosomiasis. They exploit unusual vacuolar soluble pyrophosphatases (VSPs), absent in humans, for cell growth and virulence and as such, are drug targets. Here, we report the crystal structures of VSP1s from Trypanosoma cruzi and T. brucei, together with that of the T. cruzi protein bound to a bisphosphonate inhibitor. Both VSP1s form a hybrid structure containing an (N-terminal) EF-hand domain fused to a (C-terminal) pyrophosphatase domain. The two domains are connected via an extended loop of about 17 residues. Crystallographic analysis and size exclusion chromatography indicate that the VSP1s form tetramers containing head-to-tail dimers. Phosphate and diphosphate ligands bind in the PPase substrate-binding pocket and interact with several conserved residues, and a bisphosphonate inhibitor (BPH-1260) binds to the same site. Based on Cytoscape and other bioinformatics analyses it is apparent that similar folds will be found in most if not all trypanosomatid VSP1s, including those found in insects (Angomonas deanei, Strigomonas culicis), plant pathogens (Phytomonas spp.) and Leishmania spp. Overall, the results are of general interest since they open the way to structure-based drug design for many of the neglected tropical diseases. PMID:26907161
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meyers, K.M.; Boehme, M.; Inbar, O.
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8more » endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.« less
Aloise, P; Kagawa, Y; Coleman, P S
1991-06-05
Three F1 preparations, the beef heart (MF1) and thermophilic bacterium (TF1) holoenzymes, and the alpha 3 beta 3 "core" complex of TF1 reconstituted from individually expressed alpha and beta subunits, were compared as to their kinetic and binding stoichiometric responses to covalent photoaffinity labeling with BzATP and BzADP (+/- Mg2+). Each enzyme displayed an enhanced pseudo-first order rate of photoinhibition and one-third of the sites covalent binding to a catalytic site for full inhibition, plus, but not minus Mg2+. Titration of near stoichiometric [MgBzADP]/[F1] ratios during photolysis disclosed two sequential covalent binding patterns for each enzyme; a high affinity binding corresponding to unistoichiometric covalent association concomitant with enzyme inhibition, followed by a low affinity multisite-saturating covalent association. Thus, in the absence of the structural asymmetry inducing gamma delta epsilon subunits of the holoenzyme, the sequential binding of nucleotide at putative catalytic sites on the alpha 3 beta 3 complex of any F1 appears sufficient to effect binding affinity changes. With MF1, final covalent saturation of BzADP-accessible sites was achieved with 2 mol of BzADP/mol of enzyme, but with TF1 or its alpha 3 beta 3 complex, saturation required 3 mol of BzADP/mol of enzyme. Such differential final labeling stoichiometries could arise because of the endogenous presence of 1 nucleotide already bound to one of the 3 potential catalytic sites on normally prepared MF1, whereas TF1, possessing no endogenous nucleotide, has 3 vacant BzADP-accessible sites. Kinetics measurements revealed that regardless of the incremental extent of inhibition of the TF1 holoenzyme by BzADP during photolysis, the two higher apparent Km values (approximately 1.5 x 10(-4) and approximately 10(-3) M, respectively) of the progressively inactivated incubation are unchanged relative to fully unmodified enzyme. As reported for BzATP (or BzADP) and MF1 (Ackerman, S.H., Grubmeyer, C., and Coleman, P.S. (1987) J. Biol. Chem. 262, 13765-13772), this supports the fact that the photocovalent inhibition of F1 is a one-hit one-kill phenomenon. Isoelectric focusing gels revealed that [3H]BzADP covalently modifies both TF1 and MF1 exclusively on the beta subunit, whether or not Mg2+ is present. A single 19-residue [3H]BzADP-labeled peptide was resolved from a tryptic digest of MF1, and this peptide corresponded with the one believed to contain at least a portion of the beta subunit catalytic site domain (i.e. beta Ala-338----beta Arg-356).
Ebselen Reversibly Inhibits Human Glutamate Dehydrogenase at the Catalytic Site.
Jin, Yanhong; Li, Di; Lu, Shiying; Zhao, Han; Chen, Zhao; Hou, Wei; Ruan, Benfang Helen
Human glutamate dehydrogenase (GDH) plays an important role in neurological diseases, tumor metabolism, and hyperinsulinism-hyperammonemia syndrome (HHS). However, there are very few inhibitors known for human GDH. Recently, Ebselen was reported to crosslink with Escherichia coli GDH at the active site cysteine residue (Cys321), but the sequence alignment showed that the corresponding residue is Ala329 in human GDH. To investigate whether Ebselen could be an inhibitor for human GDH, we cloned and expressed an N-terminal His-tagged human GDH in E. coli. The recombinant human GDH enzyme showed expected properties such as adenosine diphosphate activation and nicotinamide adenine dinucleotide/nicotinamide adenine dinucleotide phosphate dual recognition. Further, we developed a 2-(3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-tetrazol-3-ium-5-yl) benzenesulfonate sodium salt (EZMTT)-based assay for human GDH, which was highly sensitive and is suitable for high-throughput screening for potent GDH inhibitors. In addition, ForteBio binding assays demonstrated that Ebselen is a reversible active site inhibitor for human GDH. Since Ebselen is a multifunctional organoselenium compound in Phase III clinical trials for inflammation, an Ebselen-based GDH inhibitor might be valuable for future drug discovery for HHS patients.
Activation of G-proteins by receptor-stimulated nucleoside diphosphate kinase in Dictyostelium.
Bominaar, A A; Molijn, A C; Pestel, M; Veron, M; Van Haastert, P J
1993-01-01
Recently, interest in the enzyme nucleoside diphosphate kinase (EC2.7.4.6) has increased as a result of its possible involvement in cell proliferation and development. Since NDP kinase is one of the major sources of GTP in cells, it has been suggested that the effects of an altered NDP kinase activity on cellular processes might be the result of altered transmembrane signal transduction via guanine nucleotide-binding proteins (G-proteins). In the cellular slime mould Dictyostelium discoideum, extracellular cAMP induces an increase of phospholipase C activity via a surface cAMP receptor and G-proteins. In this paper it is demonstrated that part of the cellular NDP kinase is associated with the membrane and stimulated by cell surface cAMP receptors. The GTP produced by the action of NDP kinase is capable of activating G-proteins as monitored by altered G-protein-receptor interaction and the activation of the effector enzyme phospholipase C. Furthermore, specific monoclonal antibodies inhibit the effect of NDP kinase on G-protein activation. These results suggest that receptor-stimulated NDP kinase contributes to the mediation of hormone action by producing GTP for the activation of GTP-binding proteins. Images PMID:8389692
NASA Astrophysics Data System (ADS)
Schwiebert, Erik M.; Kizer, Neil; Gruenert, Dieter C.; Stanton, Bruce A.
1992-11-01
Cystic fibrosis (CF) is a genetic disease characterized, in part, by defective regulation of Cl^- secretion by airway epithelial cells. In CF, cAMP does not activate Cl^- channels in the apical membrane of airway epithelial cells. We report here whole-cell patch-clamp studies demonstrating that pertussis toxin, which uncouples heterotrimeric GTP-binding proteins (G proteins) from their receptors, and guanosine 5'-[β-thio]diphosphate, which prevents G proteins from interacting with their effectors, increase Cl^- currents and restore cAMP-activated Cl^- currents in airway epithelial cells isolated from CF patients. In contrast, the G protein activators guanosine 5'-[γ-thio]triphosphate and AlF^-_4 reduce Cl^- currents and inhibit cAMP from activating Cl^- currents in normal airway epithelial cells. In CF cells treated with pertussis toxin or guanosine 5'-[β-thio]diphosphate and in normal cells, cAMP activates a Cl^- conductance that has properties similar to CF transmembrane-conductance regulator Cl^- channels. We conclude that heterotrimeric G proteins inhibit cAMP-activated Cl^- currents in airway epithelial cells and that modulation of the inhibitory G protein signaling pathway may have the therapeutic potential for improving cAMP-activated Cl^- secretion in CF.
A novel prenyltransferase from Paracoccus denitrificans.
Ishii, K; Sagami, H; Ogura, K
1986-01-01
A new polyprenyltransferase catalysing the formation of Z-double bonds was found and partially purified from extracts of Paracoccus denitrificans. The enzyme catalysed a consecutive condensation of isopentenyl diphosphate with EE-farnesyl diphosphate as a primer to produce EE-farnesyl-all-Z-hexaprenyl diphosphate (ZE-mixed nonaprenyl diphosphate) as the final product. Not only EE-farnesyl diphosphate but also neryl diphosphate, ZE-farnesyl diphosphate, ZEE-geranylgeranyl diphosphate and ZZEE-pentaprenyl diphosphate were all accepted as substrates. This polyprenyltransferase required detergent such as Triton X-100 for its catalytic activity. The formation of ZE-mixed undecaprenyl diphosphate, which is well known as the precursor of the bacterial sugar-carrier lipid, was not detected in extracts of this bacterium. PMID:3707524
Soni, Vijay; Suryadevara, Priyanka; Sriram, Dharmarajan; Kumar, Santhosh; Nandicoori, Vinay Kumar; Yogeeswari, Perumal
2015-07-01
Persistent nature of Mycobacterium tuberculosis is one of the major factors which make the drug development process monotonous against this organism. The highly lipophilic cell wall, which constituting outer mycolic acid and inner peptidoglycan layers, acts as a barrier for the drugs to enter the bacteria. The rigidity of the cell wall is imparted by the peptidoglycan layer, which is covalently linked to mycolic acid by arabinogalactan. Uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc) serves as the starting material in the biosynthesis of this peptidoglycan layers. This UDP-GlcNAc is synthesized by N-acetylglucosamine-1-phosphate uridyltransferase (GlmU(Mtb)), a bi-functional enzyme with two functional sites, acetyltransferase site and uridyltransferase site. Here, we report design and screening of nine inhibitors against UTP and NAcGlc-1-P of uridyltransferase active site of glmU(Mtb). Compound 4 was showing good inhibition and was selected for further analysis. The isothermal titration calorimetry (ITC) experiments showed the binding energy pattern of compound 4 to the uridyltransferase active site is similar to that of substrate UTP. In silico molecular dynamics (MD) simulation studies, for compound 4, carried out for 10 ns showed the protein-compound complex to be stable throughout the simulation with relative rmsd in acceptable range. Hence, these compounds can serve as a starting point in the drug discovery processes against Mycobacterium tuberculosis.
Sullivan, Sarah M; Holyoak, Todd
2007-09-04
The structures of the rat cytosolic isoform of phosphoenolpyruvate carboxykinase (PEPCK) reported in the PEPCK-Mn2+, -Mn2+-oxaloacetic acid (OAA), -Mn2+-OAA-Mn2+-guanosine-5'-diphosphate (GDP), and -Mn2+-Mn2+-guanosine-5'-tri-phosphate (GTP) complexes provide insight into the mechanism of phosphoryl transfer and decarboxylation mediated by this enzyme. OAA is observed to bind in a number of different orientations coordinating directly to the active site metal. The Mn2+-OAA and Mn2+-OAA-Mn2+GDP structures illustrate inner-sphere coordination of OAA to the manganese ion through the displacement of two of the three water molecules coordinated to the metal in the holo-enzyme by the C3 and C4 carbonyl oxygens. In the PEPCK-Mn2+-OAA complex, an alternate bound conformation of OAA is present. In this conformation, in addition to the previous interactions, the C1 carboxylate is directly coordinated to the active site Mn2+, displacing all of the waters coordinated to the metal in the holo-enzyme. In the PEPCK-Mn2+-GTP structure, the same water molecule displaced by the C1 carboxylate of OAA is displaced by one of the gamma-phosphate oxygens of the triphosphate nucleotide. The structures are consistent with a mechanism of direct in-line phosphoryl transfer, supported by the observed stereochemistry of the reaction. In the catalytically competent binding mode, the C1 carboxylate of OAA is sandwiched between R87 and R405 in an environment that would serve to facilitate decarboxylation. In the reverse reaction, these two arginines would form the CO2 binding site. Comparison of the Mn2+-OAA-Mn2+GDP and Mn2+-Mn2+GTP structures illustrates a marked difference in the bound conformations of the nucleotide substrates in which the GTP nucleotide is bound in a high-energy state resulting from the eclipsing of all three of the phosphoryl groups along the triphosphate chain. This contrasts a previously determined structure of PEPCK in complex with a triphosphate nucleotide analogue in which the analogue mirrors the conformation of GDP as opposed to GTP. Last, the structures illustrate a correlation between conformational changes in the P-loop, the nucleotide binding site, and the active site lid that are important for catalysis.
The Biosynthetic Origin of Irregular Monoterpenes in Lavandula
Demissie, Zerihun A.; Erland, Lauren A. E.; Rheault, Mark R.; Mahmoud, Soheil S.
2013-01-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s−1, respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering. PMID:23306202
Geranyl diphosphate synthase from mint
Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan
1999-01-01
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.
Geranyl diphosphate synthase from mint
Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.
1999-03-02
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.
Rancour, D M; Menon, A K
1998-01-01
Much of the enzymic machinery required for the assembly of cell surface carbohydrates is located in the endoplasmic reticulum (ER) of eukaryotic cells. Structural information on these proteins is limited and the identity of the active polypeptide(s) is generally unknown. This paper describes the synthesis and characteristics of a photoaffinity reagent that can be used to identify and analyse members of the ER glycan assembly apparatus, specifically those glycosyltransferases, nucleotide phosphatases and nucleotide-sugar transporters that recognize uridine nucleotides or UDP-sugars. The photoaffinity reagent, P3-(4-azidoanilido)uridine 5'-triphosphate (AAUTP), was synthesized easily from commercially available precursors. AAUTP inhibited the activity of ER glycosyltransferases that utilize UDP-GlcNAc and UDP-Glc, indicating that it is recognized by UDP-sugar-binding proteins. In preliminary tests AAUTP[alpha-32P] labelled bovine milk galactosyltransferase, a model UDP-sugar-utilizing enzyme, in a UV-light-dependent, competitive and saturable manner. When incubated with rat liver ER vesicles, AAUTP[alpha-32P] labelled a discrete subset of ER proteins; labelling was light-dependent and metal ion-specific. Photolabelling of intact ER vesicles with AAUTP[alpha-32P] caused selective incorporation of radioactivity into proteins with cytoplasmically disposed binding sites; UDP-Glc:glycoprotein glucosyltransferase, a lumenal protein, was labelled only when the vesicle membrane was disrupted. These data indicate that AAUTP is a membrane topological probe of catalytic sites in target proteins. Strategies for using AAUTP to identify and study novel ER proteins involved in glycan assembly are discussed. PMID:9677326
Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.
2009-01-01
We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473
Effect of diazepam and clonazepam on the function of isolated rat platelet and neutrophil.
Rajtar, Grazyna; Zółkowska, Dorota; Kleinrok, Zdzisław
2002-04-01
Benzodiazepine binding sites distinct from the GABA-receptor-chloride-complex in the central nervous system have been recognized in many peripheral tissues, but their physiological role remains unexplained. Our study was undertaken to examine the effects of diazepam, clonazepam, and PK 11195, a peripheral benzodiazepine receptor antagonist, on the functional and biochemical responses of platelets and neutrophils stimulated by different physiological agonists. The experiments were conducted on isolated washed rat platelets activated by arachidonic acid (AA), adenosine 5'-diphosphate (ADP), or thrombin and on isolated rat neutrophils activated by a chemotactic peptide, formyl methionyl leucyl phenylalanine (fMLP). The results showed that neither diazepam nor clonazepam nor PK 11195 alone augmented the response of resting platelets or modified neutrophil response, but diazepam and clonazepam in a concentration-dependent manner inhibited thrombin, ADP or AA-stimulated platelet aggregation and the thrombin-induced increase in free intracellular Ca2+. Both drugs also exerted an inhibitory effect on reactive oxygen species (ROS) produced by fMLP-stimulated neutrophils. However, diazepam was about 10 times more effective than clonazepam. PK11195 did not influence platelet and neutrophil function stimulated by agonists, but reversed the inhibitory action of both benzodiazepines on platelet activation and ROS production. The results indicated that in vitro diazepam, and in a much smaller degree clonazepam, may down-regulate platelet activation and release of some proinflammatory mediators by stimulated neutrophils. These effects are probably exerted by a specific benzodiazepine binding sites.
Ohto, C; Ishida, C; Nakane, H; Muramatsu, M; Nishino, T; Obata, S
1999-05-01
Prenyltransferases (prenyl diphosphate synthases), which are a broad group of enzymes that catalyze the consecutive condensation of homoallylic diphosphate of isopentenyl diphosphates (IPP, C5) with allylic diphosphates to synthesize prenyl diphosphates of various chain lengths, have highly conserved regions in their amino acid sequences. Based on the above information, three prenyltransferase homologue genes were cloned from a thermophilic cyanobacterium, Synechococcus elongatus. Through analyses of the reaction products of the enzymes encoded by these genes, it was revealed that one encodes a thermolabile geranylgeranyl (C20) diphosphate synthase, another encodes a farnesyl (C15) diphosphate synthase whose optimal reaction temperature is 60 degrees C, and the third one encodes a prenyltransferase whose optimal reaction temperature is 75 degrees C. The last enzyme could catalyze the synthesis of five prenyl diphosphates of farnesyl, geranylgeranyl, geranylfarnesyl (C25), hexaprenyl (C30), and heptaprenyl (C35) diphosphates from dimethylallyl (C5) diphosphate, geranyl (C10) diphosphate, or farnesyl diphosphate as the allylic substrates. The product specificity of this novel kind of enzyme varied according to the ratio of the allylic and homoallylic substrates. The situations of these three S. elongatus enzymes in a phylogenetic tree of prenyltransferases are discussed in comparison with a mesophilic cyanobacterium of Synechocystis PCC6803, whose complete genome has been reported by Kaneko et al. (1996).
Identification of a receptor for ADP on blood platelets by photoaffinity labelling.
Cristalli, G; Mills, D C
1993-01-01
The synthesis of a new analogue of ADP, 2-(p-azidophenyl)-ethythioadenosine 5'-diphosphate (AzPET-ADP), is described. This compound contains a photolabile phenylazide group attached to the ADP molecule by a thioether link at the purine 2 position. It has been prepared in radioactive form with 32P in the beta-phosphate at a specific radioactivity of 100 mCi/mumol. The reagent activated platelets, causing shape change and aggregation, with somewhat lower affinity than ADP. On photolysis the affinity was increased. The reagent also inhibited platelet adenylate cyclase stimulation by prostaglandin E1, with considerably higher affinity than ADP. On photolysis the affinity was decreased. AzPET-ADP competitively inhibited the binding of 2-methylthio[beta-32P]ADP, a ligand for the receptor by which ADP causes inhibition of adenylate cyclase. In the dark, AzPET-[beta-32P]ADP bound reversibly and with high affinity to a single population of sites similar in number to the sites that bind 2-methylthio[beta-32P]ADP. Binding was inhibited by ADP and by ATP and by p-chloromercuribenzenesulphonic acid (pCMBS). On exposure to u.v. light in the presence of platelets, AzPET-[beta-32P]ADP was incorporated covalently but non-specifically into several platelet proteins, although prominent intracellular proteins were not labelled. Specific labelling was confined to a single region of SDS/polyacrylamide gels, overlying but not comigrating with actin. Incorporation of radioactivity into this region was inhibited by ADP and by ATP as well as by ADP beta S, ATP alpha S and pCMBS, but not by adenosine, GDP or AMP. Inhibition of AzPET-[beta-32P]ADP incorporation was closely correlated with inhibition of equilibrium binding of 2-methylthio[beta-32P]ADP. These results suggests that the labelled protein, which migrates with an apparent molecular mass of 43 kDa in reduced gels, is the receptor through which ADP inhibits adenylate cyclase. Images Figure 5 PMID:8387782
Geranyl diphosphate synthase large subunit, and methods of use
Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.
2001-10-16
A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.
Cloning and kinetic characterization of Arabidopsis thaliana solanesyl diphosphate synthase.
Hirooka, Kazutake; Bamba, Takeshi; Fukusaki, Ei-ichiro; Kobayashi, Akio
2003-03-01
trans -Long-chain prenyl diphosphate synthases catalyse the sequential condensation of isopentenyl diphosphate (C(5)) units with allylic diphosphate to produce the C(30)-C(50) prenyl diphosphates, which are precursors of the side chains of prenylquinones. Based on the relationship between product specificity and the region around the first aspartate-rich motif in trans -prenyl diphosphate synthases characterized so far, we have isolated the cDNA for a member of trans -long-chain prenyl diphosphate synthases from Arabidopsis thaliana. The cDNA was heterologously expressed in Escherichia coli, and the recombinant His(6)-tagged protein was purified and characterized. Product analysis revealed that the cDNA encodes solanesyl diphosphate (C(45)) synthase (At-SPS). At-SPS utilized farnesyl diphosphate (FPP; C(15)) and geranylgeranyl diphosphate (GGPP; C(20)), but did not accept either the C(5) or the C(10) allylic diphosphate as a primer substrate. The Michaelis constants for FPP and GGPP were 5.73 microM and 1.61 microM respectively. We also performed an analysis of the side chains of prenylquinones extracted from the A. thaliana plant, and showed that its major prenylquinones, i.e. plastoquinone and ubiquinone, contain the C(45) prenyl moiety. This suggests that At-SPS might be devoted to the biosynthesis of either or both of the prenylquinone side chains. This is the first established trans -long-chain prenyl diphosphate synthase from a multicellular organism.
Frojmovic, M. M.; Mooney, R. F.; Wong, T.
1994-01-01
We have previously reported that maximal platelet activation with adenosine diphosphate (100 microM ADP) causes rapid expression of all GPIIb-IIIa receptors for fibrinogen (FgR) (< 1-3 s), measured with FITC-labeled PAC1 by flow cytometry. We have extended these studies to examine the effects of ADP concentration on the graded expression and Fg occupancy of GPIIb-IIIa receptors. Human citrated platelet-rich plasma, diluted 10-fold with Walsh-albumin-Mg+2 (2 mM), was treated with ADP (0.1-100 microM). The rates of GPIIb-IIIa receptor expression or Fg binding were measured in unstirred samples by flow cytometry, using FITC-labeled monoclonal antibodies (mAb) PAC1 and 9F9, respectively, from on-rates, using increasing times between mAb and ADP additions. Fibrinogen receptors were all expressed rapidly at low (1 microM) or high (100 microM) ADP (few seconds), whereas Fg occupancy was 50% of maximal by about 2 min. The maximal extent of GPIIb-IIIa receptor expression and Fg occupancy was determined from maximal binding (Flmax) at 30 min incubation with PAC1 or 9F9. On-rates and maximal extents of binding for either PAC1 or 9F9 probes showed identical [ADP]-response profiles ("KD" approximately 1.4 +/- 0.1 microM). However, Flmax studies showed bimodal histograms consisting of "resting" (Po) and maximally "activated" (P*) platelets for both PAC1 and 9F9 binding, with the fraction of "activated" platelets increasing with ADP concentration. The data best fit a model where platelet subpopulations are "quantally" transformed from Po to P*, expressing all GPIIb-IIIa receptors, rapidly filled by Fg, but "triggered" at critical ADP concentrations. Larger, but not the largest, platelets appear to be the most sensitive subpopulation. The implications for clinical studies are discussed, and the relationship to dynamics of aggregation are described in a companion paper. PMID:7858143
He, Haifeng; Xia, Hongying; Xia, Qin; Ren, Yanliang; He, Hongwu
2017-10-15
By targeting the thiamin diphosphate (ThDP) binding site of Escherichia coli (E. coli) pyruvate dehydrogenase multienzyme complex E1 (PDHc E1), a series of novel 'open-chain' classes of ThDP analogs A, B, and C with N-acylhydrazone moieties was designed and synthesized to explore their activities against E. coli PHDc E1 in vitro and their inhibitory activity against microbial diseases were further evaluated in vivo. As a result, A1-23 exhibited moderate to potent inhibitory activities against E. coli PDHc E1 (IC 50 =0.15-23.55μM). The potent inhibitors A13, A14, A15, C2, had strong inhibitory activities with IC 50 values of 0.60, 0.15, 0.39 and 0.34μM against E. coli PDHc E1 and with good enzyme-selective inhibition between microorganisms and mammals. Especially, the most powerful inhibitor A14 could 99.37% control Xanthimonas oryzae pv. Oryzae. Furthermore, the binding features of compound A14 within E. coli PDHc E1 were investigated to provide useful insights for the further construction of new inhibitor by molecular docking, site-directed mutagenesis, and enzymatic assays. The results indicated that A14 had most powerful inhibition against E. coli PDHc E1 due to the establishment of stronger interaction with Glu571, Met194, Glu522, Leu264 and Phe602 at active site of E.coli PDHc E1. It could be used as a lead compound for further optimization, and may have potential as a new microbicide. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kinesin expands and stabilizes the GDP-microtubule lattice
NASA Astrophysics Data System (ADS)
Peet, Daniel R.; Burroughs, Nigel J.; Cross, Robert A.
2018-05-01
Kinesin-1 is a nanoscale molecular motor that walks towards the fast-growing (plus) ends of microtubules, hauling molecular cargo to specific reaction sites in cells. Kinesin-driven transport is central to the self-organization of eukaryotic cells and shows great promise as a tool for nano-engineering1. Recent work hints that kinesin may also play a role in modulating the stability of its microtubule track, both in vitro2,3 and in vivo4, but the results are conflicting5-7 and the mechanisms are unclear. Here, we report a new dimension to the kinesin-microtubule interaction, whereby strong-binding state (adenosine triphosphate (ATP)-bound and apo) kinesin-1 motor domains inhibit the shrinkage of guanosine diphosphate (GDP) microtubules by up to two orders of magnitude and expand their lattice spacing by 1.6%. Our data reveal an unexpected mechanism by which the mechanochemical cycles of kinesin and tubulin interlock, and so allow motile kinesins to influence the structure, stability and mechanics of their microtubule track.
