Inactivation of human norovirus and Tulane virus in simple media and fresh whole strawberries by ionizing radiation.

PubMed

DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong

2016-09-02

Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.

Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.

PubMed

Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane

2008-02-01

Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.

Polymeric assay film for direct colorimetric detection

DOEpatents

Charych, Deborah; Nagy, Jon; Spevak, Wayne

2002-01-01

A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

Polymeric assay film for direct colorimetric detection

DOEpatents

Charych, Deborah; Nagy, Jon; Spevak, Wayne

1999-01-01

A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

PubMed

Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

2014-11-01

A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

Development of a Competitive Binding Assay System with Recombinant Estrogen Receptors from Multiple Species

EPA Science Inventory

ABSTRACT In the current study, we developed a new system using full-length recombinant baculovirus-expressed estrogen receptors which allows for direct comparison of binding across species. Estrogen receptors representing five vertebrate classes were compared: human (hERα), quai...

Efavirenz directly modulates the oestrogen receptor and induces breast cancer cell growth.

PubMed

Sikora, M J; Rae, J M; Johnson, M D; Desta, Z

2010-10-01

Efavirenz-based HIV therapy is associated with breast hypertrophy and gynaecomastia. Here, we tested the hypothesis that efavirenz induces gynaecomastia through direct binding and modulation of the oestrogen receptor (ER). To determine the effect of efavirenz on growth, the oestrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under oestrogen-free conditions in the presence or absence of the anti-oestrogen ICI 182,780. Cells treated with 17β-oestradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure the ER binding affinity of efavirenz. Efavirenz induced growth in MCF-7 cells with an estimated effective concentration for half-maximal growth (EC(50)) of 15.7 μM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to the ER [inhibitory concentration for half maximal binding (IC(50)) of ∼52 μM] at a roughly 1000-fold higher concentration than observed with 17β-oestradiol. Our data suggest that efavirenz-induced gynaecomastia may be caused, at least in part, by drug-induced ER activation in breast tissues.

Direct detection of methicillin resistance in Staphylococcus aureus in blood culture broth by use of a penicillin binding protein 2a latex agglutination test.

PubMed

Qian, Qinfang; Venkataraman, Lata; Kirby, James E; Gold, Howard S; Yamazumi, Toshiaki

2010-04-01

We studied the utility of performing a penicillin binding protein 2a latex agglutination (PBP-LA) assay directly on Bactec blood culture broth samples containing Staphylococcus aureus to rapidly detect methicillin resistance. The sensitivity, specificity, positive predictive value, and negative predictive value of this method were 94.1%, 97.5%, 98%, and 92.9%, respectively.

A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

PubMed Central

Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

2012-01-01

The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

Efavirenz directly modulates estrogen receptor and induces breast cancer cell growth

PubMed Central

Sikora, Matthew J.; Rae, James M.; Johnson, Michael D.; Desta, Zeruesenay

2010-01-01

Objectives Efavirenz-based HIV therapy is associated with breast hypertrophy and gynecomastia. Here, we tested the hypothesis that efavirenz induces gynecomastia through direct binding and modulation of estrogen receptor (ER). Methods To determine the effect of efavirenz on growth, the estrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under estrogen-free conditions in the presence or absence of the anti-estrogen ICI 182,780. Cells treated with 17β-estradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure efavirenz’s ER binding affinity. Results Efavirenz induced growth in MCF-7 cells with an estimated EC50 of 15.7µM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to ER (IC50 of ~52µM) at roughly 1000-fold higher concentration than observed with E2. Conclusions Our data suggest that efavirenz-induced gynecomastia may be due, at least in part, to drug-induced ER activation in breast tissues. PMID:20408889

Comparison of a direct and indirect ELISA for quantitating antisperm antibody in semen.

PubMed

Lynch, D M; Howe, S E

1987-01-01

A direct and an indirect quantitative ELISA for antisperm antibody were compared using the spermatozoa and cell-free seminal fluid of 66 infertile males. The normal concentration of sperm binding immunoglobulin was less than or equal to 1.5 fg Ig per spermatozoon for the indirect seminal plasma assay and less than or equal to 1.5 fg Ig per spermatozoon by the direct assay. Of the 66 infertile males, 21% (14/66) had elevated levels of antisperm antibody in their seminal plasma and 26% (17/66) had elevated levels bound directly to their spermatozoa. The direct correlation between the results of these assays was 94%. A simple linear regression analysis between the indirect and direct measurements of antisperm antibody resulted in a correlation coefficient of r = 0.907. There was no statistically significant difference between results from the direct and indirect methods of the patients as a group. However, there was evidence of autospecificity in a small percentage of males who had elevated levels of antisperm antibody by the direct assay that was not detected by the indirect assay using pooled donor spermatozoa.

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Antibody binding in altered gravity: implications for immunosorbent assay during space flight

NASA Technical Reports Server (NTRS)

Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.

2003-01-01

A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.

Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

PubMed

Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

2018-02-26

The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

GingisKHAN™ protease cleavage allows a high-throughput antibody to Fab conversion enabling direct functional assessment during lead identification of human monoclonal and bispecific IgG1 antibodies

PubMed Central

Moelleken, Jörg; Gassner, Christian; Lingke, Sabine; Tomaschek, Simone; Tyshchuk, Oksana; Lorenz, Stefan; Mølhøj, Michael

2017-01-01

ABSTRACT The determination of the binding strength of immunoglobulins (IgGs) to targets can be influenced by avidity when the targets are soluble di- or multimeric proteins, or associated to cell surfaces, including surfaces introduced from heterogeneous assays. However, for the understanding of the contribution of a second drug-to-target binding site in molecular design, or for ranking of monovalent binders during lead identification, affinity-based assessment of the binding strength is required. Typically, monovalent binders like antigen-binding fragments (Fabs) are generated by proteolytic cleavage with papain, which often results in a combination of under- and over-digestion, and requires specific optimization and chromatographic purification of the desired Fabs. Alternatively, the Fabs are produced by recombinant approaches. Here, we report a lean approach for the functional assessment of human IgG1s during lead identification based on an in-solution digestion with the GingisKHAN™ protease, generating a homogenous pool of intact Fabs and Fcs and enabling direct assaying of the Fab in the digestion mixture. The digest with GingisKHAN™ is highly specific and quantitative, does not require much optimization, and the protease does not interfere with methods typically applied for lead identification, such as surface plasmon resonance or cell-based assays. GingisKHAN™ is highly suited to differentiate between affinity and avidity driven binding of human IgG1 monoclonal and bispecific antibodies during lead identification. PMID:28805498

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

DIRECT ELECTROCHEMICAL IMMUNOSENSOR FOR POLYCHLORINATED BIPHENYLS. (R825323)

EPA Science Inventory

A direct electrochemical immunosensor has been developed for the determination of polychlorinated biphenyls (PCBs) in water. The assay is based on the measurement of the current due to the specific binding between PCB and anti-PCB antibody-immobilized conducting polymer matrix. T...

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

A cytoplasmic protein, bystin, interacts with trophinin, tastin, and cytokeratin and may be involved in trophinin-mediated cell adhesion between trophoblast and endometrial epithelial cells

PubMed Central

Suzuki, Nao; Zara, Jane; Sato, Takaaki; Ong, Edgar; Bakhiet, Nouna; Oshima, Robert G.; Watson, Kellie L.; Fukuda, Michiko N.

1998-01-01

Trophinin and tastin form a cell adhesion molecule complex that potentially mediates an initial attachment of the blastocyst to uterine epithelial cells at the time of implantation. Trophinin and tastin, however, do not directly bind to each other, suggesting the presence of an intermediary protein. The present study identifies a cytoplasmic protein, named bystin, that directly binds trophinin and tastin. Bystin consists of 306 amino acid residues and is predicted to contain tyrosine, serine, and threonine residues in contexts conforming to motifs for phosphorylation by protein kinases. Database searches revealed a 53% identity of the predicted peptide sequence with the Drosophila bys (mrr) gene. Direct protein–protein interactions of trophinin, tastin, and bystin analyzed by yeast two-hybrid assays and by in vitro protein binding assays indicated that binding between bystin and trophinin and between bystin and tastin is enhanced when cytokeratin 8 and 18 are present as the third molecule. Immunocytochemistry of bystin showed that bystin colocalizes with trophinin, tastin, and cytokeratins in a human trophoblastic teratocarcinoma cell, HT-H. It is therefore possible that these molecules form a complex and thus are involved in the process of embryo implantation. PMID:9560222

A biotin-drug extraction and acid dissociation (BEAD) procedure to eliminate matrix and drug interference in a protein complex anti-drug antibody (ADA) isotype specific assay.

PubMed

Niu, Hongmei; Klem, Thomas; Yang, Jinsong; Qiu, Yongchang; Pan, Luying

2017-07-01

Monitoring anti-drug antibody (ADA) responses in patients receiving protein therapeutics treatment is an important safety assessment for regulatory agencies, drug manufacturers, clinicians and patients. Recombinant human IGF-1/IGFBP-3 (rhIGF-1/rhIGFBP-3) is a 1:1 formulation of naturally occurring protein complex. The individual IGF-1 and IGFBP-3 proteins have multiple binding partners in serum matrix with high binding affinity to each other, which presents challenges in ADA assay development. We have developed a biotin-drug extraction with acid dissociation (BEAD) procedure followed by an electrochemiluminescence (ECL) direct assay to overcome matrix and drug interference. The method utilizes two step acid dissociation and excess biotin-drug to extract total ADA, which are further captured by soluble biotin-drug and detected in an ECL semi-homogeneous direct assay format. The pre-treatment method effectively eliminates interference by serum matrix and free drug, and enhances assay sensitivity. The assays passed acceptance criteria for all validation parameters, and have been used for clinical sample Ab testing. This method principle exemplifies a new approach for anti-isotype ADA assays, and could be an effective strategy for neutralizing antibody (NAb), pharmacokinetic (PK) and biomarker analysis in need of overcoming interference factors. Copyright © 2017 Elsevier B.V. All rights reserved.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.

PubMed

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-19

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System

PubMed Central

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-01

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476

Progranulin Directly Binds to the CRD 2 and CRD3 of TNFR Extracellular Domains

PubMed Central

Jian, Jinlong; Zhao, Shuai; Tian, Qingyun; Gonzalez-Gugel, Elena; Mundra, Jyoti Joshi; Uddin, Sardar MZ; Liu, Ben; Richbourgh, Brendon; Brunetti, Ryan; Liu, Chuan-ju

2013-01-01

We previously reported that PGRN directly bound to TNF receptors (TNFR) in vitro and in chondrocytes (Tang, et al, Science, 2011). Here we report that PGRN also associated with TNFR in splenocytes, and inhibited the binding of TNFα to immune cells. Proper folding of PGRN is essential for its binding to TNFR, as DTT treatment abolished its binding to TNFR. In contrast, the binding of PGRN to Sortilin was enhanced by DTT. Protein interaction assays with mutants of the TNFR extracellular domain demonstrated that CRD2 and CRD3 of TNFR are important for the interaction with PGRN, similar to the binding to TNFα. Taken together, these findings provide the molecular basis underlying PGRN/TNFR interaction and PGRN-mediated anti-inflammatory activity in various autoimmune diseases and conditions. PMID:24070898

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Regulation of Egr1 Target Genes by the NuRD Chromatin Remodeling Complex

DTIC Science & Technology

2006-12-01

the M12 metastatic subline of P69SV40T prostate epithelial cells (Bae et al. 1998), Western analysis using an antibody directed against CHD4 revealed...Chromatin was then sonicated and immunoprecipitated with antibodies directed against EGR1, MTA2 or IgG control. The specificity of the assay is tested...subtle. Control ChIP assays employing an EGR1 antibody show correlated increased binding of EGR1 upon EGR1 overexpression, but this level of EGR1

Radioligand Recognition of Insecticide Targets.

PubMed

Casida, John E

2018-04-04

Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

Interpretation of the Raji cell assay in sera containing anti-nuclear antibodies and immune complexes.

PubMed Central

Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N

1981-01-01

The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676

Demonstration of four immunoassay formats using the array biosensor

NASA Technical Reports Server (NTRS)

Sapsford, Kim E.; Charles, Paul T.; Patterson, Charles H Jr; Ligler, Frances S.

2002-01-01

The ability of a fluorescence-based array biosensor to measure and quantify the binding of an antigen to an immobilized antibody has been demonstrated using the four different immunoassay formats: direct, competitive, displacement, and sandwich. A patterned array of antibodies specific for 2,4,6-trinitrotoluene (TNT) immobilized onto the surface of a planar waveguide and used to measure signals from different antigen concentrations simultaneously. For direct, competitive, and displacement assays, which are one-step assays, measurements were obtained in real time. Dose-response curves were calculated for all four assay formats, demonstrating the array biosensor's ability to quantify the amount of antigen present in solution.

Spectroscopy on the wing: naturally inspired SERS substrates for biochemical analysis.

PubMed

Garrett, Natalie L; Vukusic, Peter; Ogrin, Feodor; Sirotkin, Evgeny; Winlove, C Peter; Moger, Julian

2009-03-01

We show that naturally occurring chitinous nanostructures found on the wings of the Graphium butterfly can be used as substrates for surface-enhanced Raman scattering when coated with a thin film of gold or silver. The substrates were found to exhibit excellent biocompatibility and sensitivity, making them ideal for protein assaying. An assay using avidin/biotin binding showed that the substrates could be used to quantify protein binding directly from changes in the surface-enhanced Raman scattering (SERS) spectra and were sensitive over a concentration range comparable with a typical enzyme-linked immunosorbent assays (ELISA) assay. A biomimetic version of the wing nanostructures produced using a highly reproducible, large-scale fabrication process, yielded comparable enhancement factors and biocompatibility. The excellent biocompatibility of the wings and biomimetic substrates is unparalleled by other lithographically produced substrates, and this could pave the way for widespread application of ultrasensitive SERS-based bioassays.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA).

PubMed

Kohl, Thomas O; Ascoli, Carl A

2017-07-05

The competitive enzyme-linked immunosorbent assay (ELISA) (cELISA; also called an inhibition ELISA) is designed so that purified antigen competes with antigen in the test sample for binding to an antibody that has been immobilized in microtiter plate wells. The same concept works if the immobilized molecule is antigen and the competing molecules are purified labeled antibody versus antibody in a test sample. Direct cELISAs incorporate labeled antigen or antibody, whereas indirect assay configurations use reporter-labeled secondary antibodies. The cELISA is very useful for determining the concentration of small-molecule antigens in complex sample mixtures. In the direct cELISA, antigen-specific capture antibody is adsorbed onto the microtiter plate before incubation with either known standards or unknown test samples. Enzyme-linked antigen (i.e., labeled antigen) is also added, which can bind to the capture antibody only when the antibody's binding site is not occupied by either the antigen standard or antigen in the test samples. Unbound labeled and unlabeled antigens are washed away and substrate is added. The amount of antigen in the standard or the test sample determines the amount of reporter-labeled antigen bound to antibody, yielding a signal that is inversely proportional to antigen concentration within the sample. Thus, the higher the antigen concentration in the test sample, the less labeled antigen is bound to the capture antibody, and hence the weaker is the resultant signal. © 2017 Cold Spring Harbor Laboratory Press.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Binding of selected extracellular matrix proteins to enterococci and Streptococcus bovis of animal origin.

PubMed

Styriak, I; Lauková, A; Fallgren, C; Wadström, T

1999-12-01

Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.

The Dot Blot ELISA.

ERIC Educational Resources Information Center

Gerbig, Donald G., Jr.; Fenk, Christopher J.; Goodhart, Amy S.

2000-01-01

Uses two laboratory techniques, Enzyme Linked Immunosorbent Assay (ELISA) and Western Blot, to demonstrate antibody-antigen binding concepts. Includes a list of required materials and directions for the procedure, and makes suggestions for classroom applications. (Contains 13 references.) (YDS)

ELEGANT ENVIRONMENTAL IMMUNOASSAYS

EPA Science Inventory

Immunochemical methods are based on selective antibodies directed to a particular target analyte. The specific binding between antibody and analyte can be used for detection and quantitation. Methods such as the enzyme-linked immunosorbent assay (ELISA) can provide a sensitiv...

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Bacteroides gingivalis-Actinomyces viscosus cohesive interactions as measured by a quantitative binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, S.; Ellen, R.P.; Grove, D.A.

1987-10-01

There is limited evidence, mostly indirect, to suggest that the adherence of Bacteroides gingivalis to teeth may be enhanced by the presence of gram-positive dental plaque bacteria like Actinomyces viscosus. The purpose of this study was to carry out direct quantitative assessments of the cohesion of B gingivalis and A. viscosus by using an in vitro assay modeled on the natural sequence in which these two species colonize the teeth. The assay allowed comparisons to be made of the adherence of /sup 3/H-labeled B. gingivalis 2561 and 381 to saliva-coated hydroxyapatite beads (S-HA) and A. viscosus WVU627- or T14V-coated S-HAmore » (actinobeads) in equilibrium and kinetics binding studies. A series of preliminary binding studies with 3H-labeled A. viscosus and parallel studies by scanning electron microscopy with unlabeled A. viscosus were conducted to establish a protocol by which actinobeads suitable for subsequent Bacteroides adherence experiments could be prepared. By scanning electron microscopy, the actinobeads had only small gaps of exposed S-HA between essentially irreversibly bound A. viscosus cells. Furthermore, B. gingivalis cells appeared to bind preferentially to the Actinomyces cells instead of the exposed S-HA. B. gingivalis binding to both S-HA and actinobeads was saturable with at least 2 X 10(9) to 3 X 10(9) cells per ml, and equilibrium with saturating concentrations was reached within 10 to 20 min. B. gingivalis always bound in greater numbers to the actinobeads than to S-HA. These findings provide direct measurements supporting the concept that cohesion with dental plaque bacteria like A. viscosus may foster the establishment of B. gingivalis on teeth by enhancing its adherence.« less

Cross-linking staphylococcal enterotoxin A bound to major histocompatibility complex class I is required for TNF-alpha secretion

NASA Technical Reports Server (NTRS)

Wright, A. D.; Chapes, S. K.

1999-01-01

The mechanism of how superantigens function to activate cells has been linked to their ability to bind and cross-link the major histocompatibility complex class II (MHCII) molecule. Cells that lack the MHCII molecule also respond to superantigens, however, with much less efficiency. Therefore, the purpose of this study was to confirm that staphylococcal enterotoxin A (SEA) could bind the MHCI molecule and to test the hypothesis that cross-linking SEA bound to MHCII-deficient macrophages would induce a more robust cytokine response than without cross-linking. We used a capture enzyme-linked immunosorbent assay and an immunprecipitation assay to directly demonstrate that MHCI molecules bind SEA. Directly cross-linking MHCI using monoclonal antibodies or cross-linking bound SEA with an anti-SEA antibody or biotinylated SEA with avidin increased TNF-alpha and IL-6 secretion by MHCII(-/-) macrophages. The induction of a vigorous macrophage cytokine response by SEA/anti-SEA cross-linking of MHCI offers a mechanism to explain how MHCI could play an important role in superantigen-mediated pathogenesis. Copyright 1999 Academic Press.

A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

PubMed

Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

2017-03-01

Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

The binding of human and guinea-pig IgG subclasses to homologous macrophage and monocyte Fc receptors.

PubMed Central

Alexander, M D; Andrews, J A; Leslie, R G; Wood, N J

1978-01-01

Guinea-pig IgG2 and IgT1 bind to contiguous Fc receptors on homologous peritoneal macrophages. Equilibrium association constants determined for the binding of human IgG subclasses to homologous peripheral blood monocytes show that the order of binding is IgG1 greater than IgG3 greater than IgG4 greater than IgG2. Direct binding and rosette assay techniques independently established that both guinea-pig IgG2 and human IgG bind to homologous macrophage-monocyte Fc receptors through a site present in whole Fc (CH2. CH3)2, but absent in pFc' subfragments (CH3)2. PMID:680795

Critical ligand binding reagent preparation/selection: when specificity depends on reagents.

PubMed

Rup, Bonita; O'Hara, Denise

2007-05-11

Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.

Analysis of Ethylene Receptors: Ethylene-Binding Assays.

PubMed

Binder, Brad M; Schaller, G Eric

2017-01-01

Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

Bio-nanocapsule-based scaffold improves the sensitivity and ligand-binding capacity of mammalian receptors on the sensor chip.

PubMed

Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Maturana, Andrés D; Kuroda, Shun'ichi

2016-06-01

Mammalian receptors are recognized as target molecules for drug discovery, and chemical libraries have been screened for both potential antagonists and agonists mainly by ligand-binding assays using immobilized receptors. A bio-nanocapsule (BNC) of approximately 30 nm that displays a tandem form of the protein A-derived immunoglobulin G (IgG) Fc-binding Z domains (denoted as ZZ-BNC) has been developed for both clustering and oriented immobilization of IgGs on the solid phase of immunosensors. In this study, human IgG1 Fc-fused vascular endothelial growth factor (VEGF) receptor was immobilized through ZZ-BNC on the sensor chip of quartz crystal microbalance (ZZ-BNC-coating). When compared with direct adsorption and protein A-coating, the sensor chip showed higher sensitivity (∽46- and ∽165-fold, respectively) and larger ligand-binding capacity (∽4- and ∽18-fold, respectively). Furthermore, the number of VEGF molecules bound to its receptor increased from 0.20 (direct adsorption) to 2.06 by ZZ-BNC-coating, strongly suggesting that ZZ-BNC reduced the steric hindrance near ligand recognition sites through oriented immobilization. Similarly, the sensitivity and ligand-binding capacity of leptin and prolactin receptors were both enhanced at a level comparable to that observed for the VEGF receptor. Thus, the combination of ZZ-BNC and Fc-fused receptors could significantly improve the function of ligand-binding assays. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT

NASA Astrophysics Data System (ADS)

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-07-01

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT.

PubMed

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-07-16

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.

Direct fluorescence anisotropy assay for cocaine using tetramethylrhodamine-labeled aptamer.

PubMed

Liu, Yingxiong; Zhao, Qiang

2017-06-01

Development of simple, sensitive, and rapid method for cocaine detection is important in medicine and drug abuse monitoring. Taking advantage of fluorescence anisotropy and aptamer, this study reports a direct fluorescence anisotropy (FA) assay for cocaine by employing an aptamer probe with tetramethylrhodamine (TMR) labeled on a specific position. The binding of cocaine and the aptamer causes a structure change of the TMR-labeled aptamer, leading to changes of the interaction between labeled TMR and adjacent G bases in aptamer sequence, so FA of TMR varies with increasing of cocaine. After screening different labeling positions of the aptamer, including thymine (T) bases and terminals of the aptamer, we obtained a favorable aptamer probe with TMR labeled on the 25th base T in the sequence, which exhibited sensitive and significant FA-decreasing responses upon cocaine. Under optimized assay conditions, this TMR-labeled aptamer allowed for direct FA detection of cocaine as low as 5 μM. The maximum FA change reached about 0.086. This FA method also enabled the detection of cocaine spiked in diluted serum and urine samples, showing potential for applications. Graphical Abstract The binding of cocaine to the TMR-labeled aptamer causes conformation change and alteration of the intramolecular interaction between TMR and bases of aptamer, leading to variance of fluorescence anisotropy (FA) of TMR, so direct FA analyis of cocaine is achieved.

Comparison of techniques of detecting immunoglobulin-binding protein reactivity to immunoglobulin produced by different avian and mammalian species.

PubMed

Justiz-Vaillant, A A; Akpaka, P E; McFarlane-Anderson, N; Smikle, M F

2013-01-01

The rationale of this study was to use several immunological assays to investigate the reactivity of immunoglobulin binding protein (IBP) to immunoglobulins from various avian and mammalian species. The IBP studied were Staphylococcal protein A (SpA), Streptococcal protein G (SpG), Peptostreptococcal protein L (SpL) and recombinant protein LA (SpLA). The various immunological techniques used were double immunodiffusion (Ouchterlony technique) that tested positive high protein reactivities, direct and competitive enzyme-linked immunosorbent assays (ELISAs) that tested moderate and low positive protein binding capacities, respectively. In addition to sandwich ELISAs, immunoblot analyses and Ig-purification by SpA-affinity chromatography, which were sensitive tests and helpful in the screening and confirmatory tests were also used. The Ouchterlony technique showed that compared to the other proteins, SpLA had the highest range of reactivity with animal sera and purified immunoglobulins while SpL was least reactive. With the direct ELISA, SpL reacted with the raccoon sera, rabbit IgG and with IgY from bantam hens and pigeons. While with the direct ELISA, SpA reacted with sera from skunk, coyote, raccoon, mule, donkey and human. The sandwich ELISA revealed high reactivity of both SpG and SpLA with mammalian sera titres ranging from 1:32 (raccoon serum) to 1:1024 (mule and donkey sera). These results suggest that IBP can be used for the detection of immunoglobulin using various immunological assays and this is important for the diagnosis of infectious diseases in animal and bird populations studied and in the purification of immunoglobulins.

Integration of cell-free protein coexpression with an enzyme-linked immunosorbent assay enables rapid analysis of protein–protein interactions directly from DNA

PubMed Central

Layton, Curtis J; Hellinga, Homme W

2011-01-01

Assays that integrate detection of binding with cell-free protein expression directly from DNA can dramatically increase the pace at which protein–protein interactions (PPIs) can be analyzed by mutagenesis. In this study, we present a method that combines in vitro protein production with an enzyme-linked immunosorbent assay (ELISA) to measure PPIs. This method uses readily available commodity instrumentation and generic antibody–affinity tag interactions. It is straightforward and rapid to execute, enabling many interactions to be assessed in parallel. In traditional ELISAs, reporter complexes are assembled stepwise with one layer at a time. In the method presented here, all the members of the reporter complex are present and assembled together. The signal strength is dependent on all the intercomponent interaction affinities and concentrations. Although this assay is straightforward to execute, establishing proper conditions and analysis of the results require a thorough understanding of the processes that determine the signal strength. The formation of the fully assembled reporter sandwich can be modeled as a competition between Langmuir adsorption isotherms for the immobilized components and binding equilibria of the solution components. We have shown that modeling this process provides semiquantitative understanding of the effects of affinity and concentration and can guide strategies for the development of experimental protocols. We tested the method experimentally using the interaction between a synthetic ankyrin repeat protein (Off7) and maltose-binding protein. Measurements obtained for a collection of alanine mutations in the interface between these two proteins demonstrate that a range of affinities can be analyzed. PMID:21674663

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Replacing antibodies with modified DNA aptamers in vaccine potency assays.

PubMed

Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten

2017-10-04

Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

PubMed

Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of functional assays used in the clinical development of a placental malaria vaccine.

PubMed

Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A

2017-01-23

Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.

Validation of an enzyme-linked immunosorbent assay for the quantification of human IgG directed against the repeat region of the circumsporozoite protein of the parasite Plasmodium falciparum

PubMed Central

2012-01-01

Background Several pre-erythrocytic malaria vaccines based on the circumsporozoite protein (CSP) antigen of Plasmodium falciparum are in clinical development. Vaccine immunogenicity is commonly evaluated by the determination of anti-CSP antibody levels using IgG-based assays, but no standard assay is available to allow comparison of the different vaccines. Methods The validation of an anti-CSP repeat region enzyme-linked immunosorbent assay (ELISA) is described. This assay is based on the binding of serum antibodies to R32LR, a recombinant protein composed of the repeat region of P. falciparum CSP. In addition to the original recombinant R32LR, an easy to purify recombinant His-tagged R32LR protein has been constructed to be used as solid phase antigen in the assay. Also, hybridoma cell lines have been generated producing human anti-R32LR monoclonal antibodies to be used as a potential inexhaustible source of anti-CSP repeats standard, instead of a reference serum. Results The anti-CSP repeats ELISA was shown to be robust, specific and linear within the analytical range, and adequately fulfilled all validation criteria as defined in the ICH guidelines. Furthermore, the coefficient of variation for repeatability and intermediate precision did not exceed 23%. Non-interference was demonstrated for R32LR-binding sera, and the assay was shown to be stable over time. Conclusions This ELISA, specific for antibodies directed against the CSP repeat region, can be used as a standard assay for the determination of humoral immunogenicity in the development of any CSP-based P. falciparum malaria vaccine. PMID:23173602

The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

PubMed Central

Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

2017-01-01

DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

NASA Astrophysics Data System (ADS)

Song, Hong Yan; Su, Xiaodi

In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

Molecular interactions between general anesthetics and the 5HT2B receptor.

PubMed

Matsunaga, Felipe; Gao, Lu; Huang, Xi-Ping; Saven, Jeffery G; Roth, Bryan L; Liu, Renyu

2015-01-01

Serotonin modulates many processes through a family of seven serotonin receptors. However, no studies have screened for interactions between general anesthetics currently in clinical use and serotonergic G-protein-coupled receptors (GPCRs). Given that both intravenous and inhalational anesthetics have been shown to target other classes of GPCRs, we hypothesized that general anesthetics might interact directly with some serotonin receptors and thus modify their function. Radioligand binding assays were performed to screen serotonin receptors for interactions with propofol and isoflurane as well as for affinity determinations. Docking calculations using the crystal structure of 5-HT2B were performed to computationally confirm the binding assay results and locate anesthetic binding sites. The 5-HT2B class of receptors interacted significantly with both propofol and isoflurane in the primary screen. The affinities for isoflurane and propofol were determined to be 7.78 and .95 μM, respectively, which were at or below the clinical concentrations for both anesthetics. The estimated free energy derived from docking calculations for propofol (-6.70 kcal/mol) and isoflurane (-5.10 kcal/mol) correlated with affinities from the binding assay. The anesthetics were predicted to dock at a pharmacologically relevant binding site of 5HT2B. The molecular interactions between propofol and isoflurane with the 5-HT2B class of receptors were discovered and characterized. This finding implicates the serotonergic GPCRs as potential anesthetic targets.

A simple method for determining polymeric IgA-containing immune complexes.

PubMed

Sancho, J; Egido, J; González, E

1983-06-10

A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.

Targeting Anti-Cancer Active Compounds: Affinity-Based Chromatographic Assays

PubMed Central

de Moraes, Marcela Cristina; Cardoso, Carmen Lucia; Seidl, Claudia; Moaddel, Ruin; Cass, Quezia Bezerra

2016-01-01

Affinity-based chromatography assays encompass the use of solid supports containing immobilized biological targets to monitor binding events in the isolation , identification and/or characterization of bioactive compounds. This powerful bioanalytical technique allows the screening of potential binders through fast analyses that can be directly performed using isolated substances or complex matrices. An overview of the recent researches in frontal and zonal affinity-based chromatography screening assays, which has been used as a tool in the identification and characterization of new anti-cancer agents, is discussed. In addition, a critical evaluation of the recently emerged ligands fishing assays in complex mixtures is also discussed. PMID:27306095

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus

PubMed Central

Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen

2018-01-01

ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365

Empirically Optimized Flow Cytometric Immunoassay Validates Ambient Analyte Theory

PubMed Central

Parpia, Zaheer A.; Kelso, David M.

2010-01-01

Ekins’ ambient analyte theory predicts, counter intuitively, that an immunoassay’s limit of detection can be improved by reducing the amount of capture antibody. In addition, it also anticipates that results should be insensitive to the volume of sample as well as the amount of capture antibody added. The objective of this study is to empirically validate all of the performance characteristics predicted by Ekins’ theory. Flow cytometric analysis was used to detect binding between a fluorescent ligand and capture microparticles since it can directly measure fractional occupancy, the primary response variable in ambient analyte theory. After experimentally determining ambient analyte conditions, comparisons were carried out between ambient and non-ambient assays in terms of their signal strengths, limits of detection, and their sensitivity to variations in reaction volume and number of particles. The critical number of binding sites required for an assay to be in the ambient analyte region was estimated to be 0.1VKd. As predicted, such assays exhibited superior signal/noise levels and limits of detection; and were not affected by variations in sample volume and number of binding sites. When the signal detected measures fractional occupancy, ambient analyte theory is an excellent guide to developing assays with superior performance characteristics. PMID:20152793

Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

PubMed Central

Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

2013-01-01

IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

In Situ Protein Binding Assay Using Fc-Fusion Proteins.

PubMed

Padmanabhan, Nirmala; Siddiqui, Tabrez J

2017-01-01

This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

PubMed Central

Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

2015-01-01

The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

Identification of a domain within human TAF(I)48, a subunit of Selectivity Factor 1, that interacts with helix 2 of TBP.

PubMed

Xu, Shuping; Hori, Roderick T

2004-09-01

RNA polymerase I transcription in human cells requires Selectivity Factor 1, a multisubunit complex composed of the TATA-box-binding protein (TBP) and three TBP-associated factors (TAFs) called TAF(I)48, TAF(I)63 and TAF(I)110. Each of the Selectivity Factor 1 subunits binds directly to the other three components, but these interactions have not been characterized. This study is the initial identification and analysis of a TBP-binding domain within a Selectivity Factor 1 TAF. The interaction between human TBP and human TAF(I)48 was initially examined using the yeast two-hybrid assay, and a TBP-binding domain was identified in the carboxyl-terminus of human (h)TAF(I)48. Consistent with this result, the hTAF(I)48 carboxyl-terminus was able to bind directly to TBP in protein-protein interaction assays. When mutations were introduced into the hTAF(I)48 carboxyl-terminus, we identified changes in uncharged and positive residues that affect its interaction with TBP. By examining TBP mutants, residues within and adjacent to helix 2 of TBP, previously demonstrated to interact with subunits of other TBP-containing complexes [Transcription Factor IID (TFIID) and TFIIIB] were also found to diminish its affinity for the carboxyl-terminus of hTAF(I)48. The regions of hTAF(I)48 and TBP that interact are compared to those identified within other complexes containing TBP.

PatchSurfers: Two methods for local molecular property-based binding ligand prediction.

PubMed

Shin, Woong-Hee; Bures, Mark Gregory; Kihara, Daisuke

2016-01-15

Protein function prediction is an active area of research in computational biology. Function prediction can help biologists make hypotheses for characterization of genes and help interpret biological assays, and thus is a productive area for collaboration between experimental and computational biologists. Among various function prediction methods, predicting binding ligand molecules for a target protein is an important class because ligand binding events for a protein are usually closely intertwined with the proteins' biological function, and also because predicted binding ligands can often be directly tested by biochemical assays. Binding ligand prediction methods can be classified into two types: those which are based on protein-protein (or pocket-pocket) comparison, and those that compare a target pocket directly to ligands. Recently, our group proposed two computational binding ligand prediction methods, Patch-Surfer, which is a pocket-pocket comparison method, and PL-PatchSurfer, which compares a pocket to ligand molecules. The two programs apply surface patch-based descriptions to calculate similarity or complementarity between molecules. A surface patch is characterized by physicochemical properties such as shape, hydrophobicity, and electrostatic potentials. These properties on the surface are represented using three-dimensional Zernike descriptors (3DZD), which are based on a series expansion of a 3 dimensional function. Utilizing 3DZD for describing the physicochemical properties has two main advantages: (1) rotational invariance and (2) fast comparison. Here, we introduce Patch-Surfer and PL-PatchSurfer with an emphasis on PL-PatchSurfer, which is more recently developed. Illustrative examples of PL-PatchSurfer performance on binding ligand prediction as well as virtual drug screening are also provided. Copyright © 2015 Elsevier Inc. All rights reserved.

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT

PubMed Central

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-01-01

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway. PMID:26177797

Identification and Validation of Novel Hedgehog-Responsive Enhancers Predicted by Computational Analysis of Ci/Gli Binding Site Density

PubMed Central

Richards, Neil; Parker, David S.; Johnson, Lisa A.; Allen, Benjamin L.; Barolo, Scott; Gumucio, Deborah L.

2015-01-01

The Hedgehog (Hh) signaling pathway directs a multitude of cellular responses during embryogenesis and adult tissue homeostasis. Stimulation of the pathway results in activation of Hh target genes by the transcription factor Ci/Gli, which binds to specific motifs in genomic enhancers. In Drosophila, only a few enhancers (patched, decapentaplegic, wingless, stripe, knot, hairy, orthodenticle) have been shown by in vivo functional assays to depend on direct Ci/Gli regulation. All but one (orthodenticle) contain more than one Ci/Gli site, prompting us to directly test whether homotypic clustering of Ci/Gli binding sites is sufficient to define a Hh-regulated enhancer. We therefore developed a computational algorithm to identify Ci/Gli clusters that are enriched over random expectation, within a given region of the genome. Candidate genomic regions containing Ci/Gli clusters were functionally tested in chicken neural tube electroporation assays and in transgenic flies. Of the 22 Ci/Gli clusters tested, seven novel enhancers (and the previously known patched enhancer) were identified as Hh-responsive and Ci/Gli-dependent in one or both of these assays, including: Cuticular protein 100A (Cpr100A); invected (inv), which encodes an engrailed-related transcription factor expressed at the anterior/posterior wing disc boundary; roadkill (rdx), the fly homolog of vertebrate Spop; the segment polarity gene gooseberry (gsb); and two previously untested regions of the Hh receptor-encoding patched (ptc) gene. We conclude that homotypic Ci/Gli clustering is not sufficient information to ensure Hh-responsiveness; however, it can provide a clue for enhancer recognition within putative Hedgehog target gene loci. PMID:26710299

The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection▿ †

PubMed Central

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D.; Levin, Henry L.