Shen, Qinqin; Li, Lixia; Jiang, Yu; Wang, Qiang
2016-01-01
To characterize the ent-copalyl diphosphate (ent-CPP) synthase involved in the biosynthetic pathway of andrographolides in a medicinal plant, Andrographis paniculata. The ent-CPP synthase (ent-CPS) gene was cloned from A. paniculata and its encoded ApCPS was demonstrated to react with (E,E,E)-geranylgeranyl diphosphate to form ent-CPP through recombinant expression in Escherichia coli. Site-directed mutagenesis of the Asp to Ala in the conserved DXDD motif of ApCPS resulted in loss of function. One Arg is located in the conserved position close to DXDD motif indicating the involvement of ApCPS in specialized metabolism. In addition, RT-PCR analysis revealed that ApCPS was expressed in all tissues of A. paniculata at all growth stages, which is consistent with andrographolides accumulating in these organs. Methyl jasmonate induced ApCPS gene expression, matching inducible accumulation of andrographolides in vivo. ApCPS is the first ent-CPS characterized in A. paniculata and is suggested to be involved in biosynthesis of andrographolides that have high pharmaceutical values.
Arjunan, Palaniappa; Sax, Martin; Brunskill, Andrew; Chandrasekhar, Krishnamoorthy; Nemeria, Natalia; Zhang, Sheng; Jordan, Frank; Furey, William
2006-06-02
The crystal structure of the E1 component from the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDHc) has been determined with phosphonolactylthiamin diphosphate (PLThDP) in its active site. PLThDP serves as a structural and electrostatic analogue of the natural intermediate alpha-lactylthiamin diphosphate (LThDP), in which the carboxylate from the natural substrate pyruvate is replaced by a phosphonate group. This represents the first example of an experimentally determined, three-dimensional structure of a thiamin diphosphate (ThDP)-dependent enzyme containing a covalently bound, pre-decarboxylation reaction intermediate analogue and should serve as a model for the corresponding intermediates in other ThDP-dependent decarboxylases. Regarding the PDHc-specific reaction, the presence of PLThDP induces large scale conformational changes in the enzyme. In conjunction with the E1-PLThDP and E1-ThDP structures, analysis of a H407A E1-PLThDP variant structure shows that an interaction between His-407 and PLThDP is essential for stabilization of two loop regions in the active site that are otherwise disordered in the absence of intermediate analogue. This ordering completes formation of the active site and creates a new ordered surface likely involved in interactions with the lipoyl domains of E2s within the PDHc complex. The tetrahedral intermediate analogue is tightly held in the active site through direct hydrogen bonds to residues His-407, Tyr-599, and His-640 and reveals a new, enzyme-induced, strain-related feature that appears to aid in the decarboxylation process. This feature is almost certainly present in all ThDP-dependent decarboxylases; thus its inclusion in our understanding of general thiamin catalysis is important.
Schilmiller, Anthony L; Schauvinhold, Ines; Larson, Matthew; Xu, Richard; Charbonneau, Amanda L; Schmidt, Adam; Wilkerson, Curtis; Last, Robert L; Pichersky, Eran
2009-06-30
We identified a cis-prenyltransferase gene, neryl diphosphate synthase 1 (NDPS1), that is expressed in cultivated tomato (Solanum lycopersicum) cultivar M82 type VI glandular trichomes and encodes an enzyme that catalyzes the formation of neryl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. mRNA for a terpene synthase gene, phellandrene synthase 1 (PHS1), was also identified in these glands. It encodes an enzyme that uses neryl diphosphate to produce beta-phellandrene as the major product as well as a variety of other monoterpenes. The profile of monoterpenes produced by PHS1 is identical with the monoterpenes found in type VI glands. PHS1 and NDPS1 map to chromosome 8, and the presence of a segment of chromosome 8 derived from Solanum pennellii LA0716 causes conversion from the M82 gland monoterpene pattern to that characteristic of LA0716 plants. The data indicate that, contrary to the textbook view of geranyl diphosphate as the "universal" substrate of monoterpene synthases, in tomato glands neryl diphosphate serves as a precursor for the synthesis of monoterpenes.
Schilmiller, Anthony L.; Schauvinhold, Ines; Larson, Matthew; Xu, Richard; Charbonneau, Amanda L.; Schmidt, Adam; Wilkerson, Curtis; Last, Robert L.; Pichersky, Eran
2009-01-01
We identified a cis-prenyltransferase gene, neryl diphosphate synthase 1 (NDPS1), that is expressed in cultivated tomato (Solanum lycopersicum) cultivar M82 type VI glandular trichomes and encodes an enzyme that catalyzes the formation of neryl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. mRNA for a terpene synthase gene, phellandrene synthase 1 (PHS1), was also identified in these glands. It encodes an enzyme that uses neryl diphosphate to produce β-phellandrene as the major product as well as a variety of other monoterpenes. The profile of monoterpenes produced by PHS1 is identical with the monoterpenes found in type VI glands. PHS1 and NDPS1 map to chromosome 8, and the presence of a segment of chromosome 8 derived from Solanum pennellii LA0716 causes conversion from the M82 gland monoterpene pattern to that characteristic of LA0716 plants. The data indicate that, contrary to the textbook view of geranyl diphosphate as the “universal” substrate of monoterpene synthases, in tomato glands neryl diphosphate serves as a precursor for the synthesis of monoterpenes. PMID:19487664
NASA Astrophysics Data System (ADS)
Angmo, Stanzin; Tripathi, Neha; Abbat, Sheenu; Sharma, Shailesh; Singh, Shelley Sardul; Halder, Avishek; Yadav, Kamalendra; Shukla, Geeta; Sandhir, Rajat; Rishi, Vikas; Bharatam, Prasad V.; Yadav, Hariom; Singhal, Nitin Kumar
2017-01-01
Hepcidin, a peptide hormone, is a key regulator in mammalian iron homeostasis. Increased level of hepcidin due to inflammatory conditions stimulates the ferroportin (FPN) transporter internalization, impairing the iron absorption; clinically manifested as anemia of inflammation (AI). Inhibiting hepcidin-mediated FPN degradation is proposed as an important strategy to combat AI. A systematic approach involving in silico, in vitro, ex vivo and in vivo studies is employed to identify hepcidin-binding agents. The virtual screening of 68,752 natural compounds via molecular docking resulted into identification of guanosine 5‧-diphosphate (GDP) as a promising hepcidin-binding agent. The molecular dynamics simulations helped to identify the important hepcidin residues involved in stabilization of hepcidin-GDP complex. The results gave a preliminary indication that GDP may possibly inhibit the hepcidin-FPN interactions. The in vitro studies revealed that GDP caused FPN stabilization (FPN-GFP cell lines) and increased the FPN-mediated cellular iron efflux (HepG2 and Caco-2 cells). Interestingly, the co-administration of GDP and ferrous sulphate (FeSO4) ameliorated the turpentine-induced AI in mice (indicated by increased haemoglobin level, serum iron, FPN expression and decreased ferritin level). These results suggest that GDP a promising natural small-molecule inhibitor that targets Hepcidin-FPN complex may be incorporated with iron supplement regimens to ameliorate AI.
Angmo, Stanzin; Tripathi, Neha; Abbat, Sheenu; Sharma, Shailesh; Singh, Shelley Sardul; Halder, Avishek; Yadav, Kamalendra; Shukla, Geeta; Sandhir, Rajat; Rishi, Vikas; Bharatam, Prasad V.; Yadav, Hariom; Singhal, Nitin Kumar
2017-01-01
Hepcidin, a peptide hormone, is a key regulator in mammalian iron homeostasis. Increased level of hepcidin due to inflammatory conditions stimulates the ferroportin (FPN) transporter internalization, impairing the iron absorption; clinically manifested as anemia of inflammation (AI). Inhibiting hepcidin-mediated FPN degradation is proposed as an important strategy to combat AI. A systematic approach involving in silico, in vitro, ex vivo and in vivo studies is employed to identify hepcidin-binding agents. The virtual screening of 68,752 natural compounds via molecular docking resulted into identification of guanosine 5′-diphosphate (GDP) as a promising hepcidin-binding agent. The molecular dynamics simulations helped to identify the important hepcidin residues involved in stabilization of hepcidin-GDP complex. The results gave a preliminary indication that GDP may possibly inhibit the hepcidin-FPN interactions. The in vitro studies revealed that GDP caused FPN stabilization (FPN-GFP cell lines) and increased the FPN-mediated cellular iron efflux (HepG2 and Caco-2 cells). Interestingly, the co-administration of GDP and ferrous sulphate (FeSO4) ameliorated the turpentine-induced AI in mice (indicated by increased haemoglobin level, serum iron, FPN expression and decreased ferritin level). These results suggest that GDP a promising natural small-molecule inhibitor that targets Hepcidin-FPN complex may be incorporated with iron supplement regimens to ameliorate AI. PMID:28054602
Ohara, Kazuaki; Muroya, Ayumu; Fukushima, Nobuhiro; Yazaki, Kazufumi
2009-06-26
The AS-PT (aromatic substrate prenyltransferase) family plays a critical role in the biosynthesis of important quinone compounds such as ubiquinone and plastoquinone, although biochemical characterizations of AS-PTs have rarely been carried out because most members are membrane-bound enzymes with multiple transmembrane alpha-helices. PPTs [PHB (p-hydroxybenzoic acid) prenyltransferases] are a large subfamily of AS-PTs involved in ubiquinone and naphthoquinone biosynthesis. LePGT1 [Lithospermum erythrorhizon PHB geranyltransferase] is the regulatory enzyme for the biosynthesis of shikonin, a naphthoquinone pigment, and was utilized in the present study as a representative of membrane-type AS-PTs to clarify the function of this enzyme family at the molecular level. Site-directed mutagenesis of LePGT1 with a yeast expression system indicated three out of six conserved aspartate residues to be critical to the enzymatic activity. A detailed kinetic analysis of mutant enzymes revealed the amino acid residues responsible for substrate binding were also identified. Contrary to ubiquinone biosynthetic PPTs, such as UBIA in Escherichia coli which accepts many prenyl substrates of different chain lengths, LePGT1 can utilize only geranyl diphosphate as its prenyl substrate. Thus the substrate specificity was analysed using chimeric enzymes derived from LePGT1 and UBIA. In vitro and in vivo analyses of the chimeras suggested that the determinant region for this specificity was within 130 amino acids of the N-terminal. A 3D (three-dimensional) molecular model of the substrate-binding site consistent with these biochemical findings was generated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Street, I.P.; Poulter, C.D.
1990-08-14
Isopentenyldiphosphate:dimethylallyldiphosphate isomerase (IPP isomerase) is an enzyme in isoprene metabolism which catalyzes the interconversion of the fundamental five-carbon homoallylic and allylic diphosphate building blocks for the pathway. The gene encoding IPP isomerase has recently been isolated from Saccharomyces cerevisiae. A heterologous expression system was constructed for the gene and used to overexpress IPP isomerase in Escherichia coli. In transformants carrying the expression vector, IPP isomerase activity was increased by over 100,000-fold relative to that of the untransformed host strain. The overexpressed enzyme constitutes 30-35% of the total soluble cell protein and can be purified to homogeneity in two steps. Recombinantmore » IPP isomerase was indistinguishable from that purified from yeast. 3-(Fluoromethyl)-3-butenyl diphosphate (FIPP) is a specific active-site-directed inhibitor of IPP isomerase from Claviceps purpurea. Inactivation of yeast IPP isomerase by FIPP was active-site-directed, and inhibition resulted in formation of a stoichiometric enzyme-inhibitor complex. The site of covalent attachment in the enzyme-inhibitor complex was determined by inactivating IPP isomerase with (4-{sup 3}H)FIPP, followed by digestion of the labeled enzyme with trypsin and purification of the resulting radioactive peptides by reversed-phase high-performance liquid chromatography. The primary site of attachment was Cys-139.« less
A conserved NAD+ binding pocket that regulates protein-protein interactions during aging.
Li, Jun; Bonkowski, Michael S; Moniot, Sébastien; Zhang, Dapeng; Hubbard, Basil P; Ling, Alvin J Y; Rajman, Luis A; Qin, Bo; Lou, Zhenkun; Gorbunova, Vera; Aravind, L; Steegborn, Clemens; Sinclair, David A
2017-03-24
DNA repair is essential for life, yet its efficiency declines with age for reasons that are unclear. Numerous proteins possess Nudix homology domains (NHDs) that have no known function. We show that NHDs are NAD + (oxidized form of nicotinamide adenine dinucleotide) binding domains that regulate protein-protein interactions. The binding of NAD + to the NHD domain of DBC1 (deleted in breast cancer 1) prevents it from inhibiting PARP1 [poly(adenosine diphosphate-ribose) polymerase], a critical DNA repair protein. As mice age and NAD + concentrations decline, DBC1 is increasingly bound to PARP1, causing DNA damage to accumulate, a process rapidly reversed by restoring the abundance of NAD + Thus, NAD + directly regulates protein-protein interactions, the modulation of which may protect against cancer, radiation, and aging. Copyright © 2017, American Association for the Advancement of Science.
Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio
2017-01-01
Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation. PMID:28223697
Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio
2017-02-22
Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation.
Schneider, David J; Keating, Friederike K; Baumann, Patricia Q; Whitaker, Deborah A; Sobel, Burton E
2006-02-01
Both tirofiban and eptifibatide release rapidly from glycoprotein IIb-IIIa but have different dissociation constants (KD of tirofiban=15 nmol/l, of eptifibatide=120 nmol/l). Binding of fibrinogen to glycoprotein IIb-IIIa is biphasic, forming an initial reversible complex (KD=155-180 nmol/l) and a second more stable complex (KD=20-70 nmol/l). Diabetes is known to alter platelet function. To determine the influence of affinity on inhibitory effects in blood from patients with (n=20) and without (n=20) diabetes mellitus, we characterized the extent of inhibition as a function of time. Blood was added to reaction tubes containing tirofiban 100 ng/ml or eptifibatide 1.7 microg/ml (concentrations previously defined to be optimal) plus a platelet agonist (1 micromol/l adenosine diphosphate or 25 micromol/l thrombin receptor agonist peptide), and fluorochrome-labeled fibrinogen before analysis by flow cytometry. The extent of inhibition early on (30 s to 3 min) was similar (>85%) with either agent in blood from those with and without diabetes mellitus, whereas the extent of inhibition 10-15 min later was maintained more effectively with tirofiban than with eptifibatide (difference in slope P<0.01). After 15 min, the extent of inhibition in response to adenosine diphosphate in those with diabetes mellitus was 95+/-6% for tirofiban and 70+/-15% for eptifibatide (P<0.001); in those without diabetes mellitus, it was 91+/-9% for tirofiban and 73+/-19% for eptifibatide (P<0.001). For glycoprotein IIb-IIIa antagonists with a rapid rate of release, the biphasic binding of fibrinogen influences to a similar extent their ability to maintain inhibitory effects in blood from patients with and without diabetes mellitus.
Ogawa, Takuya; Emi, Koh-Ichi; Koga, Kazushi; Yoshimura, Tohru; Hemmi, Hisashi
2016-06-01
Cis-prenyltransferase usually consecutively catalyzes the head-to-tail condensation reactions of isopentenyl diphosphate to allylic prenyl diphosphate in the production of (E,Z-mixed) polyprenyl diphosphate, which is the precursor of glycosyl carrier lipids. Some recently discovered homologs of the enzyme, however, catalyze the nonhead-to-tail condensation reactions between allylic prenyl diphosphates. In this study, we characterize a cis-prenyltransferase homolog from a methanogenic archaeon, Methanosarcina acetivorans, to obtain information on the biosynthesis of the glycosyl carrier lipids within it. This enzyme catalyzes both head-to-tail and nonhead-to-tail condensation reactions. The kinetic analysis shows that the main reaction of the enzyme is consecutive head-to-tail prenyl condensation reactions yielding polyprenyl diphosphates, while the chain lengths of the major products seem shorter than expected for the precursor of glycosyl carrier lipids. On the other hand, a subsidiary reaction of the enzyme, i.e., nonhead-to-tail condensation between dimethylallyl diphosphate and farnesyl diphosphate, gives a novel diterpenoid compound, geranyllavandulyl diphosphate. © 2016 Federation of European Biochemical Societies.
Synthesis and Evaluation of Chlorinated Substrate Analogues for Farnesyl Diphosphate Synthase
Heaps, Nicole A.; Poulter, C. Dale
2011-01-01
Substrate analogues for isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP), where the C3 methyl groups were replaced by chlorine, were synthesized and evaluated as substrates for avian farnesyl diphosphate synthase (FPPase). The IPP analogue (3-ClIPP) was a co-substrate when incubated with dimethylallyl diphosphate (DMAPP) or geranyl diphosphate (GPP) to give the corresponding chlorinated analogues of geranyl diphosphate (3-ClGPP) and farnesyl diphosphate (3-ClFPP), respectively. No products were detected in incubations of 3-ClIPP with 3-ClDMAPP. Incubation of IPP with 3-ClDMAPP gave 11-ClFPP as the sole product. Values of KM3-ClIPP (with DMAPP) and KM3-ClDMAPP (with IPP) were similar to those for IPP and DMAPP, however values of kcat for both analogues were substantially lower. These results are consistent with a dissociative electrophilic alkylation mechanism where the rate-limiting step changes from heterolytic cleavage of the carbon-oxygen bond in the allylic substrate to alkylation of the double bond of the homoallylic substrate. PMID:21344952
Study of the Crystal Structures of Sodium Magnesium and Sodium Nickel Diphosphates
NASA Astrophysics Data System (ADS)
Erragh, Fatima; Boukhari, Ali; Abraham, Francis; Elouadi, Brahim
2000-07-01
Single-crystal X-ray crystallography studies have shown that diphosphates Na3.64Mg2.18(P2O7)2 and Na3.64Ni2.18(P2O7)2 crystallize with the same structural type and the same space group Poverline1. Their triclinic lattice parameters are equal to a=10.901 (2), b=9.765 (2), c=6.382 (1) Å, α=112.43 (1)°, β=99.64 (1)°, γ=107.53 (1)°, Z=2 and a=10.889 (5), b=9.705 (4), c=6.358 (4) Å, α=112.46 (4)°, β=99.92 (4)°, γ=107.54 (4)°, Z=2, respectively. The structure could be regarded as a packing of diphosphate groups [P2O7]4- and [MO6] octahedra (M=Mg, Ni) delimiting cavities and tunnels which host sodium cations. The tunnels are running along [001]. The structure is characterized by mixed (Na, M) sites with an occupation factor ratio equal to ca. 0.82/0.18. Sodium cations are located in five different sites: two cavities (one penta- and the other octa-coordinated) totally occupied and three octahedral interstices, which are partially filled by Na(3), Na(4), and Na(5) according to the respective occupation factors of 0.15, 0.42, and 0.25 for Na3.64Mg2.18(P2O7)2 and 0.13, 0.40, and 0.29 in the case of Na3.64Ni2.18(P2O7)2.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halavaty, Andrei S.; Northwestern University, Chicago, IL 60611; Kim, Youngchang
The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holomore » form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.« less
Cytidine derivatives as IspF inhibitors of Burkolderia pseudomallei
Zhang, Zheng; Jakkaraju, Sriram; Blain, Joy; Gogol, Kenneth; Zhao, Lei; Hartley, Robert C.; Karlsson, Courtney A.; Staker, Bart L.; Stewart, Lance J.; Myler, Peter J.; Clare, Michael; Begley, Darren W.; Horn, James R.; Hagen, Timothy J
2013-01-01
Published biological data suggest that the methyl erythritol phosphate (MEP) pathway, a non-mevalonate isoprenoid biosynthetic pathway, is essential for certain bacteria and other infectious disease organisms. One highly conserved enzyme in the MEP pathway is 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (IspF). Fragment-bound complexes of IspF from Burkholderia pseudomallei were used to design and synthesize a series of molecules linking the cytidine moiety to different zinc pocket fragment binders. Testing by surface plasmon resonance (SPR) found one molecule in the series to possess binding affinity equal to that of cytidine diphosphate, despite lacking any metal-coordinating phosphate groups. Close inspection of the SPR data suggest different binding stoichiometries between IspF and test compounds. Crystallographic analysis shows important variations between the binding mode of one synthesized compound and the pose of the bound fragment from which it was designed. The binding modes of these molecules add to our structural knowledge base for IspF and suggest future refinements in this compound series. PMID:24157367
Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu
2009-01-01
Isopentenyl diphosphate isomerase (idi) and farnesyl diphosphate synthase (ispA) genes were overexpressed in Escherichia coli. The resulting transformant showed 6.8-fold higher production of farnesol (389 microg/l). In a similar manner, overexpression of idi and mutated ispA led to high production of geranylgeraniol (128 microg/l).
Kim, Eun-Ha; Lee, Yongjik
2015-01-01
Fibrillins are lipid-associated proteins in plastids and are ubiquitous in plants. They accumulate in chromoplasts and sequester carotenoids during the development of flowers and fruits. However, little is known about the functions of fibrillins in leaf tissues. Here, we identified fibrillin 5 (FBN5), which is essential for plastoquinone-9 (PQ-9) biosynthesis in Arabidopsis thaliana. Homozygous fbn5-1 mutations were seedling-lethal, and XVE:FBN5-B transgenic plants expressing low levels of FBN5-B had a slower growth rate and were smaller than wild-type plants. In chloroplasts, FBN5-B specifically interacted with solanesyl diphosphate synthases (SPSs) 1 and 2, which biosynthesize the solanesyl moiety of PQ-9. Plants containing defective FBN5-B accumulated less PQ-9 and its cyclized product, plastochromanol-8, but the levels of tocopherols were not affected. The reduced PQ-9 content of XVE:FBN5-B transgenic plants was consistent with their lower photosynthetic performance and higher levels of hydrogen peroxide under cold stress. These results indicate that FBN5-B is required for PQ-9 biosynthesis through its interaction with SPS. Our study adds FBN5 as a structural component involved in the biosynthesis of PQ-9. FBN5 binding to the hydrophobic solanesyl moiety, which is generated by SPS1 and SPS2, in FBN5-B/SPS homodimeric complexes stimulates the enzyme activity of SPS1 and SPS2. PMID:26432861
Rodrigues, Joaquim Rui; Couto, Ana; Cabezas, Alicia; Pinto, Rosa María; Ribeiro, João Meireles; Canales, José; Costas, María Jesús; Cameselle, José Carlos
2014-04-11
Mammalian triokinase, which phosphorylates exogenous dihydroxyacetone and fructose-derived glyceraldehyde, is neither molecularly identified nor firmly associated to an encoding gene. Human FMN cyclase, which splits FAD and other ribonucleoside diphosphate-X compounds to ribonucleoside monophosphate and cyclic X-phosphodiester, is identical to a DAK-encoded dihydroxyacetone kinase. This bifunctional protein was identified as triokinase. It was modeled as a homodimer of two-domain (K and L) subunits. Active centers lie between K1 and L2 or K2 and L1: dihydroxyacetone binds K and ATP binds L in different subunits too distant (≈ 14 Å) for phosphoryl transfer. FAD docked to the ATP site with ribityl 4'-OH in a possible near-attack conformation for cyclase activity. Reciprocal inhibition between kinase and cyclase reactants confirmed substrate site locations. The differential roles of protein domains were supported by their individual expression: K was inactive, and L displayed cyclase but not kinase activity. The importance of domain mobility for the kinase activity of dimeric triokinase was highlighted by molecular dynamics simulations: ATP approached dihydroxyacetone at distances below 5 Å in near-attack conformation. Based upon structure, docking, and molecular dynamics simulations, relevant residues were mutated to alanine, and kcat and Km were assayed whenever kinase and/or cyclase activity was conserved. The results supported the roles of Thr(112) (hydrogen bonding of ATP adenine to K in the closed active center), His(221) (covalent anchoring of dihydroxyacetone to K), Asp(401) and Asp(403) (metal coordination to L), and Asp(556) (hydrogen bonding of ATP or FAD ribose to L domain). Interestingly, the His(221) point mutant acted specifically as a cyclase without kinase activity.
Bifunctional Homodimeric Triokinase/FMN Cyclase
Rodrigues, Joaquim Rui; Couto, Ana; Cabezas, Alicia; Pinto, Rosa María; Ribeiro, João Meireles; Canales, José; Costas, María Jesús; Cameselle, José Carlos
2014-01-01
Mammalian triokinase, which phosphorylates exogenous dihydroxyacetone and fructose-derived glyceraldehyde, is neither molecularly identified nor firmly associated to an encoding gene. Human FMN cyclase, which splits FAD and other ribonucleoside diphosphate-X compounds to ribonucleoside monophosphate and cyclic X-phosphodiester, is identical to a DAK-encoded dihydroxyacetone kinase. This bifunctional protein was identified as triokinase. It was modeled as a homodimer of two-domain (K and L) subunits. Active centers lie between K1 and L2 or K2 and L1: dihydroxyacetone binds K and ATP binds L in different subunits too distant (≈14 Å) for phosphoryl transfer. FAD docked to the ATP site with ribityl 4′-OH in a possible near-attack conformation for cyclase activity. Reciprocal inhibition between kinase and cyclase reactants confirmed substrate site locations. The differential roles of protein domains were supported by their individual expression: K was inactive, and L displayed cyclase but not kinase activity. The importance of domain mobility for the kinase activity of dimeric triokinase was highlighted by molecular dynamics simulations: ATP approached dihydroxyacetone at distances below 5 Å in near-attack conformation. Based upon structure, docking, and molecular dynamics simulations, relevant residues were mutated to alanine, and kcat and Km were assayed whenever kinase and/or cyclase activity was conserved. The results supported the roles of Thr112 (hydrogen bonding of ATP adenine to K in the closed active center), His221 (covalent anchoring of dihydroxyacetone to K), Asp401 and Asp403 (metal coordination to L), and Asp556 (hydrogen bonding of ATP or FAD ribose to L domain). Interestingly, the His221 point mutant acted specifically as a cyclase without kinase activity. PMID:24569995
Keeling, Christopher I.; Chiu, Christine C.; Aw, Tidiane; Li, Maria; Henderson, Hannah; Tittiger, Claus; Weng, Hong-Biao; Blomquist, Gary J.; Bohlmann, Joerg
2013-01-01
The mountain pine beetle (Dendroctonus ponderosae Hopkins) is the most destructive pest of western North American pine forests. Adult males produce frontalin, an eight-carbon antiaggregation pheromone, via the mevalonate pathway, as part of several pheromones that initiate and modulate the mass attack of host trees. Frontalin acts as a pheromone, attractant, or kairomone in most Dendroctonus species, other insects, and even elephants. 6-Methylhept-6-en-2-one, a frontalin precursor, is hypothesized to originate from 10-carbon geranyl diphosphate (GPP), 15-carbon farnesyl diphosphate (FPP), or 20-carbon geranylgeranyl diphosphate (GGPP) via a dioxygenase- or cytochrome P450-mediated carbon–carbon bond cleavage. To investigate the role of isoprenyl diphosphate synthases in pheromone biosynthesis, we characterized a bifunctional GPP/FPP synthase and a GGPP synthase in the mountain pine beetle. The ratio of GPP to FPP produced by the GPP/FPP synthase was highly dependent on the ratio of the substrates isopentenyl diphosphate and dimethylallyl diphosphate used in the assay. Transcript levels in various tissues and life stages suggested that GGPP rather than GPP or FPP is used as a precursor to frontalin. Reduction of transcript levels by RNA interference of the isoprenyl diphosphate synthases identified GGPP synthase as having the largest effect on frontalin production, suggesting that frontalin is derived from a 20-carbon isoprenoid precursor rather than from the 10- or 15-carbon precursors. PMID:24167290
Korlach, Jonas; Baird, Daniel W.; Heikal, Ahmed A.; Gee, Kyle R.; Hoffman, Gregory R.; Webb, Watt W.
2004-01-01
Regulated guanosine nucleotide exchange and hydrolysis constitute the fundamental activities of low molecular weight GTPases. We show that three guanosine 5′-triphosphate analogs with BODIPY fluorophores coupled via the gamma phosphate bind to the GTPases Cdc42, Rac1, RhoA, and Ras and displace guanosine 5′-diphosphate with high intrinsic exchange rates in the presence of Mg2+ ions, thereby acting as synthetic, low molecular weight guanine nucleotide exchange factors. The accompanying large fluorescence enhancements (as high as 12-fold), caused by a reduction in guanine quenching of the environmentally sensitive BODIPY dye fluorescence on protein binding, allow for real-time monitoring of this spontaneous nucleotide exchange in the visible spectrum with high signal-to-noise ratios. Binding affinities increased with longer aliphatic linkers connecting the nucleotide and BODIPY fluorophore and were in the 10–100 nM range. Steady-state and time-resolved fluorescence spectroscopy showed an inverse relationship between linker length and fluorescence enhancement factors and differences in protein-bound fluorophore mobilities, providing optimization criteria for future applications of such compounds as efficient elicitors and reporters of nucleotide exchange. EDTA markedly enhanced nucleotide exchange, enabling rapid loading of GTPases with these probes. Differences in active site geometries, in the absence of Mg2+, caused qualitatively different reporting of the bound state by the different analogs. The BODIPY analogs also prevented the interaction of Cdc42 with p21 activated kinase. Together, these results validate the use of these analogs as valuable tools for studying GTPase functions and for developing potent synthetic nucleotide exchange factors for this important class of signaling molecules. PMID:14973186
Harris, Golda G.; Lombardi, Patrick M.; Pemberton, Travis A.; Matsui, Tsutomu; Weiss, Thomas M.; Cole, Kathryn E.; Köksal, Mustafa; Murphy, Frank V.; Vedula, L. Sangeetha; Chou, Wayne K.W.; Cane, David E.; Christianson, David W.
2015-01-01
Geosmin synthase from Streptomyces coelicolor (ScGS) catalyzes an unusual, metal-dependent terpenoid cyclization and fragmentation reaction sequence. Two distinct active sites are required for catalysis: the N-terminal domain catalyzes the ionization and cyclization of farnesyl diphosphate to form germacradienol and inorganic pyrophosphate (PPi), and the C-terminal domain catalyzes the protonation, cyclization, and fragmentation of germacradienol to form geosmin and acetone through a retro-Prins reaction. A unique αα domain architecture is predicted for ScGS based on amino acid sequence: each domain contains the metal-binding motifs typical of a class I terpenoid cyclase, and each domain requires Mg2+ for catalysis. Here, we report the X-ray crystal structure of the unliganded N-terminal domain of ScGS and the structure of its complex with 3 Mg2+ ions and alendronate. These structures highlight conformational changes required for active site closure and catalysis. Although neither full-length ScGS nor constructs of the C-terminal domain could be crystallized, homology models of the C-terminal domain were constructed based on ~36% sequence identity with the N-terminal domain. Small-angle X-ray scattering experiments yield low resolution molecular envelopes into which the N-terminal domain crystal structure and the C-terminal domain homology model were fit, suggesting possible αα domain architectures as frameworks for bifunctional catalysis. PMID:26598179
Torgov, Vladimir; Danilov, Leonid; Utkina, Natalia; Veselovsky, Vladimir; Brockhausen, Inka
2017-12-01
Two new phenoxyundecyl diphosphate sugars were synthesized for the first time: P 1 -(11-phenoxyundecyl)-P 2 - (2-acetamido-2-deoxy-3-O-α-D-rhamnopyranosyl-α-D-glucopyranosyl) diphosphate and P 1 -(11-phenoxyundecyl)-P 2 -(2-acetamido-2-deoxy-3-O-β-D-galactopyranosyl-α-D-galactopyranosyl) diphosphate to study the third step of biosynthesis of the repeating units of O-antigenic polysaccharides in Pseudomonas aeruginosa and E.coli O104 respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Dahlen, T; Hauck, T; Wein, M; Schwab, W
2001-01-01
2,5-Dimethyl-4-hydroxy-3(2H)-furanone (DMHF) is an important aroma compound found in many fruits such as strawberries and pineapples and it is also produced by the soy-sauce-fermenting yeast Zygosaccharomyces rouxii after the addition of d-fructose-1,6-diphosphate to yeast-peptone-dextrose nutrient media. Dilute DMHF solutions exhibit a strawberry-like flavor while DMHF concentrates have a caramel-like aroma. In media containing D-fructose-1,6-diphosphate as the sole carbon source, growth of Z. rouxii and formation of DMHF were not observed. Although Z. rouxii cells grew in media with D-glucose as the sole carbon source, DMHF was only produced when media were supplemented with D-fructose-1,6-diphosphate. The DMHF concentration always correlated with the yeast cell count and D-fructose-1,6-diphosphate concentration. Addition of CaCl2 (up to 50 g.l(-1)) led to a higher DMHF concentration. Addition of Na2SO3 reduced the growth of Z. rouxii and inhibited DMHF formation. The amount of DMHF formed by Z. rouxii was not significantly affected by the addition of KH2PO4. DMHF concentrations of 5 and 10 g.l(-1) partially and completely inhibited the growth of Z. rouxii cells, respectively. Only the singly labeled furanone was formed after the addition of 1-13C-D-fructose-1,6-diphosphate to the medium. However, unlabeled DMHF was formed in the presence of (13)C(6)-D-glucose. Therefore, the carbons of the furanone originate exclusively from exogenously supplied D-fructose-1,6-diphosphate as no exchange with the internal pool of D-fructose-1,6-diphosphate occurs. This implies that DMHF is a secondary metabolite of Z. rouxii formed from D-fructose-1,6-diphosphate. We assume that at least the first step of the metabolism of D-fructose-1,6-diphosphate takes place in the cell wall or membrane of the yeast.
Monoterpene synthases from common sage (Salvia officinalis)
Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Kaufmann, A; Maden, K; Leisser, W; Matera, M; Gude, T
2005-11-01
Inorganic polyphosphates (di-, tri- and higher polyphosphates) can be used to treat fish, fish fillets and shrimps in order to improve their water-binding capacity. The practical relevance of this treatment is a significant gain of weight caused by the retention/uptake of water and natural juice into the fish tissues. This practice is legal; however, the use of phosphates has to be declared. The routine control testing of fish for the presence of polyphosphates, produced some results that were difficult to explain. One of the two analytical methods used determined low diphosphate concentrations in a number of untreated samples, while the other ion chromatography (IC) method did not detect them. This initiated a number of investigations: results showed that polyphosphates in fish and shrimps tissue undergo a rapid enzymatic degradation, producing the ubiquitous orthophosphate. This led to the conclusion that sensitive analytical methods are required in order to detect previous polyphosphate treatment of a sample. The polyphosphate concentrations detected by one of the analytical methods could not be explained by the degradation of endogenous high-energy nucleotides like ATP into diphosphate, but by a coeluting compound. Further investigations by LC-MS-MS proved that the substance responsible for the observed peak was inosine monophsosphate (IMP) and not as thought the inorganic diphosphate. The method producing the false-positive result was modified and both methods were ultimately able to detect polyphosphates well separated from natural nucleotides. Polyphosphates could no longer be detected (<0.5 mg kg-1) after modification of the analytical methodology. The relevance of these findings lies in the fact that similar analytical methods are employed in various control laboratories, which might lead to false interpretation of measurements.
An enzyme-coupled continuous fluorescence assay for farnesyl diphosphate synthases
Dozier, Jonathan K; Distefano, Mark D
2012-01-01
Farnesyl diphosphate synthase (FDPS) catalyzes the conversion of isopentenyl diphosphate and dimethylallyl diphosphate to farnesyl diphosphate, a crucial metabolic intermediate in the synthesis of cholesterol, ubiquinone and prenylated proteins; consequently, much effort has gone into developing inhibitors that target FDPS. Currently most FDPS assays use either radiolabeled substrates and are discontinuous, or monitor pyrophosphate release and not farnesyl diphosphate (FPP) creation. Here we report the development of a continuous coupled enzyme assay for FDPS activity that involves the subsequent incorporation of the FPP product of that reaction into a peptide via the action of protein farnesyltransferase (PFTase). By using a dansylated peptide whose fluorescence quantum yield increases upon farnesylation, the rate of FDPS-catalyzed FPP production can be measured. We show that this assay is more sensitive than existing coupled assays, that it can be used to conveniently monitor FDPS activity in a 96-well plate format and that it can reproduce IC50 values for several previously reported FDPS inhibitors. This new method offers a simple, safe and continuous method to assay FDPS activity that should greatly facilitate the screening of inhibitors of this important target. PMID:22085443
NASA Technical Reports Server (NTRS)
Mar, A.; Dworkin, J.; Oro, J.
1987-01-01
Using urea and cyanamide, the two condensing agents considered to have been present on the primitive earth, uridine diphosphate glucose (UDPG), cytidine diphosphate choline (CDP-choline), glucose-1-phosphate (G1P), and glucose-6-phosphate (G6P) were synthesized under simulated prebiotic conditions. The reaction products were separated and identified using paper chromatography, thin layer chromatography, enzymatic analyses, and ion-pair reverse-phase high performance liquid chromatography. The possibility of nonenzymatic synthesis of metabolic intermediates on the primitive earth from simple precursors was thus demonstrated.
Kimura, A; Hirose, K; Kariya, Y; Nagai, S
1976-01-01
Respiration-deficient mutants (Rho-, petite) of Saccharomyces carlsbergensis were obtained by treatment with trypaflavin (euflavine). Dried cells of these mutants phosphorylated mononucleotides to their triphosphates and further formed not only cytidine 5'-diphosphate-choline, but also sugar nucleotides, such as uridine 5'-diphosphate-glucose, guanosine 5'-diphosphate-mannose, etc. The activities were the same or slightly greater than those of the wild strain. These results showed that energy (adenosine 5'-triphosphate) necessary for phosphorylation of mononucleotides was sufficiently supplied by the glycolysis system. PMID:1245470
Wang, Yang; Desai, Janish; Zhang, Yonghui; Malwal, Satish R; Shin, Christopher J; Feng, Xinxin; Sun, Hong; Liu, Guizhi; Guo, Rey-Ting; Oldfield, Eric
2016-10-19
We synthesized a series of benzoic acids and phenylphosphonic acids and investigated their effects on the growth of Staphylococcus aureus and Bacillus subtilis. One of the most active compounds, 5-fluoro-2-(3-(octyloxy)benzamido)benzoic acid (7, ED 50 ∼0.15 μg mL -1 ) acted synergistically with seven antibiotics known to target bacterial cell-wall biosynthesis (a fractional inhibitory concentration index (FICI) of ∼0.35, on average) but had indifferent effects in combinations with six non-cell-wall biosynthesis inhibitors (average FICI∼1.45). The most active compounds were found to inhibit two enzymes involved in isoprenoid/bacterial cell-wall biosynthesis: undecaprenyl diphosphate synthase (UPPS) and undecaprenyl diphosphate phosphatase (UPPP), but not farnesyl diphosphate synthase, and there were good correlations between bacterial cell growth inhibition, UPPS inhibition, and UPPP inhibition. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bošnjaković-Pavlović, Nada; Bajuk-Bogdanović, Danica; Zakrzewska, Joanna; Yan, Zeyin; Holclajtner-Antunović, Ivanka; Gillet, Jean-Michel; Spasojević-de Biré, Anne
2017-11-01
Influence of 12-tungstophosphoric acid (WPA) on conversion of adenosine triphosphate (ATP) to adenosine diphosphate (ADP) in the presence of Na + /K + -ATPase was monitored by 31 P NMR spectroscopy. It was shown that WPA exhibits inhibitory effect on Na + /K + -ATPase activity. In order to study WPA reactivity and intermolecular interactions between WPA oxygen atoms and different proton donor types (D=O, N, C), we have considered data for WPA based compounds from the Cambridge Structural Database (CSD), the Crystallographic Open Database (COD) and the Inorganic Crystal Structure Database (ICSD). Binding properties of Keggin's anion in biological systems are illustrated using Protein Data Bank (PDB). This work constitutes the first determination of theoretical Bader charges on polyoxotungstate compound via the Atom In Molecule theory. An analysis of electrostatic potential maps at the molecular surface and charge of WPA, resulting from DFT calculations, suggests that the preferred protonation site corresponds to WPA bridging oxygen. These results enlightened WPA chemical reactivity and its potential biological applications such as the inhibition of the ATPase activity. Copyright © 2017 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Isoprenoids are a large class of compounds that are present in all living organisms. They are derived from the 5C building blocks isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP). In plants, IPP is synthesized in the cytoplasm from mevalonic acid via the “MVA pathway” a...
Properties of ribulose diphosphate carboxylase immobilized on porous glass
NASA Technical Reports Server (NTRS)
Shapira, J.; Hanson, C. L.; Lyding, J. M.; Reilly, P. J.
1974-01-01
Ribulose-1,5-diphosphate carboxylase from spinach has been bound to arylamine porous glass with a diazo linkage and to alklamine porous glass with glutaraldehyde. Stability at elevated temperatures and responses to changes of pH and ribulose-1,5-diphosphate, Mg(2+), and dithiothreitol concentrations were not significantly different from the soluble enzyme, though stability at 4 C was somewhat improved.
Puts, Johan; de Groot, Monique; Haex, Martin; Jakobs, Bernadette
2015-01-01
Background Vitamin B1 (thiamine-diphosphate) and B6 (pyridoxal-5’phosphate) are micronutrients. Analysis of these micronutrients is important to diagnose potential deficiency which often occurs in elderly people due to malnutrition, in severe alcoholism and in gastrointestinal compromise due to bypass surgery or disease. Existing High Performance Liquid Chromatography (HPLC) based methods include the need for derivatization and long analysis time. We developed an Ultra High Performance Liquid Chromatography Tandem Mass spectrometry (UHPLC-MS/MS) assay with internal standards for simultaneous measurement of underivatized thiamine-diphosphate and pyridoxal-5’phosphate without use of ion pairing reagent. Methods Whole blood, deproteinized with perchloric acid, containing deuterium labelled internal standards thiamine-diphosphate(thiazole-methyl-D3) and pyridoxal-5’phosphate(methyl-D3), was analyzed by UHPLC-MS/MS. The method was validated for imprecision, linearity, recovery and limit of quantification. Alternate (quantitative) method comparisons of the new versus currently used routine HPLC methods were established with Deming regression. Results Thiamine-diphosphate and pyridoxal-5’phosphate were measured within 2.5 minutes instrumental run time. Limits of detection were 2.8 nmol/L and 7.8 nmol/L for thiamine-diphosphate and pyridoxal-5’phosphate respectively. Limit of quantification was 9.4 nmol/L for thiamine-diphosphate and 25.9 nmol/L for pyridoxal-5’phosphate. The total imprecision ranged from 3.5–7.7% for thiamine-diphosphate (44–157 nmol/L) and 6.0–10.4% for pyridoxal-5’phosphate (30–130 nmol/L). Extraction recoveries were 101–102% ± 2.5% (thiamine-diphosphate) and 98–100% ± 5% (pyridoxal-5’phosphate). Deming regression yielded slopes of 0.926 and 0.990 in patient samples (n = 282) and national proficiency testing samples (n = 12) respectively, intercepts of +3.5 and +3 for thiamine-diphosphate (n = 282 and n = 12) and slopes of 1.04 and 0.84, intercepts of -2.9 and +20 for pyridoxal-5’phosphate (n = 376 and n = 12). Conclusion The described UHPLC-MS/MS method allows simultaneous determination of underivatized thiamine-diphosphate and pyridoxal-5’phosphate in whole blood without intensive sample preparation. PMID:26134844
Wang, Shuo; Hao, Youai; Lam, Joseph S; Vlahakis, Jason Z; Szarek, Walter A; Vinnikova, Anna; Veselovsky, Vladimir V; Brockhausen, Inka
2015-06-15
The opportunistic pathogen Pseudomonas aeruginosa produces two major cell surface lipopolysaccharides, characterized by distinct O antigens, called common polysaccharide antigen (CPA) and O-specific antigen (OSA). CPA contains a polymer of D-rhamnose (D-Rha) in α1-2 and α1-3 linkages. Three putative glycosyltransferase genes, wbpX, wbpY, and wbpZ, are part of the CPA biosynthesis cluster. To characterize the enzymatic function of the wbpZ gene product, we chemically synthesized the donor substrate GDP-D-Rha and enzymatically synthesized GDP-D-[(3)H]Rha. Using nuclear magnetic resonance (NMR) spectroscopy, we showed that WbpZ transferred one D-Rha residue from GDP-D-Rha in α1-3 linkage to both GlcNAc- and GalNAc-diphosphate-lipid acceptor substrates. WbpZ is also capable of transferring D-mannose (D-Man) to these acceptors. Therefore, WbpZ has a relaxed specificity with respect to both acceptor and donor substrates. The diphosphate group of the acceptor, however, is required for activity. WbpZ does not require divalent metal ion for activity and exhibits an unusually high pH optimum of 9. WbpZ from PAO1 is therefore a GDP-D-Rha:GlcNAc/GalNAc-diphosphate-lipid α1,3-D-rhamnosyltransferase that has significant activity of GDP-D-Man:GlcNAc/GalNAc-diphosphate-lipid α1,3-D-mannosyltransferase. We used site-directed mutagenesis to replace the Asp residues of the two DXD motifs with Ala. Neither of the mutant constructs of wbpZ (D172A or D254A) could be used to rescue CPA biosynthesis in the ΔwbpZ knockout mutant in a complementation assay. This suggested that D172 and D254 are essential for WbpZ function. This work is the first detailed characterization study of a D-Rha-transferase and a critical step in the development of CPA synthesis inhibitors. This is the first characterization of a D-rhamnosyltransferase and shows that it is essential in Pseudomonas aeruginosa for the synthesis of the common polysaccharide antigen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Subcellular localization and compartmentation of thiamine derivatives in rat brain.
Bettendorff, L; Wins, P; Lesourd, M
1994-05-26
The subcellular distribution of thiamine derivatives in rat brain was studied. Thiamine diphosphate content was highest in the mitochondrial and synaptosomal fractions, and lowest in microsomal, myelin and cytosolic fractions. Only 3-5% of total thiamine diphosphate was bound to transketolase, a cytosolic enzyme. Thiamine triphosphate was barely detectable in the microsomal and cytosolic fraction, but synaptosomes were slightly enriched in this compound compared to the crude homogenate. Both myelin and mitochondrial fractions contained significant amounts of thiamine triphosphate. In order to estimate the relative turnover rates of these compounds, the animals received an intraperitoneal injection of either [14C]thiamine or [14C]sulbutiamine (isobutyrylthiamine disulfide) 1 h before decapitation. The specific radioactivities of thiamine compounds found in the brain decreased in the order: thiamine > thiamine triphosphate > thiamine monophosphate > thiamine diphosphate. Incorporation of radioactivity into thiamine triphosphate was more marked with [14C]sulbutiamine than with [14C]thiamine. The highest specific radioactivity of thiamine diphosphate was found in the cytosolic fraction of the brain, though this pool represents less than 10% of total thiamine diphosphate. Cytosolic thiamine diphosphate had a twice higher specific radioactivity when [14C]sulbutiamine was used as precursor compared with thiamine though no significant differences were found in the other cellular compartments. Our results suggest the existence of two thiamine diphosphate pools: the bound cofactor pool is essentially mitochondrial and has a low turnover; a much smaller cytosolic pool (6-7% of total TDP) of high turnover is the likely precursor of thiamine triphosphate.
Wisitpitthaya, Somsinee; Zhao, Yi; Long, Marcus J C; Li, Minxing; Fletcher, Elaine A; Blessing, William A; Weiss, Robert S; Aye, Yimon
2016-07-15
The enzyme ribonucleotide reductase (RNR) is a major target of anticancer drugs. Until recently, suicide inactivation in which synthetic substrate analogs (nucleoside diphosphates) irreversibly inactivate the RNR-α2β2 heterodimeric complex was the only clinically proven inhibition pathway. For instance, this mechanism is deployed by the multifactorial anticancer agent gemcitabine diphosphate. Recently reversible targeting of RNR-α-alone coupled with ligand-induced RNR-α-persistent hexamerization has emerged to be of clinical significance. To date, clofarabine nucleotides are the only known example of this mechanism. Herein, chemoenzymatic syntheses of the active forms of two other drugs, phosphorylated cladribine (ClA) and fludarabine (FlU), allow us to establish that reversible inhibition is common to numerous drugs in clinical use. Enzyme inhibition and fluorescence anisotropy assays show that the di- and triphosphates of the two nucleosides function as reversible (i.e., nonmechanism-based) inhibitors of RNR and interact with the catalytic (C site) and the allosteric activity (A site) sites of RNR-α, respectively. Gel filtration, protease digestion, and FRET assays demonstrate that inhibition is coupled with formation of conformationally diverse hexamers. Studies in 293T cells capable of selectively inducing either wild-type or oligomerization-defective mutant RNR-α overexpression delineate the central role of RNR-α oligomerization in drug activity, and highlight a potential resistance mechanism to these drugs. These data set the stage for new interventions targeting RNR oligomeric regulation.
p53 regulates the mevalonate pathway in human glioblastoma multiforme
Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M
2015-01-01
The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958
Faraldos, Juan A.; Zhao, Yuxin; O'Maille, Paul E.; Noel, Joseph P.; Coates, Robert M.
2009-01-01
Tobacco 5-epi-aristolochene synthase (TEAS) catalyzes the MgII-dependent cyclizations and rearrangements of (E,E)-farnesyl diphosphate (PP) to the bicyclic sesquiterpene hydrocarbon via a tightly bound (+)-germacrene A as a deprotonated intermediate. With the native enzyme, only a few percent of the putative germacrene A intermediate is released from the active site during the catalytic cycle. 6-Fluorofarnesyl PP was designed and synthesized with the aim of arresting the cyclization-rearrangement mechanism en route to 5-epi-aristolochene. Indeed, incubation of (2E,6Z)-6-fluorofarnesyl PP with recombinant TEAS afforded (-)-1-fluororogermacrene A as the sole product in 58% yield. Steady-state kinetic experiments with farnesyl PP and the 6-fluoro analogue showed that the overall catalytic efficiencies (kcat/Km) are essentially the same for both substrates. 1-Fluorogermacrene A was characterized by chromatographic properties (TLC, GC), MS, optical rotation, UV, IR and 1H NMR data, and by heat-induced Cope rearrangement to (+)-1-fluoro-β-elemene. 1H NMR spectra at room temperature revealed that this (E,E)-configured fluorocyclodecadiene exists in solution as a 7:3 mixture of UU and UD conformers. 1-Fluorogermacrene A underwent trifluoroacetic acid-catalyzed cyclization to give three 1α-fluoroselinene isomers at a rate estimated to be about 1000 times slower than that of the similar cyclization of (+)-germacrene A to the parent selinenes. PMID:17886322
Fujimura, Tsutomu; Esteban, Rosa
2016-10-01
The 5'end of RNA conveys important information on self-identity. In mammalian cells, double-stranded RNA (dsRNA) with 5'di- or triphosphates generated during virus infection is recognized as foreign and elicits the host innate immune response. Here, we analyze the 5' ends of the dsRNA genome of the yeast L-A virus. The positive strand has largely diphosphates with a minor amount of triphosphates, while the negative strand has only diphosphates. Although the virus can produce capped transcripts by cap snatching, neither strand carried a cap structure, suggesting that only non-capped transcripts serve as genomic RNA for encapsidation. We also found that the 5' diphosphates of the positive but not the negative strand within the dsRNA genome are crucial for transcription in vitro. Furthermore, the presence of a cap structure in the dsRNA abrogated its template activity. Given that the 5' diphosphates of the transcripts are also essential for cap acquisition and that host cytosolic RNAs (mRNA, rRNA, and tRNA) are uniformly devoid of 5' pp-structures, the L-A virus takes advantage of its 5' terminal diphosphates, using them as a self-identity tag to propagate in the host cytoplasm. © 2016 John Wiley & Sons Ltd.