2009-01-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDΔ, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDΔ caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting. PMID:19109383

The chromodomain of Tf1 integrase promotes binding to cDNA and mediates target site selection.

PubMed

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D; Levin, Henry L

2009-03-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDDelta, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDDelta caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting.

International Validation of Two Human Recombinant Estrogen ...

EPA Pesticide Factsheets

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

PubMed

Murase, Akio; Nakao, Kazunari; Takada, Junji

2008-01-01

In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

PubMed

Lytton, Simon David; Schluter, Anke; Banga, Paul J

2018-06-01

Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Development of a monoclonal-based enzyme-linked immunoassay for saxitoxin-induced protein.

PubMed

Smith, D S; Kitts, D D

1994-03-01

A monoclonal antibody was generated against saxitoxin-induced protein (SIP) from the small shore crab Hemigrapsus oregenesis. SIP was induced by saxitoxin injection and could be detected in the crude crab extracts with both polyclonal and monoclonal antibody preparations. On Western blots, the polyclonal serum reacted against several bands which were induced by saxitoxin in the crude extracts. These bands represented proteins related to SIP. The monoclonal (4G5), however, was specific for the 79,000 mol. wt subunit of SIP. A triple antibody sandwich ELISA was developed in which polyclonal anti-SIP IgG was used as a trapping layer and monoclonal 4G5 was used as the detection layer. This assay was shown to be more specific and more accurate than a direct bind assay which employed the polyclonal antiserum alone. Although the polyclonal serum was more sensitive than the monoclonal on Western blots, the triple antibody sandwich and direct bind ELISAs were of comparable sensitivity.

Parallel Force Assay for Protein-Protein Interactions

PubMed Central

Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146

Parallel force assay for protein-protein interactions.

PubMed

Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.

Synthesis of biotinylated glycoconjugates and their use in a novel ELISA for direct comparison of HIV-1 Gp120 recognition of GalCer and related carbohydrate analogues.

PubMed

McReynolds, K D; Hadd, M J; Gervay-Hague, J

1999-01-01

As part of our program directed toward the design and synthesis of high-affinity ligands for the GalCer-binding site on the HIV cell surface glycoprotein, gp120, we required a reliable method for qualitatively assessing relative binding affinities for related analogues. Due to the hydrophilic nature of these synthetic conjugates, difficulties were encountered with typical ELISA methods, which rely upon hydrophobic interactions to anchor the ligand to a microtiter plate. Other types of assays were also problematic due to nonspecific binding of gp120. Therefore, we developed a general method for plating water-soluble ligands on microtiter plates using biotin/NeutrAvidin recognition for adhesion. A water-soluble GalCer analogue was prepared by conjugating psychosine to biotin using a novel tetraethylene glycol linker. In a similar manner, LacCer and GlcCer analogues were prepared and these conjugates were plated into microtiter wells containing NeutrAvidin. Unoccupied sites were blocked using biotin functionalized as a primary amide. Gp120 binding to galactosyl sphingosine, GalSph (19), GlcSph (22), and LacSph (23) conjugates was assessed through incubation with recombinant HRP-gp120. It was determined that LacSph has the strongest interaction with gp120. The binding affinities of GalSph and GlcSph were similar to each other and less strong than LacSph. These data contradict earlier studies where HPTLC showed that LacCer and GlcCer do not significantly bind gp120. They also contradict liposome-based assays that reported psychosine is not recognized by gp120. The extent of plating for each biotinylated molecule was quantified using HRP-biotin, allowing direct comparison of ligand plating efficiencies for the first time. Several other synthetic biotin conjugates were prepared and tested, demonstrating the feasibility of performing ELISA on water-soluble ligands.

Specific binding of a Pop6/Pop7 heterodimer to the P3 stem of the yeast RNase MRP and RNase P RNAs.

PubMed

Perederina, Anna; Esakova, Olga; Koc, Hasan; Schmitt, Mark E; Krasilnikov, Andrey S

2007-10-01

Pop6 and Pop7 are protein subunits of Saccharomyces cerevisiae RNase MRP and RNase P. Here we show that bacterially expressed Pop6 and Pop7 form a soluble heterodimer that binds the RNA components of both RNase MRP and RNase P. Footprint analysis of the interaction between the Pop6/7 heterodimer and the RNase MRP RNA, combined with gel mobility assays, demonstrates that the Pop6/7 complex binds to a conserved region of the P3 domain. Binding of these proteins to the MRP RNA leads to local rearrangement in the structure of the P3 loop and suggests that direct interaction of the Pop6/7 complex with the P3 domain of the RNA components of RNases MRP and P may mediate binding of other protein components. These results suggest a role for a key element in the RNase MRP and RNase P RNAs in protein binding, and demonstrate the feasibility of directly studying RNA-protein interactions in the eukaryotic RNases MRP and P complexes.

Pyridoxylamine reactivity kinetics as an amine based nucleophile for screening electrophilic dermal sensitizers

PubMed Central

Chipinda, Itai; Mbiya, Wilbes; Adigun, Risikat Ajibola; Morakinyo, Moshood K.; Law, Brandon F.; Simoyi, Reuben H.; Siegel, Paul D.

2015-01-01

Chemical allergens bind directly, or after metabolic or abiotic activation, to endogenous proteins to become allergenic. Assessment of this initial binding has been suggested as a target for development of assays to screen chemicals for their allergenic potential. Recently we reported a nitrobenzenethiol (NBT) based method for screening thiol reactive skin sensitizers, however, amine selective sensitizers are not detected by this assay. In the present study we describe an amine (pyridoxylamine (PDA)) based kinetic assay to complement the NBT assay for identification of amine-selective and non-selective skin sensitizers. UV-Vis spectrophotometry and fluorescence were used to measure PDA reactivity for 57 chemicals including anhydrides, aldehydes, and quinones where reaction rates ranged from 116 to 6.2 × 10−6 M−1 s−1 for extreme to weak sensitizers, respectively. No reactivity towards PDA was observed with the thiol-selective sensitizers, non-sensitizers and prohaptens. The PDA rate constants correlated significantly with their respective murine local lymph node assay (LLNA) threshold EC3 values (R2 = 0.76). The use of PDA serves as a simple, inexpensive amine based method that shows promise as a preliminary screening tool for electrophilic, amine-selective skin sensitizers. PMID:24333919

The carboxyl terminus of the alpha-subunit of the amiloride-sensitive epithelial sodium channel binds to F-actin.

PubMed

Mazzochi, Christopher; Bubien, James K; Smith, Peter R; Benos, Dale J

2006-03-10

The activity of the amiloride-sensitive epithelial sodium channel (ENaC) is modulated by F-actin. However, it is unknown if there is a direct interaction between alpha-ENaC and actin. We have investigated the hypothesis that the actin cytoskeleton directly binds to the carboxyl terminus of alpha-ENaC using a combination of confocal microscopy, co-immunoprecipitation, and protein binding studies. Confocal microscopy of Madin-Darby canine kidney cell monolayers stably transfected with wild type, rat isoforms of alpha-, beta-, and gamma-ENaC revealed co-localization of alpha-ENaC with the cortical F-actin cytoskeleton both at the apical membrane and within the subapical cytoplasm. F-actin was found to co-immunoprecipitate with alpha-ENaC from whole cell lysates of this cell line. Gel overlay assays demonstrated that F-actin specifically binds to the carboxyl terminus of alpha-ENaC. A direct interaction between F-actin and the COOH terminus of alpha-ENaC was further corroborated by F-actin co-sedimentation studies. This is the first study to report a direct and specific biochemical interaction between F-actin and ENaC.

Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

PubMed Central

Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

2009-01-01

The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay.

PubMed

Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M

2017-01-01

The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.

Editor's Highlight: Structure-Based Investigation on the Binding and Activation of Typical Pesticides With Thyroid Receptor.

PubMed

Xiang, Dandan; Han, Jian; Yao, Tingting; Wang, Qiangwei; Zhou, Bingsheng; Mohamed, Abou Donia; Zhu, Guonian

2017-12-01

A broad range of pesticides have been reported to interfere with the normal function of the thyroid endocrine system. However, the precise mechanism(s) of action has not yet been thoroughly elucidated. In this study, 21 pesticides were assessed for their binding interactions and the potential to disrupt thyroid homeostasis. In the GH3 luciferase reporter gene assays, 5 of the pesticides tested had agonistic effects in the order of procymidone > imidacloprid > mancozeb > fluroxypyr > atrazine. 11 pesticides inhibited luciferase activity of T3 to varying degrees, demonstrating their antagonistic activity. And there are 4 pesticides showed mixed effects when treated with different concentrations. Surface plasmon resonance (SPR) biosensor technique was used to directly measure the binding interactions of these pesticides to the human thyroid hormone receptor (hTR). 13 pesticides were observed to bind directly with TR, with a KD ranging from 4.80E-08 M to 9.44E-07 M. The association and disassociation of the hTR/pesticide complex revealed 2 distinctive binding modes between the agonists and antagonists. At the same time, a different binding mode was displayed by the pesticides showed mix agonist and antagonist activity. In addition, the molecular docking simulation analyses indicated that the interaction energy calculated by CDOCKER for the agonists and antagonists correlated well with the KD values measured by the surface plasmon resonance assay. These results help to explain the differences of the TR activities of these tested pesticides. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

PubMed

Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

2017-05-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

PubMed Central

Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

2017-01-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

Identification and Validation of Novel Small Molecule Disruptors of HuR-mRNA Interaction

PubMed Central

Wu, Xiaoqing; Lan, Lan; Wilson, David Michael; Marquez, Rebecca T.; Tsao, Wei-chung; Gao, Philip; Roy, Anuradha; Turner, Benjamin Andrew; McDonald, Peter; Tunge, Jon A; Rogers, Steven A; Dixon, Dan A.; Aubé, Jeffrey; Xu, Liang

2015-01-01

HuR, an RNA binding protein, binds to adenine- and uridine-rich elements (ARE) in the 3′-untranslated region (UTR) of target mRNAs, regulating their stability and translation. HuR is highly abundant in many types of cancer, and it promotes tumorigenesis by interacting with cancer-associated mRNAs, which encode proteins that are implicated in different tumor processes including cell proliferation, cell survival, angiogenesis, invasion, and metastasis. Drugs that disrupt the stabilizing effect of HuR upon mRNA targets could have dramatic effects on inhibiting cancer growth and persistence. In order to identify small molecules that directly disrupt the HuR–ARE interaction, we established a fluorescence polarization (FP) assay optimized for high throughput screening (HTS) using HuR protein and an ARE oligo from Musashi RNA-binding protein 1 (Msi1) mRNA, a HuR target. Following the performance of an HTS of ~6000 compounds, we discovered a cluster of potential disruptors, which were then validated by AlphaLISA (Amplified Luminescent Proximity Homogeneous Assay), surface plasmon resonance (SPR), ribonucleoprotein immunoprecipitation (RNP IP) assay, and luciferase reporter functional studies. These compounds disrupted HuR–ARE interactions at the nanomolar level and blocked HuR function by competitive binding to HuR. These results support future studies toward chemical probes for a HuR function study and possibly a novel therapy for HuR-overexpressing cancers. PMID:25750985

In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality

PubMed Central

Yu, Haixiang; Yang, Weijuan; Alkhamis, Obtin; Canoura, Juan; Yang, Kyung-Ae; Xiao, Yi

2018-01-01

Abstract Aptamer-based sensors offer a powerful tool for molecular detection, but the practical implementation of these biosensors is hindered by costly and laborious sequence engineering and chemical modification procedures. We report a simple strategy for directly isolating signal-reporting aptamers in vitro through systematic evolution of ligands by exponential enrichment (SELEX) that transduce binding events into a detectable change of absorbance via target-induced displacement of a small-molecule dye. We first demonstrate that diethylthiatricarbocyanine (Cy7) can stack into DNA three-way junctions (TWJs) in a sequence-independent fashion, greatly altering the dye's absorbance spectrum. We then design a TWJ-containing structured library and isolate an aptamer against 3,4-methylenedioxypyrovalerone (MDPV), a synthetic cathinone that is an emerging drug of abuse. This aptamer intrinsically binds Cy7 within its TWJ domain, but MDPV efficiently displaces the dye, resulting in a change in absorbance within seconds. This assay is label-free, and detects nanomolar concentrations of MDPV. It also recognizes other synthetic cathinones, offering the potential to detect newly-emerging designer drugs, but does not detect structurally-similar non-cathinone compounds or common cutting agents. Moreover, we demonstrate that the Cy7-displacement colorimetric assay is more sensitive than a conventional strand-displacement fluorescence assay. We believe our strategy offers an effective generalized approach for the development of sensitive dye-displacement colorimetric assays for other small-molecule targets. PMID:29361056

International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays

EPA Science Inventory

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...

Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.

PubMed

Green, David J; Rudd, Edwin A; Laugharn, James A

2014-08-01

We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.

Toxin detection using a fiber-optic-based biosensor

NASA Astrophysics Data System (ADS)

Ogert, Robert A.; Shriver-Lake, Lisa C.; Ligler, Frances S.

1993-05-01

Using an evanescent wave fiber optic-based biosensor developed at Naval Research Laboratory, ricin toxin can be detected in the low ng/ml range. Sensitivity was established at 1 - 5 ng/ml using a two-step assay. The two-step assay showed enhanced signal levels in comparison to a one-step assay. A two-step assay utilizes a 10 minute incubation of an immobilized affinity purified anti-ricin antibody fiber optic probe in the ricin sample before placement in a solution of fluorophore-labeled goat anti-ricin antibodies. The specific fluorescent signal is obtained by the binding of the fluorophore-labeled antibodies to ricin which is bound by the immobilized antibodies on the fiber optic probe. The toxin can be detected directly from urine and river water using this fiber optic assay.

Integrated Summary Report: Validation of Two Binding Assays ...

EPA Pesticide Factsheets

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89

Real-Time Tau Protein Detection by Sandwich-Based Piezoelectric Biosensing: Exploring Tubulin as a Mass Enhancer.

PubMed

Li, Dujuan; Scarano, Simona; Lisi, Samuele; Palladino, Pasquale; Minunni, Maria

2018-03-22

Human tau protein is one of the most advanced and accepted biomarkers for AD and tauopathies diagnosis in general. In this work, a quartz crystal balance (QCM) immunosensor was developed for the detection of human tau protein in buffer and artificial cerebrospinal fluid (aCSF), through both direct and sandwich assays. Starting from a conventional immuno-based sandwich strategy, two monoclonal antibodies recognizing different epitopes of tau protein were used, achieving a detection limit for the direct assay in nanomolar range both in HBES-EP and aCSF. Afterward, for exploring alternative specific receptors as secondary recognition elements for tau protein biosensing, we tested tubulin and compared its behavior to a conventional secondary antibody in the sandwich assay. Tau-tubulin binding has shown an extended working range coupled to a signal improvement in comparison with the conventional secondary antibody-based approach, showing a dose-response trend at lower tau concentration than is usually investigated and closer to the physiological levels in the reference matrix for protein tau biomarker. Our results open up new and encouraging perspectives for the use of tubulin as an alternative receptor for tau protein with interesting features due to the possibility of taking advantage of its polymerization and reversible binding to this key hallmark of Alzheimer's disease.

Development of a β-Lactoglobulin Sensor Based on SPR for Milk Allergens Detection.

PubMed

Ashley, Jon; D'Aurelio, Roberta; Piekarska, Monika; Temblay, Jeff; Pleasants, Mike; Trinh, Linda; Rodgers, Thomas L; Tothill, Ibtisam E

2018-03-27

A sensitive and label-free surface plasmon resonance (SPR) based sensor was developed in this work for the detection of milk allergens. β-lactoglobulin (BLG) protein was used as the biomarker for cow milk detection. This is to be used directly in final rinse samples of cleaning in-place (CIP) systems of food manufacturers. The affinity assay was optimised and characterised before a standard curve was performed in pure buffer conditions, giving a detection limit of 0.164 µg mL -1 as a direct binding assay. The detection limit can be further enhanced through the use of a sandwich assay and amplification with nanomaterials. However, this was not required here, as the detection limit achieved exceeded the required allergen detection levels of 2 µg mL -1 for β-lactoglobulin. The binding affinities of the polyclonal antibody for BLG, expressed by the dissociation constant (K D ), were equal to 2.59 × 10 -9 M. The developed SPR-based sensor offers several advantages in terms of label-free detection, real-time measurements, potential on-line system and superior sensitivity when compared to ELISA-based techniques. The method is novel for this application and could be applied to wider food allergen risk management decision(s) in food manufacturing.

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps.

PubMed

Wong, Jessica X H; Li, Xiaochun; Liu, Frank S F; Yu, Hua-Zhong

2015-06-30

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today's smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps.

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps

PubMed Central

Wong, Jessica X. H.; Li, Xiaochun; Liu, Frank S. F.; Yu, Hua-Zhong

2015-01-01

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today’s smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps. PMID:26122608

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps

NASA Astrophysics Data System (ADS)

Wong, Jessica X. H.; Li, Xiaochun; Liu, Frank S. F.; Yu, Hua-Zhong

2015-06-01

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today’s smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps.

Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

PubMed

Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

2001-04-01

The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

A sensory complex consisting of an ATP-binding cassette transporter and a two-component regulatory system controls bacitracin resistance in Bacillus subtilis.

PubMed

Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne

2014-10-03

Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

A Sensory Complex Consisting of an ATP-binding Cassette Transporter and a Two-component Regulatory System Controls Bacitracin Resistance in Bacillus subtilis*

PubMed Central

Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne

2014-01-01

Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. PMID:25118291

A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

PubMed Central

Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

2013-01-01

Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

Development of LSPR and SPR sensor for the detection of an anti-cancer drug for chemotherapy

NASA Astrophysics Data System (ADS)

Zhao, Sandy Shuo; Bolduc, Olivier R.; Colin, Damien Y.; Pelletier, Joelle N.; Masson, Jean-François

2012-03-01

The anti-cancer drug, methotrexate (MTX) as a strong inhibitor of human dihydrofolate reductase (hDHFR) has been studied in localized surface plasmon resonance (LSPR) and surface plasmon resonance (SPR) competitive binding assays with folic acid stabilized gold nanoparticles (FA AuNP). The latter with a diameter of 15 nm were prepared in a simple step with sequential characterization using UV-Vis, FTIR, and Raman. A LSPR competitive binding assay between different concentrations of MTX and FA AuNP for hDHFR in solution was designed to quantify MTX by using UV-Vis spectroscopy. Sensitivity of the assay was optimized with respect to both concentrations of the enzyme and FA. The detection and quantification of spiked MTX was demonstrated in phosphate buffer saline and in fetal bovine serum accompanied by solid-phase extraction treatment of the serum. In addition, this assay could also provide as a screening tool for potential inhibitors of hDHFR. In another perspective, MTX was measured in a competitive binding assay with FA AuNP for histidine-tagged hDHFR immobilized on a SPR sensitive surface. In this case, FA AuNP offer a secondary amplification of the analytical response which is indirectly proportional to the concentration of MTX. This alternative approach could contribute to the realization of direct detection of MTX in complex biological fluids. A comparison of characteristics and analytical parameters such as sensitivity, dynamic range and limit of detection between the LSPR and SPR sensing platforms will also be presented. Both assays offer potential in tackling real biological samples for the purpose of monitoring and validating anti-cancer drug levels in human serum during chemotherapy.

Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα

PubMed Central

Sun, Ying; Tan, Yu-jun; Lu, Zhan-zhao; Li, Bing-bing; Sun, Cheng-hong; Li, Tao; Zhao, Li-li; Liu, Zhong; Zhang, Gui-min; Yao, Jing-chun; Li, Jie

2018-01-01

Burdock (Arctium lappa) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro. Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography–mass spectrometry (LC–MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα, and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth. PMID:29636686

Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα.

PubMed

Sun, Ying; Tan, Yu-Jun; Lu, Zhan-Zhao; Li, Bing-Bing; Sun, Cheng-Hong; Li, Tao; Zhao, Li-Li; Liu, Zhong; Zhang, Gui-Min; Yao, Jing-Chun; Li, Jie

2018-01-01

Burdock ( Arctium lappa ) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro . Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC 50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography-mass spectrometry (LC-MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα , and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth.

Characterization of a unique motif in LIM mineralization protein-1 that interacts with jun activation-domain-binding protein 1.

PubMed

Sangadala, Sreedhara; Yoshioka, Katsuhito; Enyo, Yoshio; Liu, Yunshan; Titus, Louisa; Boden, Scott D

2014-01-01

Development and repair of the skeletal system and other organs are highly dependent on precise regulation of the bone morphogenetic protein (BMP) pathway. The use of BMPs clinically to induce bone formation has been limited in part by the requirement of much higher doses of recombinant proteins in primates than were needed in cell culture or rodents. Therefore, increasing cellular responsiveness to BMPs has become our focus. We determined that an osteogenic LIM mineralization protein, LMP-1 interacts with Smurf1 (Smad ubiquitin regulatory factor 1) and prevents ubiquitination of Smads resulting in potentiation of BMP activity. In the region of LMP-1 responsible for bone formation, there is a motif that directly interacts with the Smurf1 WW2 domain and thus effectively competes for binding with Smad1 and Smad5, key signaling proteins in the BMP pathway. Here we show that the same region also contains a motif that interacts with Jun activation-domain-binding protein 1 (Jab1) which targets a common Smad, Smad4, shared by both the BMP and transforming growth factor-β (TGF-β) pathways, for proteasomal degradation. Jab1 was first identified as a coactivator of the transcription factor c-Jun. Jab1 binds to Smad4, Smad5, and Smad7, key intracellular signaling molecules of the TGF-β superfamily, and causes ubiquitination and/or degradation of these Smads. We confirmed a direct interaction of Jab1 with LMP-1 using recombinantly expressed wild-type and mutant proteins in slot-blot-binding assays. We hypothesized that LMP-1 binding to Jab1 prevents the binding and subsequent degradation of these Smads causing increased accumulation of osteogenic Smads in cells. We identified a sequence motif in LMP-1 that was predicted to interact with Jab1 based on the MAME/MAST sequence analysis of several cellular signaling molecules that are known to interact with Jab-1. We further mutated the potential key interacting residues in LMP-1 and showed loss of binding to Jab1 in binding assays in vitro. The activities of various wild-type and mutant LMP-1 proteins were evaluated using a BMP-responsive luciferase reporter and alkaline phosphatase assay in mouse myoblastic cells that were differentiated toward the osteoblastic phenotype. Finally, to strengthen physiological relevance of LMP-1 and Jab1 interaction, we showed that overexpression of LMP-1 caused nuclear accumulation of Smad4 upon BMP treatment which is reflective of increased Smad signaling in cells.

Cobra venom factor immunoconjugates: effects of carbohydrate-directed versus amino group-directed conjugation.

PubMed

Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W

1995-01-01

Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)

An antibody reactive to the Gly63–Lys68 epitope of NT-proBNP exhibits O-glycosylation-independent binding

PubMed Central

Lee, Yujean; Kim, Hyori; Chung, Junho

2014-01-01

The N-terminal fragment of prohormone brain natriuretic peptide (NT-proBNP) is a commonly used biomarker for the diagnosis of congestive heart failure, although its biological function is not well known. NT-proBNP exhibits heavy O-linked glycosylation, and it is quite difficult to develop an antibody that exhibits glycosylation-independent binding. We developed an antibody that binds to the recombinant NT-proBNP protein and its deglycosylated form with similar affinities in an enzyme immunoassay. The epitope was defined as Gly63–Lys68 based on mimetic peptide screening, site-directed mutagenesis and a competition assay with a peptide mimotope. The nearest O-glycosylation residues are Thr58 and Thr71; therefore, four amino acid residues intervene between the epitope and those residues in both directions. In conclusion, we report that an antibody reactive to Gly63–Lys68 of NT-proBNP exhibits O-glycosylation-independent binding. PMID:25236766

Bovine κ-casein inhibits human rotavirus (HRV) infection via direct binding of glycans to HRV.

PubMed

Inagaki, M; Muranishi, H; Yamada, K; Kakehi, K; Uchida, K; Suzuki, T; Yabe, T; Nakagomi, T; Nakagomi, O; Kanamaru, Y

2014-05-01

Human rotavirus (HRV) is a major etiologic agent of severe infantile gastroenteritis. κ-Casein (κ-CN) from both human and bovine mature milk has been reported to have anti-HRV activity; however, the mechanism of this activity is poorly understood. The present study examined the molecular basis for the protective effect of bovine κ-CN derived from late colostrum (6-7 d after parturition) and from mature milk. Among the components of casein, κ-CN is the only glycosylated protein that has been identified. Therefore, we investigated whether the glycan residues in κ-CN were involved in the anti-HRV activity. Desialylated CN obtained by neuraminidase treatment exhibited anti-HRV activity, whereas deglycosylated CN obtained by o-glycosidase treatment lacked antiviral activity, indicating that glycans were responsible for the antiviral activity of CN. Furthermore, an evanescent-field fluorescence-assisted assay showed that HRV particles directly bound to heated casein (at 95°C for 30 min) in a viral titer-dependent manner. Although the heated κ-CN retained inhibitory activity in a neutralization assay, the activity was weaker than that observed before heat treatment. Our findings indicate that the inhibitory mechanism of bovine κ-CN against HRV involves direct binding to viral particles via glycan residues. In addition, heat-labile structures in κ-CN may play an important role in maintenance of κ-CN binding to HRV. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

RNA Helicase Associated with AU-rich Element (RHAU/DHX36) Interacts with the 3′-Tail of the Long Non-coding RNA BC200 (BCYRN1)*

PubMed Central

Booy, Evan P.; McRae, Ewan K. S.; Howard, Ryan; Deo, Soumya R.; Ariyo, Emmanuel O.; Dzananovic, Edis; Meier, Markus; Stetefeld, Jörg; McKenna, Sean A.

2016-01-01

RNA helicase associated with AU-rich element (RHAU) is an ATP-dependent RNA helicase that demonstrates high affinity for quadruplex structures in DNA and RNA. To elucidate the significance of these quadruplex-RHAU interactions, we have performed RNA co-immunoprecipitation screens to identify novel RNAs bound to RHAU and characterize their function. In the course of this study, we have identified the non-coding RNA BC200 (BCYRN1) as specifically enriched upon RHAU immunoprecipitation. Although BC200 does not adopt a quadruplex structure and does not bind the quadruplex-interacting motif of RHAU, it has direct affinity for RHAU in vitro. Specifically designed BC200 truncations and RNase footprinting assays demonstrate that RHAU binds to an adenosine-rich region near the 3′-end of the RNA. RHAU truncations support binding that is dependent upon a region within the C terminus and is specific to RHAU isoform 1. Tests performed to assess whether BC200 interferes with RHAU helicase activity have demonstrated the ability of BC200 to act as an acceptor of unwound quadruplexes via a cytosine-rich region near the 3′-end of the RNA. Furthermore, an interaction between BC200 and the quadruplex-containing telomerase RNA was confirmed by pull-down assays of the endogenous RNAs. This leads to the possibility that RHAU may direct BC200 to bind and exert regulatory functions at quadruplex-containing RNA or DNA sequences. PMID:26740632

Direct fluorescence polarization assay for the detection of glycopeptide antibiotics.

PubMed

Yu, Linliang; Zhong, Meng; Wei, Yinan

2010-08-15

Glycopeptide antibiotics are widely used in the treatment of infections caused by Gram-positive bacteria. They inhibit the biosynthesis of the bacterial cell wall through binding to the D-alanyl-D-alanine (D-Ala-D-Ala) terminal peptide of the peptidoglycan precursor. Taking advantage of this highly specific interaction, we developed a direct fluorescence polarization based method for the detection of glycopeptide antibiotics. Briefly, we labeled the acetylated tripeptide Ac-L-Lys-D-Ala-D-Ala-OH with a fluorophore to create a peptide probe. Using three glycopeptide antibiotics, vancomycin, teicoplanin, and telavancin, as model compounds, we demonstrated that the fluorescence polarization of the peptide probe increased upon binding to antibiotics in a concentration dependent manner. The dissociation constants (K(d)) between the peptide probes and the antibiotics were consistent with those reported between free d-Ala-d-Ala and the antibiotics in the literature. The assay is highly reproducible and selective toward glycopeptide antibiotics. Its detection limit and work concentration range are 0.5 microM and 0.5-4 microM for vancomycin, 0.25 microM and 0.25-2 microM for teicoplanin, and 1 microM and 1-8 microM for telavancin. Furthermore, we compared our assay in parallel with a commercial fluorescence polarization immunoassay (FPIA) kit in detecting teicoplanin spiked in human blood samples. The accuracy and precision of the two methods are comparable. We expect our assay to be useful in both research and clinical laboratories.

Development of binding assays in microfabricated picoliter vials: an assay for biotin.

PubMed

Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W

2000-06-01

A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.

Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data

PubMed Central

Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong

2017-01-01

ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487

An affinity improved single-chain antibody from phage display of a library derived from monoclonal antibodies detects fumonisins by immunoassay.

PubMed

Hu, Zu-Quan; Li, He-Ping; Wu, Ping; Li, Ya-Bo; Zhou, Zhu-Qing; Zhang, Jing-Bo; Liu, Jin-Long; Liao, Yu-Cai

2015-03-31

Fumonisin B analogs, particularly FB1, FB2, and FB3, are major mycotoxins found in cereals. Single-chain fragment variable (scFv) antibodies represent a promising alternative immunoassay system. A phage-displayed antibody library derived from four monoclonal antibodies (mAbs) generated against FB1 was used to screen high binding affinity scFv antibodies; the best candidate was designated H2. Surface plasmon resonance measurements confirmed that the H2 scFv displayed a 82-fold higher binding affinity than its parent mAb. Direct competitive enzyme-linked immunosorbent assay demonstrated that the H2 antibody could competitively bind to free FB1, FB2, and FB3, with an IC50 of 0.11, 0.04, and 0.10 μM, respectively; it had no cross-reactivity to deoxynivalenol, nivalenol and aflatoxin. Validation assays with naturally contaminated samples revealed a linear relationship between the H2 antibody-based assay results and chemical analysis results, that could be expressed as y=1.7072x+5.5606 (R(2)=0.8883). Homology modeling of H2 revealed a favorable binding structure highly complementary to the three fumonisins. Molecular docking analyses suggested that the preferential binding of the H2 scFv to FB2 was due to the presence of a hydrogen radical in its R1 position, leading to a proper electrostatic matching and hydrophobic interaction. The H2 scFv antibody can be used for the rapid, accurate, and specific detection of fumonisin contamination in agricultural samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Desomorphine Screening Using Commercial Enzyme-Linked Immunosorbent Assays.

PubMed

Winborn, Jessica; Kerrigan, Sarah

2017-06-01

Desomorphine ("Krokodil") is a semi-synthetic opioid that has drawn attention as a recreational drug, particularly in Russia, neighboring former Soviet Republics, Eastern and Central Europe. It has no accepted medicinal uses and is currently a schedule I drug in the United States. In clandestine environments, desomorphine is synthesized from codeine using red phosphorous, hydroiodic acid and gasoline. Residual starting materials in illicit preparations have been associated with severe dermatological effects and extensive tissue necrosis. Desomorphine is not well studied, and there are limited reports concerning its pharmacology or detection in biological matrices. Immunoassays are widely relied upon for both antemortem and postmortem toxicology screening. Although desomorphine is an opioid of the phenanthrene-type, its ability to bind to conventional opioid antibodies has not been described. In this report we describe the cross-reactivity of desomorphine using six commercially available enzyme-linked immunosorbent assays (Immunalysis Opiates Direct ELISA, Immunalysis Oxycodone/Oxymorphone Direct ELISA, Randox Opiate ELISA, OraSure Technologies OTI Opiate Micro-plate EIA, Neogen Opiate Group ELISA and Neogen Oxycodone/Oxymorphone ELISA). Cross-reactivites were highly variable between assays, ranging from 77 to <2.5%. In general, assays directed towards morphine produced greater cross-reactivity with desomorphine than those directed towards oxycodone. The Immunalysis Opiates Direct ELISA produced the greatest cross-reactivity, although several of the assays evaluated produced cross-reactivity of a sufficient magnitude to be effective for desomorphine screening. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Bidirectional helical motility of cytoplasmic dynein around microtubules

PubMed Central

Can, Sinan; Dewitt, Mark A; Yildiz, Ahmet

2014-01-01

Cytoplasmic dynein is a molecular motor responsible for minus-end-directed cargo transport along microtubules (MTs). Dynein motility has previously been studied on surface-immobilized MTs in vitro, which constrains the motors to move in two dimensions. In this study, we explored dynein motility in three dimensions using an MT bridge assay. We found that dynein moves in a helical trajectory around the MT, demonstrating that it generates torque during cargo transport. Unlike other cytoskeletal motors that produce torque in a specific direction, dynein generates torque in either direction, resulting in bidirectional helical motility. Dynein has a net preference to move along a right-handed helical path, suggesting that the heads tend to bind to the closest tubulin binding site in the forward direction when taking sideways steps. This bidirectional helical motility may allow dynein to avoid roadblocks in dense cytoplasmic environments during cargo transport. DOI: http://dx.doi.org/10.7554/eLife.03205.001 PMID:25069614

Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

PubMed

Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

2018-03-28

Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

PubMed Central

Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

2013-01-01

WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

Bisphenol AF and Bisphenol B Exert Higher Estrogenic Effects than Bisphenol A via G Protein-Coupled Estrogen Receptor Pathway.

PubMed

Cao, Lin-Ying; Ren, Xiao-Min; Li, Chuan-Hai; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong

2017-10-03

Numerous studies have indicated estrogenic disruption effects of bisphenol A (BPA) analogues. Previous mechanistic studies were mainly focused on their genomic activities on nuclear estrogen receptor pathway. However, their nongenomic effects through G protein-coupled estrogen receptor (GPER) pathway remain poorly understood. Here, using a SKBR3 cell-based fluorescence competitive binding assay, we found six BPA analogues bound to GPER directly, with bisphenol AF (BPAF) and bisphenol B (BPB) displaying much higher (∼9-fold) binding affinity than BPA. Molecular docking also demonstrated the binding of these BPA analogues to GPER. By measuring calcium mobilization and cAMP production in SKBR3 cells, we found the binding of these BPA analogues to GPER lead to the activation of subsequent signaling pathways. Consistent with the binding results, BPAF and BPB presented higher agonistic activity than BPA with the lowest effective concentration (LOEC) of 10 nM. Moreover, based on the results of Boyden chamber and wound-healing assays, BPAF and BPB displayed higher activity in promoting GPER mediated SKBR3 cell migration than BPA with the LOEC of 100 nM. Overall, we found two BPA analogues BPAF and BPB could exert higher estrogenic effects than BPA via GPER pathway at nanomolar concentrations.

Direct replacement of antibodies with molecularly imprinted polymer nanoparticles in ELISA--development of a novel assay for vancomycin.

PubMed

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J Sarah; Piletska, Elena V; De Vargas Sansalvador, Isabel M Perez; Whitcombe, Michael J; Piletsky, Sergey A

2013-09-03

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop assays similar to the enzyme-linked immunosorbent assay (ELISA) is presented here for the first time. NanoMIPs were synthesized by a solid-phase approach with an immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering, and electron microscopy. Immobilization, blocking, and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a horseradish peroxidase-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range of 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was 3 orders of magnitude better than a previously described ELISA based on antibodies. In these experiments, nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA.

Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.

2014-09-01

Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

Positive selection moments identify potential functional residues in human olfactory receptors

NASA Technical Reports Server (NTRS)

Singer, M. S.; Weisinger-Lewin, Y.; Lancet, D.; Shepherd, G. M.

1996-01-01

Correlated mutation analysis and molecular models of olfactory receptors have provided evidence that residues in the transmembrane domains form a binding pocket for odor ligands. As an independent test of these results, we have calculated positive selection moments for the alpha-helical sixth transmembrane domain (TM6) of human olfactory receptors. The moments can be used to identify residues that have been preferentially affected by positive selection and are thus likely to interact with odor ligands. The results suggest that residue 622, which is commonly a serine or threonine, could form critical H-bonds. In some receptors a dual-serine subsite, formed by residues 622 and 625, could bind hydroxyl determinants on odor ligands. The potential importance of these residues is further supported by site-directed mutagenesis in the beta-adrenergic receptor. The findings should be of practical value for future physiological studies, binding assays, and site-directed mutagenesis.

Synthesis and characterization of time-resolved fluorescence probes for evaluation of competitive binding to melanocortin receptors.

PubMed

Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A

2013-09-01

Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.

Immunogenicity and protective efficacy of heparan sulphate binding proteins of Entamoeba histolytica in a guinea pig model of intestinal amoebiasis.