Xiao, Qianlin; Wang, Yayun; Du, Jia; Li, Hui; Wei, Bin; Wang, Yongbin; Li, Yangping; Yu, Guowu; Liu, Hanmei; Zhang, Junjie; Liu, Yinghong; Hu, Yufeng; Huang, Yubi
2017-09-01
The biosynthesis of starch is a complex process that depends on the regulatory mechanisms of different functional enzymes, and transcriptional regulation plays an important role in this process. Brittle 1, encoded by BT1, is a transporter of adenosine diphosphate-glucose, which plays an important role in the biosynthesis of starch in the endosperm of cereals. Here, we report that the promoter (pZmBT1) of the maize BT1 homolog, ZmBT1, contains an MBSI site (TAACTG), which is important for its activity. Moreover, high expression level of the gene for ZmMYB14 transcription factor was observed in the maize endosperm; its expression pattern was similar to those of the starch synthesis-related genes in maize seeds. ZmMYB14 is a typical 2R-MYB transcription factor localized in the nucleus and possessed transcriptional activation activity. ZmMYB14 could bind to the region of pZmBT1 from -280 to -151 bp and promote its activity through the TAACTG site. It was also observed to promote the activity of pZmSh2, pZmBt2, pZmGBSSI, pZmSSI, and pZmSBE1 in the maize endosperm in transient gene overexpression assays. Furthermore, ZmMYB14 was also shown to bind directly to the promoters of six starch-synthesizing genes, ZmGBSSI, ZmSSI, ZmSSIIa, ZmSBE1, ZmISA1, and ZmISA2 in yeast. These findings indicate that ZmMYB14 functions as a key regulator of ZmBT1 and is closely related to the biosynthesis of starch. Our results provide crucial information related to the regulation of starch biosynthesis in maize and would be helpful in devising strategies for modulating starch production in maize endosperm. © 2017 Federation of European Biochemical Societies.
Plaga, W; Lottspeich, F; Oesterhelt, D
1992-04-01
An improved purification procedure, including nickel chelate affinity chromatography, is reported which resulted in a crystallizable pyruvate:ferredoxin oxidoreductase preparation from Halobacterium halobium. Crystals of the enzyme were obtained using potassium citrate as the precipitant. The genes coding for pyruvate:ferredoxin oxidoreductase were cloned and their nucleotide sequences determined. The genes of both subunits were adjacent to one another on the halobacterial genome. The derived amino acid sequences were confirmed by partial primary structure analysis of the purified protein. The structural motif of thiamin-diphosphate-binding enzymes was unequivocally located in the deduced amino acid sequence of the small subunit.
Multiscale Modelling for investigating single molecule effects on the mechanics of actin filaments
NASA Astrophysics Data System (ADS)
A, Deriu Marco; C, Bidone Tamara; Laura, Carbone; Cristina, Bignardi; M, Montevecchi Franco; Umberto, Morbiducci
2011-12-01
This work presents a preliminary multiscale computational investigation of the effects of nucleotides and cations on the mechanics of actin filaments (F-actin). At the molecular level, Molecular Dynamics (MD) simulations are employed to characterize the rearrangements of the actin monomers (G-actin) in terms of secondary structures evolution in physiological conditions. At the mesoscale level, a coarse grain (CG) procedure is adopted where each monomer is represented by means of Elastic Network Modeling (ENM) technique. At the macroscale level, actin filaments up to hundreds of nanometers are assumed as isotropic and elastic beams and characterized via Rotation Translation Block (RTB) analysis. F-actin bound to adenosine triphosphate (ATP) shows a persistence length around 5 μm, while actin filaments bound to adenosine diphosphate (ADP) have a persistence length of about 3 μm. With magnesium bound to the high affinity binding site of G-actin, the persistence length of F-actin decreases to about 2 μm only in the ADP-bound form of the filament, while the same ion has no effects, in terms of stiffness variation, on the ATP-bound form of F-actin. The molecular mechanisms behind these changes in flexibility are herein elucidated. Thus, this study allows to analyze how the local binding of cations and nucleotides on G-actin induce molecular rearrangements that transmit to the overall F-actin, characterizing shifts of mechanical properties, that can be related with physiological and pathological cellular phenomena, as cell migration and spreading. Further, this study provides the basis for upcoming investigating of network and cellular remodelling at higher length scales.
NASA Technical Reports Server (NTRS)
Johnson, E. J.; Johnson, M. K.; Macelroy, R. D.
1968-01-01
Ribulose diphosphate carboxylase and phosphoribulokinase activity in chemosynthetic autotrophs Thiobacillus thioparus and Thiobacillus neapolitanus, noting sedimentation and gel filtration characteristics
Nagel, Raimund; Berasategui, Aileen; Paetz, Christian; Gershenzon, Jonathan; Schmidt, Axel
2014-01-01
Spruce (Picea spp.) and other conifers employ terpenoid-based oleoresin as part of their defense against herbivores and pathogens. The short-chain isoprenyl diphosphate synthases (IDS) are situated at critical branch points in terpene biosynthesis, producing the precursors of the different terpenoid classes. To determine the role of IDS and to create altered terpene phenotypes for assessing the defensive role of terpenoids, we overexpressed a bifunctional spruce IDS, a geranyl diphosphate and geranylgeranyl diphosphate synthase in white spruce (Picea glauca) saplings. While transcript level (350-fold), enzyme activity level (7-fold), and in planta geranyl diphosphate and geranylgeranyl diphosphate levels (4- to 8-fold) were significantly increased in the needles of transgenic plants, there was no increase in the major monoterpenes and diterpene acids of the resin and no change in primary isoprenoids, such as sterols, chlorophylls, and carotenoids. Instead, large amounts of geranylgeranyl fatty acid esters, known from various gymnosperm and angiosperm plant species, accumulated in needles and were shown to act defensively in reducing the performance of larvae of the nun moth (Lymantria monacha), a conifer pest in Eurasia. These results show the impact of overexpression of an IDS and the defensive role of an unexpected accumulation product of terpenoid biosynthesis with the potential for a broader function in plant protection. PMID:24346420
Crow, V L; Thomas, T D
1982-01-01
Two D-ketohexose 1,6-diphosphate aldolases are present in Streptococcus cremoris E8 and S. lactis C10. One aldolase, which was induced by growth on either lactose or galactose, was active with both tagatose 1,6-diphosphate (TDP) and fructose 1,6-diphosphate (FDP), having a lower Km and a higher Vmax with TDP as the substrate. This enzyme, named TDP aldolase, had properties typical of a class I aldolase, being insensitive to EDTA and showing substrate-dependent inactivation by sodium borohydride. Sodium dodecyl sulfate-gel electrophoresis indicated a subunit molecular weight of 34,500. The amino acid composition of TDP aldolase is reported. When the enzyme was incubated with either triose phosphates or FDP, the equilibrium mixture contained an FDP/TDP ratio of 6.9:1. The other aldolase, which had properties typical of a class II aldolase, showed activity with FDP but not with TDP. The intracellular TDP concentration, measured with the purified TDP aldolase, was 0.4 to 4.0 mM in cells growing on lactose or galactose and was lower (0 to 1.0 mM) in cells growing on glucose. The intracellular concentration of FDP was always higher than that of TDP. The role of ketohexose diphosphates in the regulation of end product fermentation by lactic streptococci is discussed. PMID:6807956
Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F
2014-10-01
A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.
Pan, Jian-Jung; Ramamoorthy, Gurusankar; Poulter, C. Dale
2013-01-01
Long-chain E-polyprenyl diphosphate synthases (E-PDS) catalyze repetitive addition of isopentenyl diphosphate (IPP) to the growing prenyl chain of an allylic diphosphate. The polyprenyl diphosphate products are required for the biosynthesis of ubiquinones and menaquinones required for electron transport during oxidative phosphorylation to generate ATP. In vitro, the long-chain PDSs require addition of phospholipids or detergents to the assay buffer to enhance product release and maintain efficient turnover. During preliminary assays of product chain-length with anionic, zwitterionic, and non-ionic detergents, we discovered considerable variability. Examination of a series of non-ionic PEG detergents with several long-chain E-PDSs from different organisms revealed that in vitro incubations with nonaethylene glycol monododecyl ether or Triton X-100 typically gave chain lengths that corresponded to those of the isoprenoid moieties in respiratory quinones synthesized in vivo. In contrast incubations in buffer with n-butanol, CHAPS, DMSO, n-octyl-β-glucopyranoside, or β-cyclodextrin or in buffer without detergent typically proceeded more slowly and gave a broad range of chain lengths. PMID:23802587
Vassilopoulos, Athanassios; Pennington, J. Daniel; Andresson, Thorkell; Rees, David M.; Bosley, Allen D.; Fearnley, Ian M.; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Walker, John E.
2014-01-01
Abstract Aims: Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. Results: By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCPK139 directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. Innovation: This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Conclusion: Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins. Antioxid. Redox Signal. 21, 551–564. PMID:24252090
Lawlis, V B; Roche, T E
1981-04-28
Micromolar Ca2+ markedly reduces NADH inhibition of bovine kidney alpha-ketoglutarate dehydrogenase complex [Lawlis, V. B., & Roche, T. E. (1980) Mol. Cell. Biochem. 32, 147-152]. Product inhibition patterns from initial velocity studies conducted at less than 10(-9) M or at 1.5 X 10(-5) M Ca2+ with NAD+, CoA, or alpha-ketoglutarate as the variable substrate showed that NADH was a noncompetitive inhibitor with respect to each of these substrates, except at high NAD+ concentrations, where reciprocal plots were nonlinear and the inhibition pattern for NADH vs. NAD+ changed from a noncompetitive to a competitive pattern. From slope and intercept replots, 2-fold to 12-fold higher inhibition constants were estimated for inhibition by NADH vs. the various substrates in the presence of 1.5 X 10(-5) M Ca2+ than for inhibition at less than 10(-9) M Ca2+. These inhibition patterns and the lack of an effect of Ca2+ on the inhibition of the dihydrolipoyl dehydrogenase component suggested that Ca2+-modulated NADH inhibition occurs at an allosteric site with competitive binding at the site by high levels of NAD+. Decarboxylation of alpha-keto[1-14C]glutarate by the resolved alpha-ketoglutarate dehydrogenase component was investigated in the presence of 5.0 mM glyoxylate which served as an efficient acceptor. NADH (0.2 mM) or 1.0 mM ATP inhibited the partial reaction whereas 15 muM Ca2+, 1.0 mM ADP, or 10 mM NAD+ stimulated the partial reaction and reduced NADH inhibition of this reaction. Thus these effectors alter the activity of the alpha-ketoglutarate dehydrogenase complex by binding at allosteric sites on the alpha-ketoglutarate dehydrogenase component. Inhibition by NADH over a wide range of NADH/NAD+ ratios was measured under conditions in which the level of alpha-ketoglutarate was adjusted to give matching control activities at less than 10(-9) M Ca2+ or 1.5 X 10(-5) M Ca2+ in either the presence or the absence of 1.6 mM ADP. These studies establish that both Ca2+ and ADP decreased NADH inhibition under conditions compensating for the effects of Ca2+ and ADP on S0.5 for alpha-ketoglutarate. ADP was particularly effective in reducing NADH inhibition; further studies are required to determine whether this occurs through binding of NADH and ADP at the same, overlapping, or interacting sites.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
NASA Astrophysics Data System (ADS)
Wang, Jianghua
1999-07-01
We have measured the Raman spectra of monophosphate compounds in aqueous solution. The measured frequencies were correlated with P
Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.
Bischoff, F R; Krebber, H; Smirnova, E; Dong, W; Ponstingl, H
1995-01-01
RCC1 (the regulator of chromosome condensation) stimulates guanine nucleotide dissociation on the Ras-related nuclear protein Ran. Both polypeptides are components of a regulatory pathway that has been implicated in regulating DNA replication, onset of and exit from mitosis, mRNA processing and transport, and import of proteins into the nucleus. In a search for further members of the RCC1-Ran signal pathway, we have identified proteins of 23, 45 and 300 kDa which tightly bind to Ran-GTP but not Ran-GDP. The purified soluble 23 kDa Ran binding protein RanBP1 does not activate RanGTPase, but increases GTP hydrolysis induced by the RanGTPase-activating protein RanGAP1 by an order of magnitude. In the absence of RanGAP, it strongly inhibits RCC1-induced exchange of Ran-bound GTP. In addition, it forms a stable complex with nucleotide-free RCC1-Ran. With these properties, it differs markedly from guanine diphosphate dissociation inhibitors which preferentially prevent the exchange of protein-bound GDP and in some cases were shown to inhibit GAP-induced GTP hydrolysis. RanBP1 is the first member of a new class of proteins regulating the binding and hydrolysis of GTP by Ras-related proteins. Images PMID:7882974
Beyer, K; Nuscher, B
1996-12-10
The interaction of cardiolipin with the isolated ADP/ATP carrier protein from beef heart mitochondria has been studied by means of the unmasking of a single cysteinyl residue, Cys56, which accompanies the conformational transition of the protein [Leblanc, P., & Clauser, H, (1972) FEBS Lett. 23, 107-113]. The unmasking was monitored by using the static fluorescence of the sulfhydryl reagent N-(1-pyrenyl)maleimide (PYM). The rate of PYM binding that was observed after initiation of the conformational transition by ADP was drastically reduced in the presence of cardiolipin (CL). Phospholipids other than CL were much less effective. It can be shown that the conformational transition and the binding reaction are both affected by CL, although to varying extents. An enhancement of the rate of the ADP-dependent PYM binding was observed upon digestion of the protein bound phospholipid by phospholipase A2. The phospholipase treatment also led to an increased ADP-independent PYM binding, thus indicating that the ADP control of the carrier transition was gradually lost. The ADP control could be fully restored through the addition of CL, provided that the phospholipase incubation had been terminated after approximately 1 h. These results will be discussed in relation to an earlier report of tight cardiolipin binding [Beyer, K., & Klingenberg, M. (1985) Biochemistry 24, 3821-3826] and to current structural models of the ADP/ATP carrier protein.
Crystal structure of wild-type and mutant human Ap4A hydrolase.
Ge, Honghua; Chen, Xiaofang; Yang, Weili; Niu, Liwen; Teng, Maikun
2013-03-01
Ap4A hydrolase (asymmetrical diadenosine tetraphosphate hydrolase, EC 3.6.1.17), an enzyme involved in a number of biological processes, is characterized as cleaving the polyphosphate chain at the fourth phosphate from the bound adenosine moiety. This paper presents the crystal structure of wild-type and E58A mutant human Ap4A hydrolase. Similar to the canonical Nudix fold, human Ap4A hydrolase shows the common αβα-sandwich architecture. Interestingly, two sulfate ions and one diphosphate coordinated with some conserved residues were observed in the active cleft, which affords a better understanding of a possible mode of substrate binding. Copyright © 2013 Elsevier Inc. All rights reserved.
Simon, D I; Ezratty, A M; Francis, S A; Rennke, H; Loscalzo, J
1993-10-15
Fibrin(ogen) (FGN) is important for hemostasis and wound healing and is cleared from sites of injury primarily by the plasminogen activator system. However, there is emerging evidence in plasminogen activator-deficient transgenic mice that nonplasmin pathways may be important in fibrin(ogen)olysis, as well. Given the proximity of FGN and monocytes within the occlusive thrombus at sites of vascular injury, we considered the possibility that monocytes may play an ancillary role in the degradation and clearance of fibrin. We found that monocytes possess an alternative fibrinolytic pathway that uses the integrin Mac-1, which directly binds and internalizes FGN, resulting in its lysosomal degradation. At 4 degrees C, FGN binds to U937 monocytoid cells in a specific and saturable manner with a kd of 1.8 mumol/L. Binding requires adenosine diphosphate stimulation and is calcium-dependent. At 37 degrees C, FGN and fibrin monomer (FM) are internalized and degraded at rates of 0.37 +/- 0.13 and 0.55 +/- 0.03 microgram/10(6) cells/h by U937 cells, 1.38 +/- 0.02 and 1.20 +/- 0.30 microgram/10(6) cells/h by THP-1 cells, and 2.10 +/- 0.20 and 2.52 +/- 0.18 micrograms/10(6) cells/h by human peripheral blood mononuclear cells, respectively. The serine protease inhibitors, PPACK and aprotinin, and the specific elastase inhibitor, AAPVCK, do not significantly inhibit degradation. However, degradation is inhibited by chloroquine, suggesting that a lysosomal pathway is involved. Factor X, a competitive ligand with FGN for the Mac-1 receptor, also blocks degradation, as does a monoclonal antibody to the alpha-subunit of Mac-1. Autoradiography of radioiodinated, internalized FGN shows that FGN proteolysis by the pathway produces a unique degradation pattern distinct from that observed with plasmin. In a fibrin clot lysis assay, Mac-1-mediated fibrinolysis contributed significantly to total fibrinolysis. In summary, FGN is internalized and degraded by activated human monocytoid cells via Mac-1 in the absence of plasmin, thereby providing an alternative fibrinolytic pathway. Thus, in addition to the function of cell adhesion, integrins may also act as receptors that mediate the internalization and degradation of bound ligands.
Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio
2011-02-04
Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.
A kinetic study on the chemical cleavage of nucleoside diphosphate sugars.
Huhta, Eija; Parjanen, Atte; Mikkola, Satu
2010-03-30
Nucleoside diphosphate sugars serve in essential roles in metabolic processes. They have, therefore, been used in mechanistic studies on glycosylation reactions, and their analogues have been synthesised as enzyme and receptor inhibitors. Despite extensive biochemical research, little is known about their chemical reactions. In the present work the chemical cleavage of two different types of nucleoside diphosphate sugars has been studied. UDP-Glc is phosphorylated at the anomeric carbon, whereas in ADP-Rib C-1 is unsubstituted, allowing hence the equilibrium between cyclic hemiacetal and acyclic carbonyl forms. Due to the structural difference, these substrates react via different pathways under slightly alkaline conditions: while UDP-Glc reacts exclusively by a nucleophilic attack of a glucose hydroxyl group on the diphosphate moiety, ADP-Rib undergoes a complex reaction sequence that involves isomerisation processes of the acyclic ribose sugar and results in a release of ADP. Copyright 2009 Elsevier Ltd. All rights reserved.
Monoterpenoid biosynthesis in Saccharomyces cerevisiae.
Oswald, Marilyne; Fischer, Marc; Dirninger, Nicole; Karst, Francis
2007-05-01
Plant monoterpenoids belong to a large family of plant secondary metabolites with valuable applications in cosmetics and medicine. Their usual low levels and difficult purification justify the need for alternative fermentative processes for large-scale production. Geranyl diphosphate is the universal precursor of monoterpenoids. In yeast it occurs exclusively as an intermediate of farnesyl diphosphate synthesis. In the present study we investigated the potential use of Saccharomyces cerevisiae as an alternative engineering tool. The expression of geraniol synthase of Ocimum basilicum in yeast allowed a strong and specific excretion of geraniol to the growth medium, in contrast to mutants defective in farnesyl diphosphate synthase which excreted geraniol and linalool in similar amounts. A further increase of geraniol synthesis was obtained using yeast mutants defective in farnesyl diphosphate synthase. We also showed that geraniol synthase expression affects the general ergosterol pathway, but in a manner dependent on the genetic background of the strain.
Carta, Claudio; Pantaleoni, Francesca; Bocchinfuso, Gianfranco; Stella, Lorenzo; Vasta, Isabella; Sarkozy, Anna; Digilio, Cristina; Palleschi, Antonio; Pizzuti, Antonio; Grammatico, Paola; Zampino, Giuseppe; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco
2006-01-01
Noonan syndrome (NS) is a developmental disorder characterized by short stature, facial dysmorphia, congenital heart disease, and multiple skeletal and hematologic defects. NS is an autosomal dominant trait and is genetically heterogeneous. Gain of function of SHP-2, a protein tyrosine phosphatase that positively modulates RAS signaling, is observed in nearly 50% of affected individuals. Here, we report the identification of heterozygous KRAS gene mutations in two subjects exhibiting a severe NS phenotype with features overlapping those of cardiofaciocutaneous and Costello syndromes. Both mutations were de novo and affected exon 6, which encodes the C-terminal portion of KRAS isoform B but does not contribute to KRAS isoform A. Structural analysis indicated that both substitutions (Val152Gly and Asp153Val) perturb the conformation of the guanine ring–binding pocket of the protein, predicting an increase in the guanine diphosphate/guanine triphosphate (GTP) dissociation rate that would favor GTP binding to the KRASB isoform and bypass the requirement for a guanine nucleotide exchange factor. PMID:16773572
The beginning of kinesin's force-generating cycle visualized at 9-Å resolution
Sindelar, Charles V.; Downing, Kenneth H.
2007-01-01
We have used cryo-electron microscopy of kinesin-decorated microtubules to resolve the structure of the motor protein kinesin's crucial nucleotide response elements, switch I and the switch II helix, in kinesin's poorly understood nucleotide-free state. Both of the switch elements undergo conformational change relative to the microtubule-free state. The changes in switch I suggest a role for it in “ejecting” adenosine diphosphate when kinesin initially binds to the microtubule. The switch II helix has an N-terminal extension, apparently stabilized by conserved microtubule contacts, implying a microtubule activation mechanism that could convey the state of the bound nucleotide to kinesin's putative force-delivering element (the “neck linker”). In deriving this structure, we have adapted an image-processing technique, single-particle reconstruction, for analyzing decorated microtubules. The resulting reconstruction visualizes the asymmetric seam present in native, 13-protofilament microtubules, and this method will provide an avenue to higher-resolution characterization of a variety of microtubule- binding proteins, as well as the microtubule itself. PMID:17470637
A novel plant enzyme with dual activity: an atypical Nudix hydrolase and a dipeptidyl peptidase III
Karačić, Zrinka; Vukelić, Bojana; Ho, Gabrielle H.; Jozić, Iva; Sučec, Iva; Salopek-Sondi, Branka; Kozlović, Marija; Brenner, Steven E.; Ludwig-Müller, Jutta; Abramić, Marija
2017-01-01
In a search for plant homologues of dipeptidyl peptidase III (DPP III) family, we found a predicted protein from the moss Physcomitrella patens (UniProt entry: A9TLP4), which shared 61% sequence identity with the Arabidopsis thaliana uncharacterized protein, designated Nudix hydrolase 3. Both proteins contained all conserved regions of the DPP III family, but instead of the characteristic hexapeptide HEXXGH zinc-binding motif, they possessed a pentapeptide HEXXH, and at the N-terminus, a Nudix box, a hallmark of Nudix hydrolases, known to act upon a variety of nucleoside diphosphate derivatives. To investigate their biochemical properties, we expressed heterologously and purified Physcomitrella (PpND) and Arabidopsis (AtND) protein. Both hydrolyzed, with comparable catalytic efficiency, the isopentenyl diphosphate (IPP), a universal precursor for the biosynthesis of isoprenoid compounds. In addition, PpND dephosphorylated four purine nucleotides (ADP, dGDP, dGTP, and 8-oxo-dATP) with strong preference for oxidized dATP. Furthermore, PpND and AtND showed DPP III activity against dipeptidyl-2-arylamide substrates, which they cleaved with different specificity. This is the first report of a dual activity enzyme, highly conserved in land plants, which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. PMID:27467751
Freas, Nicholas; Newton, Peter; Perozich, John
2016-01-01
UDP-glucose dehydrogenase (UDPGDH), UDP-N-acetyl-mannosamine dehydrogenase (UDPNAMDH) and GDP-mannose dehydrogenase (GDPMDH) belong to a family of NAD (+)-linked 4-electron-transfering oxidoreductases called nucleotide diphosphate sugar dehydrogenases (NDP-SDHs). UDPGDH is an enzyme responsible for converting UDP-d-glucose to UDP-d-glucuronic acid, a product that has different roles depending on the organism in which it is found. UDPNAMDH and GDPMDH convert UDP-N-acetyl-mannosamine to UDP-N-acetyl-mannosaminuronic acid and GDP-mannose to GDP-mannuronic acid, respectively, by a similar mechanism to UDPGDH. Their products are used as essential building blocks for the exopolysaccharides found in organisms like Pseudomonas aeruginosa and Staphylococcus aureus. Few studies have investigated the relationships between these enzymes. This study reveals the relationships between the three enzymes by analysing 229 amino acid sequences. Eighteen invariant and several other highly conserved residues were identified, each serving critical roles in maintaining enzyme structure, coenzyme binding or catalytic function. Also, 10 conserved motifs that included most of the conserved residues were identified and their roles proposed. A phylogenetic tree demonstrated relationships between each group and verified group assignment. Finally, group entropy analysis identified novel conservations unique to each NDP-SDH group, including residue positions critical to NDP-sugar substrate interaction, enzyme structure and intersubunit contact. These positions may serve as targets for future research. UDP-glucose dehydrogenase (UDPGDH, EC 1.1.1.22).
Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun
2017-08-26
Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.
Orlova, Irina; Nagegowda, Dinesh A.; Kish, Christine M.; Gutensohn, Michael; Maeda, Hiroshi; Varbanova, Marina; Fridman, Eyal; Yamaguchi, Shinjiro; Hanada, Atsushi; Kamiya, Yuji; Krichevsky, Alexander; Citovsky, Vitaly; Pichersky, Eran; Dudareva, Natalia
2009-01-01
Geranyl diphosphate (GPP), the precursor of many monoterpene end products, is synthesized in plastids by a condensation of dimethylallyl diphosphate and isopentenyl diphosphate (IPP) in a reaction catalyzed by homodimeric or heterodimeric GPP synthase (GPPS). In the heterodimeric enzymes, a noncatalytic small subunit (GPPS.SSU) determines the product specificity of the catalytic large subunit, which may be either an active geranylgeranyl diphosphate synthase (GGPPS) or an inactive GGPPS-like protein. Here, we show that expression of snapdragon (Antirrhinum majus) GPPS.SSU in tobacco (Nicotiana tabacum) plants increased the total GPPS activity and monoterpene emission from leaves and flowers, indicating that the introduced catalytically inactive GPPS.SSU found endogenous large subunit partner(s) and formed an active snapdragon/tobacco GPPS in planta. Bimolecular fluorescence complementation and in vitro enzyme analysis of individual and hybrid proteins revealed that two of four GGPPS-like candidates from tobacco EST databases encode bona fide GGPPS that can interact with snapdragon GPPS.SSU and form a functional GPPS enzyme in plastids. The formation of chimeric GPPS in transgenic plants also resulted in leaf chlorosis, increased light sensitivity, and dwarfism due to decreased levels of chlorophylls, carotenoids, and gibberellins. In addition, these transgenic plants had reduced levels of sesquiterpene emission, suggesting that the export of isoprenoid intermediates from the plastids into the cytosol was decreased. These results provide genetic evidence that GPPS.SSU modifies the chain length specificity of phylogenetically distant GGPPS and can modulate IPP flux distribution between GPP and GGPP synthesis in planta. PMID:20028839
The compartmentation of phosphorylated thiamine derivatives in cultured neuroblastoma cells.