PubMed

Kaur, Upninder; Khurana, Sumeeta; Saikia, Uma Nahar; Dubey, M L

2013-11-01

Entamoeba histolytica infection is associated with considerable morbidity and mortality in the form of intestinal and extraintestinal amoebiasis. No vaccine is yet available for amoebiasis. Heparan Sulphate Binding Proteins (HSBPs) from E. histolytica were evaluated for immunogenicity and protective efficacy in a Guinea pig model. Animals were immunized subcutaneously with 30μg of HSBP by three weekly inoculations. The immunogenicity of HSBP was determined by antibody response (IgG, IgM and IgA), splenocyte proliferation assay and in vitro direct amoebicidal assay with splenic lymphocytes and monocytes from vaccinated and control animals. The efficacy of the vaccine was evaluated by challenge infection to vaccinated and control animals by intra-caecal inoculation of E. histolytica trophozoites and comparing gross and histopathological findings in caeca of these animals. HSBP was found to induce specific anti-amoebic response as seen by specific antibody production and direct amoebicidal activity of splenocytes. The vaccine also showed partial protection against challenge infection in vaccinated animals as shown by mild/absent lesions and histopathological findings. Copyright © 2013 Elsevier Inc. All rights reserved.

Evaluation of a newly developed quantitative heart-type fatty acid binding protein assay based on fluorescence immunochromatography using specific monoclonal antibodies.

PubMed

Kang, Keren; Wu, Peidian; Li, Wenmei; Tang, Shixing; Wang, Jihua; Luo, Xiaochun; Xie, Mingquan

2015-01-01

To develop a rapid, sensitive and specific assay for quantification of serum heart-type fatty acid binding protein (H-FABP) based on immunofluorescence of specific monoclonal antibodies. We generated novel H-FABP-directed monoclonal antibodies by cloning of spleen cells of mice immunized with H-FABP. Epitopes were mapped and antigen affinity was assessed by surface plasmon resonance (SPR). The H-FABP specific monoclonal antibodies were coupled to fluorescent beads and sprayed onto a nitrocellulose membrane facilitating quantification of H-FABP by immunofluorescence. Reagent cross-reactivity, interference resistance, accuracy and sensitivity were examined. A total of 103 clinical samples were used to compare the sensitivity and specificity of the new assay to a commercially available Randox kit. This new assay could be finished within 15 min, with sensitivity reaching 1 ng/ml. In a trial of 103 clinical serum samples, the new testing kit results were highly correlated with those from the Randox kit (R(2) = 0.9707). Using the Randox kit as the reference kit, the sensitivity of the new assay was 98.25%, and specificity was 100%. An immunofluorescence-based H-FABP assay employing novel monoclonal antibodies could rapidly, specifically and sensitively detect H-FABP in serum samples, providing an effective method for rapid clinical assessment of H-FABP index in the clinic.

The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

PubMed

Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

2014-09-01

Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

Solubilization of a membrane protein by combinatorial supercharging.

PubMed

Hajduczki, Agnes; Majumdar, Sudipta; Fricke, Marie; Brown, Isola A M; Weiss, Gregory A

2011-04-15

Hydrophobic and aggregation-prone, membrane proteins often prove too insoluble for conventional in vitro biochemical studies. To engineer soluble variants of human caveolin-1, a phage-displayed library of caveolin variants targeted the hydrophobic intramembrane domain with substitutions to charged residues. Anti-selections for insolubility removed hydrophobic variants, and positive selections for binding to the known caveolin ligand HIV gp41 isolated functional, folded variants. Assays with several caveolin binding partners demonstrated the successful folding and functionality by a solubilized, full-length caveolin variant selected from the library. This caveolin variant allowed assay of the direct interaction between caveolin and cavin. Clustered along one face of a putative helix, the solubilizing mutations suggest a structural model for the intramembrane domain of caveolin. The approach provides a potentially general method for solubilization and engineering of membrane-associated proteins by phage display.

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

Competition-based cellular peptide binding assays for 13 prevalent HLA class I alleles using fluorescein-labeled synthetic peptides.

PubMed

Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W

2003-02-01

We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.

Direct replacement of antibodies with molecularly imprinted polymer (MIP) nanoparticles in ELISA – development of a novel assay for vancomycin

PubMed Central

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J. Sarah; Piletska, Elena V.; Perez De Vargas Sansalvador, Isabel M.; Whitcombe, Michael J.; Piletsky, Sergey A.

2016-01-01

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop ELISA type assays is presented here for the first time. NanoMIPs were synthesized by a solid phase approach with immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering and electron microscopy. Immobilization, blocking and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a HRP-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was three orders of magnitude better than a previously described ELISA based on antibodies. In these experiments nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA. PMID:23947402

Quantitatively and Kinetically Identifying Binding Motifs of Amelogenin Proteins to Mineral Crystals Through Biochemical and Spectroscopic Assays

PubMed Central

Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu

2014-01-01

Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774

Mapping the signal peptide binding and oligomer contact sites of the core subunit of the pea twin arginine protein translocase.

PubMed

Ma, Xianyue; Cline, Kenneth

2013-03-01

Twin arginine translocation (Tat) systems of thylakoid and bacterial membranes transport folded proteins using the proton gradient as the sole energy source. Tat substrates have hydrophobic signal peptides with an essential twin arginine (RR) recognition motif. The multispanning cpTatC plays a central role in Tat operation: It binds the signal peptide, directs translocase assembly, and may facilitate translocation. An in vitro assay with pea (Pisum sativum) chloroplasts was developed to conduct mutagenesis and analysis of cpTatC functions. Ala scanning mutagenesis identified mutants defective in substrate binding and receptor complex assembly. Mutations in the N terminus (S1) and first stromal loop (S2) caused specific defects in signal peptide recognition. Cys matching between substrate and imported cpTatC confirmed that S1 and S2 directly and specifically bind the RR proximal region of the signal peptide. Mutations in four lumen-proximal regions of cpTatC were defective in receptor complex assembly. Copurification and Cys matching analyses suggest that several of the lumen proximal regions may be important for cpTatC-cpTatC interactions. Surprisingly, RR binding domains of adjacent cpTatCs directed strong cpTatC-cpTatC cross-linking. This suggests clustering of binding sites on the multivalent receptor complex and explains the ability of Tat to transport cross-linked multimers. Transport of substrate proteins cross-linked to the signal peptide binding site tentatively identified mutants impaired in the translocation step.

Mannose-recognition mutant of the galactose/N-acetylgalactosamine-specific C-type lectin CEL-I engineered by site-directed mutagenesis.

PubMed

Moriuchi, Hiromi; Unno, Hideaki; Goda, Shuichiro; Tateno, Hiroaki; Hirabayashi, Jun; Hatakeyama, Tomomitsu

2015-07-01

CEL-I is a galactose/N-acetylgalactosamine-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. Its carbohydrate-binding site contains a QPD (Gln-Pro-Asp) motif, which is generally recognized as the galactose specificity-determining motif in the C-type lectins. In our previous study, replacement of the QPD motif by an EPN (Glu-Pro-Asn) motif led to a weak binding affinity for mannose. Therefore, we examined the effects of an additional mutation in the carbohydrate-binding site on the specificity of the lectin. Trp105 of EPN-CEL-I was replaced by a histidine residue using site-directed mutagenesis, and the binding affinity of the resulting mutant, EPNH-CEL-I, was examined by sugar-polyamidoamine dendrimer assay, isothermal titration calorimetry, and glycoconjugate microarray analysis. Tertiary structure of the EPNH-CEL-I/mannose complex was determined by X-ray crystallographic analysis. Sugar-polyamidoamine dendrimer assay and glycoconjugate microarray analysis revealed a drastic change in the specificity of EPNH-CEL-I from galactose/N-acetylgalactosamine to mannose. The association constant of EPNH-CEL-I for mannose was determined to be 3.17×10(3) M(-1) at 25°C. Mannose specificity of EPNH-CEL-I was achieved by stabilization of the binding of mannose in a correct orientation, in which the EPN motif can form proper hydrogen bonds with 3- and 4-hydroxy groups of the bound mannose. Specificity of CEL-I can be engineered by mutating a limited number of amino acid residues in addition to the QPD/EPN motifs. Versatility of the C-type carbohydrate-recognition domain structure in the recognition of various carbohydrate chains could become a promising platform to develop novel molecular recognition proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

Structural basis for collagen recognition by the immune receptor OSCAR.

PubMed

Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

2016-02-04

The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

Immunoblotting assays for keratan sulfate.

PubMed

Yoon, Jung Hae; Brooks, Randolph; Halper, Jaroslava

2002-07-15

The detection of microquantities of glycosaminoglycans (GAGs) in biological samples has been hampered by the lack of sensitive methods. In this paper we describe the modification and development of three sensitive assays capable of detecting nanogram quantities of GAGs in biological samples. The first assay detects total GAGs. It is a modified Alcian blue dye precipitation assay in which the dye binds to the negatively charged GAGs in CsCl-fractionated extracts from chicken tendons. This assay compares favorably with the widely used uronic acid assay in terms of its sensitivity and ability to detect all classes of GAGs, including keratan sulfate (KS). Two other assays, dot-blotting and immunoblotting, detect KS in complex mixtures and can be easily adapted for the detection of other GAGs. Both take advantage of binding of carboxyl and sulfate groups of GAGs to trivalent neodymium. In dot-blotting, samples were directly blotted onto nitrocellulose membrane soaked in Nd(2)(SO(4))(3) buffer, and KS was detected with the monoclonal anti-KS 5-D-4 antibody and an avidin-biotin complex detection system. In immunoblotting, the samples were first separated in 28% polyacrylamide gels, transferred onto a Nd(2)(SO(4))(3)-soaked nitrocellulose membrane using a phosphate buffer system, and stained and developed using the same protocol as in dot-blotting. Whereas dot-blotting allows the use of very low quantities of samples because of its high sensitivity (lower detection limit was 5 ng), immunoblotting provides more specificity.

Oleamide activates peroxisome proliferator-activated receptor gamma (PPARγ) in vitro.

PubMed

Dionisi, Mauro; Alexander, Stephen P H; Bennett, Andrew J

2012-05-14

Oleamide (ODA) is a fatty acid primary amide first identified in the cerebrospinal fluid of sleep-deprived cats, which exerts effects on vascular and neuronal tissues, with a variety of molecular targets including cannabinoid receptors and gap junctions. It has recently been reported to exert a hypolipidemic effect in hamsters. Here, we have investigated the nuclear receptor family of peroxisome proliferator-activated receptors (PPARs) as potential targets for ODA action. Activation of PPARα, PPARβ and PPARγ was assessed using recombinant expression in Chinese hamster ovary cells with a luciferase reporter gene assay. Direct binding of ODA to the ligand binding domain of each of the three PPARs was monitored in a cell-free fluorescent ligand competition assay. A well-established assay of PPARγ activity, the differentiation of 3T3-L1 murine fibroblasts into adipocytes, was assessed using an Oil Red O uptake-based assay. ODA, at 10 and 50 μM, was able to transactivate PPARα, PPARβ and PPARγ receptors. ODA bound to the ligand binding domain of all three PPARs, although complete displacement of fluorescent ligand was only evident for PPARγ, at which an IC50 value of 38 μM was estimated. In 3T3-L1 cells, ODA, at 10 and 20 μM, induced adipogenesis. We have, therefore, identified a novel site of action of ODA through PPAR nuclear receptors and shown how ODA should be considered as a weak PPARγ ligand in vitro.

Designed Ankyrin Repeat Proteins: A New Approach to Mimic Complex Antigens for Diagnostic Purposes?

PubMed Central

Hausammann, Stefanie; Vogel, Monique; Kremer Hovinga, Johanna A.; Lacroix-Desmazes, Sebastien; Stadler, Beda M.; Horn, Michael P.

2013-01-01

Inhibitory antibodies directed against coagulation factor VIII (FVIII) can be found in patients with acquired and congenital hemophilia A. Such FVIII-inhibiting antibodies are routinely detected by the functional Bethesda Assay. However, this assay has a low sensitivity and shows a high inter-laboratory variability. Another method to detect antibodies recognizing FVIII is ELISA, but this test does not allow the distinction between inhibitory and non-inhibitory antibodies. Therefore, we aimed at replacing the intricate antigen FVIII by Designed Ankyrin Repeat Proteins (DARPins) mimicking the epitopes of FVIII inhibitors. As a model we used the well-described inhibitory human monoclonal anti-FVIII antibody, Bo2C11, for the selection on DARPin libraries. Two DARPins were selected binding to the antigen-binding site of Bo2C11, which mimic thus a functional epitope on FVIII. These DARPins inhibited the binding of the antibody to its antigen and restored FVIII activity as determined in the Bethesda assay. Furthermore, the specific DARPins were able to recognize the target antibody in human plasma and could therefore be used to test for the presence of Bo2C11-like antibodies in a large set of hemophilia A patients. These data suggest, that our approach might be used to isolate epitopes from different sets of anti-FVIII antibodies in order to develop an ELISA-based screening assay allowing the distinction of inhibitory and non-inhibitory anti-FVIII antibodies according to their antibody signatures. PMID:23626669

A Two-Component Assay for Hypoxia Incorporating Long-Term Nitroreduction and Short-Term DNA-Damage Allows Differentiation of the Three Hypoxia Sub-types.

PubMed

Koch, Cameron J

2018-05-10

Hypoxia in tumors has many well-characterized effects that are known to prevent optimal cancer treatment. Despite the existence of a large number of assays that have supported hypoxia as an important diagnostic, there is no routine clinical assay in use, and anti-hypoxia therapies have often not included parallel hypoxia measurements. Even with a functioning hypoxia assay, it is difficult to match the oxygen dependence of treatment resistance to that of the assay, and this mismatch can vary substantially from assay to assay and even from tumor to tumor [e.g., caused by endogenous variations in non-protein sulfhydryls (NPSH)]. An underlying concern is the current inability to measure the three types of hypoxia; in particular, cycling hypoxia can affect all aspects of detection and treatment strategy. Here we present data that help validate a new two-component hypoxia assay recently suggested by our laboratory. This assay incorporates the long-term bioreduction of the 2-nitroimidazole, EF5, and the short-term production of γ-H2AX (e.g., time of ionizing radiation exposure). The former can be calibrated to provide the average tissue pO 2 over the EF5 exposure time while the latter provides the combined sum of microenvironmental radiation response modifiers (e.g., oxygen and NPSH) at the time of irradiation. Importantly, formation of γ-H2AX is not dependent on blood flow, while EF5 binding is only minimally so, due to the rapid and extensive diffusion characteristics of lipophilic compounds. While both individual assays have their limitations, which are addressed in this article, their combination can dissect the type of hypoxia present. In particular, a mismatch between the two assays can directly detect cycling hypoxia in a therapeutically relevant manner. Preliminary use of this two-component assay in small PC3 tumors showed essentially no binding of EF5. Similarly, there were no tumor regions (for uniform irradiation with 12 Gy) with the low levels of γ-H2AX expected for a condition of cycling hypoxia. Thus, both assays were consistent with an essentially aerobic, radiation-responsive tumor. In a larger PC3 tumor, all regions of high EF5 binding had low levels of γ-H2AX.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Avoiding false positives and optimizing identification of true ...

EPA Pesticide Factsheets

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive

A novel BRET-based binding assay for interaction studies of relaxin family peptide receptor 3 with its ligands.

PubMed

Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun

2017-05-01

Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.

Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

PubMed

Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

2015-10-01

Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

Assessing cellular efficacy of bromodomain inhibitors using fluorescence recovery after photobleaching

PubMed Central

2014-01-01

Background Acetylation of lysine residues in histone tails plays an important role in the regulation of gene transcription. Bromdomains are the readers of acetylated histone marks, and, consequently, bromodomain-containing proteins have a variety of chromatin-related functions. Moreover, they are increasingly being recognised as important mediators of a wide range of diseases. The first potent and selective bromodomain inhibitors are beginning to be described, but the diverse or unknown functions of bromodomain-containing proteins present challenges to systematically demonstrating cellular efficacy and selectivity for these inhibitors. Here we assess the viability of fluorescence recovery after photobleaching (FRAP) assays as a target agnostic method for the direct visualisation of an on-target effect of bromodomain inhibitors in living cells. Results Mutation of a conserved asparagine crucial for binding to acetylated lysines in the bromodomains of BRD3, BRD4 and TRIM24 all resulted in reduction of FRAP recovery times, indicating loss of or significantly reduced binding to acetylated chromatin, as did the addition of known inhibitors. Significant differences between wild type and bromodomain mutants for ATAD2, BAZ2A, BRD1, BRD7, GCN5L2, SMARCA2 and ZMYND11 required the addition of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) to amplify the binding contribution of the bromodomain. Under these conditions, known inhibitors decreased FRAP recovery times back to mutant control levels. Mutation of the bromodomain did not alter FRAP recovery times for full-length CREBBP, even in the presence of SAHA, indicating that other domains are primarily responsible for anchoring CREBBP to chromatin. However, FRAP assays with multimerised CREBBP bromodomains resulted in a good assay to assess the efficacy of bromodomain inhibitors to this target. The bromodomain and extraterminal protein inhibitor PFI-1 was inactive against other bromodomain targets, demonstrating the specificity of the method. Conclusions Viable FRAP assays were established for 11 representative bromodomain-containing proteins that broadly cover the bromodomain phylogenetic tree. Addition of SAHA can overcome weak binding to chromatin, and the use of tandem bromodomain constructs can eliminate masking effects of other chromatin binding domains. Together, these results demonstrate that FRAP assays offer a potentially pan-bromodomain method for generating cell-based assays, allowing the testing of compounds with respect to cell permeability, on-target efficacy and selectivity. PMID:25097667

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

PubMed

Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

1999-01-01

Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities

PubMed Central

Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

2011-01-01

C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Lex trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Lex less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Lex at all. PMID:21112966

Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities.

PubMed

Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

2011-04-01

C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Le(x) trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Le(x) less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Le(x) at all.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

Monocyte-endothelial adhesion in chronic rheumatoid arthritis. In situ detection of selectin and integrin-dependent interactions.

PubMed Central

Grober, J S; Bowen, B L; Ebling, H; Athey, B; Thompson, C B; Fox, D A; Stoolman, L M

1993-01-01

Blood monocytes are the principal reservoir for tissue macrophages in rheumatoid synovitis. Receptor-mediated adhesive interactions between circulating cells and the synovial venules initiate recruitment. These interactions have been studied primarily in cultured endothelial cells. Thus the functional activities of specific adhesion receptors, such as the endothelial selectins and the leukocytic integrins, have not been evaluated directly in diseased tissues. We therefore examined monocyte-microvascular interactions in rheumatoid synovitis by modifying the Stamper-Woodruff frozen section binding assay initially developed to study lymphocyte homing. Specific binding of monocytes to venules lined by low or high endothelium occurred at concentrations as low as 5 x 10(5) cells/ml. mAbs specific for P-selectin (CD62, GMP-140/PADGEM) blocked adhesion by > 90% in all synovitis specimens examined. In contrast, P-selectin-mediated adhesion to the microvasculature was either lower or absent in frozen sections of normal foreskin and placenta. mAbs specific for E-selectin (ELAM-1) blocked 20-50% of monocyte attachment in several RA synovial specimens but had no effect in others. mAbs specific for LFA-1, Mo1/Mac 1, the integrin beta 2-chain, and L-selectin individually inhibited 30-40% of adhesion. An mAb specific for the integrin beta 1-chain inhibited the attachment of elutriated monocytes up to 20%. We conclude that P-selectin associated with the synovial microvasculature initiates shear-resistant adhesion of monocytes in the Stamper-Woodruff assay and stabilizes bonds formed by other selectins and the integrins. Thus the frozen section binding assay permits direct evaluation of leukocyte-microvascular adhesive interactions in inflamed tissues and suggests a prominent role for P-selectin in monocyte recruitment in vivo. Images PMID:7685772

The Biology of IgG Subclasses and Their Clinical Relevance to Transplantation.

PubMed

Valenzuela, Nicole M; Schaub, Stefan

2018-01-01

Immunoglobulin G (IgG) is the dominant immunoglobulin and can be divided into 4 distinct subclasses. The evolution of IgG subclass switches is regulated by interaction with T cells and follows a 1-way direction (IgG3 → IgG1 → IgG2 → IgG4). Based on their structure, the 4 IgG subclasses can initiate different effector function such as complement activation, recruitment of various cells by Fc receptors, and agonistic signaling. Using current assays for HLA antibody detection as a template and replacing the generic reporter antibody with IgG subclass-specific reporter antibodies, it is possible to investigate the IgG subclasses of HLA antibodies. There are 15 different IgG subclass compositions possible. Based on the capability to activate the complement system and the class switch direction, 3 arbitrary patterns can be defined (ie, only complement-binding subclasses [IgG3 and/or IgG1], expansion to noncomplement-binding subclasses [IgG3 and/or IgG1 plus IgG2 and/or IgG4], and switch to noncomplement-binding subclasses [IgG2 and/or IgG4]). The latter group accounts for less than 5%, whereas the former 2 groups have a similar prevalence close to 50%. In the past 5 years, several studies correlated the IgG subclass pattern with occurrence of antibody-mediated rejection and allograft outcomes. Because of differences of the used IgG subclass assay, the time point of analyses, and the definition of outcomes, a clear picture has not emerged yet. Future needs are standardization of the assay, a more detailed knowledge of the initiated effector functions, and more well-designed clinical studies also looking at changes of the IgG subclass pattern over time.

Arabidopsis F-box protein containing a Nictaba-related lectin domain interacts with N-acetyllactosamine structures.

PubMed

Stefanowicz, Karolina; Lannoo, Nausicaä; Proost, Paul; Van Damme, Els J M

2012-01-01

The Arabidopsis thaliana genome contains a small group of bipartite F-box proteins, consisting of an N-terminal F-box domain and a C-terminal domain sharing sequence similarity with Nictaba, the jasmonate-induced glycan-binding protein (lectin) from tobacco. Based on the high sequence similarity between the C-terminal domain of these proteins and Nictaba, the hypothesis was put forward that the so-called F-box-Nictaba proteins possess carbohydrate-binding activity and accordingly can be considered functional homologs of the mammalian sugar-binding F-box or Fbs proteins which are involved in proteasomal degradation of glycoproteins. To obtain experimental evidence for the carbohydrate-binding activity and specificity of the A. thaliana F-box-Nictaba proteins, both the complete F-box-Nictaba sequence of one selected Arabidopsis F-box protein (in casu At2g02360) as well as the Nictaba-like domain only were expressed in Pichia pastoris and analyzed by affinity chromatography, agglutination assays and glycan micro-array binding assays. These results demonstrated that the C-terminal Nictaba-like domain provides the F-box-protein with a carbohydrate-binding activity that is specifically directed against N- and O-glycans containing N-acetyllactosamine (Galβ1-3GlcNAc and Galβ1-4GlcNAc) and poly-N-acetyllactosamine ([Galβ1-4GlcNAc]n) as well as Lewis A (Galβ1-3(Fucα1-4)GlcNAc), Lewis X (Galβ1-4(Fucα1-3)GlcNAc, Lewis Y (Fucα1-2Galβ1-4(Fucα1-3)GlcNAc) and blood type B (Galα1-3(Fucα1-2)Galβ1-3GlcNAc) motifs. Based on these findings one can reasonably conclude that at least the A. thaliana F-box-Nictaba protein encoded by At2g02360 can act as a carbohydrate-binding protein. The results from the glycan array assays revealed differences in sugar-binding specificity between the F-box protein and Nictaba, indicating that the same carbohydrate-binding motif can accommodate unrelated oligosaccharides.

Cys Site-Directed Mutagenesis of the Human SLC1A5 (ASCT2) Transporter: Structure/Function Relationships and Crucial Role of Cys467 for Redox Sensing and Glutamine Transport

PubMed Central

Scalise, Mariafrancesca; Pochini, Lorena; Console, Lara; Pappacoda, Gilda; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

2018-01-01

The human plasma membrane transporter ASCT2 is responsible for mediating Na- dependent antiport of neutral amino acids. New insights into structure/function relationships were unveiled by a combined approach of recombinant over-expression, site-directed mutagenesis, transport assays in proteoliposomes and bioinformatics. WT and Cys mutants of hASCT2 were produced in P. pastoris and purified for functional assay. The reactivity towards SH reducing and oxidizing agents of WT protein was investigated and opposite effects were revealed; transport activity increased upon treatment with the Cys reducing agent DTE, i.e., when Cys residues were in thiol (reduced) state. Methyl-Hg, which binds to SH groups, was able to inhibit WT and seven out of eight Cys to Ala mutants. On the contrary, C467A loses the sensitivity to both DTE activation and Methyl-Hg inhibition. The C467A mutant showed a Km for Gln one order of magnitude higher than that of WT. Moreover, the C467 residue is localized in the substrate binding region of the protein, as suggested by bioinformatics on the basis of the EAAT1 structure comparison. Taken together, the experimental data allowed identifying C467 residue as crucial for substrate binding and for transport activity modulation of hASCT2. PMID:29495336

Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.

PubMed

Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J

2014-08-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.

Role of the Adenovirus DNA-Binding Protein in In Vitro Adeno-Associated Virus DNA Replication

PubMed Central

Ward, Peter; Dean, Frank B.; O’Donnell, Michael E.; Berns, Kenneth I.

1998-01-01

A basic question in adeno-associated virus (AAV) biology has been whether adenovirus (Ad) infection provided any function which directly promoted replication of AAV DNA. Previously in vitro assays for AAV DNA replication, using linear duplex AAV DNA as the template, uninfected or Ad-infected HeLa cell extracts, and exogenous AAV Rep protein, demonstrated that Ad infection provides a direct helper effect for AAV DNA replication. It was shown that the nature of this helper effect was to increase the processivity of AAV DNA replication. Left unanswered was the question of whether this effect was the result of cellular factors whose activity was enhanced by Ad infection or was the result of direct participation of Ad proteins in AAV DNA replication. In this report, we show that in the in vitro assay, enhancement of processivity occurs with the addition of either the Ad DNA-binding protein (Ad-DBP) or the human single-stranded DNA-binding protein (replication protein A [RPA]). Clearly Ad-DBP is present after Ad infection but not before, whereas the cellular level of RPA is not apparently affected by Ad infection. However, we have not measured possible modifications of RPA which might occur after Ad infection and affect AAV DNA replication. When the substrate for replication was an AAV genome inserted into a plasmid vector, RPA was not an effective substitute for Ad-DBP. Extracts supplemented with Ad-DBP preferentially replicated AAV sequences rather than adjacent vector sequences; in contrast, extracts supplemented with RPA preferentially replicated vector sequences. PMID:9420241

Multiple Length Peptide-Pheromone Variants Produced by Streptococcus pyogenes Directly Bind Rgg Proteins to Confer Transcriptional Regulation*

PubMed Central

Aggarwal, Chaitanya; Jimenez, Juan Cristobal; Nanavati, Dhaval; Federle, Michael J.

2014-01-01

Streptococcus pyogenes, a human-restricted pathogen, accounts for substantial mortality related to infections worldwide. Recent studies indicate that streptococci produce and respond to several secreted peptide signaling molecules (pheromones), including those known as short hydrophobic peptides (SHPs), to regulate gene expression by a quorum-sensing mechanism. Upon transport into the bacterial cell, pheromones bind to and modulate activity of receptor proteins belonging to the Rgg family of transcription factors. Previously, we reported biofilm regulation by the Rgg2/3 quorum-sensing circuit in S. pyogenes. The aim of this study was to identify the composition of mature pheromones from cell-free culture supernatants that facilitate biofilm formation. Bioluminescent reporters were employed to detect active pheromones in culture supernatants fractionated by reverse-phase chromatography, and mass spectrometry was used to characterize their properties. Surprisingly, multiple SHPs that varied by length were detected. Synthetic peptides of each variant were tested individually using bioluminescence reporters and biofilm growth assays, and although activities differed widely among the group, peptides comprising the C-terminal eight amino acids of the full-length native peptide were most active. Direct Rgg/SHP interactions were determined using a fluorescence polarization assay that utilized FITC-labeled peptide ligands. Peptide receptor affinities were seen to be as low as 500 nm and their binding affinities directly correlated with observed bioactivity. Revelation of naturally produced pheromones along with determination of their affinity for cognate receptors are important steps forward in designing compounds whose purpose is positioned for future therapeutics aimed at treating infections through the interference of bacterial communication. PMID:24958729

Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

PubMed Central

Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

1989-01-01

Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

Absolute quantitation of NAPQI-modified rat serum albumin by LC-MS/MS: monitoring acetaminophen covalent binding in vivo.

PubMed

LeBlanc, André; Shiao, Tze Chieh; Roy, René; Sleno, Lekha

2014-09-15

Acetaminophen is known to cause hepatoxicity via the formation of a reactive metabolite, N-acetyl p-benzoquinone imine (NAPQI), as a result of covalent binding to liver proteins. Serum albumin (SA) is known to be covalently modified by NAPQI and is present at high concentrations in the bloodstream and is therefore a potential biomarker to assess the levels of protein modification by NAPQI. A newly developed method for the absolute quantitation of serum albumin containing NAPQI covalently bound to its active site cysteine (Cys34) is described. This optimized assay represents the first absolute quantitation of a modified protein, with very low stoichiometric abundance, using a protein-level standard combined with isotope dilution. The LC-MS/MS assay is based on a protein standard modified with a custom-designed reagent, yielding a surrogate peptide (following digestion) that is a positional isomer to the target peptide modified by NAPQI. To illustrate the potential of this approach, the method was applied to quantify NAPQI-modified SA in plasma from rats dosed with acetaminophen. The resulting method is highly sensitive (capable of quantifying down to 0.0006% of total RSA in its NAPQI-modified form) and yields excellent precision and accuracy statistics. A time-course pharmacokinetic study was performed to test the usefulness of this method for following acetaminophen-induced covalent binding at four dosing levels (75-600 mg/kg IP), showing the viability of this approach to directly monitor in vivo samples. This approach can reliably quantify NAPQI-modified albumin, allowing direct monitoring of acetaminophen-related covalent binding.

A Novel Cytosolic Isoform of Mitochondrial Trans-2-Enoyl-CoA Reductase Enhances Peroxisome Proliferator-Activated Receptor α Activity.

PubMed

Kim, Dong-Gyu; Yoo, Jae Cheal; Kim, Eunju; Lee, Young-Sun; Yarishkin, Oleg V; Lee, Da Yong; Lee, Kun Ho; Hong, Seong-Geun; Hwang, Eun Mi; Park, Jae-Yong

2014-06-01

Mitochondrial trans-2-enoyl-CoA reductase (MECR) is involved in mitochondrial synthesis of fatty acids and is highly expressed in mitochondria. MECR is also known as nuclear receptor binding factor-1, which was originally reported with yeast two-hybrid screening as a binding protein of the nuclear hormone receptor peroxisome proliferator-activated receptor α (PPARα). However, MECR and PPARα are localized at different compartment, mitochondria, and the nucleus, respectively. Therefore, the presence of a cytosolic or nuclear isoform of MECR is necessary for functional interaction between MECR and PPARα. To identify the expression pattern of MECR and the cytosolic form of MECR (cMECR), we performed reverse transcription polymerase chain reaction (RT-PCR) with various tissue samples from Sprague-Dawley rats. To confirm the interaction between cMECR and PPARα, we performed several binding assays such as yeast two-hybrid, coimmunoprecipitation, and bimolecular fluorescence complementation. To observe subcellular localization of these proteins, immunocytochemistry was performed. A luciferase assay was used to measure PPARα activity. We provide evidence of an alternatively spliced variant of the rat MECR gene that yields cMECR. The cMECR lacks the N-terminal 76 amino acids of MECR and shows uniform distribution in the cytoplasm and nucleus of HeLa cells. cMECR directly bound PPARα in the nucleus and increased PPARα-dependent luciferase activity in HeLa cells. We found the cytosolic form of MECR (cMECR) was expressed in the cytosolic and/or nuclear region, directly binds with PPARα, and enhances PPARα activity.

An SPR based sensor for allergens detection.

PubMed

Ashley, J; Piekarska, M; Segers, C; Trinh, L; Rodgers, T; Willey, R; Tothill, I E

2017-02-15

A simple, sensitive and label-free optical sensor method was developed for allergens analysis using α-casein as the biomarker for cow's milk detection, to be used directly in final rinse samples of cleaning in place systems (CIP) of food manufacturers. A Surface Plasmon Resonance (SPR) sensor chip consisting of four sensing arrays enabling the measurement of samples and control binding events simultaneously on the sensor surface was employed in this work. SPR offers several advantages in terms of label free detection, real time measurements and superior sensitivity when compared to ELISA based techniques. The gold sensor chip was used to immobilise α-casein-polyclonal antibody using EDC/NHS coupling procedure. The performance of the assay and the sensor was first optimised and characterised in pure buffer conditions giving a detection limit of 58ngmL -1 as a direct binding assay. The assay sensitivity can be further improved by using sandwich assay format and amplified with nanoparticles. However, at this stage this is not required as the detection limit achieved exceeded the required allergens detection levels of 2µgmL -1 for α-S1-casein. The sensor demonstrated good selectivity towards the α-casein as the target analyte and adequate recoveries from CIP final rinse wash samples. The sensor would be useful tool for monitoring allergen levels after cleaning procedures, providing additional data that may better inform upon wider food allergen risk management decision(s) that are made by food manufacturer. In particular, this sensor could potentially help validate or optimise cleaning practices for a given food manufacturing process. Copyright © 2016 Elsevier B.V. All rights reserved.

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Recombinant human antibody fragment against tetanus toxoid produced by phage display.

PubMed

Neelakantam, B; Sridevi, N V; Shukra, A M; Sugumar, P; Samuel, S; Rajendra, L

2014-03-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen.

Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

PubMed

Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

2010-01-01

The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

Application of the novel bioluminescent ligand-receptor binding assay to relaxin-RXFP1 system for interaction studies.

PubMed

Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

2016-04-01

Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.

Molecular Control of Polyene Macrolide Biosynthesis

PubMed Central

Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

2011-01-01

Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

USGS Publications Warehouse

Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

1997-01-01

The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

Analyte detection using an active assay

DOEpatents

Morozov, Victor; Bailey, Charles L.; Evanskey, Melissa R.

2010-11-02

Analytes using an active assay may be detected by introducing an analyte solution containing a plurality of analytes to a lacquered membrane. The lacquered membrane may be a membrane having at least one surface treated with a layer of polymers. The lacquered membrane may be semi-permeable to nonanalytes. The layer of polymers may include cross-linked polymers. A plurality of probe molecules may be arrayed and immobilized on the lacquered membrane. An external force may be applied to the analyte solution to move the analytes towards the lacquered membrane. Movement may cause some or all of the analytes to bind to the lacquered membrane. In cases where probe molecules are presented, some or all of the analytes may bind to probe molecules. The direction of the external force may be reversed to remove unbound or weakly bound analytes. Bound analytes may be detected using known detection types.

Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.

PubMed

Hu, Xiaotang; Li, Hongbin

2014-10-01

Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Triiodothyronine enhances accumulation of intracellular lipids in adipocytes through thyroid hormone receptor α via direct and indirect mechanisms.

PubMed

Gambo, Yurina; Matsumura, Miki; Fujimori, Ko

2016-08-15

Triiodothyronine (T3) enhanced the expression of adipogenic and lipogenic genes with elevation of the intracellular lipids through thyroid hormone receptor (TR) α in mouse 3T3-L1 cells. However, the transcription of the SREBP-1c and HSL genes was decreased by T3. Such T3-mediated alterations were negated by TRα siRNA. Chromatin immunoprecipitation assay showed that the binding of TRα to the TR-responsive element (TRE) of the FAS promoter was elevated by T3. In contrast, the ability of TRα to bind to the TRE of the SREBP-1c promoter was decreased by T3. In addition, the binding of SREBP-1c to the SRE of the HSL promoter was lowered by T3. These results indicate that T3 increased the accumulation of intracellular lipids by enhancing the expression of the FAS gene through direct binding of TRα to the FAS promoter and simultaneously lowered the amount of lipolysis via reduced binding of T3-decreased SREBP-1c to the HSL promoter. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Modeling the Interaction between Quinolinate and the Receptor for Advanced Glycation End Products (RAGE): Relevance for Early Neuropathological Processes

PubMed Central

Serratos, Iris N.; Castellanos, Pilar; Pastor, Nina; Millán-Pacheco, César; Rembao, Daniel; Pérez-Montfort, Ruy; Cabrera, Nallely; Reyes-Espinosa, Francisco; Díaz-Garrido, Paulina; López-Macay, Ambar; Martínez-Flores, Karina; López-Reyes, Alberto; Sánchez-García, Aurora; Cuevas, Elvis; Santamaria, Abel

2015-01-01

The receptor for advanced glycation end products (RAGE) is a pattern-recognition receptor involved in neurodegenerative and inflammatory disorders. RAGE induces cellular signaling upon binding to a variety of ligands. Evidence suggests that RAGE up-regulation is involved in quinolinate (QUIN)-induced toxicity. We investigated the QUIN-induced toxic events associated with early noxious responses, which might be linked to signaling cascades leading to cell death. The extent of early cellular damage caused by this receptor in the rat striatum was characterized by image processing methods. To document the direct interaction between QUIN and RAGE, we determined the binding constant (Kb) of RAGE (VC1 domain) with QUIN through a fluorescence assay. We modeled possible binding sites of QUIN to the VC1 domain for both rat and human RAGE. QUIN was found to bind at multiple sites to the VC1 dimer, each leading to particular mechanistic scenarios for the signaling evoked by QUIN binding, some of which directly alter RAGE oligomerization. This work contributes to the understanding of the phenomenon of RAGE-QUIN recognition, leading to the modulation of RAGE function. PMID:25757085

Structure of the transcriptional regulator LmrR and its mechanism of multidrug recognition.