Bettendorff, L
1994-05-26
Thiamine transport in cultured neuroblastoma cells is mediated by a high-affinity carrier (KM = 40 nM). In contrast, the uptake of the more hydrophobic sulbutiamine (isobutyrylthiamine disulfide) is unsaturable and its initial transport rate is 20-times faster than for thiamine. In the cytoplasm, sulbutiamine is rapidly hydrolyzed and reduced to free thiamine, the overall process resulting in a rapid and concentrative thiamine accumulation. Incorporation of radioactivity from [14C]thiamine or [14C]sulbutiamine into intracellular thiamine diphosphate is slow in both cases. Despite the fact that the diphosphate is probably the direct precursor for both thiamine monophosphate and triphosphate, the specific radioactivity increased much faster for the latter two compounds than for thiamine diphosphate. This suggests the existence of two pools of thiamine diphosphate, the larger one having a very slow turnover (about 17 h); a much smaller, rapidly turning over pool would be the precursor of thiamine mono- and triphosphate. The turnover time for thiamine triphosphate could be estimated to be 1-2 h. When preloading the cells with [14C]sulbutiamine was followed by a chase with the same concentration of the unlabeled compound, the specific radioactivities of thiamine and thiamine monophosphate decreased exponentially as expected, but labeling of the diphosphate continued to increase slowly. Specific radioactivity of thiamine triphosphate increased first, but after 30 min it began to slowly decrease. These results show for the first time the existence of distinct thiamine diphosphate pools in the same homogeneous cell population. They also suggest a complex compartmentation of thiamine metabolism.
Rhaese, H J; Hoch, J A; Groscurth, R
1977-03-01
To test our model on the mechanism of initiation of differentiation in Bacillus subtilis, we tested early blocked (stage 0) sporulation mutants for their ability to synthesize highly phosphorylated nucleotides. We also isolated early blocked asporogenous mutants with the aid of the intercalating drug tilorone. Among all mutants tested we found that the spo0F-bearing strain was unable to synthesize adenosine 3'(2')-triphosphate 5'-triphosphate, pppAppp. A revertant of this mutant regained the ability to both sporulate and synthesize pppAppp. Ribosomes of the asporogenous mutant isolated at T2 (2 hr after the end of logarithmic growth) of sporulation, in contrast to the wild type, do not synthesize adenosine 3'(2')-diphosphate 5'-diphosphate, ppApp, or adenosine 3'(2')-diphosphate 5'-triphosphate, pppApp, but synthesize guanosine 3'(2')-diphosphate 5'-diphosphate, ppGpp, and guanosine 3'(2')-diphosphate 5'-triphosphate, pppGpp. This behavior is characteristic of ribosomes from vegetative, not sporulating, cells. Ribosomes from the sporogenous revertant behave like those of the wild type. The results suggest that the spo0F mutation may be a mutation in the structural gene for pppAppp synthetase. The inability to synthesize pppAppp in this strain also prevents the formation of "sporulation-specific ribosomes," i.e., ribosomes that synthetize ppApp and pppApp. The present experiments suggest that the nucleotide pppAppp participates in the initiation of sporulation by triggering a sequencies of events required for the production of heat-resistant spores.
NASA Astrophysics Data System (ADS)
Lösche, Matthias
2012-02-01
The lipid matrix of biomembranes is an in-plane fluid, thermally and compositionally disordered leaflet of 5 nm thickness and notoriously difficult to characterize in structural terms. Yet, biomembranes are ubiquitous in the cell, and membrane-bound proteins are implicated in a variety of signaling pathways and intra-cellular transport. We developed methodology to study proteins associated with model membranes using neutron reflection measurements and showed recently that this approach can resolve the penetration depth and orientation of membrane proteins with ångstrom resolution if their crystal or NMR structure is known. Here we apply this technology to determine the membrane bindung and unravel functional details of the PTEN phosphatase, a key player in the PI3K apoptosis pathway. PTEN is an important regulatory protein and tumor suppressor that performs its phosphatase activity as an interfacial enzyme at the plasma membrane-cytoplasm boundary. Acting as an antagonist to phosphoinositide-3-kinase (PI3K) in cell signaling, it is deleted in many human cancers. Despite its importance in regulating the levels of the phosphoinositoltriphosphate PI(3,4,5)P3, there is little understanding of how PTEN binds to membranes, is activated and then acts as a phosphatase. We investigated the structure and function of PTEN by studying its membrane affinity and localization on in-plane fluid, thermally disordered synthetic membrane models. The membrane association of the protein depends strongly on membrane composition, where phosphatidylserine (PS) and phosphatidylinositol diphosphate (PI(4,5)P2) act synergetically in attracting the enzyme to the membrane surface. Membrane affinities depend strongly on membrane fluidity, which suggests multiple binding sites on the protein for PI(4,5)P2. Neutron reflection measurements show that the PTEN phosphatase ``scoots'' along the membrane surface (penetration < 5 å) but binds the membrane tightly with its two major domains, the C2 and phosphatase domains. In the bound state, PTEN's regulatory C-terminal tail is displaced from the membrane and organized on the far side of the protein, ˜ 60 å away from the bilayer surface, in a rather compact structure. The combination of binding studies and neutron reflection allows us to distinguish between PTEN mutant proteins and ultimately may identify the structural features required for membrane binding and activation of PTEN. Molecular dynamics simulations, currently in progress, refine this structural picture further.
Parkhomenko, Yulia M; Kudryavtsev, Pavel A; Pylypchuk, Svetlana Yu; Chekhivska, Lilia I; Stepanenko, Svetlana P; Sergiichuk, Andrej A; Bunik, Victoria I
2011-06-01
Thiamine-dependent changes in alcoholic brain were studied using a rat model. Brain thiamine and its mono- and diphosphates were not reduced after 20 weeks of alcohol exposure. However, alcoholism increased both synaptosomal thiamine uptake and thiamine diphosphate synthesis in brain, pointing to mechanisms preserving thiamine diphosphate in the alcoholic brain. In spite of the unchanged level of the coenzyme thiamine diphosphate, activities of the mitochondrial 2-oxoglutarate and pyruvate dehydrogenase complexes decreased in alcoholic brain. The inactivation of pyruvate dehydrogenase complex was caused by its increased phosphorylation. The inactivation of 2-oxoglutarate dehydrogenase complex (OGDHC) correlated with a decrease in free thiols resulting from an elevation of reactive oxygen species. Abstinence from alcohol following exposure to alcohol reactivated OGDHC along with restoration of the free thiol content. However, restoration of enzyme activity occurred before normalization of reactive oxygen species levels. Hence, the redox status of cellular thiols mediates the action of oxidative stress on OGDHC in alcoholic brain. As a result, upon chronic alcohol consumption, physiological mechanisms to counteract the thiamine deficiency and silence pyruvate dehydrogenase are activated in rat brain, whereas OGDHC is inactivated due to impaired antioxidant ability. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.
Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K
1995-08-04
The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
Ohara, Kazuaki; Sasaki, Kanako; Yazaki, Kazufumi
2010-01-01
Long chain prenyl diphosphates are crucial biosynthetic precursors of ubiquinone (UQ) in many organisms, ranging from bacteria to humans, as well as precursors of plastoquinone in photosynthetic organisms. The cloning and characterization of two solanesyl diphosphate synthase genes, OsSPS1 and OsSPS2, in Oryza sativa is reported here. OsSPS1 was highly expressed in root tissue whereas OsSPS2 was found to be high in both leaves and roots. Enzymatic characterization using recombinant proteins showed that both OsSPS1 and OsSPS2 could produce solanesyl diphosphates as their final product, while OsSPS1 showed stronger activity than OsSPS2. However, an important biological difference was observed between the two genes: OsSPS1 complemented the yeast coq1 disruptant, which does not form UQ, whereas OsSPS2 only very weakly complemented the growth defect of the coq1 mutant. HPLC analyses showed that both OsSPS1 and OsSPS2 yeast transformants produced UQ9 instead of UQ6, which is the native yeast UQ. According to the complementation study, the UQ9 levels in OsSPS2 transformants were much lower than that of OsSPS1. Green fluorescent protein fusion analyses showed that OsSPS1 localized to mitochondria, while OsSPS2 localized to plastids. This suggests that OsSPS1 is involved in the supply of solanesyl diphosphate for ubiquinone-9 biosynthesis in mitochondria, whereas OsSPS2 is involved in providing solanesyl diphosphate for plastoquinone-9 formation. These findings indicate that O. sativa has a different mechanism for the supply of isoprenoid precursors in UQ biosynthesis from Arabidopsis thaliana, in which SPS1 provides a prenyl moiety for UQ9 at the endoplasmic reticulum. PMID:20421194
Ohara, Kazuaki; Sasaki, Kanako; Yazaki, Kazufumi
2010-06-01
Long chain prenyl diphosphates are crucial biosynthetic precursors of ubiquinone (UQ) in many organisms, ranging from bacteria to humans, as well as precursors of plastoquinone in photosynthetic organisms. The cloning and characterization of two solanesyl diphosphate synthase genes, OsSPS1 and OsSPS2, in Oryza sativa is reported here. OsSPS1 was highly expressed in root tissue whereas OsSPS2 was found to be high in both leaves and roots. Enzymatic characterization using recombinant proteins showed that both OsSPS1 and OsSPS2 could produce solanesyl diphosphates as their final product, while OsSPS1 showed stronger activity than OsSPS2. However, an important biological difference was observed between the two genes: OsSPS1 complemented the yeast coq1 disruptant, which does not form UQ, whereas OsSPS2 only very weakly complemented the growth defect of the coq1 mutant. HPLC analyses showed that both OsSPS1 and OsSPS2 yeast transformants produced UQ9 instead of UQ6, which is the native yeast UQ. According to the complementation study, the UQ9 levels in OsSPS2 transformants were much lower than that of OsSPS1. Green fluorescent protein fusion analyses showed that OsSPS1 localized to mitochondria, while OsSPS2 localized to plastids. This suggests that OsSPS1 is involved in the supply of solanesyl diphosphate for ubiquinone-9 biosynthesis in mitochondria, whereas OsSPS2 is involved in providing solanesyl diphosphate for plastoquinone-9 formation. These findings indicate that O. sativa has a different mechanism for the supply of isoprenoid precursors in UQ biosynthesis from Arabidopsis thaliana, in which SPS1 provides a prenyl moiety for UQ9 at the endoplasmic reticulum.
Synergistic effects of ATP and RNA binding to human DEAD-box protein DDX1.
Kellner, Julian N; Reinstein, Jochen; Meinhart, Anton
2015-03-11
RNA helicases of the DEAD-box protein family form the largest group of helicases. The human DEAD-box protein 1 (DDX1) plays an important role in tRNA and mRNA processing, is involved in tumor progression and is also hijacked by several virus families such as HIV-1 for replication and nuclear export. Although important in many cellular processes, the mechanism of DDX1's enzymatic function is unknown. We have performed equilibrium titrations and transient kinetics to determine affinities for nucleotides and RNA. We find an exceptional tight binding of DDX1 to adenosine diphosphate (ADP), one of the strongest affinities observed for DEAD-box helicases. ADP binds tighter by three orders of magnitude when compared to adenosine triphosphate (ATP), arresting the enzyme in a potential dead-end ADP conformation under physiological conditions. We thus suggest that a nucleotide exchange factor leads to DDX1 recycling. Furthermore, we find a strong cooperativity in binding of RNA and ATP to DDX1 that is also reflected in ATP hydrolysis. We present a model in which either ATP or RNA binding alone can partially shift the equilibrium from an 'open' to a 'closed'-state; this shift appears to be not further pronounced substantially even in the presence of both RNA and ATP as the low rate of ATP hydrolysis does not change. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Shedge, Hemangi Y; Creager, Stephen E
2010-01-11
Non-specific binding (NSB) of high-molecular-weight proteins onto electrode surfaces can complicate the application of electroanalytical techniques to clinical and environmental research, particularly in biosensor applications. We present herein various strategies to modify the surface of reticulated vitreous carbon (RVC) electrodes to suppress non-specific binding of biomolecules onto its surface. Non-specific binding and specific binding (SB) of two enzyme conjugates, neutravidin-alkaline phosphatase (NA-ALP) and biotinylated alkaline phosphatase (B-ALP), and also neutravidin itself, were studied using hydroquinone diphosphate (HQDP) as an enzyme substrate for ALP inside the pores of RVC electrodes that had been subjected to various modification schemes. The extent of NSB and SB of these biomolecules inside RVC pores was assessed by measuring the initial rate of generation of an electroactive product, hydroquinone (HQ), of the enzyme-catalyzed reaction, using linear scan voltammetry (LSV) for HQ detection. Electrodes functionalized with phenylacetic acid and poly(ethylene glycol) (PEG) showed low NSB and high SB (when biotin capture ligands were included in the modification scheme) in comparison with unmodified electrodes and RVC electrodes modified in other ways. A simple sandwich bioassay for neutravidin was performed on the RVC electrode with the lowest NSB. A concentration detection limit of 52+/-2 ng mL(-1) and an absolute detection limit of 5.2+/-0.2 ng were achieved for neutravidin when this assay was performed using a 100 microL sample size.
Withers, Sydnor T.; Gottlieb, Shayin S.; Lieu, Bonny; Newman, Jack D.; Keasling, Jay D.
2007-01-01
We have developed a novel method to clone terpene synthase genes. This method relies on the inherent toxicity of the prenyl diphosphate precursors to terpenes, which resulted in a reduced-growth phenotype. When these precursors were consumed by a terpene synthase, normal growth was restored. We have demonstrated that this method is capable of enriching a population of engineered Escherichia coli for those clones that express the sesquiterpene-producing amorphadiene synthase. In addition, we enriched a library of genomic DNA from the isoprene-producing bacterium Bacillus subtilis strain 6051 in E. coli engineered to produce elevated levels of isopentenyl diphosphate and dimethylallyl diphosphate. The selection resulted in the discovery of two genes (yhfR and nudF) whose protein products acted directly on the prenyl diphosphate precursors and produced isopentenol. Expression of nudF in E. coli engineered with the mevalonate-based isopentenyl pyrophosphate biosynthetic pathway resulted in the production of isopentenol. PMID:17693564
Hoeffler, Jean-François; Hemmerlin, Andréa; Grosdemange-Billiard, Catherine; Bach, Thomas J; Rohmer, Michel
2002-01-01
In the bacterium Escherichia coli, the mevalonic-acid (MVA)-independent 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway is characterized by two branches leading separately to isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). The signature of this branching is the retention of deuterium in DMAPP and the deuterium loss in IPP after incorporation of 1-[4-(2)H]deoxy-d-xylulose ([4-(2)H]DX). Feeding tobacco BY-2 cell-suspension cultures with [4-(2)H]DX resulted in deuterium retention in the isoprene units derived from DMAPP, as well as from IPP in the plastidial isoprenoids, phytoene and plastoquinone, synthesized via the MEP pathway. This labelling pattern represents direct evidence for the presence of the DMAPP branch of the MEP pathway in a higher plant, and shows that IPP can be synthesized from DMAPP in plant plastids, most probably via a plastidial IPP isomerase. PMID:12010124
An activity transition from NADH dehydrogenase to NADH oxidase during protein denaturation.
Huston, Scott; Collins, John; Sun, Fangfang; Zhang, Ting; Vaden, Timothy D; Zhang, Y-H Percival; Fu, Jinglin
2018-05-01
A decrease in the specific activity of an enzyme is commonly observed when the enzyme is inappropriately handled or is stored over an extended period. Here, we reported a functional transition of an FMN-bound diaphorase (FMN-DI) that happened during the long-term storage process. It was found that FMN-DI did not simply lose its β-nicotinamide adenine diphosphate (NADH) dehydrogenase activity after a long-time storage, but obtained a new enzyme activity of NADH oxidase. Further mechanistic studies suggested that the alteration of the binding strength of an FMN cofactor with a DI protein could be responsible for this functional switch of the enzyme. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Voleti, Rashmi; Tomchick, Diana R.; Südhof, Thomas C.
Synaptotagmins (Syts) act as Ca2+ sensors in neurotransmitter release by virtue of Ca2+-binding to their two C2 domains, but their mechanisms of action remain unclear. Puzzlingly, Ca2+-binding to the C2B domain appears to dominate Syt1 function in synchronous release, whereas Ca2+-binding to the C2A domain mediates Syt7 function in asynchronous release. Here we show that crystal structures of the Syt7 C2A domain and C2AB region, and analyses of intrinsic Ca2+-binding to the Syt7 C2 domains using isothermal titration calorimetry, did not reveal major differences that could explain functional differentiation between Syt7 and Syt1. However, using liposome titrations under Ca2+ saturatingmore » conditions, we show that the Syt7 C2A domain has a very high membrane affinity and dominates phospholipid binding to Syt7 in the presence or absence of L-α-phosphatidylinositol 4,5-diphosphate (PIP2). For Syt1, the two Ca2+-saturated C2 domains have similar affinities for membranes lacking PIP2, but the C2B domain dominates binding to PIP2-containing membranes. Mutagenesis revealed that the dramatic differences in membrane affinity between the Syt1 and Syt7 C2A domains arise in part from apparently conservative residue substitutions, showing how striking biochemical and functional differences can result from the cumulative effects of subtle residue substitutions. Viewed together, our results suggest that membrane affinity may be a key determinant of the functions of Syt C2 domains in neurotransmitter release.« less
vom Dorp, Katharina; Hölzl, Georg; Plohmann, Christian; Eisenhut, Marion; Abraham, Marion
2015-01-01
Phytol from chlorophyll degradation can be phosphorylated to phytyl-phosphate and phytyl-diphosphate, the substrate for tocopherol (vitamin E) synthesis. A candidate for the phytyl-phosphate kinase from Arabidopsis thaliana (At1g78620) was identified via a phylogeny-based approach. This gene was designated VITAMIN E DEFICIENT6 (VTE6) because the leaves of the Arabidopsis vte6 mutants are tocopherol deficient. The vte6 mutant plants are incapable of photoautotrophic growth. Phytol and phytyl-phosphate accumulate, and the phytyl-diphosphate content is strongly decreased in vte6 leaves. Phytol feeding and enzyme assays with Arabidopsis and recombinant Escherichia coli cells demonstrated that VTE6 has phytyl-P kinase activity. Overexpression of VTE6 resulted in increased phytyl-diphosphate and tocopherol contents in seeds, indicating that VTE6 encodes phytyl-phosphate kinase. The severe growth retardation of vte6 mutants was partially rescued by introducing the phytol kinase mutation vte5. Double mutant plants (vte5 vte6) are tocopherol deficient and contain more chlorophyll, but reduced amounts of phytol and phytyl-phosphate compared with vte6 mutants, suggesting that phytol or phytyl-phosphate are detrimental to plant growth. Therefore, VTE6 represents the missing phytyl-phosphate kinase, linking phytol release from chlorophyll with tocopherol synthesis. Moreover, tocopherol synthesis in leaves depends on phytol derived from chlorophyll, not on de novo synthesis of phytyl-diphosphate from geranylgeranyl-diphosphate. PMID:26452599
Luo, Shi-Hong; Schmidt, Axel; Sun, Gui-Ling; Kuang, Ce; Yang, Min-Jie; Jing, Shu-Xi; Li, Chun-Huan
2016-01-01
Plant sesterterpenoids, an important class of terpenoids, are widely distributed in various plants, including food crops. However, little is known about their biosynthesis. Here, we cloned and functionally characterized a plant geranylfarnesyl diphosphate synthase (Lc-GFDPS), the enzyme producing the C25 prenyl diphosphate precursor to all sesterterpenoids, from the glandular trichomes of the woody plant Leucosceptrum canum. GFDPS catalyzed the formation of GFDP after expression in Escherichia coli. Overexpressing GFDPS in Arabidopsis thaliana also gave an extract catalyzing GFDP formation. GFDPS was strongly expressed in glandular trichomes, and its transcript profile was completely in accordance with the sesterterpenoid accumulation pattern. GFDPS is localized to the plastids, and inhibitor studies indicated its use of isoprenyl diphosphate substrates supplied by the 2-C-methyl-d-erythritol 4-phosphate pathway. Application of a jasmonate defense hormone induced GFDPS transcript and sesterterpenoid accumulation, while reducing feeding and growth of the generalist insect Spodoptera exigua, suggesting that these C25 terpenoids play a defensive role. Phylogenetic analysis suggested that GFDPS probably evolved from plant geranylgeranyl diphosphate synthase under the influence of positive selection. The isolation of GFDPS provides a model for investigating sesterterpenoid formation in other species and a tool for manipulating the formation of this group in plants and other organisms. PMID:26941091
Agabiti, Sherry S; Li, Jin; Wiemer, Andrew J
2017-03-16
Bisphosphonates are diphosphate analogs that inhibit the intermediate enzymes of the mevalonate pathway. Here, we compared the effects of a farnesyl diphosphate synthase inhibitor, zoledronate, and a geranylgeranyl diphosphate synthase (GGDPS) inhibitor, digeranyl bisphosphonate (DGBP), on lymphocytic leukemia cell proliferation and apoptosis. Both zoledronate and DGBP inhibited proliferation with DGBP doing so more potently. DGBP was markedly less toxic than zoledronate toward the viability of healthy human peripheral blood mononuclear cells. Addition of GGPP, but not farnesyl diphosphate (FPP), prevented the anti-proliferative effects of DGBP. Both GGPP and FPP partially rescued the effects of zoledronate. Co-treatment with DGBP and zoledronate was antagonistic. To further assess the effects of the bisphosphonates, we analyzed annexin V and propidium iodide staining via flow cytometry and found that DGBP induced apoptosis more potently than zoledronate. Western blots show that DGBP treatment altered expression and membrane affinity of some but not all geranylgeranylated small GTPases, activated caspases and increased ERK phosphorylation. Importantly, the anti-proliferative effects of DGBP were blocked by treatment with a caspase inhibitor and by treatment with a MEK inhibitor. Together, our findings indicate that DGBP is a more potent and selective compound than zoledronate in inducing apoptosis mediated through pathways that include caspases and MEK/ERK. These findings support the further development of GGDPS inhibitors as anticancer therapeutics.
Kemper, Katarina; Hirte, Max; Reinbold, Markus; Fuchs, Monika; Brück, Thomas
2017-01-01
With over 50.000 identified compounds terpenes are the largest and most structurally diverse group of natural products. They are ubiquitous in bacteria, plants, animals and fungi, conducting several biological functions such as cell wall components or defense mechanisms. Industrial applications entail among others pharmaceuticals, food additives, vitamins, fragrances, fuels and fuel additives. Central building blocks of all terpenes are the isoprenoid compounds isopentenyl diphosphate and dimethylallyl diphosphate. Bacteria like Escherichia coli harbor a native metabolic pathway for these isoprenoids that is quite amenable for genetic engineering. Together with recombinant terpene biosynthesis modules, they are very suitable hosts for heterologous production of high value terpenes. Yet, in contrast to the number of extracted and characterized terpenes, little is known about the specific biosynthetic enzymes that are involved especially in the formation of highly functionalized compounds. Novel approaches discussed in this review include metabolic engineering as well as site-directed mutagenesis to expand the natural terpene landscape. Focusing mainly on the validation of successful integration of engineered biosynthetic pathways into optimized terpene producing Escherichia coli , this review shall give an insight in recent progresses regarding manipulation of mostly diterpene synthases.
Palaniyar, Nades; Nadesalingam, Jeya; Clark, Howard; Shih, Michael J; Dodds, Alister W; Reid, Kenneth B M
2004-07-30
Collectins are a family of innate immune proteins that contain fibrillar collagen-like regions and globular carbohydrate recognition domains (CRDs). The CRDs of these proteins recognize various microbial surface-specific carbohydrate patterns, particularly hexoses. We hypothesized that collectins, such as pulmonary surfactant proteins (SPs) SP-A and SP-D and serum protein mannose-binding lectin, could recognize nucleic acids, pentose-based anionic phosphate polymers. Here we show that collectins bind DNA from a variety of origins, including bacteria, mice, and synthetic oligonucleotides. Pentoses, such as arabinose, ribose, and deoxyribose, inhibit the interaction between SP-D and mannan, one of the well-studied hexose ligands for SP-D, and biologically relevant d-forms of the pentoses are better competitors than the l-forms. In addition, DNA and RNA polymer-related compounds, such as nucleotide diphosphates and triphosphates, also inhibit the carbohydrate binding ability of SP-D, or approximately 60 kDa trimeric recombinant fragments of SP-D that are composed of the alpha-helical coiled-coil neck region and three CRDs (SP-D(n/CRD)) or SP-D(n/CRD) with eight GXY repeats (SPD(GXY)(8)(n/CRD)). Direct binding and competition studies suggest that collectins bind nucleic acid via their CRDs as well as by their collagen-like regions, and that SP-D binds DNA more effectively than do SP-A and mannose-binding lectin at physiological salt conditions. Furthermore, the SP-D(GXY)(8)(n/CRD) fragments co-localize with DNA, and the protein competes the interaction between propidium iodide, a DNA-binding dye, and apoptotic cells. In conclusion, we show that collectins are a new class of proteins that bind free DNA and the DNA present on apoptotic cells by both their globular CRDs and collagen-like regions. Collectins may therefore play an important role in decreasing the inflammation caused by DNA in lungs and other tissues.
New Synthetic Methodology for the Construction of 7-Substituted Farnesyl Diphosphate Analogs
Placzek, Andrew T.
2012-01-01
Through the use of a 1,2-metalate rearrangement, six 7-substituted farnesol analogs were generated in a concise manner. This new synthetic route allowed us to quickly prepare several diverse farnesyl diphosphate analogs with interesting biological activities against mammalian protein-farnesyl transferase. PMID:21699139
Manipulation of GES and ERG20 for geraniol overproduction in Saccharomyces cerevisiae.