PubMed

Madoori, Pramod Kumar; Agustiandari, Herfita; Driessen, Arnold J M; Thunnissen, Andy-Mark W H

2009-01-21

LmrR is a PadR-related transcriptional repressor that regulates the production of LmrCD, a major multidrug ABC transporter in Lactococcus lactis. Transcriptional regulation is presumed to follow a drug-sensitive induction mechanism involving the direct binding of transporter ligands to LmrR. Here, we present crystal structures of LmrR in an apo state and in two drug-bound states complexed with Hoechst 33342 and daunomycin. LmrR shows a common topology containing a typical beta-winged helix-turn-helix domain with an additional C-terminal helix involved in dimerization. Its dimeric organization is highly unusual with a flat-shaped hydrophobic pore at the dimer centre serving as a multidrug-binding site. The drugs bind in a similar manner with their aromatic rings sandwiched in between the indole groups of two dimer-related tryptophan residues. Multidrug recognition is facilitated by conformational plasticity and the absence of drug-specific hydrogen bonds. Combined analyses using site-directed mutagenesis, fluorescence-based drug binding and protein-DNA gel shift assays reveal an allosteric coupling between the multidrug- and DNA-binding sites of LmrR that most likely has a function in the induction mechanism.

HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

PubMed

Brendle, Sarah A; Christensen, Neil D

2015-01-01

Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

A novel assay to identify the trafficking proteins that bind to specific vesicle populations

PubMed Central

Bentley, Marvin; Banker, Gary

2016-01-01

Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371

A cytoplasmic long noncoding RNA LINC00470 as a new AKT activator to mediate glioblastoma cell autophagy.

PubMed

Liu, Changhong; Zhang, Yan; She, Xiaoling; Fan, Li; Li, Peiyao; Feng, Jianbo; Fu, Haijuan; Liu, Qing; Liu, Qiang; Zhao, Chunhua; Sun, Yingnan; Wu, Minghua

2018-06-04

Despite the overwhelming number of investigations on AKT, little is known about lncRNA on AKT regulation, especially in GBM cells. RNA-binding protein immunoprecipitation assay (RIP) and RNA pulldown were used to confirm the binding of LINC00470 and fused in sarcoma (FUS). Confocal imaging, co-immunoprecipitation (Co-IP) and GST pulldown assays were used to detect the interaction between FUS and AKT. EdU assay, CCK-8 assay, and intracranial xenograft assays were performed to demonstrate the effect of LINC00470 on the malignant phenotype of GBM cells. RT-qPCR and Western blotting were performed to test the effect of LINC00470 on AKT and pAKT. In this study, we demonstrated that LINC00470 was a positive regulator for AKT activation in GBM. LINC00470 bound to FUS and AKT to form a ternary complex, anchoring FUS in the cytoplasm to increase AKT activity. Higher pAKT activated by LINC00470 inhibited ubiquitination of HK1, which affected glycolysis, and inhibited cell autophagy. Furthermore, higher LINC00470 expression was associated with GBM tumorigenesis and poor patient prognosis. Our findings revealed a noncanonical AKT activation signaling pathway, i.e., LINC00470 directly interacts with FUS, serving as an AKT activator to promote GBM progression. LINC00470 has an important referential significance to evaluate the prognosis of patients.

A Novel Atypical PKC-Iota Inhibitor, Echinochrome A, Enhances Cardiomyocyte Differentiation from Mouse Embryonic Stem Cells.

PubMed

Kim, Hyoung Kyu; Cho, Sung Woo; Heo, Hye Jin; Jeong, Seung Hun; Kim, Min; Ko, Kyung Soo; Rhee, Byoung Doo; Mishchenko, Natalia P; Vasileva, Elena A; Fedoreyev, Sergey A; Stonik, Valentin A; Han, Jin

2018-06-02

Echinochrome A (EchA) is a marine bioproduct extracted from sea urchins having antioxidant, antimicrobial, anti-inflammatory, and chelating effects, and is the active component of the clinical drug histochrome. We investigated the potential use of Ech A for inducing cardiomyocyte differentiation from mouse embryonic stem cells (mESCs). We also assessed the effects of Ech A on mitochondrial mass, inner membrane potential (Δψm), reactive oxygen species generation, and levels of Ca 2+ . To identify the direct target of Ech A, we performed in vitro kinase activity and surface plasmon resonance binding assays. Ech A dose-dependently enhanced cardiomyocyte differentiation with higher beating rates. Ech A (50 μM) increased the mitochondrial mass and membrane potential but did not alter the mitochondrial superoxide and Ca 2+ levels. The in vitro kinase activity of the atypical protein kinase C-iota (PKCι) was significantly decreased by 50 μM of Ech A with an IC 50 for PKCι activity of 107 μM. Computational protein-ligand docking simulation results suggested the direct binding of Ech A to PKCι, and surface plasmon resonance confirmed the direct binding with a low K D of 6.3 nM. Therefore, Ech A is a potential drug for enhancing cardiomyocyte differentiation from mESCs through direct binding to PKCι and inhibition of its activity.

Cholera toxin binding affinity and specificity for gangliosides determined by surface plasmon resonance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuziemko, G.M.; Stroh, M.; Stevens, R.C.

1996-05-21

The present study determines the affinity of cholera toxin for the ganglioside series GM1, GM2, GM3, GD1A, GD1B, GT1B, asialo GM1, globotriosyl ceramide, and lactosyl ceramide using real time biospecific interaction analysis (surface plasmon resonance, SPR). SPR shows that cholera toxin preferably binds to gangliosides in the following sequence: GM1 > GM2 > GD1A > GM3 > GT1B > GD1B > asialo-GM1. The measured binding affinity of cholera toxin for the ganglioside sequence ranges from 4.61 {times} 10{sup {minus}12} M for GM1 to 1.88 {times} 10{sup {minus}10} M for asialo GM1. The picomolar values obtained by surface plasmon resonance aremore » similar to K{sub d} values determined with whole-cell binding assays. Both whole-cell assays ans SPR measurements on synthetic membranes are higher than free solution measurements by several orders of magnitude. This difference may be caused by the effects of avidity and charged lipid head-groups, which may play a major role in the binding between cholera toxin, the receptor, and the membrane surface. The primary difference between free solution binding studies and surface plasmon resonance studies is that the latter technique is performed on surfaces resembling the cell membrane. Surface plasmon resonance has the further advantage of measuring apparent kinetic association and dissociation rates in real time, providing direct information about binding events at the membrane surface. 34 refs., 8 figs., 2 tabs.« less

Two antibacterial C-type lectins from crustacean, Eriocheir sinensis, stimulated cellular encapsulation in vitro.

PubMed

Jin, Xing-Kun; Li, Shuang; Guo, Xiao-Nv; Cheng, Lin; Wu, Min-Hao; Tan, Shang-Jian; Zhu, You-Ting; Yu, Ai-Qing; Li, Wei-Wei; Wang, Qun

2013-12-01

The first step of host fighting against pathogens is that pattern recognition receptors recognized pathogen-associated molecular patterns. However, the specificity of recognition within the innate immune molecular of invertebrates remains largely unknown. In the present study, we investigated how invertebrate pattern recognition receptor (PRR) C-type lectins might be involved in the antimicrobial response in crustacean. Based on our previously obtained completed coding regions of EsLecA and EsLecG in Eriocheir sinensis, the recombinant EsLectin proteins were produced via prokaryotic expression system and affinity chromatography. Subsequently, both rEsLecA and rEsLecG were discovered to have wide spectrum binding activities towards microorganisms, and their microbial-binding was calcium-independent. Moreover, the binding activities of both rEsLecA and rEsLecG induced the aggregation against microbial pathogens. Both microorganism growth inhibitory activities assays and antibacterial activities assays revealed their capabilities of suppressing microorganisms growth and directly killing microorganisms respectively. Furthermore, the encapsulation assays signified that both rEsLecA and rEsLecG could stimulate the cellular encapsulation in vitro. Collectively, data presented here demonstrated the successful expression and purification of two C-type lectins proteins in the Chinese mitten crab, and their critical role in the innate immune system of an invertebrate. Copyright © 2013 Elsevier Ltd. All rights reserved.

The ligand-binding profile of HARE: hyaluronan and chondroitin sulfates A, C, and D bind to overlapping sites distinct from the sites for heparin, acetylated low-density lipoprotein, dermatan sulfate, and CS-E.

PubMed

Harris, Edward N; Weigel, Paul H

2008-08-01

The hyaluronic acid receptor for endocytosis (HARE)/ Stabilin-2 is the primary systemic scavenger receptor for hyaluronan (HA), the chondroitin sulfates (CS), dermatan sulfate (DS), and nonglycosaminoglycan (GAG) ligands such as acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides, and advanced glycation end products. We recently discovered that HARE is also a systemic scavenger receptor for heparin (Hep) (Harris EN, Weigel JA, Weigel PH. 2008. The human hyaluronan receptor for endocytosis [HARE/Stabilin-2] is a systemic clearance receptor for heparin. J Biol Chem. 283:17341-17350). Our goal was to map the binding sites of eight different ligands within HARE. We used biotinylated GAGs and radio-iodinated streptavidin or AcLDL to assess the binding activities of ligands directly or indirectly (by competition with unlabeled ligands) in endocytosis assays using stable cell lines expressing the 315 or 190 kDa HA receptor for endocytosis (315- or 190-HARE) isoforms, and ELISA-like assays, with purified recombinant soluble 190-HARE ecto-domain. For example, Hep binding to HARE was competed by DS, CS-E, AcLDL, and dextran sulfate, but not by other CS types, HA, dextran, or heparosan. (125)I-AcLDL binding to HARE was partially competed by Hep and dextran sulfate, but not competed by HA. Two ligands, DS and CS-E, competed with both Hep and HA to some degree. Hep and HA binding or endocytosis is mutually inclusive; binding of these two GAGs occurs with functionally separate, noncompetitive, and apparently noninteracting domains. Thus, HARE binds to HA and Hep simultaneously. Although the domain(s) responsible for Hep binding remains unknown, the Link domain was required for HARE binding to HA, CS-A, CS-C, and CS-D. These results enable us to outline, for the first time, a binding activity map for multiple ligands of HARE.

The ligand-binding profile of HARE: hyaluronan and chondroitin sulfates A, C, and D bind to overlapping sites distinct from the sites for heparin, acetylated low-density lipoprotein, dermatan sulfate, and CS-E

PubMed Central

Harris, Edward N.; Weigel, Paul H.

2008-01-01

The hyaluronic acid receptor for endocytosis (HARE)/ Stabilin-2 is the primary systemic scavenger receptor for hyaluronan (HA), the chondroitin sulfates (CS), dermatan sulfate (DS), and nonglycosaminoglycan (GAG) ligands such as acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides, and advanced glycation end products. We recently discovered that HARE is also a systemic scavenger receptor for heparin (Hep) (Harris EN, Weigel JA, Weigel PH. 2008. The human hyaluronan receptor for endocytosis [HARE/Stabilin-2] is a systemic clearance receptor for heparin. J Biol Chem. 283:17341–17350). Our goal was to map the binding sites of eight different ligands within HARE. We used biotinylated GAGs and radio-iodinated streptavidin or AcLDL to assess the binding activities of ligands directly or indirectly (by competition with unlabeled ligands) in endocytosis assays using stable cell lines expressing the 315 or 190 kDa HA receptor for endocytosis (315- or 190-HARE) isoforms, and ELISA-like assays, with purified recombinant soluble 190-HARE ecto-domain. For example, Hep binding to HARE was competed by DS, CS-E, AcLDL, and dextran sulfate, but not by other CS types, HA, dextran, or heparosan. 125I-AcLDL binding to HARE was partially competed by Hep and dextran sulfate, but not competed by HA. Two ligands, DS and CS-E, competed with both Hep and HA to some degree. Hep and HA binding or endocytosis is mutually inclusive; binding of these two GAGs occurs with functionally separate, noncompetitive, and apparently noninteracting domains. Thus, HARE binds to HA and Hep simultaneously. Although the domain(s) responsible for Hep binding remains unknown, the Link domain was required for HARE binding to HA, CS-A, CS-C, and CS-D. These results enable us to outline, for the first time, a binding activity map for multiple ligands of HARE. PMID:18499864

Investigation of molecular mechanism of recognition between citral and MARK4: A newer therapeutic approach to attenuate cancer cell progression.

PubMed

Naz, Farha; Khan, Faez Iqbal; Mohammad, Taj; Khan, Parvez; Manzoor, Saaliqa; Hasan, Gulam Mustafa; Lobb, Kevin A; Luqman, Suaib; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz

2018-02-01

Microtubule affinity regulating kinase 4 (MARK4) is a member of AMP-activated protein kinase, found to be involved in apoptosis, inflammation and many other regulatory pathways. Since, its aberrant expression is directly associated with the cell cycle and thus cancer. Therefore, MARK4 is being considered as a potential drug target for cancer therapy. Here, we investigated the mechanism of inhibition of MARK4 activity by citral. Docking studies suggested that citral effectively binds to the active site cavity, and complex is stabilized by several interactions. We further performed molecular dynamics simulation of MARK4-citral complex under explicit water condition for 100ns and observed that binding of citral to MARK4 was quite stable. Fluorescence binding studies suggested that citral strongly binds to MARK4 and thereby inhibits its enzyme activity which was measured by the kinase inhibition assay. We further performed MTT assay and observed that citral inhibits proliferation of breast cancer cell line MCF-7. This work provides a newer insight into the use of citral as novel cancer therapeutics through the MARK4 inhibition. Results may be employed to design novel therapeutic molecule using citral as a scaffold for MARK4 inhibition to fight related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Lectin binding assays for in-process monitoring of sialylation in protein production.

PubMed

Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

2010-07-01

Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

Porcine aminopeptidase N binds to F4+ enterotoxigenic Escherichia coli fimbriae.

PubMed

Xia, Pengpeng; Wang, Yiting; Zhu, Congrui; Zou, Yajie; Yang, Ying; Liu, Wei; Hardwidge, Philip R; Zhu, Guoqiang

2016-02-09

F4(+) enterotoxigenic Escherichia coli (ETEC) strains cause diarrheal disease in neonatal and post-weaned piglets. Several different host receptors for F4 fimbriae have been described, with porcine aminopeptidase N (APN) reported most recently. The FaeG subunit is essential for the binding of the three F4 variants to host cells. Here we show in both yeast two-hybrid and pulldown assays that APN binds directly to FaeG, the major subunit of F4 fimbriae, from three serotypes of F4(+) ETEC. Modulating APN gene expression in IPEC-J2 cells affected ETEC adherence. Antibodies raised against APN or F4 fimbriae both reduced ETEC adherence. Thus, APN mediates the attachment of F4(+) E. coli to intestinal epithelial cells.

Bidirectional motility of the fission yeast kinesin-5, Cut7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Edamatsu, Masaki, E-mail: cedam@mail.ecc.u-tokyo.ac.jp

Highlights: • Motile properties of Cut7 (fission yeast kinesin-5) were studied for the first time. • Half-length Cut7 moved toward plus-end direction of microtubule. • Full-length Cut7 moved toward minus-end direction of microtubule. • N- and C-terminal microtubule binding sites did not switch the motile direction. - Abstract: Kinesin-5 is a homotetrameric motor with its motor domain at the N-terminus. Kinesin-5 crosslinks microtubules and functions in separating spindle poles during mitosis. In this study, the motile properties of Cut7, fission yeast kinesin-5, were examined for the first time. In in vitro motility assays, full-length Cut7 moved toward minus-end of microtubules,more » but the N-terminal half of Cut7 moved toward the opposite direction. Furthermore, additional truncated constructs lacking the N-terminal or C-terminal regions, but still contained the motor domain, did not switch the motile direction. These indicated that Cut7 was a bidirectional motor, and microtubule binding regions at the N-terminus and C-terminus were not involved in its directionality.« less

Discovery of potent and selective cytotoxic activity of new quinazoline-ureas against TMZ-resistant glioblastoma multiforme (GBM).

PubMed

Elkamhawy, Ahmed; Viswanath, Ambily Nath Indu; Pae, Ae Nim; Kim, Hyeon Young; Heo, Jin-Chul; Park, Woo-Kyu; Lee, Chong-Ock; Yang, Heekyoung; Kim, Kang Ho; Nam, Do-Hyun; Seol, Ho Jun; Cho, Heeyeong; Roh, Eun Joo

2015-10-20

Herein, we report new quinazoline-urea based compounds with potent cytotoxic activities against TMZ-resistant glioblastoma multiforme (GBM) cells. Low micromolar IC₅₀ values were exhibited over a panel of three primary GBM patient-derived cell cultures belonging to proneural (GBM-1), mesenchymal (GBM-2), and classical (GBM-3) subtypes. Eight compounds showed excellent selectivity indices for GBM cells comparing to a normal astrocyte cell line. In JC-1 assay, analogues 11, 12, 20, 22, and 24 exerted promising rates of mPTP opening induction towards proneural GBM subtype. Compounds 11, 20, and 24 bound to the translocator protein 18 kDa (TSPO) in submicromolar range using [(3)H] PK-11195 binding affinity assay. A homology model was built and docked models of 11, 12, 20, 22 and 24 were generated for describing their plausible binding modes in TSPO. In 3D clonogenic assay, compound 20 manifested potent tumoricidal effects on TMZ-resistant GBM cells even at submicromolar concentrations. In addition, CYP450 and hERG assays presented a safe toxicity profile of 20. Taken as a whole, this report presents compound 20 as a potent, selective and safe GBM cytotoxic agent which constitutes a promising direction against TMZ-resistant GBM. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

The juxtamembrane domain of the E-cadherin cytoplasmic tail contributes to its interaction with Myosin VI

PubMed Central

Mangold, Sabine; Norwood, Suzanne J.; Yap, Alpha S.; Collins, Brett M.

2012-01-01

We recently identified the atypical myosin, Myosin VI, as a component of epithelial cell-cell junctions that interacts with E-cadherin. Recombinant proteins bearing the cargo-binding domain of Myosin VI (Myo VI-CBD) or the cytoplasmic tail of E-cadherin can interact directly with one another. In this report we further investigate the molecular requirements of the interaction between Myo VI-CBD and E-cadherin combining truncation mutation analysis with in vitro binding assays. We report that a short (28 amino acid) juxtamembrane region of the cadherin cytoplasmic tail is sufficient to bind Myo VI-CBD. However, central regions of the cadherin tail adjacent to the juxtamembrane sequence also display binding activity for Myo VI-CBD. It is therefore possible that the cadherin tail bears two binding sites for Myosin VI, or an extended binding site that includes the juxtamembrane region. Nevertheless, our biochemical data highlight the capacity for the juxtamembrane region to interact with functionally-significant cytoplasmic proteins. PMID:23007415

Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

PubMed Central

Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

1994-01-01

To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

Immobilizing affinity proteins to nitrocellulose: a toolbox for paper-based assay developers.

PubMed

Holstein, Carly A; Chevalier, Aaron; Bennett, Steven; Anderson, Caitlin E; Keniston, Karen; Olsen, Cathryn; Li, Bing; Bales, Brian; Moore, David R; Fu, Elain; Baker, David; Yager, Paul

2016-02-01

To enable enhanced paper-based diagnostics with improved detection capabilities, new methods are needed to immobilize affinity reagents to porous substrates, especially for capture molecules other than IgG. To this end, we have developed and characterized three novel methods for immobilizing protein-based affinity reagents to nitrocellulose membranes. We have demonstrated these methods using recombinant affinity proteins for the influenza surface protein hemagglutinin, leveraging the customizability of these recombinant "flu binders" for the design of features for immobilization. The three approaches shown are: (1) covalent attachment of thiolated affinity protein to an epoxide-functionalized nitrocellulose membrane, (2) attachment of biotinylated affinity protein through a nitrocellulose-binding streptavidin anchor protein, and (3) fusion of affinity protein to a novel nitrocellulose-binding anchor protein for direct coupling and immobilization. We also characterized the use of direct adsorption for the flu binders, as a point of comparison and motivation for these novel methods. Finally, we demonstrated that these novel methods can provide improved performance to an influenza hemagglutinin assay, compared to a traditional antibody-based capture system. Taken together, this work advances the toolkit available for the development of next-generation paper-based diagnostics.

Minoxidil may suppress androgen receptor-related functions.

PubMed

Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

2014-04-30

Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a K(d) value of 2.6 µM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases.

Minoxidil may suppress androgen receptor-related functions

PubMed Central

Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

2014-01-01

Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a Kd value of 2.6 μM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases. PMID:24742982

Transactivation Assays that Identify Indirect and Direct Activators of Human Pregnane X Receptor (PXR, NR1I2) and Constitutive Androstane Receptor (CAR, NR1I3).

PubMed

Pinne, Marija; Ponce, Elsa; Raucy, Judy L

2017-01-01

Nuclear Receptors (NRs), including PXR and CAR, are presumed to be ligand-dependent transcription factors, but ligand binding is not an absolute requirement for activation. Indeed, many compounds activate PXR and CAR by indirect mechanisms. Detecting these indirect activators of specific nuclear receptors in vitro has been difficult. As NR activation of either or both PXR and CAR can lead to drug-drug interactions and adverse drug effects, false negatives obtained with screening tools incapable of detecting indirect activators could present liabilities. The aim of this study was to establish assays that identify indirect activators of human PXR and CAR. Commercially available human PXR and CAR transactivation assays were used for analyses. We show that transactivation assays containing full-length nuclear receptors with native promoters can identify indirect activators of human CAR and PXRwhen compared to those of commercially available assays containing only the LBD of PXR and CAR. Of these two assay systems, only human PXR and CAR1 assays with full-length receptors and native promoters are capable of detecting indirect and ligand activators. With this capability, several kinase inhibitors were identified that activate PXR and CAR by indirect mechanisms. Furthermore by using both the LBD and full-length receptors, phenobarbital and midostaurin were found to be direct and indirect activators of PXR while human CAR activation by phenobarbital occurs by indirect mechanisms only. Cell based transactivation assays employing the full-length receptors and native promoters identify both direct and indirect activators of either or both human PXR and CAR. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The binding sites for benztropines and dopamine in the dopamine transporter overlap

PubMed Central

Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

2013-01-01

Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

PubMed

Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

2012-11-21

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

PubMed Central

2012-01-01

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

Flow cytometer measurement of binding assays

DOEpatents

Saunders, George C.

1987-01-01

A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

A new kind of highly sensitive competitive lateral flow immunoassay displaying direct analyte-signal dependence. Application to the determination of the mycotoxin deoxynivalenol.

PubMed

Urusov, Alexandr E; Gubaidullina, Miliausha K; Petrakova, Alina V; Zherdev, Anatoly V; Dzantiev, Boris B

2017-12-06

A new kind of competitive immunochromatographic assay is presented. It is based on the use of a test strip loaded with (a) labeled specific antibodies, (b) a hapten-protein conjugate at the control zone, and (c) antibodies interacting with the specific antibodies in the analytical zone. In the case where a sample does not contain the target antigen (hapten), all labeled antibodies remain in the control zone because of the selected ratio of reactants. The analytical zone remains colorless because the labeled antibodies do not reach it. If an antigen is present in the sample, it interferes with the binding of the specific antibodies in the control zone and knocks them out. Some of these antibodies pass the control zone to form a colored line in the analytical zone. The intensity of the color is directly proportional to the amount of the target antigen in the sample. The assay has an attractive feature in that an appearance in coloration is more easily detected visually than a decoloration. Moreover, the onset of coloration is detectable at a lower concentration than a decoloration. The new detection scheme was applied to the determination of the mycotoxin deoxynivalenol. The visual limit of detection is 2 ng·mL -1 in corn extracts (35 ng per gram of sample). With the same reagents, this is lower by a factor of 60 than the established test strip. The assay takes only 15 min. This new kind of assay has wide potential applications for numerous low molecular weight analytes. Graphical abstract Competitive immunochromatography with direct analyte-signal dependence is proposed. It provides a 60-fold decrease of the detection limit for mycotoxin deoxynivalenol. The analyte-antibody-label complexes move along the immobilized antigen (control zone) and bind with anti-species antibodies (test zone).

A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

PubMed Central

Guarnieri, Michael T.; Blagg, Brian S. J.

2011-01-01

Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069

Concerted application of LC-MS and ligand binding assays to better understand exposure of a large molecule drug.

PubMed

Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C

2018-06-20

A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.

Dopamine D1A directly interacts with otoferlin synaptic pathway proteins: Ca2+ and phosphorylation underlie an NSF-to-AP2mu1 molecular switch.

PubMed

Selvakumar, Dakshnamurthy; Drescher, Marian J; Deckard, Nathan A; Ramakrishnan, Neeliyath A; Morley, Barbara J; Drescher, Dennis G

2017-01-01

Dopamine receptors regulate exocytosis via protein-protein interactions (PPIs) as well as via adenylyl cyclase transduction pathways. Evidence has been obtained for PPIs in inner ear hair cells coupling D1A to soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein receptor (SNARE)-related proteins snapin, otoferlin, N-ethylmaleimide-sensitive factor (NSF), and adaptor-related protein complex 2, mu 1 (AP2mu1), dependent on [Ca 2+ ] and phosphorylation. Specifically, the carboxy terminus of dopamine D1A was found to directly bind t-SNARE-associated protein snapin in teleost and mammalian hair cell models by yeast two-hybrid (Y2H) and pull-down assays, and snapin directly interacts with hair cell calcium-sensor otoferlin. Surface plasmon resonance (SPR) analysis, competitive pull-downs, and co-immunoprecipitation indicated that these interactions were promoted by Ca 2+ and occur together. D1A was also found to separately interact with NSF, but with an inverse dependence on Ca 2+ Evidence was obtained, for the first time, that otoferlin domains C2A, C2B, C2D, and C2F interact with NSF and AP2mu1, whereas C2C or C2E do not bind to either protein, representing binding characteristics consistent with respective inclusion or omission in individual C2 domains of the tyrosine motif YXXΦ. In competitive pull-down assays, as predicted by K D values from SPR (+Ca 2+ ), C2F pulled down primarily NSF as opposed to AP2mu1. Phosphorylation of AP2mu1 gave rise to a reversal: an increase in binding by C2F to phosphorylated AP2mu1 was accompanied by a decrease in binding to NSF, consistent with a molecular switch for otoferlin from membrane fusion (NSF) to endocytosis (AP2mu1). An increase in phosphorylated AP2mu1 at the base of the cochlear inner hair cell was the observed response elicited by a dopamine D1A agonist, as predicted. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

PubMed Central

Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

2016-01-01

Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

PubMed

Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

2016-11-02

Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.

PubMed

Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K

1999-01-01

Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.

A TATA binding protein mutant with increased affinity for DNA directs transcription from a reversed TATA sequence in vivo.

PubMed

Spencer, J Vaughn; Arndt, Karen M

2002-12-01

The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.

Multiple length peptide-pheromone variants produced by Streptococcus pyogenes directly bind Rgg proteins to confer transcriptional regulation.

PubMed

Aggarwal, Chaitanya; Jimenez, Juan Cristobal; Nanavati, Dhaval; Federle, Michael J

2014-08-08

Streptococcus pyogenes, a human-restricted pathogen, accounts for substantial mortality related to infections worldwide. Recent studies indicate that streptococci produce and respond to several secreted peptide signaling molecules (pheromones), including those known as short hydrophobic peptides (SHPs), to regulate gene expression by a quorum-sensing mechanism. Upon transport into the bacterial cell, pheromones bind to and modulate activity of receptor proteins belonging to the Rgg family of transcription factors. Previously, we reported biofilm regulation by the Rgg2/3 quorum-sensing circuit in S. pyogenes. The aim of this study was to identify the composition of mature pheromones from cell-free culture supernatants that facilitate biofilm formation. Bioluminescent reporters were employed to detect active pheromones in culture supernatants fractionated by reverse-phase chromatography, and mass spectrometry was used to characterize their properties. Surprisingly, multiple SHPs that varied by length were detected. Synthetic peptides of each variant were tested individually using bioluminescence reporters and biofilm growth assays, and although activities differed widely among the group, peptides comprising the C-terminal eight amino acids of the full-length native peptide were most active. Direct Rgg/SHP interactions were determined using a fluorescence polarization assay that utilized FITC-labeled peptide ligands. Peptide receptor affinities were seen to be as low as 500 nm and their binding affinities directly correlated with observed bioactivity. Revelation of naturally produced pheromones along with determination of their affinity for cognate receptors are important steps forward in designing compounds whose purpose is positioned for future therapeutics aimed at treating infections through the interference of bacterial communication. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Hsp90 Binds Directly to Fibronectin (FN) and Inhibition Reduces the Extracellular Fibronectin Matrix in Breast Cancer Cells

PubMed Central

Kenyon, Amy; Dhanani, Karim C. H.; Prinsloo, Earl; Edkins, Adrienne L.

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis. PMID:24466266

Hsp90 binds directly to fibronectin (FN) and inhibition reduces the extracellular fibronectin matrix in breast cancer cells.

PubMed

Hunter, Morgan C; O'Hagan, Kyle L; Kenyon, Amy; Dhanani, Karim C H; Prinsloo, Earl; Edkins, Adrienne L

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis.

Transcription factor HBP1 is a direct anti-cancer target of transcription factor FOXO1 in invasive oral cancer.

PubMed

Chan, Chien-Yi; Huang, Shih-Yi; Sheu, Jim Jinn-Chyuan; Roth, Mendel M; Chou, I-Tai; Lien, Chia-Hsien; Lee, Ming-Fen; Huang, Chun-Yin

2017-02-28

Either FOXO1 or HBP1 transcription factor is a downstream effector of the PI3K/Akt pathway and associated with tumorigenesis. However, the relationship between FOXO1 and HBP1 in oral cancer remains unclear. Analysis of 30 oral tumor specimens revealed that mean mRNA levels of both FOXO1 and HBP1 in non-invasive and invasive oral tumors were found to be significantly lower than that of the control tissues, and the status of low FOXO1 and HBP1 (< 0.3 fold of the control) was associated with invasiveness of oral tumors. To investigate if HBP1 is a direct transcription target of FOXO1, we searched potential FOXO1 binding sites in the HBP1 promoter using the MAPPER Search Engine, and two putative FOXO1 binding sites located in the HBP1 promoter -132 to -125 bp and -343 to -336 bp were predicted. These binding sites were then confirmed by both reporter gene assays and the in cellulo ChIP assay. In addition, Akt activity manipulated by PI3K inhibitor LY294002 or Akt mutants was shown to negatively affect FOXO1-mediated HBP1 promoter activation and gene expression. Last, the biological significance of the FOXO1-HBP1 axis in oral cancer malignancy was evaluated in cell growth, colony formation, and invasiveness. The results indicated that HBP1 knockdown potently promoted malignant phenotypes of oral cancer and the suppressive effect of FOXO1 on cell growth, colony formation, and invasion was alleviated upon HBP1 knockdown in invasive oral cancer cells. Taken together, our data provide evidence for HBP1 as a direct downstream target of FOXO1 in oral cancer malignancy.

Characterization of the Catalytic and Nucleotide Binding Properties of the α-Kinase Domain of Dictyostelium Myosin-II Heavy Chain Kinase A*

PubMed Central

Yang, Yidai; Ye, Qilu; Jia, Zongchao; Côté, Graham P.

2015-01-01

The α-kinases are a widely expressed family of serine/threonine protein kinases that exhibit no sequence identity with conventional eukaryotic protein kinases. In this report, we provide new information on the catalytic properties of the α-kinase domain of Dictyostelium myosin-II heavy chain kinase-A (termed A-CAT). Crystallization of A-CAT in the presence of MgATP yielded structures with AMP or adenosine in the catalytic cleft together with a phosphorylated Asp-766 residue. The results show that the β- and α-phosphoryl groups are transferred either directly or indirectly to the catalytically essential Asp-766. Biochemical assays confirmed that A-CAT hydrolyzed ATP, ADP, and AMP with kcat values of 1.9, 0.6, and 0.32 min−1, respectively, and showed that A-CAT can use ADP to phosphorylate peptides and proteins. Binding assays using fluorescent 2′/3′-O-(N-methylanthraniloyl) analogs of ATP and ADP yielded Kd values for ATP, ADP, AMP, and adenosine of 20 ± 3, 60 ± 20, 160 ± 60, and 45 ± 15 μm, respectively. Site-directed mutagenesis showed that Glu-713, Leu-716, and Lys-645, all of which interact with the adenine base, were critical for nucleotide binding. Mutation of the highly conserved Gln-758, which chelates a nucleotide-associated Mg2+ ion, eliminated catalytic activity, whereas loss of the highly conserved Lys-722 and Arg-592 decreased kcat values for kinase and ATPase activities by 3–6-fold. Mutation of Asp-663 impaired kinase activity to a much greater extent than ATPase, indicating a specific role in peptide substrate binding, whereas mutation of Gln-768 doubled ATPase activity, suggesting that it may act to exclude water from the active site. PMID:26260792

Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

EPA Science Inventory

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

Integrated Summary Report: Validation of Two Binding Assays Using Human Recombinant Estrogen Receptor Alpha (hrERa)

EPA Science Inventory

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

AMP Is an Adenosine A1 Receptor Agonist*

PubMed Central

Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.

2012-01-01

Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671

AMP is an adenosine A1 receptor agonist.

PubMed

Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J

2012-02-17

Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.

Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

PubMed

Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

2018-05-05

The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

Investigation of Trimethyllysine Binding by the HP1 Chromodomain via Unnatural Amino Acid Mutagenesis.

PubMed

Baril, Stefanie A; Koenig, Amber L; Krone, Mackenzie W; Albanese, Katherine I; He, Cyndi Qixin; Lee, Ga Young; Houk, Kendall N; Waters, Marcey L; Brustad, Eric M

2017-12-06

Trimethyllysine (Kme3) reader proteins are targets for inhibition due to their role in mediating gene expression. Although all such reader proteins bind Kme3 in an aromatic cage, the driving force for binding may differ; some readers exhibit evidence for cation-π interactions whereas others do not. We report a general unnatural amino acid mutagenesis approach to quantify the contribution of individual tyrosines to cation binding using the HP1 chromodomain as a model system. We demonstrate that two tyrosines (Y24 and Y48) bind to a Kme3-histone tail peptide via cation-π interactions, but linear free energy trends suggest they do not contribute equally to binding. X-ray structures and computational analysis suggest that the distance and degree of contact between Tyr residues and Kme3 plays an important role in tuning cation-π-mediated Kme3 recognition. Although cation-π interactions have been studied in a number of proteins, this work is the first to utilize direct binding assays, X-ray crystallography, and modeling, to pinpoint factors that influence the magnitude of the individual cation-π interactions.

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

EMSA Analysis of DNA Binding By Rgg Proteins

PubMed Central

LaSarre, Breah; Federle, Michael J.

2016-01-01

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

EMSA Analysis of DNA Binding By Rgg Proteins.

PubMed

LaSarre, Breah; Federle, Michael J

2013-08-20

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

PubMed

Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

2017-01-27

DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

Interaction of the Sliding Clamp β-Subunit and Hda, a DnaA-Related Protein

PubMed Central

Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

2004-01-01

In Escherichia coli, interactions between the replication initiation protein DnaA, the β subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and β proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with β in vitro. A new β-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified β-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind β. A 10-amino-acid peptide containing the E. coli Hda β-binding motif was shown to compete with Hda for binding to β in an Hda-β interaction assay. These results establish that the interaction of Hda with β is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication. PMID:15150238

Interaction of the sliding clamp beta-subunit and Hda, a DnaA-related protein.

PubMed

Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

2004-06-01

In Escherichia coli, interactions between the replication initiation protein DnaA, the beta subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and beta proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with beta in vitro. A new beta-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified beta-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind beta. A 10-amino-acid peptide containing the E. coli Hda beta-binding motif was shown to compete with Hda for binding to beta in an Hda-beta interaction assay. These results establish that the interaction of Hda with beta is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication.

DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

PubMed Central

Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

2009-01-01

GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

Thyroid Hormone Receptor β (THRB) Is a Major Target Gene for MicroRNAs Deregulated in Papillary Thyroid Carcinoma (PTC)

PubMed Central

Boguslawska, Joanna; Jendrzejewski, Jaroslaw; Liyanarachchi, Sandya; Pachucki, Janusz; Wardyn, Kazimierz A.; Nauman, Alicja

2011-01-01

Context: Loss of the thyroid hormone receptor is common in tumors. In mouse models, a truncated THRB gene leads to thyroid cancer. Previously, we observed up-regulation of the expression of eight microRNAs (miRs) in papillary thyroid carcinoma (PTC) tumors. Objective: Our objective was to determine whether THRB might be inhibited by miRs up-regulated in PTC. Design: The potential binding of miR to the 3′-untranslated region of THRB was analyzed in silico. Direct inhibition by miRs binding to the cloned 3′-untranslated region of THRB was evaluated using luciferase assays. Inhibition of endogenous THRB and its target genes (DIO1 and APP) was examined in cell lines transfected by pre-miRs. The impact on thyroid hormone response element (TRE) was evaluated in promoter assays. Correlations between the expression of THRB and miRs was evaluated in 13 PTC tumor/normal tissue pairs. Results: THRB contains binding sites for the top seven miRs up-regulated in PTC (P = 0.0000002). Direct interaction with THRB was shown for miR-21 and miR-146a. We observed lower levels of THRB transcripts in cell lines transfected with miR-21, -146a, and -221 (down-regulation of 37–48%; P < 0.0001), but not with miR-181a. THRB protein was suppressed down to 10–28% by each of four miRs. Concomitant expression of DIO1 and APP was affected (down-regulation of 32–66%, P < 0.0034 and up-regulation of 48–57%, P < 0.0002, respectively). All four miRs affected TRE activity in promoter assays. Down-regulation of luciferase occurred after transfection with pTRE-TK-Luc construct and each of four miRs. The analysis of tumor/normal tissue pairs revealed down-regulation of THRB in 11 of 13 pairs (1.3- to 9.1-fold), and up-regulation of miR-21, -146a, -181a, and -221 in almost all pairs. Conclusions: MiRs up-regulated in PTC tumors directly inhibit the expression of THRB, an important tumor suppressor gene. PMID:21159845

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Myosin Va Bound to Phagosomes Binds to F-Actin and Delays Microtubule-dependent Motility

PubMed Central

Al-Haddad, Ahmed; Shonn, Marion A.; Redlich, Bärbel; Blocker, Ariel; Burkhardt, Janis K.; Yu, Hanry; Hammer, John A.; Weiss, Dieter G.; Steffen, Walter; Griffiths, Gareth; Kuznetsov, Sergei A.

2001-01-01

We established a light microscopy-based assay that reconstitutes the binding of phagosomes purified from mouse macrophages to preassembled F-actin in vitro. Both endogenous myosin Va from mouse macrophages and exogenous myosin Va from chicken brain stimulated the phagosome–F-actin interaction. Myosin Va association with phagosomes correlated with their ability to bind F-actin in an ATP-regulated manner and antibodies to myosin Va specifically blocked the ATP-sensitive phagosome binding to F-actin. The uptake and retrograde transport of phagosomes from the periphery to the center of cells in bone marrow macrophages was observed in both normal mice and mice homozygous for the dilute-lethal spontaneous mutation (myosin Va null). However, in dilute-lethal macrophages the accumulation of phagosomes in the perinuclear region occurred twofold faster than in normal macrophages. Motion analysis revealed saltatory phagosome movement with temporarily reversed direction in normal macrophages, whereas almost no reversals in direction were observed in dilute-lethal macrophages. These observations demonstrate that myosin Va mediates phagosome binding to F-actin, resulting in a delay in microtubule-dependent retrograde phagosome movement toward the cell center. We propose an “antagonistic/cooperative mechanism” to explain the saltatory phagosome movement toward the cell center in normal macrophages. PMID:11553713

Screening of a library of T7 phage-displayed peptides identifies alphaC helix in 14-3-3 protein as a CBP501-binding site.

PubMed

Matsumoto, Yuki; Shindo, Yosuke; Takakusagi, Yoichi; Takakusagi, Kaori; Tsukuda, Senko; Kusayanagi, Tomoe; Sato, Hitoshi; Kawabe, Takumi; Sugawara, Fumio; Sakaguchi, Kengo

2011-12-01

CBP501 is a chemically modified peptide composed of twelve unnatural d-amino acids, which inhibits Chk kinase and abrogates G2 arrest induced by DNA-damaging agents. Here we identified an alphaC helix in 14-3-3 protein as a CBP501-binding site using T7 phage display technology. An affinity selection of T7 phage-displayed peptide using biotinylated CBP501 identified a 14-mer peptide NSDCIISRKIEQKE. This peptide sequence showed similarity to a portion of the alphaC helix of human 14-3-3ε, suggesting that CBP501 may bind to this region. Surface plasmon resonance (SPR) and ELISA demonstrated that CBP501 interacts with 14-3-3ε specifically at the screen-guided region. An avidin-agarose bead pull-down assay showed that CBP501 also binds to other 14-3-3 isoforms in Jurkat cells. Among the other known Chk kinase inhibitors tested, CBP501 showed the strongest affinity for 14-3-3ε. Thus, we conclude that in addition to the direct inhibition of Chk kinase activity, CBP501 directly binds to cellular 14-3-3 proteins through alphaC helix. Copyright © 2011 Elsevier Ltd. All rights reserved.

Antibody humanization by molecular dynamics simulations-in-silico guided selection of critical backmutations.

PubMed

Margreitter, Christian; Mayrhofer, Patrick; Kunert, Renate; Oostenbrink, Chris

2016-06-01

Monoclonal antibodies represent the fastest growing class of biotherapeutic proteins. However, as they are often initially derived from rodent organisms, there is a severe risk of immunogenic reactions, hampering their applicability. The humanization of these antibodies remains a challenging task in the context of rational drug design. "Superhumanization" describes the direct transfer of the complementarity determining regions to a human germline framework, but this humanization approach often results in loss of binding affinity. In this study, we present a new approach for predicting promising backmutation sites using molecular dynamics simulations of the model antibody Ab2/3H6. The simulation method was developed in close conjunction with novel specificity experiments. Binding properties of mAb variants were evaluated directly from crude supernatants and confirmed using established binding affinity assays for purified antibodies. Our approach provides access to the dynamical features of the actual binding sites of an antibody, based solely on the antibody sequence. Thus we do not need structural data on the antibody-antigen complex and circumvent cumbersome methods to assess binding affinities. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd.

High resolution Chromatin Immunoprecipitation (ChIP) sequencing reveals novel bindings targets and prognostic role for SOX11 in Mantle cell lymphoma

PubMed Central

Kuo, Pei-Yu; Leshchenko, Violetta V.; Fazzari, Melissa J.; Perumal, Deepak; Gellen, Tobias; He, Tianfang; Iqbal, Javeed; Baumgartner-Wennerholm, Stefanie; Nygren, Lina; Zhang, Fan; Zhang, Weijia; Suh, K. Stephen; Goy, Andre; Yang, David T.; Chan, Wing-Chung; Kahl, Brad S.; Verma, Amit K.; Gascoyne, Randy D.; Kimby, Eva; Sander, Birgitta; Ye, B. Hilda; Melnick, Ari M.; Parekh, Samir

2015-01-01

SOX11 (Sex determining region Y-box 11) expression is specific for MCL as compared to other Non-Hodgkin's lymphomas. However, the function and direct binding targets of SOX11 in MCL are largely unknown. We used high-resolution ChIP-Seq to identify the direct target genes of SOX11 in a genome-wide, unbiased manner and elucidate its functional significance. Pathway analysis identified WNT, PKA and TGF-beta signaling pathways as significantly enriched by SOX11 target genes. qCHIP and promoter reporter assays confirmed that SOX11 directly binds to individual genes and modulates their transcription activities in these pathways in MCL. Functional studies using RNA interference demonstrate that SOX11 directly regulates WNT in MCL. We analyzed SOX11 expression in three independent well-annotated tissue microarrays from the University of Wisconsin (UW), Karolinska Institute and British Columbia Cancer Agency (BCCA). Our findings suggest that high SOX11 expression is associated with improved survival in a subset of MCL patients, particularly those treated with intensive chemotherapy. Transcriptional regulation of WNT and other biological pathways affected by SOX11 target genes may help explain the impact of SOX11 expression on patient outcomes. PMID:24681958

Recombinant human antibody fragment against tetanus toxoid produced by phage display

PubMed Central

Neelakantam, B.; Sridevi, N. V.; Shukra, A. M.; Sugumar, P.; Samuel, S.

2014-01-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen. PMID:24678405

c-Fos downregulation positively regulates EphA5 expression in a congenital hypothyroidism rat model.

PubMed

Song, Honghua; Zheng, Yuqin; Cai, Fuying; Ma, Yanyan; Yang, Jingyue; Wu, Youjia

2018-04-01

The EphA5 receptor is well established as an axon guidance molecule during neural system development and plays an important role in dendritic spine formation and synaptogenesis. Our previous study has showed that EphA5 is decreased in the developing brain of congenital hypothyroidism (CH) and the EphA5 promoter methylation modification participates in its decrease. c-Fos, a well-kown transcription factor, has been considered in association with brain development. Bioinformatics analysis showed that the EphA5 promoter region contained five putative c-fos binding sites. The chromatin immunoprecipitation (ChIP) assays were used to assess the direct binding of c-fos to the EphA5 promoter. Furthermore, dual-luciferase assays showed that these three c-fos protein binding sites were positive regulatory elements for EphA5 expression in PC12 cells. Moreover, We verified c-fos positively regulation for EphA5 expression in CH model. Q-PCR and Western blot showed that c-fos overexpression could upregulate EphA5 expression in hippocampal neurons of rats with CH. Our results suggest that c-fos positively regulates EphA5 expression in CH rat model.

Direct observation of transcription activator-like effector (TALE) protein dynamics

NASA Astrophysics Data System (ADS)

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

2014-03-01

In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Andrographolide derivatives inhibit guanine nucleotide exchange and abrogate oncogenic Ras function

PubMed Central

Hocker, Harrison J.; Cho, Kwang-Jin; Chen, Chung-Ying K.; Rambahal, Nandini; Sagineedu, Sreenivasa Rao; Shaari, Khozirah; Stanslas, Johnson; Hancock, John F.; Gorfe, Alemayehu A.

2013-01-01

Aberrant signaling by oncogenic mutant rat sarcoma (Ras) proteins occurs in ∼15% of all human tumors, yet direct inhibition of Ras by small molecules has remained elusive. Recently, several small-molecule ligands have been discovered that directly bind Ras and inhibit its function by interfering with exchange factor binding. However, it is unclear whether, or how, these ligands could lead to drugs that act against constitutively active oncogenic mutant Ras. Using a dynamics-based pocket identification scheme, ensemble docking, and innovative cell-based assays, here we show that andrographolide (AGP)—a bicyclic diterpenoid lactone isolated from Andrographis paniculata—and its benzylidene derivatives bind to transient pockets on Kirsten-Ras (K-Ras) and inhibit GDP–GTP exchange. As expected for inhibitors of exchange factor binding, AGP derivatives reduced GTP loading of wild-type K-Ras in response to acute EGF stimulation with a concomitant reduction in MAPK activation. Remarkably, however, prolonged treatment with AGP derivatives also reduced GTP loading of, and signal transmission by, oncogenic mutant K-RasG12V. In sum, the combined analysis of our computational and cell biology results show that AGP derivatives directly bind Ras, block GDP–GTP exchange, and inhibit both wild-type and oncogenic K-Ras signaling. Importantly, our findings not only show that nucleotide exchange factors are required for oncogenic Ras signaling but also demonstrate that inhibiting nucleotide exchange is a valid approach to abrogating the function of oncogenic mutant Ras. PMID:23737504

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV

PubMed Central

Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun

2013-01-01

Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868

Discovery of non-peptidic small molecule inhibitors of cyclophilin D as neuroprotective agents in Aβ-induced mitochondrial dysfunction

NASA Astrophysics Data System (ADS)

Park, Insun; Londhe, Ashwini M.; Lim, Ji Woong; Park, Beoung-Geon; Jung, Seo Yun; Lee, Jae Yeol; Lim, Sang Min; No, Kyoung Tai; Lee, Jiyoun; Pae, Ae Nim

2017-10-01

Cyclophilin D (CypD) is a mitochondria-specific cyclophilin that is known to play a pivotal role in the formation of the mitochondrial permeability transition pore (mPTP).The formation and opening of the mPTP disrupt mitochondrial homeostasis, cause mitochondrial dysfunction and eventually lead to cell death. Several recent studies have found that CypD promotes the formation of the mPTP upon binding to β amyloid (Aβ) peptides inside brain mitochondria, suggesting that neuronal CypD has a potential to be a promising therapeutic target for Alzheimer's disease (AD). In this study, we generated an energy-based pharmacophore model by using the crystal structure of CypD—cyclosporine A (CsA) complex and performed virtual screening of ChemDiv database, which yielded forty-five potential hit compounds with novel scaffolds. We further tested those compounds using mitochondrial functional assays in neuronal cells and identified fifteen compounds with excellent protective effects against Aβ-induced mitochondrial dysfunction. To validate whether these effects derived from binding to CypD, we performed surface plasmon resonance (SPR)—based direct binding assays with selected compounds and discovered compound 29 was found to have the equilibrium dissociation constants (KD) value of 88.2 nM. This binding affinity value and biological activity correspond well with our predicted binding mode. We believe that this study offers new insights into the rational design of small molecule CypD inhibitors, and provides a promising lead for future therapeutic development.

Entry Inhibition of Influenza Viruses with High Mannose Binding Lectin ESA-2 from the Red Alga Eucheuma serra through the Recognition of Viral Hemagglutinin

PubMed Central

Sato, Yuichiro; Morimoto, Kinjiro; Kubo, Takanori; Sakaguchi, Takemasa; Nishizono, Akira; Hirayama, Makoto; Hori, Kanji

2015-01-01

Lectin sensitivity of the recent pandemic influenza A virus (H1N1-2009) was screened for 12 lectins with various carbohydrate specificity by a neutral red dye uptake assay with MDCK cells. Among them, a high mannose (HM)-binding anti-HIV lectin, ESA-2 from the red alga Eucheuma serra, showed the highest inhibition against infection with an EC50 of 12.4 nM. Moreover, ESA-2 exhibited a wide range of antiviral spectrum against various influenza strains with EC50s of pico molar to low nanomolar levels. Besides ESA-2, HM-binding plant lectin ConA, fucose-binding lectins such as fungal AOL from Aspergillus oryzae and AAL from Aleuria aurantia were active against H1N1-2009, but the potency of inhibition was of less magnitude compared with ESA-2. Direct interaction between ESA-2 and a viral envelope glycoprotein, hemagglutinin (HA), was demonstrated by ELISA assay. This interaction was effectively suppressed by glycoproteins bearing HM-glycans, indicating that ESA-2 binds to the HA of influenza virus through HM-glycans. Upon treatment with ESA-2, no viral antigens were detected in the host cells, indicating that ESA-2 inhibited the initial steps of virus entry into the cells. ESA-2 would thus be useful as a novel microbicide to prevent penetration of viruses such as HIV and influenza viruses to the host cells. PMID:26035023

Beyond conventional dose-response curves: Sensorgram comparison in SPR allows single concentration activity and similarity assessment.

PubMed

Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J

2018-05-30

Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.

A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

PubMed

Banasik, Michał; Sachadyn, Paweł

2016-09-01

A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva† †Electronic supplementary information (ESI) available: Optimization of Mg2+ and ATMND concentrations for our CBSA-based ATMND-binding assay; ATMND-reported calibration curve for CBSA-5325 at various cocaine concentrations; ATMND binding affinity for the cocaine-assembled CBSA-5325; K D of 38-GC and different 38-GC mutants for cocaine as characterized by ITC; stem length effects on cocaine-induced CBSA assembly; spectra of CBSA-5335-based fluorescence detection of cocaine in 1× binding buffer; characterization of cocaine binding affinity of CBSA-5335 and PSA using ITC; fluorescence detection of cocaine in saliva with our fluorophore/quencher modified CBSA-5335; calibration curve of our CBSA-5335-based fluorophore/quencher assay in 1× binding buffer and 10% saliva at cocaine concentrations ranging from 0 to 10 μM; bias and precision of the CBSA-5335-based fluorophore/quencher assay; comparison of amplification-free split-aptamer assays for cocaine detection; sequence ID and DNA sequences used in this work. See DOI: 10.1039/c6sc01833e Click here for additional data file.

PubMed Central

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157

Cortactin scaffolds Arp2/3 and WAVE2 at the epithelial zonula adherens.

PubMed

Han, Siew Ping; Gambin, Yann; Gomez, Guillermo A; Verma, Suzie; Giles, Nichole; Michael, Magdalene; Wu, Selwin K; Guo, Zhong; Johnston, Wayne; Sierecki, Emma; Parton, Robert G; Alexandrov, Kirill; Yap, Alpha S

2014-03-14

Cadherin junctions arise from the integrated action of cell adhesion, signaling, and the cytoskeleton. At the zonula adherens (ZA), a WAVE2-Arp2/3 actin nucleation apparatus is necessary for junctional tension and integrity. But how this is coordinated with cadherin adhesion is not known. We now identify cortactin as a key scaffold for actin regulation at the ZA, which localizes to the ZA through influences from both E-cadherin and N-WASP. Using cell-free protein expression and fluorescent single molecule coincidence assays, we demonstrate that cortactin binds directly to the cadherin cytoplasmic tail. However, its concentration with cadherin at the apical ZA also requires N-WASP. Cortactin is known to bind Arp2/3 directly (Weed, S. A., Karginov, A. V., Schafer, D. A., Weaver, A. M., Kinley, A. W., Cooper, J. A., and Parsons, J. T. (2000) J. Cell Biol. 151, 29-40). We further show that cortactin can directly bind WAVE2, as well as Arp2/3, and both these interactions are necessary for actin assembly at the ZA. We propose that cortactin serves as a platform that integrates regulators of junctional actin assembly at the ZA.

Cortactin Scaffolds Arp2/3 and WAVE2 at the Epithelial Zonula Adherens*♦

PubMed Central

Han, Siew Ping; Gambin, Yann; Gomez, Guillermo A.; Verma, Suzie; Giles, Nichole; Michael, Magdalene; Wu, Selwin K.; Guo, Zhong; Johnston, Wayne; Sierecki, Emma; Parton, Robert G.; Alexandrov, Kirill; Yap, Alpha S.

2014-01-01

Cadherin junctions arise from the integrated action of cell adhesion, signaling, and the cytoskeleton. At the zonula adherens (ZA), a WAVE2-Arp2/3 actin nucleation apparatus is necessary for junctional tension and integrity. But how this is coordinated with cadherin adhesion is not known. We now identify cortactin as a key scaffold for actin regulation at the ZA, which localizes to the ZA through influences from both E-cadherin and N-WASP. Using cell-free protein expression and fluorescent single molecule coincidence assays, we demonstrate that cortactin binds directly to the cadherin cytoplasmic tail. However, its concentration with cadherin at the apical ZA also requires N-WASP. Cortactin is known to bind Arp2/3 directly (Weed, S. A., Karginov, A. V., Schafer, D. A., Weaver, A. M., Kinley, A. W., Cooper, J. A., and Parsons, J. T. (2000) J. Cell Biol. 151, 29–40). We further show that cortactin can directly bind WAVE2, as well as Arp2/3, and both these interactions are necessary for actin assembly at the ZA. We propose that cortactin serves as a platform that integrates regulators of junctional actin assembly at the ZA. PMID:24469447

A generic HTS assay for kinase screening: Validation for the isolation of an engineered malate kinase

PubMed Central

Irague, Romain; Topham, Christopher M.; Martineau, Nelly; Baylac, Audrey; Auriol, Clément; Walther, Thomas; François, Jean-Marie; Remaud-Siméon, Magali

2018-01-01

An end-point ADP/NAD+ acid/alkali assay procedure, directly applicable to library screening of any type of ATP-utilising/ADP producing enzyme activity, was implemented. Typically, ADP production is coupled to NAD+ co-enzyme formation by the conventional addition of pyruvate kinase and lactate dehydrogenase. Transformation of enzymatically generated NAD+ into a photometrically active alkali derivative product is then achieved through the successive application of acidic/alkali treatment steps. The assay was successfully miniaturized to search for malate kinase activity in a structurally-guided library of LysC aspartate kinase variants comprising 6,700 clones. The screening procedure enabled the isolation of nine positive variants showing novel kinase activity on (L)-malate, the best mutant, LysC V115A:E119S:E434V exhibited strong substrate selectivity for (L)-malate compared to (L)-aspartate with a (kcat/Km)malate/(kcat/Km)aspartate ratio of 86. Double mutants V115A:E119S, V115A:E119C and E119S:E434V were constructed to further probe the origins of stabilising substrate binding energy gains for (L)-malate due to mutation. The introduction of less sterically hindering side-chains in engineered enzymes carrying E119S and V115A mutations increases the effective volume available for substrate binding in the catalytic pocket. Improved binding of the (L)-malate substrate may be assisted by less hindered movement of the Phe184 aromatic side-chain. Additional favourable long-range electostatic effects on binding arising from the E434V surface mutation are conditionally dependent upon the presence of the V115A mutation close to Phe184 in the active-site. PMID:29462203

The organic solute transporters alpha and beta are induced by hypoxia in human hepatocytes

PubMed Central

Schaffner, Carlos A; Mwinyi, Jessica; Gai, Zhibo; Thasler, Wolfgang E; Eloranta, Jyrki J; Kullak-Ublick, Gerd A

2015-01-01

Background & Aims The organic solute transporters alpha and beta (OSTα-OSTβ) form a heterodimeric transporter located at the basolateral membrane of intestinal epithelial cells and hepatocytes. Liver injury caused by ischaemia-reperfusion, cancer, inflammation or cholestasis can induce a state of hypoxia in hepatocytes. Here, we studied the effect of hypoxia on the expression of OSTα-OSTβ. Methods OSTα-OSTβ expression was measured in Huh7 cells and primary human hepatocytes (PHH) exposed to chenodeoxycholic acid (CDCA), hypoxia or both. OSTα-OSTβ promoter activity was analysed in luciferase reporter gene assays. Binding of hypoxia-inducible factor-1 alpha (HIF-1α) to the OSTα-OSTβ gene promoters was studied in electrophoretic mobility shift assays (EMSA). Results Expression of OSTα and OSTβ increased in PHH under conditions of hypoxia. Exposure of Huh7 cells or PHH to CDCA (50 μM) enhanced the effect of hypoxia on OSTα mRNA levels. In luciferase assays and EMSA, the inducing effect of low oxygen could be assigned to HIF-1α, which binds to hypoxia responsive elements (HRE) in the OSTα and OSTβ gene promoters. Site-directed mutagenesis of either the predicted HRE or the bile acid responsive FXR binding site abolished inducibility of the OSTα promoter, indicating that both elements need to be intact for induction by hypoxia and CDCA. In a rat model of chronic renal failure, the known increase in hepatic OSTα expression was associated with an increase in HIF-1α protein levels. Conclusion OSTα-OSTβ expression is induced by hypoxia. FXR and HIF-1α bind in close proximity to the OSTα gene promoter and produce synergistic effects on OSTα expression. PMID:24703425

The g.763G>C SNP of the bovine FASN gene affects its promoter activity via Sp-mediated regulation: implications for the bovine lactating mammary gland.

PubMed

Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina

2008-07-15

Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.

Inhibition of the EGFR/STAT3/CEBPD Axis Reverses Cisplatin Cross-resistance with Paclitaxel in the Urothelial Carcinoma of the Urinary Bladder.

PubMed

Wang, Wei-Jan; Li, Chien-Feng; Chu, Yu-Yi; Wang, Yu-Hui; Hour, Tzyh-Chyuan; Yen, Chia-Jui; Chang, Wen-Chang; Wang, Ju-Ming

2017-01-15

Cisplatin (CDDP) is frequently used in combination chemotherapy with paclitaxel for treating urothelial carcinoma of the urinary bladder (UCUB). CDDP cross-resistance has been suggested to develop with paclitaxel, thus hindering successful UCUB treatment. Therefore, elucidating the mechanisms underlying CDDP-induced anticancer drug resistance is imperative and may provide an insight in developing novel therapeutic strategy. Loss-of-function assays were performed to elucidate the role of the EGFR and STAT3 in CDDP-induced CCAAT/enhancer-binding protein delta (CEBPD) expression in UCUB cells. Reporter and in vivo DNA-binding assays were employed to determine whether CEBPD directly regulates ATP binding cassette subfamily B member 1 (ABCB1) and ATP binding cassette subfamily C member 2 (ABCC2) activation. Finally, a xenograft animal assay was used to examine the abilities of gefitinib and S3I-201 (a STAT3 inhibitor) to reverse CDDP and paclitaxel sensitivity. CEBPD expression was maintained in postoperative chemotherapy patients, and this expression was induced by CDDP even in CDDP-resistant UCUB cells. Upon CDDP treatment, CEBPD activated ABCB1 and ABCC2. Furthermore, the EGFR/STAT3 pathway contributed to CDDP-induced CEBPD expression in UCUB cells. Gefitinib and S3I-201 treatment significantly reduced the expression of CEBPD and enhanced the sensitivity of CDDP-resistant UCUB cells to CDDP and paclitaxel. Our results revealed the risk of CEBPD activation in CDDP-resistant UCUB cells and suggested a therapeutic strategy for patients with UCUB or UCUB resisted to CDDP and paclitaxel by combination with either gefitinib or S3I-201. Clin Cancer Res; 23(2); 503-13. ©2016 AACR. ©2016 American Association for Cancer Research.

An RNA-Binding Multimer Specifies Nematode Sperm Fate.

PubMed

Aoki, Scott T; Porter, Douglas F; Prasad, Aman; Wickens, Marvin; Bingman, Craig A; Kimble, Judith

2018-06-26

FOG-3 is a master regulator of sperm fate in Caenorhabditis elegans and homologous to Tob/BTG proteins, which in mammals are monomeric adaptors that recruit enzymes to RNA binding proteins. Here, we determine the FOG-3 crystal structure and in vitro demonstrate that FOG-3 forms dimers that can multimerize. The FOG-3 multimeric structure has a basic surface potential, suggestive of binding nucleic acid. Consistent with that prediction, FOG-3 binds directly to nearly 1,000 RNAs in nematode spermatogenic germ cells. Most binding is to the 3' UTR, and most targets (94%) are oogenic mRNAs, even though assayed in spermatogenic cells. When tethered to a reporter mRNA, FOG-3 represses its expression. Together these findings elucidate the molecular mechanism of sperm fate specification and reveal the evolution of a protein from monomeric to multimeric form with acquisition of a distinct mode of mRNA repression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

CLASPs are required for proper microtubule localization of End-binding proteins

PubMed Central

Grimaldi, Ashley D.; Maki, Takahisa; Fitton, Benjamin P.; Roth, Daniel; Yampolsky, Dmitry; Davidson, Michael W.; Svitkina, Tatyana; Straube, Anne; Hayashi, Ikuko; Kaverina, Irina

2014-01-01

Summary Microtubule (MT) plus-end tracking proteins (+TIPs) preferentially localize to MT plus-ends. End-binding proteins (EBs) are master regulators of the +TIP complex; however, it is unknown whether EBs are regulated by other +TIPs. Here, we show that Cytoplasmic linker associated proteins (CLASPs) modulate EB localization at MTs. In CLASP-depleted cells, EBs localized along the MT lattice in addition to plus-ends. The MT-binding region of CLASP was sufficient for restoring normal EB localization, while neither EB-CLASP interactions nor EB tail-binding proteins are involved. In vitro assays revealed that CLASP directly functions to remove EB from MTs. Importantly, this effect occurs specifically during MT polymerization, but not at pre-formed MTs. Increased GTP-tubulin content within MTs in CLASP-depleted cells suggests that CLASPs facilitate GTP-hydrolysis to reduce EB lattice binding. Together, these findings suggest that CLASPs influence the MT lattice itself to regulate EB and determine exclusive plus-end localization of EBs in cells. PMID:25117684

Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

PubMed

Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

2006-07-07

We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.

PubMed

Diana, T; Wüster, C; Kanitz, M; Kahaly, G J

2016-10-01

TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.

Heterotypic binding between neuronal membrane vesicles and glial cells is mediated by a specific cell adhesion molecule

PubMed Central

1984-01-01

By means of a multistage quantitative assay, we have identified a new kind of cell adhesion molecule (CAM) on neuronal cells of the chick embryo that is involved in their adhesion to glial cells. The assay used to identify the binding component (which we name neuron-glia CAM or Ng-CAM) was designed to distinguish between homotypic binding (e.g., neuron to neuron) and heterotypic binding (e.g., neuron to glia). This distinction was essential because a single neuron might simultaneously carry different CAMs separately mediating each of these interactions. The adhesion of neuronal cells to glial cells in vitro was previously found to be inhibited by Fab' fragments prepared from antisera against neuronal membranes but not by Fab' fragments against N-CAM, the neural cell adhesion molecule. This suggested that neuron-glia adhesion is mediated by specific cell surface molecules different from previously isolated CAMs . To verify that this was the case, neuronal membrane vesicles were labeled internally with 6-carboxyfluorescein and externally with 125I-labeled antibodies to N-CAM to block their homotypic binding. Labeled vesicles bound to glial cells but not to fibroblasts during a 30-min incubation period. The specific binding of the neuronal vesicles to glial cells was measured by fluorescence microscopy and gamma spectroscopy of the 125I label. Binding increased with increasing concentrations of both glial cells and neuronal vesicles. Fab' fragments prepared from anti-neuronal membrane sera that inhibited binding between neurons and glial cells were also found to inhibit neuronal vesicle binding to glial cells. The inhibitory activity of the Fab' fragments was depleted by preincubation with neuronal cells but not with glial cells. Trypsin treatment of neuronal membrane vesicles released material that neutralized Fab' fragment inhibition; after chromatography, neutralizing activity was enriched 50- fold. This fraction was injected into mice to produce monoclonal antibodies; an antibody was obtained that interacted with neurons, inhibited binding of neuronal membrane vesicles to glial cells, and recognized an Mr = 135,000 band in immunoblots of embryonic chick brain membranes. These results suggest that this molecule is present on the surfaces of neurons and that it directly or indirectly mediates adhesion between neurons and glial cells. Because the monoclonal antibody as well as the original polyspecific antibodies that were active in the assay did not bind to glial cells, we infer that neuron- glial interaction is heterophilic, i.e., it occurs between Ng-CAM on neurons and an as yet unidentified CAM present on glial cells. PMID:6725397

Aptamer-phage reporters for ultrasensitive lateral flow assays

PubMed Central

Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E. V.; Kourentzi, Katerina; Conrad, Jacinta C.; Willson, Richard C.

2015-01-01

We introduce the modification of bacteriophage particles with aptamers for the use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ~100 times lower than those of previously reported IgE assays. PMID:26456715

Aptamer-Phage Reporters for Ultrasensitive Lateral Flow Assays.

PubMed

Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E V; Kourentzi, Katerina; Conrad, Jacinta C; Willson, Richard C

2015-12-01

We introduce the modification of bacteriophage particles with aptamers for use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ∼100 times lower than those of previously reported IgE assays.

Screening Carbohydrate Libraries for Protein Interactions Using the Direct ESI-MS Assay. Applications to Libraries of Unknown Concentration

NASA Astrophysics Data System (ADS)

Kitova, Elena N.; El-Hawiet, Amr; Klassen, John S.

2014-08-01

A semiquantitative electrospray ionization mass spectrometry (ESI-MS) binding assay suitable for analyzing mixtures of oligosaccharides, at unknown concentrations, for interactions with target proteins is described. The assay relies on the differences in the ratio of the relative abundances of the ligand-bound and free protein ions measured by ESI-MS at two or more initial protein concentrations to distinguish low affinity (≤103 M-1) ligands from moderate and high affinity (>105 M-1) ligands present in the library and to rank their affinities. Control experiments were performed on solutions of a single chain antibody and a mixture of synthetic oligosaccharides, with known affinities, in the absence and presence of a 40-component carbohydrate library to demonstrate the implementation and reliability of the assay. The application of the assay for screening natural libraries of carbohydrates against proteins is also demonstrated using mixtures of human milk oligosaccharides, isolated from breast milk, and fragments of a bacterial toxin and human galectin 3.

Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy.

PubMed

Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan

2016-06-01

G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Determination of optimal biomass pretreatment strategies for biofuel production: investigation of relationships between surface-exposed polysaccharides and their enzymatic conversion using carbohydrate-binding modules.

PubMed

Khatri, Vinay; Meddeb-Mouelhi, Fatma; Adjallé, Kokou; Barnabé, Simon; Beauregard, Marc

2018-01-01

Pretreatment of lignocellulosic biomass (LCB) is a key step for its efficient bioconversion into ethanol. Determining the best pretreatment and its parameters requires monitoring its impacts on the biomass material. Here, we used fluorescent protein-tagged carbohydrate-binding modules method (FTCM)-depletion assay to study the relationship between surface-exposed polysaccharides and enzymatic hydrolysis of LCB. Our results indicated that alkali extrusion pretreatment led to the highest hydrolysis rates for alfalfa stover, cattail stems and flax shives, despite its lower lignin removal efficiency compared to alkali pretreatment. Corn crop residues were more sensitive to alkali pretreatments, leading to higher hydrolysis rates. A clear relationship was consistently observed between total surface-exposed cellulose detected by the FTCM-depletion assay and biomass enzymatic hydrolysis. Comparison of bioconversion yield and total composition analysis (by NREL/TP-510-42618) of LCB prior to or after pretreatments did not show any close relationship. Lignin removal efficiency and total cellulose content (by NREL/TP-510-42618) led to an unreliable prediction of enzymatic polysaccharide hydrolysis. Fluorescent protein-tagged carbohydrate-binding modules method (FTCM)-depletion assay provided direct evidence that cellulose exposure is the key determinant of hydrolysis yield. The clear and robust relationships that were observed between the cellulose accessibility by FTCM probes and enzymatic hydrolysis rates change could be evolved into a powerful prediction tool that might help develop optimal biomass pretreatment strategies for biofuel production.

Distinct T cell interactions with HLA class II tetramers characterize a spectrum of TCR affinities in the human antigen-specific T cell response.

PubMed

Reichstetter, S; Ettinger, R A; Liu, A W; Gebe, J A; Nepom, G T; Kwok, W W

2000-12-15

The polyclonal nature of T cells expanding in an ongoing immune response results in a range of disparate affinities and activation potential. Recently developed human class II tetramers provide a means to analyze this diversity by direct characterization of the trimolecular TCR-peptide-MHC interaction in live cells. Two HSV-2 VP16(369-379)-specific, DQA1*0102/DQB1*0602 (DQ0602)-restricted T cell clones were compared by means of T cell proliferation assay and HLA-DQ0602 tetramer staining. These two clones were obtained from the same subject, but show different TCR gene usage. Clone 48 was 10-fold more sensitive to VP16(369-379) peptide stimulation than clone 5 as assayed by proliferation assays, correlating with differences in MHC tetramer binding. Clone 48 gave positive staining with the DQ0602/VP16(369-379) tetramer at either 23 or 37 degrees C. Weak staining was also observed at 4 degrees C. Clone 5 showed weaker staining compared with clone 48 at 37 degrees C, and no staining was observed at 23 degrees C or on ice. Receptor internalization was not required for positive staining. Competitive binding indicates that the cell surface TCR of clone 48 has higher affinity for the DQ0602/VP16(369-379) complex than clone 5. The higher binding affinity of clone 48 for the peptide-MHC complex also correlates with a slower dissociation rate compared with clone 5.

VEGFR2 Translocates to the Nucleus to Regulate Its Own Transcription

PubMed Central

Domingues, Inês; Rino, José; Demmers, Jeroen A. A.; de Lanerolle, Primal; Santos, Susana Constantino Rosa

2011-01-01

Vascular Endothelial Growth Factor Receptor-2 (VEGFR2) is the major mediator of the angiogenic effects of VEGF. In addition to its well known role as a membrane receptor that activates multiple signaling pathways, VEGFR2 also has a nuclear localization. However, what VEGFR2 does in the nucleus is still unknown. In the present report we show that, in endothelial cells, nuclear VEGFR2 interacts with several nuclear proteins, including the Sp1, a transcription factor that has been implicated in the regulation of genes needed for angiogenesis. By in vivo chromatin immunoprecipitation (ChIP) assays, we found that VEGFR2 binds to the Sp1-responsive region of the VEGFR2 proximal promoter. These results were confirmed by EMSA assays, using the same region of the VEGFR2 promoter. Importantly, we show that the VEGFR2 DNA binding is directly linked to the transcriptional activation of the VEGFR2 promoter. By reporter assays, we found that the region between -300/-116 relative to the transcription start site is essential to confer VEGFR2-dependent transcriptional activity. It was previously described that nuclear translocation of the VEGFR2 is dependent on its activation by VEGF. In agreement, we observed that the binding of VEGFR2 to DNA requires VEGF activation, being blocked by Bevacizumab and Sunitinib, two anti-angiogenic agents that inhibit VEGFR2 activation. Our findings demonstrate a new mechanism by which VEGFR2 activates its own promoter that could be involved in amplifying the angiogenic response. PMID:21980525

Persistent Graves' hyperthyroidism despite rapid negative conversion of thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results: a case report.