Jiang, Guo-Zhen; Yao, Ming-Dong; Wang, Ying; Zhou, Liang; Song, Tian-Qing; Liu, Hong; Xiao, Wen-Hai; Yuan, Ying-Jin
2017-05-01
Manipulation of monoterpene synthases to maximize flux towards targeted products from GPP (geranyl diphosphate) is the main challenge for heterologous monoterpene overproduction, in addition to cell toxicity from compounds themselves. In our study, by manipulation of the key enzymes geraniol synthase (GES) and farnesyl diphosphate synthase (Erg20), geraniol (a valuable acyclic monoterpene alcohol) overproduction was achieved in Saccharomyces cerevisiae with truncated 3-hydroxy-3-methylglutaryl-coenzyme reductase (tHMGR) and isopentenyl diphosphate isomerase (IDI1) overexpressed. The expressions of all above engineered genes were under the control of Gal promoter for alleviating product toxicity. Geraniol production varied from trace amount to 43.19mg/L (CrGES, GES from Catharanthus roseus) by screening of nine GESs from diverse species. Further through protein structure analysis and site-directed mutation in CrGES, it was firstly demonstrated that among the high-conserved amino acid residues located in active pocket, Y436 and D501 with strong affinity to diphosphate function group, were critical for the dephosphorylation (the core step for geraniol formation). Moreover, the truncation position of the transit peptide from the N-terminus of CrGES was found to influence protein expression and activity significantly, obtaining a titer of 191.61mg/L geraniol in strain with CrGES truncated at S43 (t3CrGES). Furthermore, directed by surface electrostatics distribution of t3CrGES and Erg20 WW (Erg20 F96W-N127W ), co-expression of the reverse fusion of Erg20 ww /t3CrGES and another copy of Erg20 WW promoted the geraniol titer to 523.96mg/L at shakes flask level, due to enhancing GPP accessibility led by protein interaction of t3CrGES-Erg20 WW and the free Erg20 WW . Eventually, a highest reported titer of 1.68g/L geraniol in eukaryote cells was achieved in 2.0L fed-batch fermentation under carbon restriction strategy. Our research opens large opportunities for other microbial production of monoterpenes. It also sets a good reference for desired compounds overproduction in microorganisms in terms of manipulation of key enzymes by protein engineering and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.
El Zoeiby, A; Sanschagrin, F; Lamoureux, J; Darveau, A; Levesque, R C
2000-02-15
We cloned and sequenced the murC gene from Pseudomonas aeruginosa encoding a protein of 53 kDa. Multiple alignments with 20 MurC peptide sequences from different bacteria confirmed the presence of highly conserved regions having sequence identities ranging from 22-97% including conserved motifs for ATP-binding and the active site of the enzyme. Genetic complementation was done in Escherichia coli (murCts) suppressing the lethal phenotype. The murC gene was subcloned into the expression vector pET30a and overexpressed in E. coli BL21(lambdaDE3). Three PCR cloning strategies were used to obtain the three recombinant plasmids for expression of the native MurC, MurC His-tagged at N-terminal and at C-terminal, respectively. MurC His-tagged at C-terminal was chosen for large scale production and protein purification in the soluble form. The purification was done in a single chromatographic step on an affinity nickel column and obtained in mg quantities at 95% homogeneity. MurC protein was used to produce monoclonal antibodies for epitope mapping and for assay development in high throughput screenings. Detailed studies of MurC and other genes of the bacterial cell cycle will provide the reagents and strain constructs for high throughput screening and for design of novel antibacterials.
Liger, D; Masson, A; Blanot, D; van Heijenoort, J; Parquet, C
1995-05-15
The UDP-N-acetylmuramate:L-alanine ligase of Escherichia coli was over-produced in strains harbouring recombinant plasmids bearing the murC gene under the control of the lac or trc promoter. Plasmid pAM1005, in which the promoter and ribosome-binding site region of murC were removed and in which the gene was directly under the control of promoter trc, led to a 2000-fold amplification of the L-alanine-adding activity after induction by isopropyl-thio-beta-D-galactopyranoside. The murC gene product was visualized as a 50-kDa protein accounting for approximately 50% of the cell protein. A two-step purification led to 1 g of a homogeneous protein from an 18-1 culture. The N-terminal sequence of the purified protein correlated with the nucleotide sequence of the murC gene. The presence of 2-mercaptoethanol and glycerol was essential for the stability of the enzyme. The Km values for UDP-N-acetylmuramic acid, L-alanine and ATP/Mg2+ were estimated at 100, 20 and 450 microM, respectively. Under the optimal in vitro conditions a turnover number of 928 min-1 was calculated and a copy number/cell of 600 could be roughly estimated. The specificity of the enzyme for its substrates was investigated with various analogues. The enzyme also catalysed the reverse reaction.
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Chen, Bin Bin; Liu, Meng Li; Zhan, Lei; Li, Chun Mei; Huang, Cheng Zhi
2018-03-20
Highly selective and sensitive detection of guanosine 3'-diphosphate-5'-diphosphate (ppGpp), namely, the stringent in plants or microorganisms responding to strict or extreme environmental conditions such as stress and starvation, which plays an important role in gene expression, rRNA and antibiotics production, regulations of virulence of bacteria, and growth of plants, faces a great challenge owing to its extreme similarity to normal nucleotides. By modifying the surface groups of a facile two-step hydrothermal route prepared carbon dots (CDs) with terbium ions (Tb 3+ ) in this contribution, a novel fluorescent probe with excellent properties such as highly physical and chemical stability, narrow emission and excitation wavelength-independent emission was prepared. The Tb 3+ ions on the surface of CDs cannot only preserve the intrinsic fluorescence (FL) of CDs but also keep its own coordination capacity with rare earth complex, and thus the clamp structure (four phosphate groups) of ppGpp can specific binding with Tb 3+ ions on the surface of CDs to produce antenna effect. Therefore, a highly selective and sensitive fluorescent ratiometry of ppGpp was developed by terbium-modified carbon dots (CDs-Tb) with the limit of detection as low as 50 nM based on the synergistic effect of antenna effect of Tb 3+ ions and specific recognition capacity of CDs. The applicability of this assay was demonstrated by CDs-Tb-based paper sensor for high distinguishing ppGpp from other nucleotides with similar structure.
Johnson, Larry; Atanasova, Kalina R.; Bui, Phuong Q.; Lee, Jungnam; Hung, Shu-Chen; Yilmaz, Özlem; Ojcius, David M.
2015-01-01
Many intracellular pathogens evade the innate immune response in order to survive and proliferate within infected cells. We show that Porphyromonas gingivalis, an intracellular opportunistic pathogen, uses a nucleoside-diphosphate kinase (NDK) homolog to inhibit innate immune responses due to stimulation by extracellular ATP, which acts as a danger signal that binds to P2X7 receptors and induces activation of an inflammasome and caspase-1. Thus, infection of gingival epithelial cells (GECs) with wild-type P. gingivalis results in inhibition of ATP-induced caspase-1 activation. However, ndk-deficient P. gingivalis is less effective than wild-type P. gingivalis in reducing ATP-mediated caspase-1 activation and secretion of the proinflammatory cytokine, IL-1β, from infected GECs. Furthermore, P. gingivalis NDK modulates release of high-mobility group protein B1 (HMGB1), a pro-inflammatory danger signal, which remains associated with chromatin in healthy cells. Unexpectedly, infection with either wild-type or ndk-deficient P. gingivalis causes release of HMGB1 from the nucleus to the cytosol. But HMGB1 is released to the extracellular space when uninfected GECs are further stimulated with ATP, and there is more HMGB1 released from the cells when ATP-treated cells are infected with ndk-deficient mutant than wild-type P. gingivalis. Our results reveal that NDK plays a significant role in inhibiting P2X7-dependent inflammasome activation and HMGB1 release from infected GECs. PMID:25828169
Ghosh, Amrita; Shrivastav, Anupama; Jose, D Amilan; Mishra, Sanjiv K; Chandrakanth, C K; Mishra, Sandhya; Das, Amitava
2008-07-15
The chromogenic complex 1 x Zn (where 1 is (E)-4-(4-dimethylamino-phenylazo)-N,N-bispyridin-2-ylmethyl-benzenesulfonamide) showed high affinity toward the phosphate ion in tetrabutylammonium phosphate in acetonitrile solution and could preferentially bind to adenosine triphosphate (ATP) in aqueous solution at physiological pH. This binding caused a visual change in color, whereas no such change was noticed with other related anions (adenosine monophosphate, adenosine diphosphate, pyrophosphate, and phosphate) of biological significance. Thus, 1 x Zn could be used as a staining agent for different biological cells through binding to the ATP, generated in situ by the mitochondria (in eukaryotes). For prokaryotes (bacteria) the cell membrane takes care of the cells' energy conversion, since they lack mitochondria. ATP is produced in their unique cell structure on the cell membrane, which is not found in any eukaryotes. These stained cells could be viewed with normal light microscopy. This reagent could even be used for distinguishing the gram-positive and the gram-negative bacteria (prokaryotes). This dye was found to be nonlipophilic in nature and nontoxic to living microbes (eukaryotes and prokaryotes). Further, stained cells were found to grow in their respective media, and this confirmed the maintenance of viability of the microbes even after staining, unlike with many other dyes available commercially.
Grabińska, Kariona A; Park, Eon Joo; Sessa, William C
2016-08-26
cis-Prenyltransferases (cis-PTs) constitute a large family of enzymes conserved during evolution and present in all domains of life. cis-PTs catalyze consecutive condensation reactions of allylic diphosphate acceptor with isopentenyl diphosphate (IPP) in the cis (Z) configuration to generate linear polyprenyl diphosphate. The chain lengths of isoprenoid carbon skeletons vary widely from neryl pyrophosphate (C10) to natural rubber (C>10,000). The homo-dimeric bacterial enzyme, undecaprenyl diphosphate synthase (UPPS), has been structurally and mechanistically characterized in great detail and serves as a model for understanding the mode of action of eukaryotic cis-PTs. However, recent experiments have revealed that mammals, fungal, and long-chain plant cis-PTs are heteromeric enzymes composed of two distantly related subunits. In this review, the classification, function, and evolution of cis-PTs will be discussed with a special emphasis on the role of the newly described NgBR/Nus1 subunit and its plants' orthologs as essential, structural components of the cis-PTs activity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of the enzyme's active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modeling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.
NASA Astrophysics Data System (ADS)
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of the enzyme’s active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modelling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.
Asano, Kyouhei; Lee, Jung-Bum; Yamamura, Yoshimi; Kurosaki, Fumiya
2013-12-01
Leaf tissues of Atropa belladonna were transformed by Sdrac2, a Rac GTPase gene, that is isolated from Scoparia dulcis, and the change in atropine concentration of the transformants was examined. Re-differentiated A. belladonna overexpressing Sdrac2 accumulated considerable concentration of atropine in the leaf tissues, whereas the leaves of plants transformed by an empty vector accumulated only a very low concentration of the compound. A. belladonna transformed by CASdrac2, a modified Sdrac2 of which translate was expected to bind guanosine triphosphate (GTP) permanently, accumulated very high concentrations of atropine (approximately 2.4-fold excess to those found in the wild-type plant in its natural habitat). In sharp contrast, the atropine concentration in transformed A. belladonna prepared with negatively modified Sdrac2, DNSdrac2, expected to bind guanosine diphosphate instead of GTP, was very low. These results suggested that Rac GTPases play an important role in the regulation of secondary metabolism in plant cells and that overexpression of the gene(s) may be capable of enhancing the production of natural products accumulated in higher plant cells.
Wang, Zhao V.; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L.; Morales, Cyndi R.; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A.; Rothermel, Beverly A.; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P.A.; Ferdous, Anwarul; Gillette, Thomas G.; Scherer, Philipp E.; Hill, Joseph A.
2014-01-01
SUMMARY The hexosamine biosynthetic pathway (HBP) generates UDP-GlcNAc (uridine diphosphate N-acetylglucosamine) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis, by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. PMID:24630721
Wang, Zhao V; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L; Morales, Cyndi R; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A; Rothermel, Beverly A; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P A; Ferdous, Anwarul; Gillette, Thomas G; Scherer, Philipp E; Hill, Joseph A
2014-03-13
The hexosamine biosynthetic pathway (HBP) generates uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. Copyright © 2014 Elsevier Inc. All rights reserved.
Gutensohn, Michael; Orlova, Irina; Nguyen, Thuong T H; Davidovich-Rikanati, Rachel; Ferruzzi, Mario G; Sitrit, Yaron; Lewinsohn, Efraim; Pichersky, Eran; Dudareva, Natalia
2013-08-01
Geranyl diphosphate (GPP), the precursor of most monoterpenes, is synthesized in plastids from dimethylallyl diphosphate and isopentenyl diphosphate by GPP synthases (GPPSs). In heterodimeric GPPSs, a non-catalytic small subunit (GPPS-SSU) interacts with a catalytic large subunit, such as geranylgeranyl diphosphate synthase, and determines its product specificity. Here, snapdragon (Antirrhinum majus) GPPS-SSU was over-expressed in tomato fruits under the control of the fruit ripening-specific polygalacturonase promoter to divert the metabolic flux from carotenoid formation towards GPP and monoterpene biosynthesis. Transgenic tomato fruits produced monoterpenes, including geraniol, geranial, neral, citronellol and citronellal, while exhibiting reduced carotenoid content. Co-expression of the Ocimum basilicum geraniol synthase (GES) gene with snapdragon GPPS-SSU led to a more than threefold increase in monoterpene formation in tomato fruits relative to the parental GES line, indicating that the produced GPP can be used by plastidic monoterpene synthases. Co-expression of snapdragon GPPS-SSU with the O. basilicum α-zingiberene synthase (ZIS) gene encoding a cytosolic terpene synthase that has been shown to possess both sesqui- and monoterpene synthase activities resulted in increased levels of ZIS-derived monoterpene products compared to fruits expressing ZIS alone. These results suggest that re-direction of the metabolic flux towards GPP in plastids also increases the cytosolic pool of GPP available for monoterpene synthesis in this compartment via GPP export from plastids. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Bacopa monniera recombinant mevalonate diphosphate decarboxylase: Biochemical characterization.
Abbassi, Shakeel J; Vishwakarma, Rishi K; Patel, Parth; Kumari, Uma; Khan, Bashir M
2015-08-01
Mevalonate diphosphate decarboxylase (MDD; EC 4.1.1.33) is an important enzyme in the mevalonic acid pathway catalyzing the Mg(2+)-ATP dependant decarboxylation of mevalonate 5-diphosphate (MVAPP) to isopentenyl diphosphate (IPP). Bacopa monniera recombinant MDD (BmMDD) protein was overexpressed in Escherichia coli BL21 (DE3) strain and purified to apparent homogeneity. Km and Vmax for MVAPP were 144 μM and 52 U mg(-1) respectively. The values of turnover (kcat) and kcat/Km for mevalonate 5-diphosphate were determined to be 40s(-1) and 2.77×10(5) M(-1) s(-1) and kcat and kcat/Km values for ATP were found to be 30 s(-1) and 2.20×10(4) M(-1) s(-1), respectively. pH activity profile indicated the involvement of carboxylate ion, lysine and arginine for the activity of enzyme. The apparent activation energy for the BmMDD catalyzed reaction was 12.7 kJ mol(-1). Optimum pH and temperature for the forward reaction was found to be 8.0 and 45 °C. The enzyme was most stable at pH 7 at 20 °C with the deactivation rate constant (Kd(*)) of 1.69×10(-4) and half life (t1/2) of 68 h. The cation studies suggested that BmMDD is a cation dependant enzyme and optimum activity was achieved in the presence of Mg(2+). Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Yazaki, Kazufumi; Kunihisa, Miyuki; Fujisaki, Takahiro; Sato, Fumihiko
2002-02-22
Two cDNAs encoding geranyl diphosphate:4-hy- droxybenzoate 3-geranyltransferase were isolated from Lithospermum erythrorhizon by nested PCR using the conserved amino acid sequences among polyprenyl- transferases for ubiquinone biosynthesis. They were functionally expressed in yeast COQ2 disruptant and showed a strict substrate specificity for geranyl diphosphate as the prenyl donor, in contrast to ubiquinone biosynthetic enzymes, suggesting that they are involved in the biosynthesis of shikonin, a naphthoquinone secondary metabolite. Regulation of their expression by various culture conditions coincided with that of geranyltransferase activity and the secondary metabolites biosynthesized via this enzyme. This is the first established plant prenyltransferase that transfers the prenyl chain to an aromatic substrate.
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
Rai, Avanish; Smita, Shachi S; Singh, Anup Kumar; Shanker, Karuna; Nagegowda, Dinesh A
2013-09-01
Catharanthus roseus is the sole source of two most important monoterpene indole alkaloid (MIA) anti-cancer agents: vinblastine and vincristine. MIAs possess a terpene and an indole moiety derived from terpenoid and shikimate pathways, respectively. Geranyl diphosphate (GPP), the entry point to the formation of terpene moiety, is a product of the condensation of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) by GPP synthase (GPPS). Here, we report three genes encoding proteins with sequence similarity to large subunit (CrGPPS.LSU) and small subunit (CrGPPS.SSU) of heteromeric GPPSs, and a homomeric GPPSs. CrGPPS.LSU is a bifunctional enzyme producing both GPP and geranyl geranyl diphosphate (GGPP), CrGPPS.SSU is inactive, whereas CrGPPS is a homomeric enzyme forming GPP. Co-expression of both subunits in Escherichia coli resulted in heteromeric enzyme with enhanced activity producing only GPP. While CrGPPS.LSU and CrGPPS showed higher expression in older and younger leaves, respectively, CrGPPS.SSU showed an increasing trend and decreased gradually. Methyl jasmonate (MeJA) treatment of leaves significantly induced the expression of only CrGPPS.SSU. GFP localization indicated that CrGPPS.SSU is plastidial whereas CrGPPS is mitochondrial. Transient overexpression of AmGPPS.SSU in C. roseus leaves resulted in increased vindoline, immediate monomeric precursor of vinblastine and vincristine. Although C. roseus has both heteromeric and homomeric GPPS enzymes, our results implicate the involvement of only heteromeric GPPS with CrGPPS.SSU regulating the GPP flux for MIA biosynthesis.
Chaves, Julie E; Romero, Paloma Rueda; Kirst, Henning; Melis, Anastasios
2016-12-01
Heterologous production of isoprene (C 5 H 8 ) hydrocarbons in cyanobacteria, emanating from sunlight, CO 2 , and water, is now attracting increasing attention. The concept entails application of an isoprene synthase transgene from terrestrial plants, heterologously expressed in cyanobacteria, aiming to reprogram carbon flux in the terpenoid biosynthetic pathway toward formation and spontaneous release of this volatile chemical from the cell and liquid culture. However, flux manipulations and carbon-partitioning reactions between isoprene (the product) and native terpenoid biosynthesis for cellular needs are not yet optimized for isoprene yield. The primary reactant for isoprene biosynthesis is dimethylallyl diphosphate (DMAPP), whereas both DMAPP and its isopentenyl diphosphate (IPP) isomer are needed for cellular terpenoid biosynthesis. The present work addressed the function of an isopentenyl diphosphate (IPP) isomerase in cyanobacteria and its role in carbon partitioning between IPP and DMAPP, both of which serve, in variable ratios, as reactants for the synthesis of different cellular terpenoids. The work was approached upon the heterologous expression in Synechocystis of the "isopentenyl diphosphate isomerase" gene (FNI) from Streptococcus pneumoniae, using isoprene production as a "reporter process" for substrate partitioning between DMAPP and IPP. It is shown that transgenic expression of the FNI gene in Synechocystis resulted in a 250 % increase in the "reporter isoprene" rate and yield, suggesting that the FNI isomerase shifted the endogenous DMAPP-IPP steady-state pool size toward DMAPP, thereby enhancing rates and yield of isoprene production. The work provides insight into the significance and functional role of the IPP isomerase in these photosynthetic microorganisms.
Mevalonate Biosynthesis Intermediates Are Key Regulators of Innate Immunity in Bovine Endometritis
Collier, Christine; Griffin, Sholeem; Schuberth, Hans-Joachim; Sandra, Olivier; Smith, David G.; Mahan, Suman; Dieuzy-Labaye, Isabelle; Sheldon, I. Martin
2016-01-01
Metabolic changes can influence inflammatory responses to bacteria. To examine whether localized manipulation of the mevalonate pathway impacts innate immunity, we exploited a unique mucosal disease model, endometritis, where inflammation is a consequence of innate immunity. IL responses to pathogenic bacteria and LPS were modulated in bovine endometrial cell and organ cultures by small molecules that target the mevalonate pathway. Treatment with multiple statins, bisphosphonates, squalene synthase inhibitors, and small interfering RNA showed that inhibition of farnesyl-diphosphate farnesyl transferase (squalene synthase), but not 3-hydroxy-3-methylglutaryl-CoA reductase or farnesyl diphosphate synthase, reduced endometrial organ and cellular inflammatory responses to pathogenic bacteria and LPS. Although manipulation of the mevalonate pathway reduced cellular cholesterol, impacts on inflammation were independent of cholesterol concentration as cholesterol depletion using cyclodextrins did not alter inflammatory responses. Treatment with the isoprenoid mevalonate pathway-intermediates, farnesyl diphosphate and geranylgeranyl diphosphate, also reduced endometrial cellular inflammatory responses to LPS. These data imply that manipulating the mevalonate pathway regulates innate immunity within the endometrium, and that isoprenoids are regulatory molecules in this process, knowledge that could be exploited for novel therapeutic strategies. PMID:26673142
Ge, Deyong; Xue, Yanfen; Ma, Yanhe
2016-05-11
Bacillus species, possessing the methylerythritol phosphate (MEP) pathway for the synthesis of isoprenoid feedstock, are the highest producers of isoprene among bacteria; however, the enzyme responsible for isoprene synthesis has not been identified. The iron-sulfur protein IspH is the final enzyme of the MEP pathway and catalyses the reductive dehydration of (E)-4-hydroxy-3-methyl-2-butenyl diphosphate (HMBPP) to form isopentenyl diphosphate and dimethylallyl diphosphate (DMAPP). In this study, we demonstrated two unexpected promiscuous activities of IspH from alkaliphilic Bacillus sp. N16-5, which can produce high levels of isoprene. Bacillus sp. N16-5 IspH could catalyse the formation of isoprene from HMBPP and the conversion of DMAPP into a mixture of 2-methyl-2-butene and 3-methyl-1-butene. Both reactions require an electron transfer system, such as that used for HMBPP dehydration. Isoprene and isoamylene synthesis in Bacillus sp. N16-5 was investigated and the reaction system was reconstituted in vitro, including IspH, ferredoxin and ferredoxin-NADP(+)-reductase proteins and NADPH. The roles of specific IspH protein residues were also investigated by site-directed mutagenesis experiments; two variants (H131N and E133Q) were found to have lost the HMBPP reductase activity but could still catalyse the formation of isoprene. Overexpression of IspH H131N in Bacillus sp. N16-5 resulted in a twofold enhancement of isoprene production, and the yield of isoprene from the strain expressing E133Q was increased 300% compared with the wild-type strain. IspH from Bacillus sp. N16-5 is a promiscuous enzyme that can catalyse formation of isoprene and isoamylene. This enzyme, especially the H131N and E133Q variants, could be used for the production of isoprene from HMBPP.
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Olson, Andrew L.; Yao, Huili; Herdendorf, Timothy J.; Miziorko, Henry M.; Hannongbua, Supa; Saparpakorn, Patchareenart; Cai, Sheng; Sem, Daniel S.