PubMed

Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi

2017-02-06

Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.

An apple NAC transcription factor negatively regulates cold tolerance via CBF-dependent pathway.

PubMed

An, Jian-Ping; Li, Rui; Qu, Feng-Jia; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin

2018-02-01

Cold stress is an adverse stimulus that affects plant growth and development, and the C-repeat binding factor (CBF) cold-regulatory cascade has been regarded as a master regulator in the plant response to cold stress. Here, we showed that a NAC transcription factor modulated low-temperature tolerance. MdNAC029/MdNAP, an apple NAC gene was isolated and its role in regulating cold tolerance was investigated. MdNAC029 was responsive to low-temperature treatment, and over-expression of MdNAC029 reduced cold tolerance in apple calli and Arabidopsis. Furthermore, EMSA assays and transient expression assays demonstrated that MdNAC029 directly repressed the expression of MdCBF1 and MdCBF4 by binding to their promoters. Taken together, our data suggest that MdNAC029 functions as a negative regulator in regulating plant cold tolerance in a CBF-dependent manner, providing a deeper understanding of NAC transcription-factor-mediated cold tolerance. Copyright © 2017 Elsevier GmbH. All rights reserved.

A magnetic bead-based ligand binding assay to facilitate human kynurenine 3-monooxygenase drug discovery.

PubMed

Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P

2015-02-01

Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Measuring Norfloxacin Binding to Trypsin Using a Fluorescence Quenching Assay in an Upper-Division, Integrated Laboratory Course

ERIC Educational Resources Information Center

Hicks, Katherine A.

2016-01-01

Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…

Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

ERIC Educational Resources Information Center

Mascotti, David P.; Waner, Mark J.

2010-01-01

A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

EPA Science Inventory

Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

Directional control of WAVE2 membrane targeting by EB1 and phosphatidylinositol 3,4,5-triphosphate.

PubMed

Takahashi, Kazuhide; Tanaka, Tacu; Suzuki, Katsuo

2010-03-01

Membrane targeting of WAVE2 along microtubules is mediated by a motor protein kinesin and requires Pak1, a downstream effector of Rac1. However, the mechanism by which WAVE2 targeting to the leading edge is directionally controlled remains largely unknown. Here we demonstrate that EB1, a microtubule plus-end-binding protein, constitutively associates with stathmin, a microtubule-destabilizing protein, in human breast cancer cells. Stimulation of the cells with insulin-like growth factor I (IGF-I) induced Pak1-dependent binding of the EB1-stathmin complex to microtubules that bear WAVE2 and colocalization of the complex with WAVE2 at the leading edge. Depletion of EB1 by small interfering RNA (siRNA) abrogated the IGF-I-induced WAVE2 targeting and stathmin binding to microtubules. On the other hand, chemotaxis chamber assays indicated that the IGF-I receptor (IGF-IR) was locally activated in the region facing toward IGF-I. In addition, IGF-I caused phosphatidylinositol 3-kinase (PI 3-kinase)-dependent production of phosphatidylinositol 3,4,5-triphosphate (PIP3) near activated IGF-IR and WAVE2 colocalization with it. Collectively, WAVE2-membrane targeting is directionally controlled by binding of the EB1-stathmin complex to WAVE2-bearing microtubules and by the interaction between WAVE2 and PIP3 produced near IGF-IR that is locally activated by IGF-I.

Direct binding to antigen-coated beads refines the specificity and cross-reactivity of four monoclonal antibodies that recognize polymorphic epitopes of HLA class I molecules

PubMed Central

Hilton, Hugo G; Parham, Peter

2013-01-01

Monoclonal antibodies with specificity for HLA class I determinants of HLA were originally characterized using serological assays in which the targets were cells expressing 3-6 HLA class I variants. Because of this complexity, the specificities of the antibodies were defined indirectly by correlation. Here we use a direct binding assay, in which the targets are synthetic beads coated with one of 111 HLA class I variants, representing the full range of HLA-A, -B and -C variation. We studied one monoclonal antibody with monomorphic specificity (W6/32) and four with polymorphic specificity (MA2.1, PA2.1, BB7.2 and BB7.1) and compared the results with those obtained previously. W6/32 reacted with all HLA class I variants. MA2.1 exhibits high specificity for HLA-A*02, -B*57 and -B*58, but also exhibited cross-reactivity with HLA-A*11 and -B*15:16. At low concentration (1μg/ml) PA2.1 and BB7.2 were both specific for HLA-A*02 and -A*69, and at high concentration (50μg/ml) exhibited significant cross-reactions with HLA-A*68, -A*23, and -A*24. BB7.1 exhibits specificity for HLA-B*07 and -B*42, as previously described, but reacts equally well with HLA-B*81, a rare allotype defined some 16 years after the description of BB7.1. The results obtained with cell-based and bead-based assays are consistent and, in combination with amino acid sequence comparison, increase understanding of the polymorphic epitopes recognized by the MA2.1, PA2.1, BB7.2 and BB7.1 antibodies. Comparison of two overlapping but distinctive bead sets from two sources gave similar results, but the overall levels of binding were significantly different. Several weaker reactions were observed with only one of the bead sets. PMID:23510417

CCAAT/enhancer-binding protein β regulates the repression of type II collagen expression during the differentiation from proliferative to hypertrophic chondrocytes.

PubMed

Ushijima, Takahiro; Okazaki, Ken; Tsushima, Hidetoshi; Iwamoto, Yukihide

2014-01-31

CCAAT/enhancer-binding protein β (C/EBPβ) is a transcription factor that promotes hypertrophic differentiation by stimulating type X collagen and matrix metalloproteinase 13 during chondrocyte differentiation. However, the effect of C/EBPβ on proliferative chondrocytes is unclear. Here, we investigated whether C/EBPβ represses type II collagen (COL2A1) expression and is involved in the regulation of sex-determining region Y-type high mobility group box 9 (SOX9), a crucial factor for transactivation of Col2a1. Endogenous expression of C/EBPβ in the embryonic growth plate and differentiated ATDC5 cells were opposite to those of COL2A1 and SOX9. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked repression of Col2a1. The expression of Sox9 mRNA and nuclear protein was also repressed, resulting in decreased binding of SOX9 to the Col2a1 enhancer as shown by a ChIP assay. Knockdown of C/EBPβ by lentivirus expressing shRNA caused significant stimulation of these genes in ATDC5 cells. Reporter assays demonstrated that C/EBPβ repressed transcriptional activity of Col2a1. Deletion and mutation analysis showed that the C/EBPβ core responsive element was located between +2144 and +2152 bp within the Col2a1 enhancer. EMSA and ChIP assays also revealed that C/EBPβ directly bound to this region. Ex vivo organ cultures of mouse limbs transfected with C/EBPβ showed that the expression of COL2A1 and SOX9 was reduced upon ectopic C/EBPβ expression. Together, these results indicated that C/EBPβ represses the transcriptional activity of Col2a1 both directly and indirectly through modulation of Sox9 expression. This consequently promotes the phenotypic conversion from proliferative to hypertrophic chondrocytes during chondrocyte differentiation.

Ombuin-3-O-β-D-glucopyranoside from Gynostemma pentaphyllum is a dual agonistic ligand of peroxisome proliferator-activated receptors α and δ/β

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malek, Mastura Abd; Hoang, Minh-Hien; Jia, Yaoyao

Highlights: ► Ombuin-3-O-β-D-glucopyranoside is a dual ligand for PPARα and δ/β. ► Ombuin-3-O-β-D-glucopyranoside reduces cellular lipid levels in multiple cell types. ► Cells stimulated with ombuine up-regulated target genes in cholesterol efflux. ► Cells stimulated with ombuine regulated target fatty acid β-oxidation and synthesis. ► Ombuin-3-O-β-D-glucopyranoside could ameliorate hyperlipidemia and hepatic steatosis. -- Abstract: We demonstrated that ombuin-3-O-β-D-glucopyranoside (ombuine), a flavonoid from Gynostemma pentaphyllum, is a dual agonist for peroxisome proliferator-activated receptors (PPARs) α and δ/β. Using surface plasmon resonance (SPR), time-resolved fluorescence resonance energy transfer (FRET) analyses, and reporter gene assays, we showed that ombuine bound directly to PPARαmore » and δ/β but not to PPARγ or liver X receptors (LXRs). Cultured HepG2 hepatocytes stimulated with ombuine significantly reduced intracellular concentrations of triglyceride and cholesterol and downregulated the expression of lipogenic genes, including sterol regulatory element binding protein-1c (SREBP1c) and stearoyl-CoA desaturase-1 (SCD-1), with activation of PPARα and δ/β. Activation of LXRs by ombuine was confirmed by reporter gene assays, however, SPR and cell-based FRET assays showed no direct binding of ombuine to either of the LXRs suggesting LXR activation by ombuine may be operated via PPARα stimulation. Ombuine-stimulated macrophages showed significantly induced transcription of ATP binding cassette cholesterol transporter A1 (ABCA1) and G1 (ABCG1), the key genes in reverse cholesterol transport, which led to reduced cellular cholesterol concentrations. These results suggest that ombuine is a dual PPAR ligand for PPARα and δ/β with the ability to decrease lipid concentrations by reducing lipogenic gene expression in hepatocytes and inducing genes involved in cholesterol efflux in macrophages.« less

Design, Synthesis, and Evaluation of Dihydrobenzo[cd]indole-6-sulfonamide as TNF-α Inhibitors.

PubMed

Deng, Xiaobing; Zhang, Xiaoling; Tang, Bo; Liu, Hongbo; Shen, Qi; Liu, Ying; Lai, Luhua

2018-01-01

Tumor necrosis factor-α (TNF-α) plays a pivotal role in inflammatory response. Dysregulation of TNF can lead to a variety of disastrous pathological effects, including auto-inflammatory diseases. Antibodies that directly targeting TNF-α have been proven effective in suppressing symptoms of these disorders. Compared to protein drugs, small molecule drugs are normally orally available and less expensive. Till now, peptide and small molecule TNF-α inhibitors are still in the early stage of development, and much more efforts should be made. In a previously study, we reported a TNF-α inhibitor, EJMC-1 with modest activity. Here, we optimized this compound by shape screen and rational design. In the first round, we screened commercial compound library for EJMC-1 analogs based on shape similarity. Out of the 68 compounds tested, 20 compounds showed better binding affinity than EJMC-1 in the SPR competitive binding assay. These 20 compounds were tested in cell assay and the most potent compound was 2-oxo-N-phenyl-1,2-dihydrobenzo[ cd ]indole-6-sulfonamide ( S10 ) with an IC 50 of 14 μM, which was 2.2-fold stronger than EJMC-1 . Based on the docking analysis of S10 and EJMC-1 binding with TNF-α, in the second round, we designed S10 analogs, purchased seven of them, and synthesized seven new compounds. The best compound, 4e showed an IC 50 -value of 3 μM in cell assay, which was 14-fold stronger than EJMC-1 . 4e was among the most potent TNF-α organic compound inhibitors reported so far. Our study demonstrated that 2-oxo-N-phenyl-1,2-dihydrobenzo[ cd ]indole-6-sulfonamide analogs could be developed as potent TNF-α inhibitors. 4e can be further optimized for its activity and properties. Our study provides insights into designing small molecule inhibitors directly targeting TNF-α and for protein-protein interaction inhibitor design.

Design, Synthesis, and Evaluation of Dihydrobenzo[cd]indole-6-sulfonamide as TNF-alpha Inhibitors

NASA Astrophysics Data System (ADS)

Deng, Xiaobing; Zhang, Xiaoling; Tang, Bo; Liu, Hongbo; Shen, Qi; Liu, Ying; Lai, Luhua

2018-04-01

Tumor necrosis factor-α (TNF-α) plays a pivotal role in inflammatory response. Dysregulation of TNF can lead to a variety of disastrous pathological effects, including auto-inflammatory diseases. Antibodies that directly targeting TNF-α have been proven effective in suppressing symptoms of these disorders. Compared to protein drugs, small molecule drugs are normally orally available and less expensive. Till now, peptide and small molecule TNF-α inhibitors are still in the early stage of development, and much more efforts should be made. In a previously study, we reported a TNF-α inhibitor, EJMC-1 with modest activity. Here, we optimized this compound by shape screen and rational design. In the first round, we screened commercial compound library for EJMC-1 analogs based on shape similarity. Out of the 68 compounds tested, 20 compounds showed better binding affinity than EJMC-1 in the SPR competitive binding assay. These 20 compounds were tested in cell assay and the most potent compound was 2-oxo-N-phenyl-1,2-dihydrobenzo[cd]indole-6-sulfonamide (S10) with an IC50 of 14 M, which was 2.2-fold stronger than EJMC-1. Based on the docking analysis of S10 and EJMC-1 binding with TNF-α, in the second round, we designed S10 analogues, purchased 7 of them and synthesized 7 new compounds. The best compound, 4e showed an IC50 value of 3 M in cell assay, which was 14-fold stronger than EJMC-1. 4e was among the most potent TNF-α organic compound inhibitors reported so far. Our study demonstrated that 2-oxo-N-phenyl-1,2-dihydrobenzo[cd]indole-6-sulfonamide analogues could be developed as potent TNF-α inhibitors. 4e can be further optimized for its activity and properties. Our study provides insights into designing small molecule inhibitors directly targeting TNF-α and for protein-protein interaction inhibitor design.

Undercarboxylated osteocalcin measured with a specific immunoassay predicts hip fracture in elderly women: the EPIDOS Study.

PubMed

Vergnaud, P; Garnero, P; Meunier, P J; Bréart, G; Kamihagi, K; Delmas, P D

1997-03-01

Increased levels of circulating undercarboxylated osteocalcin (ucOC), measured indirectly with the hydroxyapatite (HAP) binding assay, have been shown to predict hip fracture risk in a small group of elderly institutionalized women. The aim of this study was to confirm these findings in a prospective cohort study (EPIDOS prospective study) of 7598 healthy, independently living women over 75 yr of age. One hundred and four women who sustained a hip fracture during a 22-month follow-up period were age matched with 255 controls who did not fracture. Baseline samples were collected before hip fracture for measurement of total OC and ucOC, assessed either with the HAP binding assay or directly with a new enzyme-linked immunosorbent assay (ELISA). This direct ELISA uses human recombinant noncarboxylated OC as a standard and two monoclonal antibodies, one of which was raised against the 14-30 Glu synthetic peptide. We found that the intra- and interassay variations are less than 11%, and this assay exhibits a 5% cross-reactivity with purified human bone OC, used as a source of carboxylated OC. ucOC levels measured with this ELISA correlated well with the HAP binding assay in the population of 359 elderly women (r = 0.82; P < 0.0001). We estimated the risk of hip fracture for women with levels of ucOC in the highest quartile of values for the 255 controls. We found that increased levels of ucOC measured by ELISA were associated with increased hip fracture risk with an odds ratio (OR) of 1.9 (95% confidence interval, 1.2-3.0), and the ELISA had a greater sensitivity than the HAP assay. In contrast, total OC was not associated with hip fracture risk. After adjustment for femoral neck bone mineral density (BMD) and mobility status assessed by gait speed, ucOC still predicted hip fracture with an OR of 1.8 (1.0-3.0). Women with both femoral neck BMD in the lowest quartile and ucOC in the highest quartile were at higher risk of hip fracture, with an OR of 5.5 (2.7-11.2), than those with only low BMD or high ucOC levels. In conclusion, we have developed a new specific ELISA for serum ucOC, with low cross-reactivity with carboxylated OC and increased specificity and sensitivity over the HAP assay. Using this new ELISA, we found that ucOC, but not total OC, predicts hip fracture risk independently of femoral neck BMD in elderly women drawn from the general population. Thus, ucOC measurement could be combined with bone mass determination to improve the assessment of hip fracture risk in elderly women.

Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

PubMed Central

Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

2014-01-01

Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

Lipid A binding sites in membranes of macrophage tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.

1988-10-15

Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less

Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

PubMed Central

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

PubMed

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

PubMed

Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

Reliable Determinations of Protein-Ligand Interactions by Direct ESI-MS Measurements. Are We There Yet?

NASA Astrophysics Data System (ADS)

Kitova, Elena N.; El-Hawiet, Amr; Schnier, Paul D.; Klassen, John S.

2012-03-01

The association-dissociation of noncovalent interactions between protein and ligands, such as other proteins, carbohydrates, lipids, DNA, or small molecules, are critical events in many biological processes. The discovery and characterization of these interactions is essential to a complete understanding of biochemical reactions and pathways and to the design of novel therapeutic agents that may be used to treat a variety of diseases and infections. Over the last 20 y, electrospray ionization mass spectrometry (ESI-MS) has emerged as a versatile tool for the identification and quantification of protein-ligand interactions in vitro. Here, we describe the implementation of the direct ESI-MS assay for the determination of protein-ligand binding stoichiometry and affinity. Additionally, we outline common sources of error encountered with these measurements and various strategies to overcome them. Finally, we comment on some of the outstanding challenges associated with the implementation of the assay and highlight new areas where direct ESI-MS measurements are expected to make significant contributions in the future.

Unravelling the specificity and mechanism of sialic acid recognition by the gut symbiont Ruminococcus gnavus.

PubMed

Owen, C David; Tailford, Louise E; Monaco, Serena; Šuligoj, Tanja; Vaux, Laura; Lallement, Romane; Khedri, Zahra; Yu, Hai; Lecointe, Karine; Walshaw, John; Tribolo, Sandra; Horrex, Marc; Bell, Andrew; Chen, Xi; Taylor, Gary L; Varki, Ajit; Angulo, Jesus; Juge, Nathalie

2017-12-19

Ruminococcus gnavus is a human gut symbiont wherein the ability to degrade mucins is mediated by an intramolecular trans-sialidase (RgNanH). RgNanH comprises a GH33 catalytic domain and a sialic acid-binding carbohydrate-binding module (CBM40). Here we used glycan arrays, STD NMR, X-ray crystallography, mutagenesis and binding assays to determine the structure and function of RgNanH_CBM40 (RgCBM40). RgCBM40 displays the canonical CBM40 β-sandwich fold and broad specificity towards sialoglycans with millimolar binding affinity towards α2,3- or α2,6-sialyllactose. RgCBM40 binds to mucus produced by goblet cells and to purified mucins, providing direct evidence for a CBM40 as a novel bacterial mucus adhesin. Bioinformatics data show that RgCBM40 canonical type domains are widespread among Firmicutes. Furthermore, binding of R. gnavus ATCC 29149 to intestinal mucus is sialic acid mediated. Together, this study reveals novel features of CBMs which may contribute to the biogeography of symbiotic bacteria in the gut.

Development and validation of an LC-ESI-MS/MS method for the quantification of D-84, reboxetine and citalopram for their use in MS Binding Assays addressing the monoamine transporters hDAT, hSERT and hNET.

PubMed

Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T

2018-03-03

MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.

Characterization of binding preference of polyhydroxyalkanoate biosynthesis-related multifunctional protein PhaM from Ralstonia eutropha.

PubMed

Ushimaru, Kazunori; Tsuge, Takeharu

2016-05-01

The binding preference of a polyhydroxyalkanoate (PHA) biosynthesis-related multifunctional protein from Ralstonia eutropha (PhaMRe) was characterized. In vitro activity assay showed that PHA synthase from R. eutropha (PhaCRe) was activated by the presence of PhaMRe but PHA synthase from Aeromonas caviae (PhaCAc) was not. Additionally, in vitro assays of protein-protein interactions demonstrated that PhaMRe interacted with PhaCRe directly, but did not interact with PhaCAc. These results suggest that the protein-protein interaction is important for the activation of PhaC by PhaMRe. Further analyses indicated that PhaMRe has little or no direct interaction with the PHA polymer chain. Subsequently, PHA biosynthesis genes (phaA Re, phaB Re, and phaC Re/phaC Ac) and the phaM Re gene were introduced into recombinant Escherichia coli and cultivated for PHA accumulation. Contrary to our expectations, the expression of PhaMRe decreased PHA accumulation and changed the morphology of PHA granules to be microscopically obscure shape in PhaCRe-expressing E. coli. No change in the amount of P(3HB) or the morphology of granules by PhaMRe expression was observed in PhaCAc-expressing E. coli. These observations suggest that PhaMRe affects cellular physiology through the PhaM-PhaC interaction.

Wnt/β-catenin signaling stimulates the expression and synaptic clustering of the autism-associated Neuroligin 3 gene.

PubMed

Medina, Matías A; Andrade, Víctor M; Caracci, Mario O; Avila, Miguel E; Verdugo, Daniela A; Vargas, Macarena F; Ugarte, Giorgia D; Reyes, Ariel E; Opazo, Carlos; De Ferrari, Giancarlo V

2018-03-05

Synaptic abnormalities have been described in individuals with autism spectrum disorders (ASD). The cell-adhesion molecule Neuroligin-3 (Nlgn3) has an essential role in the function and maturation of synapses and NLGN3 ASD-associated mutations disrupt hippocampal and cortical function. Here we show that Wnt/β-catenin signaling increases Nlgn3 mRNA and protein levels in HT22 mouse hippocampal cells and primary cultures of rat hippocampal neurons. We characterized the activity of mouse and rat Nlgn3 promoter constructs containing conserved putative T-cell factor/lymphoid enhancing factor (TCF/LEF)-binding elements (TBE) and found that their activity is significantly augmented in Wnt/β-catenin cell reporter assays. Chromatin immunoprecipitation (ChIP) assays and site-directed mutagenesis experiments revealed that endogenous β-catenin binds to novel TBE consensus sequences in the Nlgn3 promoter. Moreover, activation of the signaling cascade increased Nlgn3 clustering and co- localization with the scaffold PSD-95 protein in dendritic processes of primary neurons. Our results directly link Wnt/β-catenin signaling to the transcription of the Nlgn3 gene and support a functional role for the signaling pathway in the dysregulation of excitatory/inhibitory neuronal activity, as is observed in animal models of ASD.

Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

PubMed

Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

2018-05-15

The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is controlled by the Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator PimR, which binds a series of heptameric direct repeats in its promoter region. The structure and importance of such repeats in protein binding, transcriptional activation, and polyene production have been investigated. These findings should provide important clues to understand the regulatory machinery that modulates antibiotic biosynthesis in Streptomyces and open new possibilities for the manipulation of metabolite production. The presence of PimR orthologues encoded by gene clusters for different secondary metabolites and the conservation of their operators suggest that the improvements observed in the activation of pimaricin biosynthesis by Streptomyces natalensis could be extrapolated to the production of different compounds by other species. Copyright © 2018 Barreales et al.

S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

PubMed Central

Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

2007-01-01

The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

PubMed

Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

1994-01-01

The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

PubMed

Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

2015-03-07

A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

PubMed Central

Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

2009-01-01

The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

PubMed

Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

2013-03-01

Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

ApoHRP-based assay to measure intracellular regulatory heme.

PubMed

Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

2015-02-01

The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

Mathematical simulations for bioanalytical assay development: the (un-)necessity and (im-)possibility of free drug quantification.

PubMed

Staack, Roland F; Jordan, Gregor; Heinrich, Julia

2012-02-01

For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.

Fatty acids and hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha - and gamma-mediated gene expression via liver fatty acid binding protein: a signaling path to the nucleus.

PubMed

Wolfrum, C; Borrmann, C M; Borchers, T; Spener, F

2001-02-27

Peroxisome proliferator-activated receptor alpha (PPARalpha) is a key regulator of lipid homeostasis in hepatocytes and target for fatty acids and hypolipidemic drugs. How these signaling molecules reach the nuclear receptor is not known; however, similarities in ligand specificity suggest the liver fatty acid binding protein (L-FABP) as a possible candidate. In localization studies using laser-scanning microscopy, we show that L-FABP and PPARalpha colocalize in the nucleus of mouse primary hepatocytes. Furthermore, we demonstrate by pull-down assay and immunocoprecipitation that L-FABP interacts directly with PPARalpha. In a cell biological approach with the aid of a mammalian two-hybrid system, we provide evidence that L-FABP interacts with PPARalpha and PPARgamma but not with PPARbeta and retinoid X receptor-alpha by protein-protein contacts. In addition, we demonstrate that the observed interaction of both proteins is independent of ligand binding. Final and quantitative proof for L-FABP mediation was obtained in transactivation assays upon incubation of transiently and stably transfected HepG2 cells with saturated, monounsaturated, and polyunsaturated fatty acids as well as with hypolipidemic drugs. With all ligands applied, we observed strict correlation of PPARalpha and PPARgamma transactivation with intracellular concentrations of L-FABP. This correlation constitutes a nucleus-directed signaling by fatty acids and hypolipidemic drugs where L-FABP acts as a cytosolic gateway for these PPARalpha and PPARgamma agonists. Thus, L-FABP and the respective PPARs could serve as targets for nutrients and drugs to affect expression of PPAR-sensitive genes.

Hypotonic activation of short ClC3 isoform is modulated by direct interaction between its cytosolic C-terminal tail and subcortical actin filaments.

PubMed

McCloskey, Diana T; Doherty, Lynda; Dai, Yan-Ping; Miller, Lisa; Hume, Joseph R; Yamboliev, Ilia A

2007-06-08

Short ClC3 isoform (sClC3) functions as a volume-sensitive outwardly rectifying anion channel (VSOAC) in some cell types. In previous studies, we have shown that the hypotonic activation of sClC3 is linked to cell swelling-mediated remodeling of the actin cytoskeleton. In the present study, we have tested the hypothesis that the cytosolic tails of sClC3 bind to actin directly and that binding modulates the hypotonic activation of the channel. Co-sedimentation assays in vitro demonstrated a strong binding between the glutathione S-transferase-fused cytosolic C terminus of sClC3 (GST-sClC3-CT) to filamentous actin (F-actin) but not to globular monomeric actin (G-actin). The GST-fused N terminus (GST-sClC3-NT) exhibited low binding affinity to both G- and F-actin. Co-sedimentation experiments with progressively truncated GST-sClC3-CT indicated that the F-actin binding region is located between amino acids 690 and 760 of sClC3. Two synthetic peptides mapping basic clusters of the cytosolic sClC3-CT (CTP2, isoleucine 716 to leucine 734; and CTP3, proline 688 to proline 709) prevented binding of GST-sClC3-CT to F-actin in vitro. Dialysis into NIH/3T3 cells of these two peptides (but not of synthetic peptide CTP1 (isoleucine 737 to glutamine 748)) reduced the maximal current density by 60 and 38%, respectively. Based on these results, we have concluded that, by direct interaction with subcortical actin filaments, sClC3 contributes to the hypotonic stress-induced VSOACs in NIH/3T3 cells.

Plasmodium vivax Invasion of Human Erythrocytes Inhibited by Antibodies Directed against the Duffy Binding Protein

PubMed Central

Grimberg, Brian T; Udomsangpetch, Rachanee; Xainli, Jia; McHenry, Amy; Panichakul, Tasanee; Sattabongkot, Jetsumon; Cui, Liwang; Bockarie, Moses; Chitnis, Chetan; Adams, John; Zimmerman, Peter A; King, Christopher L

2007-01-01

Background Plasmodium vivax invasion requires interaction between the human Duffy antigen on the surface of erythrocytes and the P. vivax Duffy binding protein (PvDBP) expressed by the parasite. Given that Duffy-negative individuals are resistant and that Duffy-negative heterozygotes show reduced susceptibility to blood-stage infection, we hypothesized that antibodies directed against region two of P. vivax Duffy binding protein (PvDBPII) would inhibit P. vivax invasion of human erythrocytes. Methods and Findings Using a recombinant region two of the P. vivax Duffy binding protein (rPvDBPII), polyclonal antibodies were generated from immunized rabbits and affinity purified from the pooled sera of 14 P. vivax–exposed Papua New Guineans. It was determined by ELISA and by flow cytometry, respectively, that both rabbit and human antibodies inhibited binding of rPvDBPII to the Duffy antigen N-terminal region and to Duffy-positive human erythrocytes. Additionally, using immunofluorescent microscopy, the antibodies were shown to attach to native PvDBP on the apical end of the P. vivax merozoite. In vitro invasion assays, using blood isolates from individuals in the Mae Sot district of Thailand, showed that addition of rabbit anti-PvDBPII Ab or serum (antibodies against, or serum containing antibodies against, region two of the Plasmodium vivax Duffy binding protein) (1:100) reduced the number of parasite invasions by up to 64%, while pooled PvDBPII antisera from P. vivax–exposed people reduced P. vivax invasion by up to 54%. Conclusions These results show, for what we believe to be the first time, that both rabbit and human antibodies directed against PvDBPII reduce invasion efficiency of wild P. vivax isolated from infected patients, and suggest that a PvDBP-based vaccine may reduce human blood-stage P. vivax infection. PMID:18092885

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

Calcium Sensing by Recoverin: Effect of Protein Conformation on Ion Affinity.

PubMed

Timr, Štěpán; Kadlec, Jan; Srb, Pavel; Ollila, O H Samuli; Jungwirth, Pavel

2018-04-05

The detailed functional mechanism of recoverin, which acts as a myristoyl switch at the rod outer-segment disk membrane, is elucidated by direct and replica-exchange molecular dynamics. In accord with NMR structural evidence and calcium binding assays, simulations point to the key role of enhanced calcium binding to the EF3 loop of the semiopen state of recoverin as compared to the closed state. This 2-4-order decrease in calcium dissociation constant stabilizes the semiopen state in response to the increase of cytosolic calcium concentration in the vicinity of recoverin. A second calcium ion then binds to the EF2 loop and, consequently, the structure of the protein changes from the semiopen to the open state. The latter has the myristoyl chain extruded to the cytosol, ready to act as a membrane anchor of recoverin.

Toxin activity assays, devices, methods and systems therefor

DOEpatents

Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

2016-04-05

Embodiments of the present invention are directed toward devices, system and method for conducting toxin activity assay using sedimentation. The toxin activity assay may include generating complexes which bind to a plurality of beads in a fluid sample. The complexes may include a target toxin and a labeling agent, or may be generated due to presence of active target toxin and/or labeling agent designed to be incorporated into complexes responsive to the presence of target active toxin. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a lower density than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.

Devices, systems, and methods for conducting assays with improved sensitivity using sedimentation

DOEpatents

Schaff, Ulrich Y.; Koh, Chung-Yan; Sommer, Gregory J.

2016-04-05

Embodiments of the present invention are directed toward devices, systems, and method for conducting assays using sedimentation. In one example, a method includes layering a mixture on a density medium, subjecting sedimentation particles in the mixture to sedimentation forces to cause the sedimentation particles to move to a detection area through a density medium, and detecting a target analyte in a detection region of the sedimentation channel. In some examples, the sedimentation particles and labeling agent may have like charges to reduce non-specific binding of labeling agent and sedimentation particles. In some examples, the density medium is provided with a separation layer for stabilizing the assay during storage and operation. In some examples, the sedimentation channel may be provided with a generally flat sedimentation chamber for dispersing the particle pellet over a larger surface area.

Devices, systems, and methods for conducting assays with improved sensitivity using sedimentation

DOEpatents

Schaff, Ulrich Y; Koh, Chung-Yan; Sommer, Gregory J

2015-02-24

Embodiments of the present invention are directed toward devices, systems, and method for conducting assays using sedimentation. In one example, a method includes layering a mixture on a density medium, subjecting sedimentation particles in the mixture to sedimentation forces to cause the sedimentation particles to move to a detection area through a density medium, and detecting a target analyte in a detection region of the sedimentation channel. In some examples, the sedimentation particles and labeling agent may have like charges to reduce non-specific binding of labeling agent and sedimentation particles. In some examples, the density medium is provided with a separation layer for stabilizing the assay during storage and operation. In some examples, the sedimentation channel may be provided with a generally flat sedimentation chamber for dispersing the particle pellet over a larger surface area.

Key amino acid residues involved in multi-point binding interactions between brazzein, a sweet protein, and the T1R2-T1R3 human sweet receptor

PubMed Central

Assadi-Porter, Fariba M.; Maillet, Emeline L.; Radek, James T.; Quijada, Jeniffer; Markley, John L.; Max, Marianna

2010-01-01

The sweet protein brazzein activates the human sweet receptor, a heterodimeric G-protein coupled receptor (GPCR) composed of subunits T1R2 and T1R3. In order to elucidate the key amino acid(s) responsible for this interaction, we mutated residues in brazzein and each of the two subunits of the receptor. The effects of brazzein mutations were assayed by a human taste panel and by an in vitro assay involving receptor subunits expressed recombinantly in human embryonic kidney cells; the effects of the receptor mutations were assayed by the in vitro assay. We mutated surface residues of brazzein at three putative interaction sites: Site 1 (Loop43), Site 2 (N- and C-terminus and adjacent Glu36, Loop33), and Site 3 (Loop9–19). Basic residues in Site 1 and acidic residues in Site 2 were essential for positive responses from each assay. Mutation of Y39A (Site 1) greatly reduced positive responses. A bulky side chain at position 54 (Site 2), rather than a side chain with hydrogen bonding potential, was required for positive responses as was the presence of the native disulfide bond in Loop 9–19 (Site 3). Results from mutagenesis and chimeras of the receptor indicated that brazzein interacts with both T1R2 and T1R3 and that the Venus fly trap module of T1R2 is important for brazzein agonism. With one exception, all mutations of receptor residues at putative interaction sites predicted by wedge models failed to yield the expected decrease in the brazzein response. The exception, hT1R2:R217A-hT1R3, which contained a substitution in lobe 2 at the interface between the two subunits, exhibited a small selective decrease in brazzein activity. However, because the mutation was found to increase the positive cooperativity of binding by multiple ligands proposed to bind both T1R subunits (brazzein, monellin, and sucralose) but not those that bind to a single subunit (neotame and cyclamate), we suggest that this site in involved in subunit-subunit interaction rather than direct brazzein binding. Results from this study support a multipoint interaction between brazzein and the sweet receptor by some mechanism other than the proposed wedge models. PMID:20302879

Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

PubMed

Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

PubMed

Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.

Rotenone Activates Phagocyte NADPH Oxidase through Binding to Its Membrane Subunit gp91phox

PubMed Central

Zhou, Hui; Zhang, Feng; Chen, Shih-heng; Zhang, Dan; Wilson, Belinda; Hong, Jau-shyong; Gao, Hui-Ming

2011-01-01

Rotenone, a widely used pesticide, reproduces Parkinsonism in rodents and associates with increased risk for Parkinson’s disease. We previously reported rotenone increased superoxide production through stimulating microglial phagocyte NADPH oxidase (PHOX). The present study identified a novel mechanism by which rotenone activates PHOX. Ligand-binding assay revealed that rotenone directly bound to membrane gp91phox, the catalytic subunit of PHOX; such binding was inhibited by diphenyleneiodonium, a PHOX inhibitor with a binding site on gp91phox. Functional studies showed both membrane and cytosolic subunits were required for rotenone-induced superoxide production in cell-free systems, intact phagocytes, and COS7 cells transfected with membrane subunits (gp91phox/p22phox) and cytosolic subunits (p67phox and p47phox). Rotenone-elicited extracellular superoxide release in p47phox-deficient macrophages suggested rotenone enabled to activate PHOX through a p47phox-independent mechanism. Increased membrane translocation of p67phox, elevated binding of p67phox to rotenone-treated membrane fractions, and co-immunoprecipitation of p67phox and gp91phox in rotenone-treated wild-type and p47phox-deficient macrophages indicated p67phox played a critical role in rotenone-induced PHOX activation via its direct interaction with gp91phox. Rac1, a Rho-like small GTPase, enhanced p67phox-gp91phox interaction; Rac1 inhibition decreased rotenone-elicited superoxide release. In conclusion, rotenone directly interacted with gp91phox; such an interaction triggered membrane translocation of p67phox, leading to PHOX activation and superoxide production. PMID:22094225

Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

PubMed

Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

2014-04-01

The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

Unique ATPase site architecture triggers cis-mediated synchronized ATP binding in heptameric AAA+-ATPase domain of flagellar regulatory protein FlrC.