2008-01-01
Phosphomevalonate kinase (PMK) catalyzes an essential step in the mevalonate pathway, which is the only pathway for synthesis of isoprenoids and steroids in humans. PMK catalyzes transfer of the γ-phosphate of ATP to mevalonate 5-phosphate (M5P) to form mevalonate 5-diphosphate. Bringing these phosphate groups in proximity to react is especially challenging, given the high negative charge density on the four phosphate groups in the active site. As such, conformational and dynamics changes needed to form the Michaelis complex are of mechanistic interest. Herein, we report the characterization of substrate induced changes (Mg-ADP, M5P, and the ternary complex) in PMK, using NMR-based dynamics and chemical shift perturbation measurements. Mg-ADP and M5P Kd's were 6-60 μM in all complexes, consistent with there being little binding synergy. Binding of M5P causes the PMK structure to compress (τc= 13.5 nsec), while subsequent binding of Mg-ADP opens the structure up (τc= 17.6 nsec). The overall complex seems to stay very rigid on the psec-nsec timescale with an average NMR order parameter of S2∼0.88. Data are consistent with addition of M5P causing movement around a hinge region to permit domain closure, which would bring the M5P domain close to ATP to permit catalysis. Dynamics data identify potential hinge residues as H55 and R93, based on their low order parameters and their location in extended regions that connect the M5P and ATP domains in the PMK homology model. Likewise, D163 may be a hinge residue for the lid region that is homologous to the adenylate kinase lid, covering the “Walker-A” catalytic loop. Binding of ATP or ADP appears to cause similar conformational changes; but, these observations do not indicate an obvious role for γ-phosphate binding interactions. Indeed, the role of γ-phosphate interactions may be more subtle than suggested by ATP/ADP comparisons, since the conservative O to NH substitution in the β-γ bridge of ATP causes a dramatic decrease in affinity and induces few chemical shift perturbations. In terms of positioning of catalytic residues, binding of M5P induces a rigidification of Gly21 (adjacent to the catalytically important Lys22), although exchange broadening in the ternary complex suggests some motion on a slower timescale does still occur. Finally, the first 9 residues of the N-terminus are highly disordered, suggesting they may be part of a cleavable signal or regulatory peptide sequence. PMID:18798562
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Phosphoribosyl Diphosphate (PRPP): Biosynthesis, Enzymology, Utilization, and Metabolic Significance
Andersen, Kasper R.; Kilstrup, Mogens; Martinussen, Jan; Switzer, Robert L.; Willemoës, Martin
2016-01-01
SUMMARY Phosphoribosyl diphosphate (PRPP) is an important intermediate in cellular metabolism. PRPP is synthesized by PRPP synthase, as follows: ribose 5-phosphate + ATP → PRPP + AMP. PRPP is ubiquitously found in living organisms and is used in substitution reactions with the formation of glycosidic bonds. PRPP is utilized in the biosynthesis of purine and pyrimidine nucleotides, the amino acids histidine and tryptophan, the cofactors NAD and tetrahydromethanopterin, arabinosyl monophosphodecaprenol, and certain aminoglycoside antibiotics. The participation of PRPP in each of these metabolic pathways is reviewed. Central to the metabolism of PRPP is PRPP synthase, which has been studied from all kingdoms of life by classical mechanistic procedures. The results of these analyses are unified with recent progress in molecular enzymology and the elucidation of the three-dimensional structures of PRPP synthases from eubacteria, archaea, and humans. The structures and mechanisms of catalysis of the five diphosphoryltransferases are compared, as are those of selected enzymes of diphosphoryl transfer, phosphoryl transfer, and nucleotidyl transfer reactions. PRPP is used as a substrate by a large number phosphoribosyltransferases. The protein structures and reaction mechanisms of these phosphoribosyltransferases vary and demonstrate the versatility of PRPP as an intermediate in cellular physiology. PRPP synthases appear to have originated from a phosphoribosyltransferase during evolution, as demonstrated by phylogenetic analysis. PRPP, furthermore, is an effector molecule of purine and pyrimidine nucleotide biosynthesis, either by binding to PurR or PyrR regulatory proteins or as an allosteric activator of carbamoylphosphate synthetase. Genetic analyses have disclosed a number of mutants altered in the PRPP synthase-specifying genes in humans as well as bacterial species. PMID:28031352
Ostertag, Luisa M; Kroon, Paul A; Wood, Sharon; Horgan, Graham W; Cienfuegos-Jovellanos, Elena; Saha, Shikha; Duthie, Garry G; de Roos, Baukje
2013-02-01
We examined whether flavan-3-ol-enriched dark chocolate, compared with standard dark and white chocolate, beneficially affects platelet function in healthy subjects, and whether this relates to flavan-3-ol bioavailability. A total of 42 healthy subjects received an acute dose of flavan-3-ol-enriched dark, standard dark or white chocolate, in random order. Blood and urine samples were obtained just before and 2 and 6 h after consumption for measurements of platelet function, and bioavailability and excretion of flavan-3-ols. Flavan-3-ol-enriched dark chocolate significantly decreased adenosine diphosphate-induced platelet aggregation and P-selectin expression in men (all p ≤ 0.020), decreased thrombin receptor-activating peptide-induced platelet aggregation and increased thrombin receptor-activating peptide-induced fibrinogen binding in women (both p ≤ 0.041), and increased collagen/epinephrine-induced ex vivo bleeding time in men and women (p ≤ 0.042). White chocolate significantly decreased adenosine diphosphate-induced platelet P-selectin expression (p = 0.002) and increased collagen/epinephrine-induced ex vivo bleeding time (p = 0.042) in men only. Differences in efficacy by which flavan-3-ols affect platelet function were only partially explained by concentrations of flavan-3-ols and their metabolites in plasma or urine. Flavan-3-ols in dark chocolate, but also compounds in white chocolate, can improve platelet function, dependent on gender, and may thus beneficially affect atherogenesis. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ARF6-dependent regulation of P2Y receptor traffic and function in human platelets.
Kanamarlapudi, Venkateswarlu; Owens, Sian E; Saha, Keya; Pope, Robert J; Mundell, Stuart J
2012-01-01
Adenosine diphosphate (ADP) is a critical regulator of platelet activation, mediating its actions through two G protein-coupled receptors, the P2Y(1) and P2Y(12) purinoceptors. Recently, we demonstrated that P2Y(1) and P2Y(12) purinoceptor activities are rapidly and reversibly modulated in human platelets, revealing that the underlying mechanism requires receptor internalization and subsequent trafficking as an essential part of this process. In this study we investigated the role of the small GTP-binding protein ADP ribosylation factor 6 (ARF6) in the internalization and function of P2Y(1) and P2Y(12) purinoceptors in human platelets. ARF6 has been implicated in the internalization of a number of GPCRs, although its precise molecular mechanism in this process remains unclear. In this study we show that activation of either P2Y(1) or P2Y(12) purinoceptors can stimulate ARF6 activity. Further blockade of ARF6 function either in cell lines or human platelets blocks P2Y purinoceptor internalization. This blockade of receptor internalization attenuates receptor resensitization. Furthermore, we demonstrate that Nm23-H1, a nucleoside diphosphate (NDP) kinase regulated by ARF6 which facilitates dynamin-dependent fission of coated vesicles during endocytosis, is also required for P2Y purinoceptor internalization. These data describe a novel function of ARF6 in the internalization of P2Y purinoceptors and demonstrate the integral importance of this small GTPase upon platelet ADP receptor function.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Walz, Felix H; Gibis, Monika; Schrey, Pia; Herrmann, Kurt; Reichert, Corina L; Hinrichs, Jörg; Weiss, Jochen
2017-10-01
This study aimed to prevent the phenomena of efflorescence formation on the surface of dry fermented sausages due to the complexation of efflorescence forming cations with phosphates. Efflorescence formation is a critical issue constituting a major quality defect, especially of dry fermented sausages. Different phosphates (di- and hexametaphosphate) were added (3.0g/kg) to the sausage batter. As a hypothesis, these additives should complex with one of the main efflorescence-causing substances such as magnesium. The formation of efflorescences was determined for dry fermented sausages without phosphate addition, with diphosphate, or hexametaphosphate addition during 8weeks of storage under modified atmosphere. The visual analyses of the sausage surface revealed high amounts of efflorescences for the control (42.2%) and for the sausages with added diphosphate (40.9%), whereas the sausages containing hexametaphosphate had significantly reduced amounts of efflorescence formation, showing only 11.9% efflorescences after 8weeks of storage. This inhibition was a result of strong complexation of hexametaphosphate with magnesium ions, thus preventing the diffusion of magnesium towards the sausage surface. This can be explained by the magnesium content on the sausage surface that increased by 163.9, 127.8, and 52.8% for the sausages without phosphate, diphosphate, and hexametaphosphate addition, respectively. The mass transport of lactate and creatine was not affected by phosphate addition. Isothermal titration calorimetry confirmed that, theoretically, 4.5g/kg of diphosphate or 2.8g/kg hexametaphosphate are required to complex 0.2g/kg magnesium ions naturally occurring in dry fermented sausages and, thus, the chosen overall phosphate concentration of 3.0g/kg was enough when adding hexametaphosphate, but not for diphosphate, to inhibit the efflorescence formation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Andrade, Paola; Caudepón, Daniel; Arró, Montserrat
2016-01-01
Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. PMID:27382138
Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert
2016-09-01
Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016 American Society of Plant Biologists. All rights reserved.
Gutensohn, Michael; Nguyen, Thuong T H; McMahon, Richard D; Kaplan, Ian; Pichersky, Eran; Dudareva, Natalia
2014-07-01
Recently it was shown that monoterpenes in tomato trichomes (Solanum lycopersicum) are synthesized by phellandrene synthase 1 (PHS1) from the non-canonical substrate neryl diphosphate (NPP), the cis-isomer of geranyl diphosphate (GPP). As PHS1 accepts both NPP and GPP substrates forming different monoterpenes, it was overexpressed in tomato fruits to test if NPP is also available in a tissue highly active in carotenoid production. However, transgenic fruits overexpressing PHS1 produced only small amounts of GPP-derived PHS1 monoterpene products, indicating the absence of endogenous NPP. Therefore, NPP formation was achieved by diverting the metabolic flux from carotenoids via expression of tomato neryl diphosphate synthase 1 (NDPS1). NDPS1 transgenic fruits produced NPP-derived monoterpenes, including nerol, neral and geranial, while displaying reduced lycopene content. NDPS1 co-expression with PHS1 resulted in a monoterpene blend, including β-phellandrene, similar to that produced from NPP by PHS1 in vitro and in trichomes. Unexpectedly, PHS1×NDPS1 fruits showed recovery of lycopene levels compared to NDPS1 fruits, suggesting that redirection of metabolic flux is only partially responsible for the reduction in carotenoids. In vitro assays demonstrated that NPP serves as an inhibitor of geranylgeranyl diphosphate synthase, thus its consumption by PHS1 leads to recovery of lycopene levels. Monoterpenes produced in PHS1×NDPS1 fruits contributed to direct plant defense negatively affecting feeding behavior of the herbivore Helicoverpa zea and displaying antifungal activity against Botrytis cinerea. These results show that NPP-derived terpenoids can be produced in plant tissues; however, NPP has to be consumed to avoid negative impacts on plant metabolism. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Na, Wei; Wu, Yuan-Yuan; Gong, Peng-Fei; Wu, Chun-Yan; Cheng, Bo-Han; Wang, Yu-Xiang; Wang, Ning; Du, Zhi-Qiang; Li, Hui
2018-05-23
In avian species, liver is the main site of de novo lipogenesis, and hepatic lipid metabolism relates closely to adipose fat deposition. Using our fat and lean chicken lines of striking differences in abdominal fat content, post-hatch lipid metabolism in both liver and adipose tissues has been studied extensively. However, whether molecular discrepancy for hepatic lipid metabolism exists in chicken embryos remains obscure. We performed transcriptome and proteome profiling on chicken livers at five embryonic stages (E7, E12, E14, E17 and E21) between the fat and lean chicken lines. At each stage, 521, 141, 882, 979 and 169 differentially expressed genes were found by the digital gene expression, respectively, which were significantly enriched in the metabolic, PPAR signaling and fatty acid metabolism pathways. Quantitative proteomics analysis found 20 differentially expressed proteins related to lipid metabolism, PPAR signaling, fat digestion and absorption, and oxidative phosphorylation pathways. Combined analysis showed that genes and proteins related to lipid transport (intestinal fatty acid-binding protein, nucleoside diphosphate kinase, and apolipoprotein A-I), lipid clearance (heat shock protein beta-1) and energy metabolism (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10 and succinate dehydrogenase flavoprotein subunit) were significantly differentially expressed between the two lines. For hepatic lipid metabolism at embryonic stages, molecular differences related to lipid transport, lipid clearance and energy metabolism exist between the fat and lean chicken lines, which might contribute to the striking differences of abdominal fat deposition at post-hatch stages.
The leukotriene E4 puzzle: finding the missing pieces and revealing the pathobiologic implications.
Austen, K Frank; Maekawa, Akiko; Kanaoka, Yoshihide; Boyce, Joshua A
2009-09-01
The intracellular parent of the cysteinyl leukotrienes (cysLTs), leukotriene (LT) C(4), is formed by conjugation of LTA(4) and reduced glutathione by LTC(4) synthase in mast cells, eosinophils, basophils, and macrophages. After extracellular export, LTC(4) is converted to LTD(4) and LTE(4) through sequential enzymatic removal of glutamic acid and then glycine. Only LTE(4) is sufficiently stable to be prominent in biologic fluids, such as urine or bronchoalveolar lavage fluid, of asthmatic individuals and at sites of inflammation in animal models. LTE(4) has received little attention because it binds poorly to the classical type 1 and 2 cysLT receptors and is much less active on normal airways than LTC(4) or LTD(4). However, early studies indicated that LTE(4) caused skin swelling in human subjects as potently as LTC(4) and LTD(4), that airways of asthmatic subjects (particularly those that were aspirin sensitive) were selectively hyperresponsive to LTE(4), and that a potential distinct LTE(4) receptor was present in guinea pig trachea. Recent studies have begun to uncover receptors selective for LTE(4): P2Y(12), an adenosine diphosphate receptor, and CysLT(E)R, which was observed functionally in the skin of mice lacking the type 1 and 2 cysLT receptors. These findings prompt a renewed focus on LTE(4) receptors as therapeutic targets that are not currently addressed by available receptor antagonists.
Heat-Responsive Photosynthetic and Signaling Pathways in Plants: Insight from Proteomics.
Wang, Xiaoli; Xu, Chenxi; Cai, Xiaofeng; Wang, Quanhua; Dai, Shaojun
2017-10-20
Heat stress is a major abiotic stress posing a serious threat to plants. Heat-responsive mechanisms in plants are complicated and fine-tuned. Heat signaling transduction and photosynthesis are highly sensitive. Therefore, a thorough understanding of the molecular mechanism in heat stressed-signaling transduction and photosynthesis is necessary to protect crop yield. Current high-throughput proteomics investigations provide more useful information for underlying heat-responsive signaling pathways and photosynthesis modulation in plants. Several signaling components, such as guanosine triphosphate (GTP)-binding protein, nucleoside diphosphate kinase, annexin, and brassinosteroid-insensitive I-kinase domain interacting protein 114, were proposed to be important in heat signaling transduction. Moreover, diverse protein patterns of photosynthetic proteins imply that the modulations of stomatal CO₂ exchange, photosystem II, Calvin cycle, ATP synthesis, and chlorophyll biosynthesis are crucial for plant heat tolerance.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Enzymatic properties and substrate specificity of a bacterial phosphatidylcholine synthase.
Aktas, Meriyem; Köster, Stefan; Kizilirmak, Sarah; Casanova, Javier C; Betz, Heidi; Fritz, Christiane; Moser, Roman; Yildiz, Özkan; Narberhaus, Franz
2014-08-01
Phosphatidylcholine (PC) is a rare membrane lipid in bacteria, but is crucial for virulence of the plant pathogen Agrobacterium tumefaciens and various other pathogens. Agrobacterium tumefaciens uses two independent PC biosynthesis pathways. One is dependent on the integral membrane protein PC synthase (Pcs), which catalyzes the conversion of cytidine diphosphate-diacylglycerol (CDP-DAG) and choline to PC, thereby releasing a cytidine monophosphate (CMP). Here, we show that Pcs consists of eight transmembrane segments with its N- and C-termini located in the cytoplasm. A cytoplasmic loop between the second and third membrane helix contains the majority of the conserved amino acids of a CDP-alcohol phosphotransferase motif (DGX2 ARX12 GX3 DX3 D). Using point mutagenesis, we provide evidence for a crucial role of this motif in choline binding and enzyme activity. To study the catalytic features of the enzyme, we established a purification protocol for recombinant Pcs. The enzyme forms stable oligomers and exhibits broad substrate specificity towards choline derivatives. The presence of CDP-DAG and manganese is a prerequisite for cooperative binding of choline. PC formation by Pcs is reversible and proceeds via two successive reactions. In a first choline- and manganese-independent reaction, CDP-DAG is hydrolyzed releasing a CMP molecule. The resulting phosphatidyl intermediate reacts with choline in a second manganese-dependent step to form PC. Pcs and Pcs bind by molecular sieving (1, 2, 3). © 2014 FEBS.
Witzel, Katja; Matros, Andrea; Møller, Anders L B; Ramireddy, Eswarayya; Finnie, Christine; Peukert, Manuela; Rutten, Twan; Herzog, Andreas; Kunze, Gotthard; Melzer, Michael; Kaspar-Schoenefeld, Stephanie; Schmülling, Thomas; Svensson, Birte; Mock, Hans-Peter
2018-06-01
Although the physiological consequences of plant growth under saline conditions have been well described, understanding the core mechanisms conferring plant salt adaptation has only started. We target the root plasma membrane proteomes of two barley varieties, cvs. Steptoe and Morex, with contrasting salinity tolerance. In total, 588 plasma membrane proteins were identified by mass spectrometry, of which 182 were either cultivar or salinity stress responsive. Three candidate proteins with increased abundance in the tolerant cv. Morex were involved either in sterol binding (a GTPase-activating protein for the adenosine diphosphate ribosylation factor [ZIGA2], and a membrane steroid binding protein [MSBP]) or in phospholipid synthesis (phosphoethanolamine methyltransferase [PEAMT]). Overexpression of barley MSBP conferred salinity tolerance to yeast cells, whereas the knock-out of the heterologous AtMSBP1 increased salt sensitivity in Arabidopsis. Atmsbp1 plants showed a reduced number of lateral roots under salinity, and root-tip-specific expression of barley MSBP in Atmsbp1 complemented this phenotype. In barley, an increased abundance of MSBP correlates with reduced root length and lateral root formation as well as increased levels of auxin under salinity being stronger in the tolerant cv. Morex. Hence, we concluded the involvement of MSBP in phytohormone-directed adaptation of root architecture in response to salinity. © 2018 John Wiley & Sons Ltd.
Mkrtchyan, Garik; Aleshin, Vasily; Parkhomenko, Yulia; Kaehne, Thilo; Luigi Di Salvo, Martino; Parroni, Alessia; Contestabile, Roberto; Vovk, Andrey; Bettendorff, Lucien; Bunik, Victoria
2015-01-01
Thiamin (vitamin B1) is a pharmacological agent boosting central metabolism through the action of the coenzyme thiamin diphosphate (ThDP). However, positive effects, including improved cognition, of high thiamin doses in neurodegeneration may be observed without increased ThDP or ThDP-dependent enzymes in brain. Here, we determine protein partners and metabolic pathways where thiamin acts beyond its coenzyme role. Malate dehydrogenase, glutamate dehydrogenase and pyridoxal kinase were identified as abundant proteins binding to thiamin- or thiazolium-modified sorbents. Kinetic studies, supported by structural analysis, revealed allosteric regulation of these proteins by thiamin and/or its derivatives. Thiamin triphosphate and adenylated thiamin triphosphate activate glutamate dehydrogenase. Thiamin and ThDP regulate malate dehydrogenase isoforms and pyridoxal kinase. Thiamin regulation of enzymes related to malate-aspartate shuttle may impact on malate/citrate exchange, responsible for exporting acetyl residues from mitochondria. Indeed, bioinformatic analyses found an association between thiamin- and thiazolium-binding proteins and the term acetylation. Our interdisciplinary study shows that thiamin is not only a coenzyme for acetyl-CoA production, but also an allosteric regulator of acetyl-CoA metabolism including regulatory acetylation of proteins and acetylcholine biosynthesis. Moreover, thiamin action in neurodegeneration may also involve neurodegeneration-related 14-3-3, DJ-1 and β-amyloid precursor proteins identified among the thiamin- and/or thiazolium-binding proteins. PMID:26212886
Petit, Chantal M; Koretke, Kristin K
2002-01-01
Thymidylate kinase (TMK) catalyses the phosphorylation of dTMP to form dTDP in both the de novo and salvage pathways of dTTP synthesis. The tmk gene from the bacterial pathogen Streptococcus pneumoniae was identified. The gene, encoding a 212-amino-acid polypeptide (23352 Da), was cloned and overexpressed in Escherichia coli with an N-terminal hexahistidine tag. The enzyme was purified to homogeneity, and characterized in the forward reaction. The pH profile of TMK indicates that its activity is optimal at pH 8.5. The substrate specificity of the enzyme was examined; it was found that not only ATP, but also dATP and to a lesser extent CTP, could act as phosphate donors, and dTMP and dUMP could serve as phosphate acceptors. Furthermore, AZT-MP (3'-azido-3'-deoxythymidine 5'-monophosphate) was shown not to be a substrate for S. pneumoniae TMK. Steady-state kinetics and inhibition studies with adenosine 5'-[beta-thio]diphosphate and dTDP in addition to isothermal titration calorimetry were performed. The data showed that binding follows an ordered pathway, in which ATP binds first with a K(m) of 235 +/- 46 microM and a K(d) of 116 +/- 3 microM, and dTMP binds secondly with a K(m) of 66 +/- 12 microM and a K(d) of 53 +/- 2 microM. PMID:11964185
Baker, Matthew D; Holloway, Daniel E; Swaminathan, G Jawahar; Acharya, K Ravi
2006-01-17
Eosinophil-derived neurotoxin (EDN) is a catalytically proficient member of the pancreatic ribonuclease superfamily secreted along with other eosinophil granule proteins during innate host defense responses and various eosinophil-related inflammatory and allergic diseases. The ribonucleolytic activity of EDN is central to its antiviral and neurotoxic activities and possibly to other facets of its biological activity. To probe the importance of this enzymatic activity further, specific inhibitors will be of great aid. Derivatives of 5'-ADP are among the most potent inhibitors currently known. Here, we use X-ray crystallography to investigate the binding of four natural nucleotides containing this moiety. 5'-ATP binds in two alternative orientations, one occupying the B2 subsite in a conventional manner and one being a retro orientation with no ordered adenosine moiety. Diadenosine triphosphate (Ap3A) and diadenosine tetraphosphate (Ap4A) bind with one adenine positioned at the B2 subsite, the polyphosphate chain extending across the P1 subsite in an ill-defined conformation, and a disordered second adenosine moiety. Diadenosine pentaphosphate (Ap5A), the most avid inhibitor of this series, binds in a completely ordered fashion with one adenine positioned conventionally at the B2 subsite, the polyphosphate chain occupying the P1 and putative P(-1) subsites, and the other adenine bound in a retro-like manner at the edge of the B1 subsite. The binding mode of each of these inhibitors has features seen in previously determined structures of adenosine diphosphates. We examine the structure-affinity relationships of these inhibitors and discuss the implications for the design of improved inhibitors.
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Wang, Yuqin; Muneton, Sabina; Sjövall, Jan; Jovanovic, Jasmina N; Griffiths, William J
2008-04-01
In humans, the brain represents only about 2% of the body's mass but contains about one-quarter of the body's free cholesterol. Cholesterol is synthesized de novo in brain and removed by metabolism to oxysterols. 24S-Hydoxycholesterol represents the major metabolic product of cholesterol in brain, being formed via the cytochrome P450 (CYP) enzyme CYP46A1. CYP46A1 is expressed exclusively in brain, normally by neurons. In this study, we investigated the effect of 24S-hydroxycholesterol on the proteome of rat cortical neurons. With the use of two-dimensional liquid chromatography linked to nanoelectrospray tandem mass spectrometry, over 1040 proteins were identified including members of the cholesterol, isoprenoid and fatty acid synthesis pathways. With the use of stable isotope labeling technology, the protein expression patterns of enzymes in these pathways were investigated. 24S-Hydroxycholesterol was found to down-regulate the expression of members of the cholesterol/isoprenoid synthesis pathways including 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (EC 2.3.3.10), diphosphomevalonate decarboxylase (EC 4.1.1.33), isopentenyl-diphosphate delta isomerase (EC 5.3.3.2), farnesyl-diphosphate synthase (Geranyl trans transferase, EC 2.5.1.10), and dedicated sterol synthesis enzymes, farnesyl-diphosphate farnesyltransferase 1 (squalene synthase, EC 2.5.1.21) and methylsterol monooxygenase (EC 1.14.13.72). The expression of many enzymes in the cholesterol/isoprenoid and fatty acid synthesis pathways are regulated by the membrane-bound transcription factors named sterol regulatory element-binding proteins (SREBPs), which themselves are both transcriptionally and post-transcriptionally regulated. The current proteomic data indicates that 24S-hydroxycholesterol down-regulates cholesterol synthesis in neurons, possibly, in a post-transcriptional manner through SREBP-2. In contrast to cholesterol metabolism, enzymes responsible for the synthesis of fatty acids were not found to be down-regulated in neurons treated with 24S-hydroxycholesterol, while apolipoprotein E (apo E), a cholesterol trafficking protein, was found to be up-regulated. Taken together, this data leads to the hypothesis that, in times of cholesterol excess, 24S-hydroxycholesterols signals down-regulation of cholesterol synthesis enzymes through SREBP-2, but up-regulates apo E synthesis (through the liver X receptor) leading to cholesterol storage and restoration of cholesterol balance.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
Tarachiwin, Lucksanaporn; Sakdapipanich, Jitladda; Ute, Koichi; Kitayama, Tatsuki; Bamba, Takashi; Fukusaki, Ei-Ichiro; Kobayashi, Akio; Tanaka, Yasuyuki
2005-01-01
Deproteinized natural rubber latex (DPNR-latex) was treated with lipase and phosphatase in order to analyze the structure of the chain-end group (alpha-terminal). The enzymatic treatment decreased the content of long-chain fatty acid ester groups in DPNR from about 6 to 2 mol per rubber molecule. The molecular weight and intrinsic viscosity were reduced to about one-third after treatment with lipase and phosphatase. The Huggins' k' constant of the enzyme-treated DPNR showed the formation of linear rubber molecules. The molecular weight distribution of DPNR changed apparently after treatment with lipase and phosphatase. (1)H NMR spectrum of rubber obtained from DPNR-latex showed small signals due to monophosphate, di-phosphate and phospholipids at the alpha-terminus. Treatment of DPNR-latex with lipase and phosphatase decreased the relative intensity of the (1)H NMR signals corresponding to phospholipids, whereas no change was observed for the signals due to mono- and diphosphates. The residual mono- and diphosphate signals as well as some phospholipid signals after lipase and phosphatase treatments indicate that mono- and diphosphate groups are directly linked at the alpha-terminus with the modified structure, expected by aggregation or linking with phospholipid molecules.
Duque, Marcelo Dutra; Kreidel, Rogério Nepomuceno; Taqueda, Maria Elena Santos; Baby, André Rolim; Kaneko, Telma Mary; Velasco, Maria Valéria Robles; Consiglieri, Vladi Olga
2013-01-01
A tablet formulation based on hydrophilic matrix with a controlled drug release was developed, and the effect of polymer concentrations on the release of primaquine diphosphate was evaluated. To achieve this purpose, a 20-run, four-factor with multiple constraints on the proportions of the components was employed to obtain tablet compositions. Drug release was determined by an in vitro dissolution study in phosphate buffer solution at pH 6.8. The polynomial fitted functions described the behavior of the mixture on simplex coordinate systems to study the effects of each factor (polymer) on tablet characteristics. Based on the response surface methodology, a tablet composition was optimized with the purpose of obtaining a primaquine diphosphate release closer to a zero order kinetic. This formulation released 85.22% of the drug for 8 h and its kinetic was studied regarding to Korsmeyer-Peppas model, (Adj-R(2) = 0.99295) which has confirmed that both diffusion and erosion were related to the mechanism of the drug release. The data from the optimized formulation were very close to the predictions from statistical analysis, demonstrating that mixture experimental design could be used to optimize primaquine diphosphate dissolution from hidroxypropylmethyl cellulose and polyethylene glycol matrix tablets.