PubMed

Dey, Sanjay; Biswas, Maitree; Sen, Udayaditya; Dasgupta, Jhimli

2015-04-03

Bacterial enhancer-binding proteins (bEBPs) oligomerize through AAA(+) domains and use ATP hydrolysis-driven energy to isomerize the RNA polymerase-σ(54) complex during transcriptional initiation. Here, we describe the first structure of the central AAA(+) domain of the flagellar regulatory protein FlrC (FlrC(C)), a bEBP that controls flagellar synthesis in Vibrio cholerae. Our results showed that FlrC(C) forms heptamer both in nucleotide (Nt)-free and -bound states without ATP-dependent subunit remodeling. Unlike the bEBPs such as NtrC1 or PspF, a novel cis-mediated "all or none" ATP binding occurs in the heptameric FlrC(C), because constriction at the ATPase site, caused by loop L3 and helix α7, restricts the proximity of the trans-protomer required for Nt binding. A unique "closed to open" movement of Walker A, assisted by trans-acting "Glu switch" Glu-286, facilitates ATP binding and hydrolysis. Fluorescence quenching and ATPase assays on FlrC(C) and mutants revealed that although Arg-349 of sensor II, positioned by trans-acting Glu-286 and Tyr-290, acts as a key residue to bind and hydrolyze ATP, Arg-319 of α7 anchors ribose and controls the rate of ATP hydrolysis by retarding the expulsion of ADP. Heptameric state of FlrC(C) is restored in solution even with the transition state mimicking ADP·AlF3. Structural results and pulldown assays indicated that L3 renders an in-built geometry to L1 and L2 causing σ(54)-FlrC(C) interaction independent of Nt binding. Collectively, our results underscore a novel mechanism of ATP binding and σ(54) interaction that strives to understand the transcriptional mechanism of the bEBPs, which probably interact directly with the RNA polymerase-σ(54) complex without DNA looping. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

F4+ enterotoxigenic Escherichia coli (ETEC) adhesion mediated by the major fimbrial subunit FaeG.

PubMed

Xia, Pengpeng; Song, Yujie; Zou, Yajie; Yang, Ying; Zhu, Guoqiang

2015-09-01

The FaeG subunit is the major constituent of F4(+) fimbriae, associated with glycoprotein and/or glycolipid receptor recognition and majorly contributes to the pathogen attachment to the host cells. To investigate the key factor involved in the fimbrial binding of F4(+) Escherichia coli, both the recombinant E. coli SE5000 strains carrying the fae operon gene clusters that express the different types of fimbriae in vitro, named as rF4ab, rF4ac, and rF4ad, respectively, corresponding to the fimbrial types F4ab, F4ac, and F4ad, and the three isogenic in-frame faeG gene deletion mutants were constructed. The adhesion assays and adhesion inhibition assays showed that ΔfaeG mutants had a significant reduction in the binding to porcine brush border as well as the intestinal epithelial cell lines, while the complemented strain ΔfaeG/pfaeG restored the adhesion function. The recombinant bacterial strains rF4ab, rF4ac, and rF4ad have the same binding property as wild-type F4(+) E. coli strains do and improvement in terms of binding to porcine brush border and the intestinal epithelial cells, and the adherence was blocked by the monoclonal antibody anti-F4 fimbriae. These data demonstrate that the fimbrial binding of F4(+) E. coli is directly mediated by the major FaeG subunit. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

PubMed

Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

2002-12-12

Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

Analysis of the synthetic pyrethroids, permethrin and 1(R)-phenothrin, in grain using a monoclonal antibody-based test

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skerritt, J.H.; Hill, A.S.; McAdam, D.P.

1992-07-01

A monoclonal antibody generated to the synthetic pyrethroid-related hapten, (3-phenoxybenzyl)-2,2-dimethylcyclopropane-1, 3-dicarboxylate-protein conjugate, was used to develop assays for determinations of permethrin and 1(R)-phenothrin in wheat grain and flour milling fractions. The earlier 3-h assay was simplified using two approaches. The antibody was directly conjugated to the enzyme horseradish peroxidase (HRP), which removes a separate incubation and washing step from the assay. Also, an assay has been developed using microwell-bound monoclonal antibody and a HRP-labeled 3-phenoxybenzoic acid derivative. These assay formats have advantages in increased sensitivity and, in the case of the latter assay, accuracy with grain and flour samples. Themore » most sensitive assay format could detect 1.5 ng/mL permethrin; 50% inhibition of antibody binding occurred at 10 ng/mL. These values corresponded to 75 and 500 ppb, respectively, in the original wheat sample. Methanol was the most effective pyrethroid extractant. Use of a simple cleanup procedure for ground grain extracts improved ELISA accuracy but could by omitted for screening purposes.« less

High-throughput assay for long chain fatty acyl-CoA elongase using homogeneous scintillation proximity format.

PubMed

Shimamura, Ken; Miyamoto, Yasuhisa; Kitazawa, Hidefumi; Kobayashi, Tsutomu; Kotani, Hidehito; Tokita, Shigeru

2009-04-01

Elongase of very-long-chain fatty acid (Elovl) 6 is a rate-limiting enzyme that is responsible for the elongation of long-chain fatty acids such as palmitoic acid (C16). Elovl6 is abundantly expressed in liver and adipose tissue, and the expression levels in these tissues are up-regulated in obese animals. Furthermore, Elovl6-deficient mice display improved glucose homeostasis and insulin sensitivity, suggesting that Elovl6 might be a potential therapeutic target for metabolic disorders. From the drug discovery point of view, it is critical to establish a high-throughput screening (HTS) assay for the identification of therapeutic agents. Conventional assay methods for fatty acid elongases include an extraction step for respective radioactive products from the reaction mixtures, which is labor-intensive and not feasible for HTS. In this study, we utilized the acyl-coenzyme A (CoA) binding protein (ACBP) as a molecular probe to detect radioactive long-chain acyl-CoA, a direct product of Elovl6. Recombinant ACBP binds stearoyl-CoA but not malonyl-CoA, enabling specific detection of the radioactive product in the homogenous reaction mixture without the liquid extraction step. Finally, combination of ACBP and scintillation proximity assay beads led to specific detection of Elovl6 activity with appropriate window and reproducibility amenable to HTS (signal-to-background noise ratio of approximately 13.0-fold, Z' = 0.85). The assay system described here has the potential to enable identification of small compounds that modify fatty acid elongase activity and assessment of the therapeutic potential of acyl-CoA elongases.

Alternatives to in vivo tests to detect endocrine disrupting chemicals (EDCs) in fish and amphibians--screening for estrogen, androgen and thyroid hormone disruption.

PubMed

Scholz, S; Renner, P; Belanger, S E; Busquet, F; Davi, R; Demeneix, B A; Denny, J S; Léonard, M; McMaster, M E; Villeneuve, D L; Embry, M R

2013-01-01

Endocrine disruption is considered a highly relevant hazard for environmental risk assessment of chemicals, plant protection products, biocides and pharmaceuticals. Therefore, screening tests with a focus on interference with estrogen, androgen, and thyroid hormone pathways in fish and amphibians have been developed. However, they use a large number of animals and short-term alternatives to animal tests would be advantageous. Therefore, the status of alternative assays for endocrine disruption in fish and frogs was assessed by a detailed literature analysis. The aim was to (i) determine the strengths and limitations of alternative assays and (ii) present conclusions regarding chemical specificity, sensitivity, and correlation with in vivo data. Data from 1995 to present were collected related to the detection/testing of estrogen-, androgen-, and thyroid-active chemicals in the following test systems: cell lines, primary cells, fish/frog embryos, yeast and cell-free systems. The review shows that the majority of alternative assays measure effects directly mediated by receptor binding or resulting from interference with hormone synthesis. Other mechanisms were rarely analysed. A database was established and used for a quantitative and comparative analysis. For example, a high correlation was observed between cell-free ligand binding and cell-based reporter cell assays, between fish and frog estrogenic data and between fish embryo tests and in vivo reproductive effects. It was concluded that there is a need for a more systematic study of the predictive capacity of alternative tests and ways to reduce inter- and intra-assay variability.

A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.

PubMed

Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

2015-02-05

1,5-Anhydro-6-deoxy-methane-sulfamido-D-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Examining the critical roles of human CB2 receptor residues Valine 3.32 (113) and Leucine 5.41 (192) in ligand recognition and downstream signaling activities.

PubMed

Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun

2014-09-26

We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

PubMed Central

Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

2017-01-01

Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

Optical sensors for therapeutic drug monitoring of antidepressants for a better medication adjustment

NASA Astrophysics Data System (ADS)

Krieg, Anne K.; Hess, Stefan; Gauglitz, Günter

2013-05-01

Therapeutic drug monitoring provides the attending physicians with detailed information on a patient's individual serum level especially during long-term medication. Due to the fact that each patient tolerates drugs or their metabolites differently a medication adjustment can reduce the number and intensity of noticeable side-effects. In particular, psychotropic drugs can cause unpleasant side-effects that affect a patient's life almost as much as the mental disease itself. The tricyclic antidepressants amitriptyline is commonly used for treatment of depressions and was selected for the development of an immunoassay using the direct optical sensor technique Reflectometric Interference Spectroscopy (RIfS). RIfS is a simple, robust and label-free method for direct monitoring of binding events on glass surfaces. Binding to the surface causes a shift of the interference spectrum by a change of the refractive index or physical thickness. This technique can be used for time-resolved observation of association and dissociation of amitriptyline (antigen) and a specific antibody using the binding inhibition test format. An amitriptyline derivative is immobilized on the sensor surface and a specific amount of antibodies can bind to the surface unless the binding is inhibited by free amitriptyline in a sample. No fluorescent label is needed making the whole assay less expensive than label-based methods. With this recently developed immunoassay amitriptyline concentrations in buffer (PBS) can easily be detected down to 500 ng/L.

Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

PubMed

Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

1992-04-01

Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common feature which defines the capacity of these elements to confer T3 induction.

A novel and sensitive radioreceptor assay for serum melatonin levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tenn, C.; Niles, L.

A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less

Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

The use of (35)S-labeled calmodulin (CaM) to screen a corn root cDNA expression library has led to the isolation of a CaM-binding protein, encoded by a cDNA with sequence similarity to small auxin up RNAs (SAURs), a class of early auxin-responsive genes. The cDNA designated as ZmSAUR1 (Zea mays SAURs) was expressed in Escherichia coli, and the recombinant protein was purified by CaM affinity chromatography. The CaM binding assay revealed that the recombinant protein binds to CaM in a calcium-dependent manner. Deletion analysis revealed that the CaM binding site was located at the NH(2)-terminal domain. A synthetic peptide of amino acids 20-45, corresponding to the potential CaM binding region, was used for calcium-dependent mobility shift assays. The synthetic peptide formed a stable complex with CaM only in the presence of calcium. The CaM affinity assay indicated that ZmSAUR1 binds to CaM with high affinity (K(d) approximately 15 nM) in a calcium-dependent manner. Comparison of the NH(2)-terminal portions of all of the characterized SAURs revealed that they all contain a stretch of the basic alpha-amphiphilic helix similar to the CaM binding region of ZmSAUR1. CaM binds to the two synthetic peptides from the NH(2)-terminal regions of Arabidopsis SAUR-AC1 and soybean 10A5, suggesting that this is a general phenomenon for all SAURs. Northern analysis was carried out using the total RNA isolated from auxin-treated corn coleoptile segments. ZmSAUR1 gene expression began within 10 min, increased rapidly between 10 and 60 min, and peaked around 60 min after 10 microM alpha-naphthaleneacetic acid treatment. These results indicate that ZmSAUR1 is an early auxin-responsive gene. The CaM antagonist N-(6-aminohexyl)5-chloro-1-naphthalenesulfonamide hydrochloride inhibited the auxin-induced cell elongation but not the auxin-induced expression of ZmSAUR1. This suggests that calcium/CaM do not regulate ZmSAUR1 at the transcriptional level. CaM binding to ZmSAUR1 in a calcium-dependent manner suggests that calcium/CaM regulate ZmSAUR1 at the post-translational level. Our data provide the first direct evidence for the involvement of calcium/CaM-mediated signaling in auxin-mediated signal transduction.

DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

DTIC Science & Technology

2001-05-01

We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

Regulation of Egr1 Target Genes by the Nurd Chromatin Remodeling Complex

DTIC Science & Technology

2008-06-01

Wade for providing a Mi2 antibody , and Megan Santarius for excellent technical assistance. REFERENCES 1. Russo, M. W., Sevetson, B. R., and Milbrandt...achieve crosslinking. Chromatin was then sonicated and immunoprecipitated with antibodies directed against Egr1, MTA2 or IgG control. After...promoter of IGF2, although the effects are more subtle. Control ChIP assays employing an EGR1 antibody show correlated increased binding of EGR1

Protein Adsorption and Its Role in Bacterial Film Development

DTIC Science & Technology

1989-06-27

only the secondary antibody conjugated to alkaline phosphatase was used. Combined Amino Acids as Measured by HPLC We are interested in a simple, direct...specific assay for chitin that relies on the lectin, wheat germ agglutinin (WGA). Lectins are a general class of proteins that bind to carbohydrates. The...protein; 2) a new method for measuring combined amino acids (includes proteins) in seawater was shown to measure higher concentration than the old

Expression of human peroxisome proliferator-activated receptors ligand binding domain-maltose binding protein fusion protein in Escherichia coli: a convenient and reliable method for preparing receptor for screening ligands.

PubMed

Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin

2008-12-01

Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.

Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Miranda Santos, I.K.; Pereira, M.E.

1984-09-01

Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

Structural insights into RISC assembly facilitated by dsRNA-binding domains of human RNA helicase A (DHX9)

PubMed Central

Fu, Qinqin; Yuan, Y. Adam

2013-01-01

Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA. PMID:23361462

Structural insights into RISC assembly facilitated by dsRNA-binding domains of human RNA helicase A (DHX9).

PubMed

Fu, Qinqin; Yuan, Y Adam

2013-03-01

Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA.

Iron assimilation and siderophore production by Vibrio ordalii strains isolated from diseased Atlantic salmon Salmo salar in Chile.

PubMed

Ruiz, Pamela; Balado, Miguel; Toranzo, Alicia E; Poblete-Morales, Matías; Lemos, Manuel L; Avendaño-Herrera, Ruben

2016-03-30

Vibrio ordalii is the causative agent of vibriosis in several cultured salmonid species worldwide. Despite its impact on aquaculture, relatively little information is available about its virulence factors. The present study demonstrates for the first time that V. ordalii possesses different systems of iron acquisition, one involving siderophore synthesis and another one that uses direct binding of heme to use iron. Using 6 strains of V. ordalii from Atlantic salmon Salmo salar and the V. ordalii type strain, we could demonstrate that all strains could grow in presence of the chelating agent 2,2'-dipyridyl and produced siderophores in solid and liquid media. Cross-feeding assays among V. ordalii strains evidenced variability in the siderophores produced. Bioassays and PCR data suggest that V. ordalii could produce a siderophore with a structure similar to piscibactin, although the production of a second siderophore in certain strains cannot be discarded. Furthermore, all strains were able to use hemin and hemoglobin as the only iron sources, although the cell yield was higher when using hemoglobin. A hemin-binding assay indicated the presence of constitutive heme-binding molecules at the cell surface of V. ordalii. Virulence tests using rainbow trout as a model of infection revealed a clear relationship between iron-uptake ability and pathogenicity in V. ordalii.

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

PubMed Central

Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

2008-01-01

We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

Human EAG channels are directly modulated by PIP2 as revealed by electrophysiological and optical interference investigations

PubMed Central

Han, Bo; He, Kunyan; Cai, Chunlin; Tang, Yin; Yang, Linli; Heinemann, Stefan H.; Hoshi, Toshinori; Hou, Shangwei

2016-01-01

Voltage-gated ether à go-go (EAG) K+ channels are expressed in various types of cancer cells and also in the central nervous system. Aberrant overactivation of human EAG1 (hEAG1) channels is associated with cancer and neuronal disorders such as Zimmermann-Laband and Temple-Baraitser syndromes. Although hEAG1 channels are recognized as potential therapeutic targets, regulation of their functional properties is only poorly understood. Here, we show that the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) is a potent inhibitory gating modifier of hEAG1 channels. PIP2 inhibits the channel activity by directly binding to a short N-terminal segment of the channel important for Ca2+/calmodulin (CaM) binding as evidenced by bio-layer interferometry measurements. Conversely, depletion of endogenous PIP2 either by serotonin-induced phospholipase C (PLC) activation or by a rapamycin-induced translocation system enhances the channel activity at physiological membrane potentials, suggesting that PIP2 exerts a tonic inhibitory influence. Our study, combining electrophysiological and direct binding assays, demonstrates that hEAG1 channels are subject to potent inhibitory modulation by multiple phospholipids and suggests that manipulations of the PIP2 signaling pathway may represent a strategy to treat hEAG1 channel-associated diseases. PMID:27005320

Coactivator-associated arginine methyltransferase 1 enhances transcriptional activity of the human T-cell lymphotropic virus type 1 long terminal repeat through direct interaction with Tax.

PubMed

Jeong, Soo-Jin; Lu, Hanxin; Cho, Won-Kyung; Park, Hyeon Ung; Pise-Masison, Cynthia; Brady, John N

2006-10-01

In this study, we demonstrate that the coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3 and other proteins such as p300/CBP, is positively involved in the regulation of Tax transactivation. First, transfection studies demonstrated that overexpression of CARM1 wild-type protein resulted in increased Tax transactivation of the human T-cell lymphotropic virus type 1 (HTLV-1) long terminal repeat (LTR). In contrast, transfection of a catalytically inactive CARM1 methyltransferase mutant did not enhance Tax transactivation. CARM1 facilitated Tax transactivation of the CREB-dependent cellular GEM promoter. A direct physical interaction between HTLV-1 Tax and CARM1 was demonstrated using in vitro glutathione S-transferase-Tax binding assays, in vivo coimmunoprecipitation, and confocal microscopy experiments. Finally, chromatin immunoprecipitation analysis of the activated HTLV-1 LTR promoter showed the association of CARM1 and methylated histone H3 with the template DNA. In vitro, Tax facilitates the binding of CARM1 to the transcription complex. Together, our data provide evidence that CARM1 enhances Tax transactivation of the HTLV-1 LTR through a direct interaction between CARM1 and Tax and this binding promotes methylation of histone H3 (R2, R17, and R26).

Discovery of a diaminoquinoxaline benzenesulfonamide antagonist of HIV-1 Nef function using a yeast-based phenotypic screen

PubMed Central

2013-01-01

Background HIV-1 Nef is a viral accessory protein critical for AIDS progression. Nef lacks intrinsic catalytic activity and binds multiple host cell signaling proteins, including Hck and other Src-family tyrosine kinases. Nef binding induces constitutive Hck activation that may contribute to HIV pathogenesis by promoting viral infectivity, replication and downregulation of cell-surface MHC-I molecules. In this study, we developed a yeast-based phenotypic screen to identify small molecules that inhibit the Nef-Hck complex. Results Nef-Hck interaction was faithfully reconstituted in yeast cells, resulting in kinase activation and growth arrest. Yeast cells expressing the Nef-Hck complex were used to screen a library of small heterocyclic compounds for their ability to rescue growth inhibition. The screen identified a dihydrobenzo-1,4-dioxin-substituted analog of 2-quinoxalinyl-3-aminobenzene-sulfonamide (DQBS) as a potent inhibitor of Nef-dependent HIV-1 replication and MHC-I downregulation in T-cells. Docking studies predicted direct binding of DQBS to Nef which was confirmed in differential scanning fluorimetry assays with recombinant purified Nef protein. DQBS also potently inhibited the replication of HIV-1 NL4-3 chimeras expressing Nef alleles representative of all M-group HIV-1 clades. Conclusions Our findings demonstrate the utility of a yeast-based growth reversion assay for the identification of small molecule Nef antagonists. Inhibitors of Nef function discovered with this assay, such as DQBS, may complement the activity of current antiretroviral therapies by enabling immune recognition of HIV-infected cells through the rescue of cell surface MHC-I. PMID:24229420

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Improved flow cytometer measurement of binding assays

DOEpatents

Saunders, G.C.

1984-05-30

The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)

The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

PubMed

Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

2016-10-01

The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

Synthesis and characterization of a Eu-DTPA-PEGO-MSH(4) derivative for evaluation of binding of multivalent molecules to melanocortin receptors.

PubMed

Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A

2010-04-15

A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.

Non-Native Metal Ion Reveals the Role of Electrostatics in Synaptotagmin 1-Membrane Interactions.

PubMed

Katti, Sachin; Nyenhuis, Sarah B; Her, Bin; Srivastava, Atul K; Taylor, Alexander B; Hart, P John; Cafiso, David S; Igumenova, Tatyana I

2017-06-27

C2 domains are independently folded modules that often target their host proteins to anionic membranes in a Ca 2+ -dependent manner. In these cases, membrane association is triggered by Ca 2+ binding to the negatively charged loop region of the C2 domain. Here, we used a non-native metal ion, Cd 2+ , in lieu of Ca 2+ to gain insight into the contributions made by long-range Coulombic interactions and direct metal ion-lipid bridging to membrane binding. Using X-ray crystallography, NMR, Förster resonance energy transfer, and vesicle cosedimentation assays, we demonstrate that, although Cd 2+ binds to the loop region of C2A/B domains of synaptotagmin 1 with high affinity, long-range Coulombic interactions are too weak to support membrane binding of individual domains. We attribute this behavior to two factors: the stoichiometry of Cd 2+ binding to the loop regions of the C2A and C2B domains and the impaired ability of Cd 2+ to directly coordinate the lipids. In contrast, electron paramagnetic resonance experiments revealed that Cd 2+ does support membrane binding of the C2 domains in full-length synaptotagmin 1, where the high local lipid concentrations that result from membrane tethering can partially compensate for lack of a full complement of divalent metal ions and specific lipid coordination in Cd 2+ -complexed C2A/B domains. Our data suggest that long-range Coulombic interactions alone can drive the initial association of C2A/B with anionic membranes and that Ca 2+ further augments membrane binding by the formation of metal ion-lipid coordination bonds and additional Ca 2+ ion binding to the C2 domain loop regions.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

2016-05-01

Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

Single-Molecule Analysis of the Rotation of F1-ATPase under High Hydrostatic Pressure

PubMed Central

Okuno, Daichi; Nishiyama, Masayoshi; Noji, Hiroyuki

2013-01-01

F1-ATPase is the water-soluble part of ATP synthase and is an ATP-driven rotary molecular motor that rotates the rotary shaft against the surrounding stator ring, hydrolyzing ATP. Although the mechanochemical coupling mechanism of F1-ATPase has been well studied, the molecular details of individual reaction steps remain unclear. In this study, we conducted a single-molecule rotation assay of F1 from thermophilic bacteria under various pressures from 0.1 to 140 MPa. Even at 140 MPa, F1 actively rotated with regular 120° steps in a counterclockwise direction, showing high conformational stability and retention of native properties. Rotational torque was also not affected. However, high hydrostatic pressure induced a distinct intervening pause at the ATP-binding angles during continuous rotation. The pause was observed under both ATP-limiting and ATP-saturating conditions, suggesting that F1 has two pressure-sensitive reactions, one of which is evidently ATP binding. The rotation assay using a mutant F1(βE190D) suggested that the other pressure-sensitive reaction occurs at the same angle at which ATP binding occurs. The activation volumes were determined from the pressure dependence of the rate constants to be +100 Å3 and +88 Å3 for ATP binding and the other pressure-sensitive reaction, respectively. These results are discussed in relation to recent single-molecule studies of F1 and pressure-induced protein unfolding. PMID:24094404

Increased Cardiac Arrhythmogenesis Associated With Gap Junction Remodeling With Upregulation of RNA-Binding Protein FXR1.

PubMed

Chu, Miensheng; Novak, Stefanie Mares; Cover, Cathleen; Wang, Anne A; Chinyere, Ikeotunye Royal; Juneman, Elizabeth B; Zarnescu, Daniela C; Wong, Pak Kin; Gregorio, Carol C

2018-02-06

Gap junction remodeling is well established as a consistent feature of human heart disease involving spontaneous ventricular arrhythmia. The mechanisms responsible for gap junction remodeling that include alterations in the distribution of, and protein expression within, gap junctions are still debated. Studies reveal that multiple transcriptional and posttranscriptional regulatory pathways are triggered in response to cardiac disease, such as those involving RNA-binding proteins. The expression levels of FXR1 (fragile X mental retardation autosomal homolog 1), an RNA-binding protein, are critical to maintain proper cardiac muscle function; however, the connection between FXR1 and disease is not clear. To identify the mechanisms regulating gap junction remodeling in cardiac disease, we sought to identify the functional properties of FXR1 expression, direct targets of FXR1 in human left ventricle dilated cardiomyopathy (DCM) biopsy samples and mouse models of DCM through BioID proximity assay and RNA immunoprecipitation, how FXR1 regulates its targets through RNA stability and luciferase assays, and functional consequences of altering the levels of this important RNA-binding protein through the analysis of cardiac-specific FXR1 knockout mice and mice injected with 3xMyc-FXR1 adeno-associated virus. FXR1 expression is significantly increased in tissue samples from human and mouse models of DCM via Western blot analysis. FXR1 associates with intercalated discs, and integral gap junction proteins Cx43 (connexin 43), Cx45 (connexin 45), and ZO-1 (zonula occludens-1) were identified as novel mRNA targets of FXR1 by using a BioID proximity assay and RNA immunoprecipitation. Our findings show that FXR1 is a multifunctional protein involved in translational regulation and stabilization of its mRNA targets in heart muscle. In addition, introduction of 3xMyc-FXR1 via adeno-associated virus into mice leads to the redistribution of gap junctions and promotes ventricular tachycardia, showing the functional significance of FXR1 upregulation observed in DCM. In DCM, increased FXR1 expression appears to play an important role in disease progression by regulating gap junction remodeling. Together this study provides a novel function of FXR1, namely, that it directly regulates major gap junction components, contributing to proper cell-cell communication in the heart. © 2017 American Heart Association, Inc.

Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

PubMed

Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

2008-11-25

The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

Ligand-activated PPARδ upregulates α-smooth muscle actin expression in human dermal fibroblasts: A potential role for PPARδ in wound healing.

PubMed

Ham, Sun Ah; Hwang, Jung Seok; Yoo, Taesik; Lee, Won Jin; Paek, Kyung Shin; Oh, Jae-Wook; Park, Chan-Kyu; Kim, Jin-Hoi; Do, Jung Tae; Kim, Jae-Hwan; Seo, Han Geuk

2015-12-01

The phenotypic changes that accompany differentiation of resident fibroblasts into myofibroblasts are important aspects of the wound healing process. Recent studies showed that peroxisome proliferator-activated receptor (PPAR) δ plays a critical role in wound healing. To determine whether the nuclear receptor PPARδ can modulate the differentiation of human dermal fibroblasts (HDFs) into myofibroblasts. These studies were undertaken in primary HDFs using Western blot analyses, small interfering (si)RNA-mediated gene silencing, reporter gene assays, chromatin immunoprecipitation (ChIP), migration assays, collagen gel contraction assays, and real-time PCR. Activation of PPARδ by GW501516, a specific ligand of PPARδ, specifically upregulated the myofibroblast marker α-smooth muscle actin (α-SMA) in a time- and concentration-dependent manner. This induction was significantly inhibited by the presence of siRNA against PPARδ, indicating that PPARδ is involved in myofibroblast transdifferentiation of HDFs. Ligand-activated PPARδ increased α-SMA promoter activity in a dual mode by directly binding a direct repeat-1 (DR1) site in the α-SMA promoter, and by inducing expression of transforming growth factor (TGF)-β, whose downstream effector Smad3 interacts with a Smad-binding element (SBE) in another region of the promoter. Mutations in these cis-elements totally abrogated transcriptional activation of the α-SMA gene by the PPARδ ligand; thus both sites represent novel types of PPARδ response elements. GW501516-activated PPARδ also increased the migration and contractile properties of HDFs, as demonstrated by Transwell and collagen lattice contraction assays, respectively. In addition, PPARδ-mediated upregulation of α-SMA was correlated with elevated expression of myofibroblast markers such as collagen I and fibronectin, with a concomitant reduction in expression of the epithelial marker E-cadherin. PPARδ plays pivotal roles in wound healing by promoting fibroblast-to-myofibroblast differentiation via TGF-β/Smad3 signaling. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Specific Armadillo Repeat Sequences Facilitate β-Catenin Nuclear Transport in Live Cells via Direct Binding to Nucleoporins Nup62, Nup153, and RanBP2/Nup358*

PubMed Central

Sharma, Manisha; Jamieson, Cara; Johnson, Michael; Molloy, Mark P.; Henderson, Beric R.

2012-01-01

β-Catenin transduces the Wnt signal from the membrane to nucleus, and certain gene mutations trigger its nuclear accumulation leading to cell transformation and cancer. β-Catenin shuttles between the nucleus and cytoplasm independent of classical Ran/transport receptor pathways, and this movement was previously hypothesized to involve the central Armadillo (Arm) domain. Fluorescence recovery after photobleaching (FRAP) assays were used to delineate functional transport regions of the Arm domain in living cells. The strongest nuclear import/export activity was mapped to Arm repeats R10–12 using both in vivo FRAP and in vitro export assays. By comparison, Arm repeats R3–8 of β-catenin were highly active for nuclear import but displayed a comparatively weak export activity. We show for the first time using purified components that specific Arm sequences of β-catenin interact directly in vitro with the FG repeats of the nuclear pore complex (NPC) components Nup62, Nup98, and Nup153, indicating an independent ability of β-catenin to traverse the NPC. Moreover, a proteomics screen identified RanBP2/Nup358 as a binding partner of Arm R10–12, and β-catenin was confirmed to interact with endogenous and ectopic forms of Nup358. We further demonstrate that knock-down of endogenous Nup358 and Nup62 impeded the rate of nuclear import/export of β-catenin to a greater extent than that of importin-β. The Arm R10–12 sequence facilitated transport even when β-catenin was bound to the Arm-binding partner LEF-1, and its activity was stimulated by phosphorylation at Tyr-654. These findings provide functional evidence that the Arm domain contributes to regulated β-catenin transport through direct interaction with the NPC. PMID:22110128

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

The MTA family proteins as novel histone H3 binding proteins.

PubMed

Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

2013-01-03

The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

The MTA family proteins as novel histone H3 binding proteins

PubMed Central

2013-01-01

Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

Evaluation of Phosphatidylserine-Binding Peptides Radiolabeled with Fluorine 18 for in vivo Imaging of Apoptosis

NASA Astrophysics Data System (ADS)

Kapty, Janice Sarah

We currently do not have a clinical method to directly assess apoptosis induced by cancer therapies. Phosphatidylserine (PS) is an attractive target for imaging apoptosis since it is on the exterior of the apoptotic cells and PS externalization is an early marker of apoptosis. PS-binding peptides are an attractive option for developing an imaging probe to detect apoptosis using positron emission tomography. In this study we evaluated binding characteristics of PS-binding peptides for ability to bind to PS, radiolabeled PS-binding peptides with fluorine-18, and performed in vitro and in vivo analysis of 18F radiolabeled PS-binding peptides including biodistribution analysis and dynamic PET imaging in a murine tumor model of apoptosis. Four peptides were evaluated for PS binding characteristics using a plate based assay system, a liposome mimic of cell membrane PS presentation, and a cell assay of apoptosis. The results indicate that all four peptides bind to PS and are specific to apoptotic cells. The widely used 18 F prosthetic group N-succinimidyl-4-[18F]fluorobenzoate ([18F]SFB) and the recently developed N-[6-(4-[ 18F]fluorobenzylidene) aminooxyhexyl]maleimide ([18F]FBAM) were investigated for radiolabeling of two representative phosphatidylserine-binding peptides. The prosthetic groups were compared with respect to required reaction conditions for optimum labeling, radiolabeling yield and chemoselectivity. The N-terminus labeled product produced by reaction of [18F]SFB with binding peptide LIKKPF was produced in 18% radiochemical yield while no N-terminus labeled product could be isolated following [18F]SFB reaction with PDGLSR. When the peptides were modified by addition of a cysteine residue at the N-terminus they provided almost quantitative radiochemical yields with [18F]FBAM. Results indicate that for the peptides in this study, [18F]FBAM is a more useful prosthetic group compared to [18F]SFB due to its excellent chemo-selectivity and high radiochemical yield. We report the first experiments where PS-binding peptides were radiolabeled with 18F and evaluated as possible radiotracers for imaging apoptosis. We investigated two radio-peptides ([ 18F]FBAM-CLIKKPF and [18F]FBAM-CPGDLSR) in vitro and in vivo as possible radiotracers able to bind to apoptotic cells and to image chemotherapy induced apoptosis.

The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

PubMed

Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

2007-11-02

The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

SOX7 Suppresses Wnt Signaling by Disrupting β-Catenin/BCL9 Interaction.

PubMed

Fan, Rong; He, HaiYan; Yao, Wang; Zhu, YanFeng; Zhou, XunJie; Gui, MingTai; Lu, Jing; Xi, Hao; Deng, ZhongLong; Fan, Min

2018-02-01

The Wnt signaling is involved in angiogenesis and tumor development. β-catenin is the core component of the Wnt pathway, which mediates oncogenic transcription and regulated by a series of proteins. Sex-determining region Y-box 7 (SOX7) is a member of high-mobility-group transcription factor family, which inhibits oncogenic Wnt signaling in lots of tumor cells with unknown mechanism. By coimmunoprecipitation (co-IP) and super Topflash reporter assay, SOX7 can bind β-catenin and inhibit β-catenin/T cell factor (TCF)-mediated transcription. Meanwhile, B cell lymphoma 9 (BCL9) drives Wnt signaling path through direct binding-mediated β-catenin. Finally, we found that SOX7 inhibits oncogenic β-catenin-mediated transcription by disrupting the β-catenin/BCL9 interaction. Mechanistically, SOX7 compete with BCL9 to bind β-catenin. Our results show SOX7 inhibited Wnt signaling as suppressor and could be an important target for anticancer therapy.

Prostate cell membrane chromatography-liquid chromatography-mass spectrometry for screening of active constituents from Uncaria rhynchophylla.

PubMed

He, Jianyu; Han, Shengli; Yang, Fangfang; Zhou, Nan; Wang, Sicen

2013-01-01

Uncaria rhynchophylla is a traditional Chinese medicinal herb used to treat hypertension and convulsive disorders such as epilepsy. Rat prostate cell membrane chromatography combined with liquid chromatography-mass spectrometry (LC-MS) was used to identify active constituents from U. rhynchophylla extracts. Four compounds (corynoxeine, isorhynchophylline, isocorynoxeine and rhynchophylline) were discovered. Competitive binding assay results indicated that the four compounds were in direct competition at a single common binding site and interacted with α1A adrenergic receptors (α1A-AR) in a manner similar to tamsulosin. Affinity constant values of the four compounds binding with α1A-AR were also measured using rat prostate cell membrane chromatography (CMC). Finally, their pharmacodynamic effects were tested on rat caudal arteries. This CMC combined LC-MS system offers a means of drug discovery by screening natural medicinal herbs for new pharmacologically active molecules targeting specific receptors.

Manuka honey inhibits adhesion and invasion of medically important wound bacteria in vitro.

PubMed

Maddocks, Sarah Elizabeth; Jenkins, Rowena Eleri; Rowlands, Richard Samuel; Purdy, Kevin John; Cooper, Rose Agnes

2013-12-01

To characterize the effect of manuka honey on medically important wound bacteria in vitro, focusing on its antiadhesive properties. Crystal violet biofilm assays, fluorescent microscopy, protein adhesion assay and gentamicin protection assay were used to determine the impact of manuka honey on biofilm formation, human protein binding and adherence to/invasion into human keratinocytes. Manuka honey effectively disrupted and caused extensive cell death in biofilms of Staphylococcus aureus, Pseudomonas aeruginosa and Streptococcus pyogenes. Sublethal doses of manuka honey inhibited bacterial adhesion to the fibronectin, fibrinogen and collagen. Manuka honey impaired adhesion of laboratory and clinical isolates of S. aureus, P. aeruginosa and S. pyogenes to human keratinocytes in vitro, and inhibited invasion by S. pyogenes and homogeneous vancomycin intermediate S. aureus. Manuka honey can directly affect bacterial cells embedded in a biofilm and exhibits antiadhesive properties against three common wound pathogens.

Exploring the Interaction of SV2A with Racetams Using Homology Modelling, Molecular Dynamics and Site-Directed Mutagenesis

PubMed Central

Lee, Joanna; Daniels, Veronique; Sands, Zara A.; Lebon, Florence; Shi, Jiye; Biggin, Philip C.