NASA Astrophysics Data System (ADS)
Dacheux, N.; Podor, R.; Brandel, V.; Genet, M.
1998-02-01
In the framework of nuclear waste management aiming at the research of a storage matrix, the chemistry of thorium phosphates has been completely re-examined. In the ThO 2-P 2O 5 system a new compound thorium phosphate-diphosphate Th 4(PO 4) 4P 2O 7 has been synthesized. The replacement of Th 4+ by a smaller cation like U 4+ and Pu 4+ in the thorium phosphate-diphosphate (TPD) lattice has been achieved. Th 4- xU x(PO 4) 4P 2O 7 and Th 4- xPu x(PO 4) 4P 2O 7 solid solutions have been synthesized through wet and dry processes with 0< x<3.0 for uranium and 0< x<1.0 for plutonium. From the variation of the unit cell parameters, an upper x value equal to 1.67 has been estimated for the thorium-plutonium (IV) phosphate-diphosphate solid solutions. Two other tetravalent cations, Ce 4+ and Zr 4+, cannot be incorporated in the TPD lattice: cerium (IV) because of its reduction into Ce (III) at high temperature, and zirconium probably because of its too small radius compared to thorium.
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.
Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
Light-regulation of enzyme activity in anacystis nidulans (Richt.).
Duggan, J X; Anderson, L E
1975-01-01
The effect of light on the levels of activity of six enzymes which are light-modulated in higher plants was examined in the photosynthetic procaryot Anacystis nidulans. Ribulose-5-phosphate kinase (EC 2.7.1.19) was found to be light-activated in vivo and dithiothreitol-activated in vitro while glucose-6-phosphate dehydrogenase (EC 1.1.1.49) was light-inactivated and dithiothreitol-inactivated. The enzymes fructose-1,6-diphosphate phosphatase (EC 3.1.3.11), sedoheptulose-1,7-diphosphate phosphatase, NAD- and NADP-linked glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12; EC 1.2.1.13) were not affected by light treatment of the intact algae, but sedoheptulose-diphosphate phosphatase and the glyceraldehyde-3-phosphate dehydrogenases were dithiothreitol-activated in crude extracts. Light apparently controls the activity of the reductive and oxidative pentose phosphate pathway in this photosynthetic procaryot as in higher plants, through a process which probably involves reductive modulation of enzyme activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Sato, Akira; Takano, Takeshi; Hiramoto, Akiko; Naito, Tomoharu; Matsuda, Akira; Fukushima, Masakazu; Wataya, Yusuke; Kim, Hye-Sook
2017-08-01
A nucleosidic medicine, 1-(3-C-ethynyl-β-D-ribo-pentofuranosyl)cytosine [3'-ethynylcytidine (ECyd)], is a potent inhibitor of RNA polymerase I and shows anticancer activity to various human solid tumors in vitro and in vivo. ECyd is phosphorylated to 3'-ethyntlcytidine 5'-monophosphate by uridine/cytidine kinase 2 (UCK2) and subsequently further to diphosphate and triphosphate (3'-ethyntlcytidine 5'-diphosphate, 3'-ethyntlcytidine 5'-triphosphate). 3'-Ethyntlcytidine 5'-triphosphate is an active metabolite that can inhibit RNA polymerase I competitively, causing cancer cell death. Here, to identify the UCK2 mutation for detecting responder or nonresponder to ECyd, we investigated the relationship between point mutation of the UCK2 gene and response to ECyd in various human solid tumors. We identified several functional point mutations including the splice-site mutation of the UCK2 gene IVS5+5 G>A. In addition, we found that the IVS5+5 G>A variant generates an aberrant mRNA transcript, namely, truncated mRNA was produced and normal mRNA levels were markedly decreased in the ECyd-resistant cancer cell line HT1080. We concluded that these findings strongly suggest that the IVS5+5 G>A variant would affect the expression level of the UCK2 transcript, resulting in decreased sensitivity to ECyd.
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
NASA Astrophysics Data System (ADS)
Keeling, Christopher I.; Blomquist, Gary J.; Tittiger, Claus
In several pine bark beetle species, phloem feeding induces aggregation pheromone production to coordinate a mass attack on the host tree. Male pine engraver beetles, Ips pini (Say) (Coleoptera: Scolytidae), produce the monoterpenoid pheromone component ipsdienol de novo via the mevalonate pathway in the anterior midgut upon feeding. To understand how pheromone production is regulated in this tissue, we used quantitative real-time PCR to examine feeding-induced changes in gene expression of seven mevalonate pathway genes: acetoacetyl-coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, mevalonate 5-diphosphate decarboxylase, isopentenyl-diphosphate isomerase, geranyl-diphosphate synthase (GPPS), and farnesyl-diphosphate synthase (FPPS). In males, expression of all these genes significantly increased upon feeding. In females, the expression of the early mevalonate pathway genes (up to and including the isomerase) increased significantly, but the expression of the later genes (GPPS and FPPS) was unaffected or decreased upon feeding. Thus, feeding coordinately regulates expression of the mevalonate pathway genes necessary for pheromone biosynthesis in male, but not female, midguts. Furthermore, basal mRNA levels were 5- to 41-fold more abundant in male midguts compared to female midguts. This is the first report of coordinated regulation of mevalonate pathway genes in an invertebrate model consistent with their sex-specific role in de novo pheromone biosynthesis.
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Antibacterial Drug Leads: DNA and Enzyme Multitargeting
Zhu, Wei; Wang, Yang; Li, Kai; ...
2015-01-09
Here, we report the results of an investigation of the activity of a series of amidine and bisamidine compounds against Staphylococcus aureus and Escherichia coli. The most active compounds bound to an AT-rich DNA dodecamer (CGCGAATTCGCG) 2 and using DSC were found to increase the melting transition by up to 24 °C. Several compounds also inhibited undecaprenyl diphosphate synthase (UPPS) with IC 50 values of 100–500 nM, and we found good correlations (R 2 = 0.89, S. aureus; R 2 = 0.79, E. coli) between experimental and predicted cell growth inhibition by using DNA ΔT m and UPPS IC 50more » experimental results together with one computed descriptor. Finally, we also solved the structures of three bisamidines binding to DNA as well as three UPPS structures. Overall, the results are of general interest in the context of the development of resistance-resistant antibiotics that involve multitargeting.« less
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Yang, Lixia; Jiang, Liangzhen; Li, Wei; Yang, Yun; Zhang, Guolin; Luo, Yinggang
2017-10-01
Geranyl diphosphate (GPP), the unique precursor for all monoterpenoids, is biosynthesized from isopentenyl diphosphate and dimethylallyl diphosphate via the head-to-tail condensation reaction catalyzed by GPP synthase (GPPS). Herein a homomeric GPPS from Camptotheca acuminata, a camptothecin-producing plant, was obtained from 5'- and 3'-rapid amplification of cDNA ends and subsequent overlap extension and convenient PCR amplifications. The truncate CaGPPS was introduced to replace ispA of pBbA5c-MevT(CO)-MBIS(CO, ispA), a de novo biosynthetic construct for farnesyl diphosphate generation, and overexpressed in Escherichia coli, together with the truncate geraniol synthase-encoding gene from C. acuminata (tCaGES), to confirm CaGPPS-catalyzed reaction in vivo. A 24.0 ± 1.3 mg L -1 of geraniol was produced in the recombinant E. coli. The production of GPP was also validated by the direct UPLC-HRMS E analyses. The tCaGPPS and tCaGES genes with different copy numbers were introduced into E. coli to balance their catalytic potential for high-yield geraniol production. A 1.6-fold increase of geraniol production was obtained when four copies of tCaGPPS and one copy of tCaGES were introduced into E. coli. The following fermentation conditions optimization, including removal of organic layers and addition of new n-decane, led to a 74.6 ± 6.5 mg L -1 of geraniol production. The present study suggested that the gene copy number optimization, i.e., the ratio of tCaGPPS and tCaGES, plays an important role in geraniol production in the recombinant E. coli. The removal and addition of organic solvent are very useful for sustainable high-yield production of geraniol in the recombinant E. coli in view of that the solubility of geraniol is limited in the fermentation broth and/or n-decane.
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
NASA Astrophysics Data System (ADS)
Putlayev, V. I.; Evdokimov, P. V.; Garshev, A. V.; Prosvirin, D. V.; Klimashina, E. S.; Safronova, T. V.; Ivanov, V. K.
2014-02-01
An investigation into the strength characteristics of ceramics based on diphosphates Ca(3- x)М2 x (PO4)2 ( x = 0-1 and М = Na, K) provides evidence of composition strengthening in the range х = 0.6-0.8 containing the greatest amount of the supercooled high-temperature modification α-СаМРО4. The method of high-temperature x-ray diffractometry is used to examine thermal expansion of rhenanite phases of СаМРО4.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Antonino, Mark J; Mahla, Elisabeth; Bliden, Kevin P; Tantry, Udaya S; Gurbel, Paul A
2009-06-01
A clopidogrel loading dose administered during stenting attenuates inflammation marker release. However, less is known of the anti-inflammatory effect of clopidogrel maintenance therapy. Platelet reactivity to adenosine diphosphate and inflammation markers were measured in 110 consecutive patients (69 clopidogrel-naive patients and 41 patients receiving long-term clopidogrel therapy for >6 months) before nonemergent stenting by turbidimetric aggregometry and flow cytometry and multianalyte profiling, respectively. All patients were treated with aspirin. Prestenting adenosine diphosphate-induced platelet aggregation, P-selectin, and activated glycoprotein IIb/IIIa expression were lower in patients receiving long-term clopidogrel therapy compared with the clopidogrel-naive group (p <0.001), accompanied by lower levels of selected inflammation markers (p < or = 0.05). Additionally, there were strong correlations between platelet aggregation and flow cytometric measurements (p < or = 0.04) and between specific inflammation markers (p < or = 0.02). In conclusion, in addition to markedly lowering platelet reactivity to adenosine diphosphate, long-term clopidogrel therapy is associated with an anti-inflammatory effect.
Silver indium diphosphate, AgInP(2)O(7).
Zouihri, Hafid; Saadi, Mohamed; Jaber, Boujemaa; El Ammari, Lehcen
2010-12-18
Polycrystalline material of the title compound, AgInP(2)O(7), was synthesized by traditional high-temperature solid-state methods and single crystals were grown from the melt of a mixture of AgInP(2)O(7) and B(2)O(3) as flux in a platinium crucible. The structure consists of InO(6) octa-hedra, which are corner-shared to PO(4) tetra-hedra into a three-dimensional network with hexa-gonal channels running parallel to the c axis. The silver cation, located in the channel, is bonded to seven O atoms of the [InP(2)O(7)] framework with Ag-O distances ranging from 2.370 (2) to 3.015 (2) Å. The P(2)O(7) diphosphate anion is characterized by a P-O-P angle of 137.27 (9) and a nearly eclipsed conformation. AgInP(2)O(7) is isotypic with the M(I)FeP(2)O(7) (M(I) = Na, K, Rb, Cs and Ag) diphosphate family.
Hildebrandt, K M; Anderson, J S
1990-01-01
Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507
Labib, Rola M.; Ebada, Sherif S.; Youssef, Fadia S.; Ashour, Mohamed L.; Ross, Samir A.
2016-01-01
Background: Leishmaniasis and African trypanosomiasis are recognized as the leading causes of mortality and morbidity with the greatest prevalence in the developing countries. They affect more than one billion of the poorest people on the globe. Objective: To find a cheap, affordable, safe, and efficacious antileshmanial and antitrypanosomal natural drug and to elucidate its probable mode of action. Materials and Methods: Phytochemical investigation of the non-polar fraction of the methanol extract of leaves of Ochrosia elliptica Labill. (Apocyanaceae) resulted in the isolation of ursolic acid, which was unambiguously determined based on HR-ESI-FTMS, extensive 1D and 2D NMR spectroscopy. It was further tested for its cytotoxicity, antimicrobial, antimalarial, antileishmanial, and trypanocidal potency. in-silico molecular modeling studies were conducted on six vital parasitic enzymes including farnesyl diphosphate synthase, N-myristoyl transferase, pteridine reductase 1, trypanothione reductase, methionyl-tRNA synthetase, and inosine–adenosine–guanosine nucleoside hydrolase to discover its potential mode of action as antitrypanosomal and antileishmanial agent. Results: Ursolic acid displayed considerable antitrypanosomal and antileishmanial activities with IC50 values ranging between 1.53 and 8.79 μg/mL. It showed superior antitrypanosomal activity as compared to the standard drug difluoromethylornithine (DFMO), with higher binding affinities towards trypanothione reductase and pteridine reductase 1. It displayed free binding energy of -30.73 and -50.08 kcal/mole towards the previously mentioned enzymes, respectively. In addition, ursolic acid exhibited considerable affinities to farnesyl diphosphate synthase, N-myristoyl transferase and methionyl-tRNA synthetase with free binding energies ranging from -42.54 to -63.93 kcal/mole. Conclusion: Ursolic acid offers a safe, effective and cheap antitrypanosomal and antileishmanial candidate acting on several key parasitic enzymes. SUMMARY The fresh leaves of Ochrosia elleptica Labill., family Apocyanaceae are a reliable source of ursolic acid.Ursolic acid displayed considerable antitrypanosomal and antileishmanial activities. It showed superior antitrypanosomal activity as compared to difluoromethylornithine (DFMO), potent antitrypanosomal reference drug.In silico molecular modeling studies revealed that the antileishmanial and antitrypanosomal activities of ursolic acid could be partially explained in view of its multiple inhibitory effects on vital parasitic enzymes with the highest potency exerted in the inhibition of pteridine reductase 1 and trypanothione reductase. Abbreviations used: AHT: African Human Trypanosomiasis, ATCC: American type cell culture, BuOH: n-butanol, DCM: dichloromethane, DFMO: difluoromethylornithine, EtOAc: ethyl acetate, FCS: fetal calf serum, HMBC: Heteronuclear Multiple Bond Correlation, HMQC: Heteronuclear Multiple-Quantum Correlation, HR-ESI-FTMS: High Resolution Electrospray ionozation Mass Spectrometry, MENA: Middle East and North Africa, MeOH: Methanol, MRSA: Methicillin-resistant Staphylococcus aureus, NTDs: Neglected tropical diseases, TLC: Thin layer chromatography, UA: Ursolic acid, UV: Ultra violet, WHO: World Health Organization. PMID:27867276
Cassady-Cain, Robin L.; Blackburn, Elizabeth A.; Alsarraf, Husam; Dedic, Emil; Bease, Andrew G.; Böttcher, Bettina; Jørgensen, René; Wear, Martin; Stevens, Mark P.
2016-01-01
Attaching and effacing Escherichia coli cause diarrhea and typically produce lymphostatin (LifA), an inhibitor of mitogen-activated proliferation of lymphocytes and pro-inflammatory cytokine synthesis. A near-identical factor (Efa1) has been reported to mediate adherence of E. coli to epithelial cells. An amino-terminal region of LifA shares homology with the catalytic domain of the large clostridial toxins, which are retaining glycosyltransferases with a DXD motif involved in binding of a metal ion. Understanding the mode(s) of action of lymphostatin has been constrained by difficulties obtaining a stably transformed plasmid expression clone. We constructed a tightly inducible clone of enteropathogenic E. coli O127:H6 lifA for affinity purification of lymphostatin. The purified protein inhibited mitogen-activated proliferation of bovine T lymphocytes in the femtomolar range. It is a monomer in solution and the molecular envelope was determined using both transmission electron microscopy and small-angle x-ray scattering. Domain architecture was further studied by limited proteolysis. The largest proteolytic fragment containing the putative glycosyltransferase domain was tested in isolation for activity against T cells, and was not sufficient for activity. Tryptophan fluorescence studies indicated thatlymphostatin binds uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc) but not UDP-glucose (UDP-Glc). Substitution of the predicted DXD glycosyltransferase motif with alanine residues abolished UDP-GlcNAc binding and lymphostatin activity, although other biophysical properties were unchanged. The data indicate that lymphostatin has UDP-sugar binding potential that is critical for activity, and is a major leap toward identifying the nature and consequences of modifications of host cell factors. PMID:26786100
Kaya, Ali I; Lokits, Alyssa D; Gilbert, James A; Iverson, Tina M; Meiler, Jens; Hamm, Heidi E
2014-08-29
G protein activation by G protein-coupled receptors is one of the critical steps for many cellular signal transduction pathways. Previously, we and other groups reported that the α5 helix in the G protein α subunit plays a major role during this activation process. However, the precise signaling pathway between the α5 helix and the guanosine diphosphate (GDP) binding pocket remains elusive. Here, using structural, biochemical, and computational techniques, we probed different residues around the α5 helix for their role in signaling. Our data showed that perturbing the Phe-336 residue disturbs hydrophobic interactions with the β2-β3 strands and α1 helix, leading to high basal nucleotide exchange. However, mutations in β strands β5 and β6 do not perturb G protein activation. We have highlighted critical residues that leverage Phe-336 as a relay. Conformational changes are transmitted starting from Phe-336 via β2-β3/α1 to Switch I and the phosphate binding loop, decreasing the stability of the GDP binding pocket and triggering nucleotide release. When the α1 and α5 helices were cross-linked, inhibiting the receptor-mediated displacement of the C-terminal α5 helix, mutation of Phe-336 still leads to high basal exchange rates. This suggests that unlike receptor-mediated activation, helix 5 rotation and translocation are not necessary for GDP release from the α subunit. Rather, destabilization of the backdoor region of the Gα subunit is sufficient for triggering the activation process. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Yang, Ya-Chun; Wang, Yen-Ting; Tseng, Wei-Lung
2017-03-22
Numerous compounds such as protein and double-stranded DNA have been shown to efficiently inhibit intrinsic peroxidase-mimic activity in Fe 3 O 4 nanoparticles (NP) and other related nanomaterials. However, only a few studies have focused on finding new compounds for enhancing the catalytic activity of Fe 3 O 4 NP-related nanomaterials. Herein, phosphate containing adenosine analogs are reported to enhance the oxidation reaction of hydrogen peroxide (H 2 O 2 ) and amplex ultrared (AU) for improving the peroxidase-like activity in Fe 3 O 4 NPs. This enhancement is suggested to be a result of the binding of adenosine analogs to Fe 2+ /Fe 3+ sites on the NP surface and from adenosine 5'-monophosphate (AMP) acting as the distal histidine residue of horseradish peroxidase for activating H 2 O 2 . Phosphate containing adenosine analogs revealed the following trend for the enhanced activity of Fe 3 O 4 NPs: AMP > adenosine 5'-diphosphate > adenosine 5'-triphosphate. The peroxidase-like activity in the Fe 3 O 4 NPs progressively increased with increasing AMP concentration and polyadenosine length. The Michaelis constant for AMP attached Fe 3 O 4 NPs is 5.3-fold lower and the maximum velocity is 2.7-fold higher than those of the bare Fe 3 O 4 NPs. Furthermore, on the basis of AMP promoted peroxidase mimicking activity in the Fe 3 O 4 NPs and the adsorption of protein on the NP surface, a selective fluorescent turn-off system for the detection of urinary protein is developed.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Gaal, T; Gourse, R L
1990-01-01
rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571
Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney
1998-01-01
Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865
Kong, Min Kyung; Kang, Hyun-Jun; Kim, Jin Ho; Oh, Soon Hwan; Lee, Pyung Cheon
2015-11-20
The ent-kaurene is a dedicated precursor pool and is responsible for synthesizing natural sweeteners such as steviol glycosides. In this study, to produce ent-kaurene in Escherichia coli, we modularly constructed and expressed two ent-kaurene genes encoding ent-copalyl diphosphate synthase (CPPS) and ent-kaurene synthase (KS) from Stevia rebaudiana known as a typical plant producing steviol glycoside. The CPPS and KS from S. rebaudiana were functionally expressed in a heterologous host E. coli. Furthermore, in order to enhance ent-kaurene production in E. coli, six geranylgeranyl diphosphate synthases (GGPPS) from various microorganisms and eight strains of E. coli as host were compared by measuring ent-kaurene production. The highest ent-kaurene production of approximately 41.1mg/L was demonstrated in E. coli strain MG1655 co-expressing synthetic CPPS-KS module and GGPPS from Rhodobacter sphaeroides. The ent-kaurene production was further increased up to 179.6 mg/L by overexpression of the three key enzymes for isoprenoid precursor, 1-deoxyxylulose-5-phosphate synthase (DXS), farnesyl diphosphate synthase (IspA) and isopentenyl diphosphate isomerase (IDI) from E. coli. Finally, the highest titer of ent-kaurene (578 mg/L) with a specific yield of ent-kaurene of 143.5mg/g dry cell weight was obtained by culturing E. coli strain MG1655 co-expressing the ent-kaurene module, DXS, IDI and IspA in 1L bioreactor containing 20 g/L glycerol. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Mar, A.; Oro, J.
1991-01-01
The nonenzymatic synthesis of the coenzymes adenosine diphosphate glucose (ADPG), guanosine diphosphate glucose (GDPG), and cytidine diphosphoethanolamine (CDP-ethanolamine) has been carried out under conditions considered to have been prevalent on the early Earth. The production of these compounds was performed by allowing simple precursor molecules to react under aqueous solutions, at moderate temperatures and short periods of time, with mediation by cyanamide or urea. These two condensing agents are considered to have been present in significant amounts on the primitive Earth and have been previously used in the nonenzymatic synthesis of several other important biochemical compounds. In our experiments, ADPG was obtained by heating glucose-1-phosphate (G1P) and ATP in the presence of cyanamide for 24 h at 70 degrees C. The reaction of G1P and GTP under the same conditions yielded GDPG. The cyanamide-mediated production of CDP-ethanolamine was carried out by reacting a mixture of ethanolamine phosphate and CTP for 24 h at 70 degrees C. The separation and identification of the reaction products was carried out by paper chromatography, thin-layer chromatography, high performance thin-layer chromatography, high performance liquid chromatography, both normal and reverse-phase, UV spectroscopy, enzymatic assays, and acid hydrolysis. Due to the mild conditions employed, and to the relative ease of these reactions, these studies offer a simple attractive system for the nonenzymatic synthesis of phosphorylated high-energy metabolic intermediates under conditions considered to have been prevalent on the ancient Earth.
2010-01-01
We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Mechanism-based post-translational modification and inactivation in terpene synthases
Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.; ...
2015-09-17
Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less
McCully, Kilmer S
2015-01-01
The active site of oxidative phosphorylation and adenosine triphosphate (ATP) synthesis in mitochondria is proposed to consist of two molecules of thioretinamide bound to cobalamin, forming thioretinaco, complexed with ozone, oxygen, nicotinamide adenine dinucleotide. and inorganic phosphate, TR2CoO3O2NAD(+)H2PO4(-). Reduction of the pyridinium nitrogen of the nicotinamide group by an electron from electron transport complexes initiates polymerization of phosphate with adenosine diphosphate, yielding nicotinamide riboside and ATP bound to thioretinaco ozonide oxygen. A second electron reduces oxygen to hydroperoxyl radical, releasing ATP from the active site. A proton gradient is created within F1F0 ATPase complexes of mitochondria by reaction of protons with reduced nicotinamide riboside and with hydroperoxyl radical, yielding reduced nicotinamide riboside and hydroperoxide. The hyperhomocysteinemia of aging and dementia is attributed to decreased synthesis of adenosyl methionine by thioretinaco ozonide and ATP, causing decreased allosteric activation of cystathionine synthase and decreased allosteric inhibition of methylenetetrahydrofolate reductase and resulting in dysregulation of methionine metabolism. © 2015 by the Association of Clinical Scientists, Inc.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
Sayer, Alon Haim; Blum, Eliav; Major, Dan Thomas; Vardi-Kilshtain, Alexandra; Levi Hevroni, Bosmat; Fischer, Bilha
2015-04-28
Although involved in various physiological functions, nucleoside bis-phosphate analogues and their metal-ion complexes have been scarcely studied. Hence, here, we explored the solution conformation of 2′-deoxyadenosine- and 2′-deoxyguanosine-3′,5′-bisphosphates, 3 and 4, d(pNp), as well as their Zn(2+)/Mg(2+) binding sites and binding-modes (i.e. inner- vs. outer-sphere coordination), acidity constants, stability constants of their Zn(2+)/Mg(2+) complexes, and their species distribution. Analogues 3 and 4, in solution, adopted a predominant Southern ribose conformer (ca. 84%), gg conformation around C4'-C5' and C5'-O5' bonds, and glycosidic angle in the anti-region (213-270°). (1)H- and (31)P-NMR experiments indicated that Zn(2+)/Mg(2+) ions coordinated to P5' and P3' groups of 3 and 4 but not to N7 nitrogen atom. Analogues 3 and 4 formed ca. 100-fold more stable complexes with Zn(2+)vs. Mg(2+)-ions. Complexes of 3 and 4 with Mg(2+) at physiological pH were formed in minute amounts (11% and 8%, respectively) vs. Zn(2+) complexes (46% and 44%). Stability constants of Zn(2+)/Mg(2+) complexes of analogues 3 and 4 (log KML(M) = 4.65-4.75/2.63-2.79, respectively) were similar to those of the corresponding complexes of ADP and GDP (log KML(M) = 4.72-5.10/2.95-3.16, respectively). Based on the above findings, we hypothesized that the unexpectedly low log K values of Zn(2+)-d(pNp) as compared to Zn(2+)-NDP complexes, are possibly due to formation of outer-sphere coordination in the Zn(2+)-d(pNp) complex vs. inner-sphere in the NDP-Zn(2+) complex, in addition to loss of chelation to N7 nitrogen atom in Zn(2+)-d(pNp). Indeed, explicit solvent molecular dynamics simulations of 1 and 3 for 100 ns supported this hypothesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.
The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, M.W.; Chen, J.P.; Wallis, C.
1992-02-26
({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less