2015-01-01

The putative Major Facilitator Superfamily (MFS) transporter, SV2A, is the target for levetiracetam (LEV), which is a successful anti-epileptic drug. Furthermore, SV2A knock out mice display a severe seizure phenotype and die after a few weeks. Despite this, the mode of action of LEV is not known at the molecular level. It would be extremely desirable to understand this more fully in order to aid the design of improved anti-epileptic compounds. Since there is no structure for SV2A, homology modelling can provide insight into the ligand-binding site. However, it is not a trivial process to build such models, since SV2A has low sequence identity to those MFS transporters whose structures are known. A further level of complexity is added by the fact that it is not known which conformational state of the receptor LEV binds to, as multiple conformational states have been inferred by tomography and ligand binding assays or indeed, if binding is exclusive to a single state. Here, we explore models of both the inward and outward facing conformational states of SV2A (according to the alternating access mechanism for MFS transporters). We use a sequence conservation analysis to help guide the homology modelling process and generate the models, which we assess further with Molecular Dynamics (MD). By comparing the MD results in conjunction with docking and simulation of a LEV-analogue used in radioligand binding assays, we were able to suggest further residues that line the binding pocket. These were confirmed experimentally. In particular, mutation of D670 leads to a complete loss of binding. The results shed light on the way LEV analogues may interact with SV2A and may help with the on-going design of improved anti-epileptic compounds. PMID:25692762

Nanoplasmonic Quantification of Tumor-derived Extracellular Vesicles in Plasma Microsamples for Diagnosis and Treatment Monitoring

PubMed Central

Liang, Kai; Liu, Fei; Fan, Jia; Sun, Dali; Liu, Chang; Lyon, Christopher J.; Bernard, David W.; Li, Yan; Yokoi, Kenji; Katz, Matthew H.; Koay, Eugene J.; Zhao, Zhen; Hu, Ye

2017-01-01

Tumour-derived extracellular vesicles (EVs) are of increasing interest as a resource of diagnostic biomarkers. However, most EV assays require large samples, are time-consuming, low-throughput and costly, and thus impractical for clinical use. Here, we describe a rapid, ultrasensitive and inexpensive nanoplasmon-enhanced scattering (nPES) assay that directly quantifies tumor-derived EVs from as little as 1 μL of plasma. The assay uses the binding of antibody-conjugated gold nanospheres and nanorods to EVs captured by EV-specific antibodies on a sensor chip to produce a local plasmon effect that enhances tumour-derived EV detection sensitivity and specificity. We identified a pancreatic cancer EV biomarker, ephrin type-A receptor 2 (EphA2), and demonstrate that an nPES assay for EphA2-EVs distinguishes pancreatic cancer patients from pancreatitis patients and healthy subjects. EphA2-EVs were also informative in staging tumour progression and in detecting early responses to neoadjuvant therapy, with better performance than a conventional enzyme-linked immunosorbent assay. The nPES assay can be easily refined for clinical use, and readily adapted for diagnosis and monitoring of other conditions with disease-specific EV biomarkers. PMID:28791195

Effects of vitamin D-binding protein-derived macrophage-activating factor on human breast cancer cells.

PubMed

Pacini, Stefania; Punzi, Tiziana; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco

2012-01-01

Searching for additional therapeutic tools to fight breast cancer, we investigated the effects of vitamin D-binding protein-derived macrophage activating factor (DBP-MAF, also known as GcMAF) on a human breast cancer cell line (MCF-7). The effects of DBP-MAF on proliferation, morphology, vimentin expression and angiogenesis were studied by cell proliferation assay, phase-contrast microscopy, immunohistochemistry and western blotting, and chorioallantoic membrane (CAM) assay. DBP-MAF inhibited human breast cancer cell proliferation and cancer cell-stimulated angiogenesis. MCF-7 cells treated with DBP-MAF predominantly grew in monolayer and appeared to be well adherent to each other and to the well surface. Exposure to DBP-MAF significantly reduced vimentin expression, indicating a reversal of the epithelial/mesenchymal transition, a hallmark of human breast cancer progression. These results are consistent with the hypothesis that the known anticancer efficacy of DBP-MAF can be ascribed to different biological properties of the molecule that include inhibition of tumour-induced angiogenesis and direct inhibition of cancer cell proliferation, migration and metastatic potential.

Serotonergic activity-guided phytochemical investigation of the roots of Angelica sinensis.

PubMed

Deng, Shixin; Chen, Shao-Nong; Yao, Ping; Nikolic, Dejan; van Breemen, Richard B; Bolton, Judy L; Fong, Harry H S; Farnsworth, Norman R; Pauli, Guido F

2006-04-01

Serotonin receptor (5-HT(7)) binding assay-directed fractionation of a methanol extract of the dried roots of Angelica sinensis led to the isolation and identification of 21 compounds including a new phenolic ester, angeliferulate (1), and three new phthalides, 10-angeloylbutylphthalide (2), sinaspirolide (3), and ansaspirolide (4), along with 17 known compounds, p-hydroxyphenethyl trans-ferulate (5), Z-ligustilide (6), Z-butylidenephthalide (7), senkyunolide I (8), Z-6-hydroxy-7-methoxydihydroligustilide (9), N-butylbenzenesulfonamide (10), 11(S),16(R)-dihydroxyoctadeca-9Z,17-diene-12,14-diyn-1-yl acetate (11), (3R,8S)-falcarindiol (12), heptadeca-1-en-9,10-epoxy-4,6-diyne-3,8-diol (13), oplopandiol (14), 8-hydroxy-1-methoxy-, Z-9-heptadecene-4,6-diyn-3-one (15), imperatorin, ferulic acid, vanillin, stigmasterol, sucrose, and 1,3-dilinolenin. This is the first report of a sulfonamide (10) identified from a higher plant source, although its presence needs further investigation. Biosynthetic pathways for dimeric phthalides 3 and 4 are proposed. Compounds 5, 7, 11, 12, 15, and imperatorin exhibited affinity toward 5-HT(7) receptors in a competitive binding assay.

Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

PubMed

Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

2017-10-15

In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

An optimized assay of specific IgE antibodies to reactive dyes and studies of immunologic responses in exposed workers.

PubMed

Wass, U; Nilsson, R; Nordlinder, R; Belin, L

1990-03-01

Methods of assaying reactive dye-specific IgE antibodies were investigated with a RAST. Sera from three patients, occupationally exposed to a reactive dye, Remazol black B (Chemical Abstract registry number 17095-24-8), were used. Directly dyed disks, that is, disks without any carrier protein, resulted in poor and unreliable measures of specific IgE. In contrast, optimized preparation of conjugates between the dye and human serum albumin resulted in efficient binding of specific IgE. The patients' RAST results were strongly positive, whereas sera from 36 exposed workers but without symptoms and sera from unexposed subjects with high levels of total IgE were negative. The hapten and carrier specificity of the IgE antibodies was studied by direct RAST and RAST inhibition. In one patient, the antibodies were principally hapten specific, whereas another patient was found to have antibodies with a high degree of specificity to the carrier. The third patient's antibodies were intermediate between the other two patients' antibodies in this respect, suggesting that antibody specificity is dependent not only on the nature of the hapten but also on individual immune response factors. The study demonstrates that it is important to use an optimized preparation of dye-protein conjugates to elicit reliable results and a high degree of specific IgE binding in the RAST.

Tyrosine Residues Regulate Multiple Nuclear Functions of P54nrb.

PubMed

Lee, Ahn R; Hung, Wayne; Xie, Ning; Liu, Liangliang; He, Leye; Dong, Xuesen

2017-04-01

The non-POU-domain-containing octamer binding protein (NONO; also known as p54nrb) has various nuclear functions ranging from transcription, RNA splicing, DNA synthesis and repair. Although tyrosine phosphorylation has been proposed to account for the multi-functional properties of p54nrb, direct evidence on p54nrb as a phosphotyrosine protein remains unclear. To investigate the tyrosine phosphorylation status of p54nrb, we performed site-directed mutagenesis on the five tyrosine residues of p54nrb, replacing the tyrosine residues with phenylalanine or alanine, and immunoblotted for tyrosine phosphorylation. We then preceded with luciferase reporter assays, RNA splicing minigene assays, co-immunoprecipitation, and confocal microscopy to study the function of p54nrb tyrosine residues on transcription, RNA splicing, protein-protein interaction, and cellular localization. We found that p54nrb was not phosphorylated at tyrosine residues. Rather, it has non-specific binding affinity to anti-phosphotyrosine antibodies. However, replacement of tyrosine with phenylalanine altered p54nrb activities in transcription co-repression and RNA splicing in gene context-dependent fashions by means of differential regulation of p54nrb protein association with its interacting partners and co-regulators of transcription and splicing. These results demonstrate that tyrosine residues, regardless of phosphorylation status, are important for p54nrb function. J. Cell. Physiol. 232: 852-861, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Tax relieves transcriptional repression by promoting histone deacetylase 1 release from the human T-cell leukemia virus type 1 long terminal repeat.

PubMed

Lu, Hanxin; Pise-Masison, Cynthia A; Linton, Rebecca; Park, Hyeon Ung; Schiltz, R Louis; Sartorelli, Vittorio; Brady, John N

2004-07-01

Expression of human T-cell leukemia virus type 1 (HTLV-1) is regulated by the viral transcriptional activator Tax. Tax activates viral transcription through interaction with the cellular transcription factor CREB and the coactivators CBP/p300. In this study, we have analyzed the role of histone deacetylase 1 (HDAC1) on HTLV-1 gene expression from an integrated template. First we show that trichostatin A, an HDAC inhibitor, enhances Tax expression in HTLV-1-transformed cells. Second, using a cell line containing a single-copy HTLV-1 long terminal repeat, we demonstrate that overexpression of HDAC1 represses Tax transactivation. Furthermore, a chromatin immunoprecipitation assay allowed us to analyze the interaction of transcription factors, coactivators, and HDACs with the basal and activated HTLV-1 promoter. We demonstrate that HDAC1 is associated with the inactive, but not the Tax-transactivated, HTLV-1 promoter. In vitro and in vivo glutathione S-transferase-Tax pull-down and coimmunoprecipitation experiments demonstrated that there is a direct physical association between Tax and HDAC1. Importantly, biotinylated chromatin pull-down assays demonstrated that Tax inhibits and/or dissociates the binding of HDAC1 to the HTLV-1 promoter. Our results provide evidence that Tax interacts directly with HDAC1 and regulates binding of the repressor to the HTLV-1 promoter.

Relative Chemical Binding Affinities for Trout and Human Estrogen Receptor Using Different Competitive Binding Assays

EPA Science Inventory

Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...

Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

EPA Science Inventory

We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

Crystal Structures of Yellowtail Ascites Virus VP4 Protease

PubMed Central

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-01-01

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Identification of N-methyl-D-aspartic acid (NMDA) receptor subtype-specific binding sites that mediate direct interactions with scaffold protein PSD-95.

PubMed

Cousins, Sarah L; Stephenson, F Anne

2012-04-13

N-methyl-D-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149-1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins.

Identification of N-Methyl-d-aspartic Acid (NMDA) Receptor Subtype-specific Binding Sites That Mediate Direct Interactions with Scaffold Protein PSD-95*

PubMed Central

Cousins, Sarah L.; Stephenson, F. Anne

2012-01-01

N-methyl-d-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149–1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins. PMID:22375001

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

Src homology domain 2-containing protein-tyrosine phosphatase-1 (SHP-1) binds and dephosphorylates G(alpha)-interacting, vesicle-associated protein (GIV)/Girdin and attenuates the GIV-phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway.

PubMed

Mittal, Yash; Pavlova, Yelena; Garcia-Marcos, Mikel; Ghosh, Pradipta

2011-09-16

GIV (Gα-interacting vesicle-associated protein, also known as Girdin) is a bona fide enhancer of PI3K-Akt signals during a diverse set of biological processes, e.g. wound healing, macrophage chemotaxis, tumor angiogenesis, and cancer invasion/metastasis. We recently demonstrated that tyrosine phosphorylation of GIV by receptor and non-receptor-tyrosine kinases is a key step that is required for GIV to directly bind and enhance PI3K activity. Here we report the discovery that Src homology 2-containing phosphatase-1 (SHP-1) is the major protein-tyrosine phosphatase that targets two critical phosphotyrosines within GIV and antagonizes phospho-GIV-dependent PI3K enhancement in mammalian cells. Using phosphorylation-dephosphorylation assays, we demonstrate that SHP-1 is the major and specific protein-tyrosine phosphatase that catalyzes the dephosphorylation of tyrosine-phosphorylated GIV in vitro and inhibits ligand-dependent tyrosine phosphorylation of GIV downstream of both growth factor receptors and GPCRs in cells. In vitro binding and co-immunoprecipitation assays demonstrate that SHP-1 and GIV interact directly and constitutively and that this interaction occurs between the SH2 domain of SHP-1 and the C terminus of GIV. Overexpression of SHP-1 inhibits tyrosine phosphorylation of GIV and formation of phospho-GIV-PI3K complexes, and specifically suppresses GIV-dependent activation of Akt. Consistently, depletion of SHP-1 enhances peak tyrosine phosphorylation of GIV, which coincides with an increase in peak Akt activity. We conclude that SHP-1 antagonizes the action of receptor and non-receptor-tyrosine kinases on GIV and down-regulates the phospho-GIV-PI3K-Akt axis of signaling.

Human antibodies against spores of the genus Bacillus: a model study for detection of and protection against anthrax and the bioterrorist threat.

PubMed

Zhou, Bin; Wirsching, Peter; Janda, Kim D

2002-04-16

A naive, human single-chain Fv (scFv) phage-display library was used in bio-panning against live, native spores of Bacillus subtilis IFO 3336 suspended in solution. A direct in vitro panning and enzyme-linked immunosorbent assay-based selection afforded a panel of nine scFv-phage clones of which two, 5B and 7E, were chosen for further study. These two clones differed in their relative specificity and affinity for spores of B. subtilis IFO 3336 vs. a panel of spores from 11 other Bacillus species/strains. A variety of enzyme-linked immunosorbent assay protocols indicated these scFv-phage clones recognized different spore epitopes. Notably, some spore epitopes markedly changed between the free and microtiter-plate immobilized state as revealed by antibody-phage binding. An additional library selection procedure also was examined by constructing a Fab chain-shuffled sublibrary from the nine positive clones and by using a subtractive panning strategy to remove crossreactivity with B. licheniformis 5A24. The Fab-phage clone 52 was improved compared with 5B and was comparable to 7E in binding B. subtilis IFO 3336 vs. B. licheniformis 5A24, yet showed a distinctive crossreactivity pattern with other spores. We also developed a method to directly detect individual spores by using fluorescently labeled antibody-phage. Finally, a variety of "powders" that might be used in deploying spores of B. anthracis were examined for antibody-phage binding. The strategies described provide a foundation to discover human antibodies specific for native spores of B. anthracis that can be developed as diagnostic and therapeutic reagents.

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

A practical approach to automate randomized design of experiments for ligand-binding assays.

PubMed

Tsoi, Jennifer; Patel, Vimal; Shih, Judy

2014-03-01

Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.

Structural and functional characterization of a new recombinant histidine-tagged acyl coenzyme A binding protein (ACBP) from mouse

PubMed Central

Petrescu, Anca D.; Huang, Huan; Hostetler, Heather A.; Schroeder, Friedhelm; Kier, Ann B.

2008-01-01

Acyl-coenzyme A binding protein (ACBP) has been proposed to transport fatty acyl-CoAs intracellularly, facilitating their metabolism. In this study, a new mouse recombinant ACBP was produced by insertion of a histidine (his) tag at the C-terminus to allow efficient purification by Ni-affinity chromatography. The his-tag was inserted at the C-terminus since ACBP is a small molecular size (10 kDa) protein whose structure and activity are sensitive to amino acid substitutions in the N-terminus. The his tag had no or little effect on ACBP structure or ligand binding affinity and specificity. His-ACBP bound the naturally-occurring fluorescent cis-parinaroyl-CoA with very high affinity (Kd=2.15 nM), but exhibited no affinity for non-esterified cis-parinaric acid. To determine if the presence of the C-terminal his tag altered ACBP interactions with other proteins, direct binding to hepatocyte nuclear factor 4α (HNF-4α), a nuclear receptor regulating transcription of genes involved in lipid metabolism, was examined. His-ACBP and HNF-4α were labeled with Cy5 and Cy3, respectively, and direct interaction was determined by a novel fluorescence resonance energy transfer (FRET) binding assay. FRET analysis showed that his-ACBP directly interacted with HNF-4α (intermolecular distance of 73 Å) at high affinity (Kd=64-111 nM) similar to native ACBP. The his-tag also had no effect on ACBPs ability to interact with and stimulate microsomal enzymes utilizing or forming fatty acyl CoA. Thus, C-terminal his-tagged-ACBP maintained very similar structural and functional features of the untagged native protein and can be used in further in vitro experiments that require pure recombinant ACBP. PMID:18178100

Improved flow cytometer measurement of binding assays

NASA Astrophysics Data System (ADS)

Saunders, G. C.

1984-05-01

A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.

D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

PubMed

Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

2003-11-01

Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

Detection of Z DNA binding proteins in tissue culture cells.

PubMed Central

Leith, I R; Hay, R T; Russell, W C

1988-01-01

A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

Binding of environmental carcinogens to asbestos and mineral fibres.

PubMed Central

Harvey, G; Pagé, M; Dumas, L

1984-01-01

A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

PubMed

Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

2015-06-26

There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis

PubMed Central

Qiu, Kai; Li, Zhongpeng; Yang, Zhen; Chen, Junyi; Wu, Shouxin; Zhu, Xiaoyu; Gao, Shan; Gao, Jiong; Ren, Guodong; Kuai, Benke; Zhou, Xin

2015-01-01

Degreening, caused by chlorophyll degradation, is the most obvious symptom of senescing leaves. Chlorophyll degradation can be triggered by endogenous and environmental cues, and ethylene is one of the major inducers. ETHYLENE INSENSITIVE3 (EIN3) is a key transcription factor in the ethylene signaling pathway. It was previously reported that EIN3, miR164, and a NAC (NAM, ATAF, and CUC) transcription factor ORE1/NAC2 constitute a regulatory network mediating leaf senescence. However, how this network regulates chlorophyll degradation at molecular level is not yet elucidated. Here we report a feed-forward regulation of chlorophyll degradation that involves EIN3, ORE1, and chlorophyll catabolic genes (CCGs). Gene expression analysis showed that the induction of three major CCGs, NYE1, NYC1 and PAO, by ethylene was largely repressed in ein3 eil1 double mutant. Dual-luciferase assay revealed that EIN3 significantly enhanced the promoter activity of NYE1, NYC1 and PAO in Arabidopsis protoplasts. Furthermore, Electrophoretic mobility shift assay (EMSA) indicated that EIN3 could directly bind to NYE1, NYC1 and PAO promoters. These results reveal that EIN3 functions as a positive regulator of CCG expression during ethylene-mediated chlorophyll degradation. Interestingly, ORE1, a senescence regulator which is a downstream target of EIN3, could also activate the expression of NYE1, NYC1 and PAO by directly binding to their promoters in EMSA and chromatin immunoprecipitation (ChIP) assays. In addition, EIN3 and ORE1 promoted NYE1 and NYC1 transcriptions in an additive manner. These results suggest that ORE1 is also involved in the direct regulation of CCG transcription. Moreover, ORE1 activated the expression of ACS2, a major ethylene biosynthesis gene, and subsequently promoted ethylene production. Collectively, our work reveals that EIN3, ORE1 and CCGs constitute a coherent feed-forward loop involving in the robust regulation of ethylene-mediated chlorophyll degradation during leaf senescence in Arabidopsis. PMID:26218222

Discovery of an Inhibitor of Z-Alpha1 Antitrypsin Polymerization

DOE PAGES

Berthelier, Valerie; Harris, Jason Brett; Estenson, Kasey Noel; ...

2015-05-11

Polymerization of the Z variant alpha-1-antitrypsin (Z-α1AT) results in the most common and severe form of α1AT deficiency (α1ATD), a debilitating genetic disorder whose clinical manifestations range from asymptomatic to fatal liver and/or lung disease. As the altered conformation of Z-α1AT and its attendant aggregation are responsible for pathogenesis, the polymerization process per se has become a major target for the development of therapeutics. Based on the ability of Z-alpha 1AT to aggregate by recruiting the reactive center loop (RCL) of another Z-α1AT into its s4A cavity, we developed a high-throughput screening assay that uses a modified 6-mer peptide mimickingmore » the RCL to screen for inhibitors of Z-α1AT polymer growth. We used a subset of compounds from the Library of Pharmacologically Active Compounds (LOPAC) with molecular weights ranging from 300 to 700 Da, to evaluate the assay's capabilities. The inhibitor S-(4-nitrobenzyl)-6-thioguanosine was identified as a lead compound and its ability to prevent Z-α1AT polymerization confirmed by secondary assays. In order to further investigate the binding location of S-(4-nitrobenzyl)-6-thioguanosine, an in silico strategy was pursued and the intermediate alpha 1AT M* state modeled to allow molecular docking simulations and explore various potential binding sites. Docking results predict that S-(4-nitrobenzyl)-6-thioguanosine can bind at the s4A cavity and at the edge of beta-sheet A. The former binding site would directly block RCL insertion whereas the latter site would prevent beta-sheet A from expanding between s3A/s5A, and thus indirectly impede RCL insertion. Our investigations have revealed a novel compound that inhibits the formation of Z-α1AT polymers, as well as in vitro and in silico strategies for identifying and characterizing additional blocking molecules of Z-α1AT polymerization.« less

Insulin-like Growth Factor 1 Regulates the Expression of ATP-Binding Cassette Transporter A1 in Pancreatic Beta Cells.

PubMed

Lyu, J; Imachi, H; Iwama, H; Zhang, H; Murao, K

2016-05-01

ATP-binding cassette transporter A1 (ABCA1) in pancreatic beta cells influences insulin secretion and cholesterol homeostasis. The present study investigates whether insulin-like growth factor 1 (IGF-1), which mediates stimulation of ABCA1 gene expression, could also interfere with the phosphatidylinositol 3-kinase (PI3-K) cascade.ABCA1 expression was examined by real-time polymerase chain reaction (PCR), Western blot analysis, and a reporter gene assay in rat insulin-secreting INS-1 cells incubated with IGF-1. The binding of forkhead box O1 (FoxO1) protein to the ABCA1 promoter was assessed by a chromatin immunoprecipitation (ChIP) assay. ABCA1 protein levels increased in response to rising concentrations of IGF-1. Real-time PCR analysis showed a significant increase in ABCA1 mRNA expression. However, both effects were suppressed after silencing the IGF-1 receptor. In parallel with its effect on endogenous ABCA1 mRNA levels, IGF-1 induced the activity of a reporter construct containing the ABCA1 promoter, while it was abrogated by LY294002, a specific inhibitor of PI3-K. Constitutively active Akt stimulated activity of the ABCA1 promoter, and a dominant-negative mutant of Akt or mutagenesis of the FoxO1 response element in the ABCA1 promoter abolished the ability of IGF-1 to stimulate promoter activity. A ChIP assay showed that FoxO1 mediated its transcriptional activity by directly binding to the ABCA1 promoter region. The knockdown of FoxO1 disrupted the effect of IGF-1 on ABCA1 expression. Furthermore, IGF-1 promoted cholesterol efflux and reduced the pancreatic lipotoxicity. These results demonstrate that the PI3-K/Akt/FoxO1 pathway contributes to the regulation of ABCA1 expression in response to IGF-1 stimulation. © Georg Thieme Verlag KG Stuttgart · New York.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berthelier, Valerie; Harris, Jason Brett; Estenson, Kasey Noel

Polymerization of the Z variant alpha-1-antitrypsin (Z-α1AT) results in the most common and severe form of α1AT deficiency (α1ATD), a debilitating genetic disorder whose clinical manifestations range from asymptomatic to fatal liver and/or lung disease. As the altered conformation of Z-α1AT and its attendant aggregation are responsible for pathogenesis, the polymerization process per se has become a major target for the development of therapeutics. Based on the ability of Z-alpha 1AT to aggregate by recruiting the reactive center loop (RCL) of another Z-α1AT into its s4A cavity, we developed a high-throughput screening assay that uses a modified 6-mer peptide mimickingmore » the RCL to screen for inhibitors of Z-α1AT polymer growth. We used a subset of compounds from the Library of Pharmacologically Active Compounds (LOPAC) with molecular weights ranging from 300 to 700 Da, to evaluate the assay's capabilities. The inhibitor S-(4-nitrobenzyl)-6-thioguanosine was identified as a lead compound and its ability to prevent Z-α1AT polymerization confirmed by secondary assays. In order to further investigate the binding location of S-(4-nitrobenzyl)-6-thioguanosine, an in silico strategy was pursued and the intermediate alpha 1AT M* state modeled to allow molecular docking simulations and explore various potential binding sites. Docking results predict that S-(4-nitrobenzyl)-6-thioguanosine can bind at the s4A cavity and at the edge of beta-sheet A. The former binding site would directly block RCL insertion whereas the latter site would prevent beta-sheet A from expanding between s3A/s5A, and thus indirectly impede RCL insertion. Our investigations have revealed a novel compound that inhibits the formation of Z-α1AT polymers, as well as in vitro and in silico strategies for identifying and characterizing additional blocking molecules of Z-α1AT polymerization.« less

Effect of novel negative allosteric modulators of neuronal nicotinic receptors on cells expressing native and recombinant nicotinic receptors: implications for drug discovery.

PubMed

González-Cestari, Tatiana F; Henderson, Brandon J; Pavlovicz, Ryan E; McKay, Susan B; El-Hajj, Raed A; Pulipaka, Aravinda B; Orac, Crina M; Reed, Damon D; Boyd, R Thomas; Zhu, Michael X; Li, Chenglong; Bergmeier, Stephen C; McKay, Dennis B

2009-02-01

Allosteric modulation of nAChRs is considered to be one of the most promising approaches for drug design targeting nicotinic acetylcholine receptors (nAChRs). We have reported previously on the pharmacological activity of several compounds that seem to act noncompetitively to inhibit the activation of alpha3beta4(*) nAChRs. In this study, the effects of 51 structurally similar molecules on native and recombinant alpha3beta4 nAChRs are characterized. These 51 molecules inhibited adrenal neurosecretion activated via stimulation of native alpha3beta4(*) nAChR, with IC(50) values ranging from 0.4 to 13.0 microM. Using cells expressing recombinant alpha3beta4 nAChRs, these molecules inhibited calcium accumulation (a more direct assay to establish nAChR activity), with IC(50) values ranging from 0.7 to 38.2 microM. Radiolabeled nAChR binding studies to orthosteric sites showed no inhibitory activity on either native or recombinant nAChRs. Correlation analyses of the data from both functional assays suggested additional, non-nAChR activity of the molecules. To test this hypothesis, the effects of the drugs on neurosecretion stimulated through non-nAChR mechanisms were investigated; inhibitory effects ranged from no inhibition to 95% inhibition at concentrations of 10 microM. Correlation analyses of the functional data confirmed this hypothesis. Several of the molecules (24/51) increased agonist binding to native nAChRs, supporting allosteric interactions with nAChRs. Computational modeling and blind docking identified a binding site for our negative allosteric modulators near the orthosteric binding site of the receptor. In summary, this study identified several molecules for potential development as negative allosteric modulators and documented the importance of multiple screening assays for nAChR drug discovery.

Effect of Novel Negative Allosteric Modulators of Neuronal Nicotinic Receptors on Cells Expressing Native and Recombinant Nicotinic Receptors: Implications for Drug Discovery

PubMed Central

González-Cestari, Tatiana F.; Henderson, Brandon J.; Pavlovicz, Ryan E.; McKay, Susan B.; El-Hajj, Raed A.; Pulipaka, Aravinda B.; Orac, Crina M.; Reed, Damon D.; Boyd, R. Thomas; Zhu, Michael X.; Li, Chenglong; Bergmeier, Stephen C.; McKay, Dennis B.

2009-01-01

Allosteric modulation of nAChRs is considered to be one of the most promising approaches for drug design targeting nicotinic acetylcholine receptors (nAChRs). We have reported previously on the pharmacological activity of several compounds that seem to act noncompetitively to inhibit the activation of α3β4* nAChRs. In this study, the effects of 51 structurally similar molecules on native and recombinant α3β4 nAChRs are characterized. These 51 molecules inhibited adrenal neurosecretion activated via stimulation of native α3β4* nAChR, with IC50 values ranging from 0.4 to 13.0 μM. Using cells expressing recombinant α3β4 nAChRs, these molecules inhibited calcium accumulation (a more direct assay to establish nAChR activity), with IC50 values ranging from 0.7 to 38.2 μM. Radiolabeled nAChR binding studies to orthosteric sites showed no inhibitory activity on either native or recombinant nAChRs. Correlation analyses of the data from both functional assays suggested additional, non-nAChR activity of the molecules. To test this hypothesis, the effects of the drugs on neurosecretion stimulated through non-nAChR mechanisms were investigated; inhibitory effects ranged from no inhibition to 95% inhibition at concentrations of 10 μM. Correlation analyses of the functional data confirmed this hypothesis. Several of the molecules (24/51) increased agonist binding to native nAChRs, supporting allosteric interactions with nAChRs. Computational modeling and blind docking identified a binding site for our negative allosteric modulators near the orthosteric binding site of the receptor. In summary, this study identified several molecules for potential development as negative allosteric modulators and documented the importance of multiple screening assays for nAChR drug discovery. PMID:18984653

Identification of small molecule inhibitors of the Chikungunya virus nsP1 RNA capping enzyme.

PubMed

Feibelman, Kristen M; Fuller, Benjamin P; Li, Linfeng; LaBarbera, Daniel V; Geiss, Brian J

2018-06-01

Chikungunya virus (CHIKV) is an arthropod-borne alphavirus. Alphaviruses are positive strand RNA viruses that require a 5' cap structure to direct translation of the viral polyprotein and prevent degradation of the viral RNA genome by host cell nucleases. Formation of the 5' RNA cap is orchestrated by the viral protein nsP1, which binds GTP and provides the N-7 methyltransferase and guanylyltransferase activities that are necessary for cap formation. Viruses with aberrant nsP1 activity are unable to replicate effectively suggesting that nsP1 is a promising target for antiviral drug discovery. Given the absence of commercially available antiviral therapies for CHIKV, it is imperative to identify compounds that could be developed as potential therapeutics. This study details a high-throughput screen of 3051 compounds from libraries containing FDA-approved drugs, natural products, and known bioactives against CHIKV nsP1 using a fluorescence polarization-based GTP competition assay. Several small molecule hits from this screen were able to compete with GTP for the CHIKV nsP1 GTP binding site at low molar concentrations. Compounds were also evaluated with an orthogonal assay that measured the ability of nsP1 to perform the guanylation step of the capping reaction in the presence of inhibitor. In addition, live virus assays with CHIKV and closely related alphavirus, Sindbis virus, were used in conjunction with cell toxicity assays to determine the antiviral activity of compounds in cell culture. The naturally derived compound lobaric acid was found to inhibit CHIKV nsP1 GTP binding and guanylation as well as attenuate viral growth in vitro at both 24 hpi and 48 hpi in hamster BHK21 and human Huh 7 cell lines. These data indicate that development of lobaric acid and further exploration of CHIKV nsP1 as a drug target may aid in the progress of anti-alphaviral drug development strategies. Copyright © 2018. Published by Elsevier B.V.

miR-214 promotes the proliferation and invasion of osteosarcoma cells through direct suppression of LZTS1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Zhengyu; Wang, Tao, E-mail: wangtaohappy2010@sohu.com

2014-06-27

Highlights: • miR-214 is upregulated in human OS tissues and inversely correlated with LZTS1 expression. • miR-214 directly targets LZTS1 by binding to its 3′-UTR. • miR-214 promotes OS cell proliferation, invasion and tumor growth. • Overexpression of LZTS1 reverses miR-214-induced proliferation and invasion of OS cells. - Abstract: Previous studies have shown that miR-214 functions either as an oncogene or a tumor suppressor in various human cancer types. The role of this microRNA in osteosarcoma (OS) is presently unclear. Here, we demonstrated that miR-214 is frequently upregulated in OS specimens, compared with noncancerous bone tissues. Bioinformatics analysis further revealedmore » leucine zipper, putative tumor suppressor 1 (LZTS1) as a potential target of miR-214. Expression patterns of miR-214 were inversely correlated with those of LZTS1 mRNA and protein in OS tissues. Data from reporter assays showed that miR-214 directly binds to the 3′-untranslated region (3′-UTR) of LZTS1 mRNA and suppresses expression at both transcriptional and translational levels. In functional assays, miR-214 promoted OS cell proliferation, invasion and tumor growth in nude mice, which could be reversed by overexpression of LZTS1. Taken together, our data provide compelling evidence that miR-214 functions as an onco-miRNA in OS, and its oncogenic effects are mediated chiefly through downregulation of LZTS1.« less

Comparison of Simplexa HSV 1 & 2 PCR with culture, immunofluorescence, and laboratory-developed TaqMan PCR for detection of herpes simplex virus in swab specimens.

PubMed

Gitman, Melissa R; Ferguson, David; Landry, Marie L

2013-11-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type.

Comparison of Simplexa HSV 1 & 2 PCR with Culture, Immunofluorescence, and Laboratory-Developed TaqMan PCR for Detection of Herpes Simplex Virus in Swab Specimens

PubMed Central

Gitman, Melissa R.; Ferguson, David

2013-01-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type. PMID:24006008

The Human Orphan Nuclear Receptor Tailless (TLX, NR2E1) Is Druggable

PubMed Central

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S.; Hwang, Peter K.; Leonard, Paul G.; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J.; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open. PMID:24936658

The human orphan nuclear receptor tailless (TLX, NR2E1) is druggable.

PubMed

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S; Hwang, Peter K; Leonard, Paul G; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.

Mutation analysis and molecular modeling for the investigation of ligand-binding modes of GPR84.

PubMed

Nikaido, Yoshiaki; Koyama, Yuuta; Yoshikawa, Yasushi; Furuya, Toshio; Takeda, Shigeki

2015-05-01

GPR84 is a G protein-coupled receptor for medium-chain fatty acids. Capric acid and 3,3'-diindolylmethane are specific agonists for GPR84. We built a homology model of a GPR84-capric acid complex to investigate the ligand-binding mode using the crystal structure of human active-state β2-adrenergic receptor. We performed site-directed mutagenesis to subject ligand-binding sites to our model using GPR84-Giα fusion proteins and a [(35)S]GTPγS-binding assay. We compared the activity of the wild type and mutated forms of GPR84 by [(35)S]GTPγS binding to capric acid and diindolylmethane. The mutations L100D `Ballesteros-Weinstein numbering: 3.32), F101Y (3.33) and N104Q (3.36) in the transmembrane helix III and N357D (7.39) in the transmembrane helix VII resulted in reduced capric acid activity but maintained the diindolylmethane responses. Y186F (5.46) and Y186H (5.46) mutations had no characteristic effect on capric acid but with diindolylmethane they significantly affected the G protein activation efficiency. The L100D (3.32) mutant responded to decylamine, a fatty amine, instead of a natural agonist, the fatty acid capric acid, suggesting that we have identified a mutated G protein-coupled receptor-artificial ligand pairing. Our molecular model provides an explanation for these results and interactions between GPR84 and capric acid. Further, from the results of a double stimulation assay, we concluded that diindolylmethane was a positive allosteric modulator for GPR84. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed Central

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-01-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Transfer of sulfur from IscS to IscU during Fe/S cluster assembly.

PubMed

Urbina, H D; Silberg, J J; Hoff, K G; Vickery, L E

2001-11-30

The cysteine desulfurase enzymes NifS and IscS provide sulfur for the biosynthesis of Fe/S proteins. NifU and IscU have been proposed to serve as template or scaffold proteins in the initial Fe/S cluster assembly events, but the mechanism of sulfur transfer from NifS or IscS to NifU or IscU has not been elucidated. We have employed [(35)S]cysteine radiotracer studies to monitor sulfur transfer between IscS and IscU from Escherichia coli and have used direct binding measurements to investigate interactions between the proteins. IscS catalyzed transfer of (35)S from [(35)S]cysteine to IscU in the absence of additional thiol reagents, suggesting that transfer can occur directly and without involvement of an intermediate carrier. Surface plasmon resonance studies and isothermal titration calorimetry measurements further revealed that IscU binds to IscS with high affinity (K(d) approximately 2 microm) in support of a direct transfer mechanism. Transfer was inhibited by treatment of IscU with iodoacetamide, and (35)S was released by reducing reagents, suggesting that transfer of persulfide sulfur occurs to cysteinyl groups of IscU. A deletion mutant of IscS lacking C-terminal residues 376-413 (IscSDelta376-413) displayed cysteine desulfurase activity similar to the full-length protein but exhibited lower binding affinity for IscU, decreased ability to transfer (35)S to IscU, and reduced activity in assays of Fe/S cluster assembly on IscU. The findings with IscSDelta376-413 provide additional support for a mechanism of sulfur transfer involving a direct interaction between IscS and IscU and suggest that the C-terminal region of IscS may be important for binding IscU.

Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

PubMed

Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

2008-08-15

Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

A22 disrupts the bacterial actin cytoskeleton by directly binding and inducing a low-affinity state in MreB.

PubMed

Bean, G J; Flickinger, S T; Westler, W M; McCully, M E; Sept, D; Weibel, D B; Amann, K J

2009-06-09

S-(3,4-Dichlorobenzyl)isothiourea (A22) disrupts the actin cytoskeleton of bacteria, causing defects of morphology and chromosome segregation. Previous studies have suggested that the actin homologue MreB itself is the target of A22, but there has been no direct observation of A22 binding to MreB and no mechanistic explanation of its mode of action. We show that A22 binds MreB with at least micromolar affinity in its nucleotide-binding pocket in a manner that is sterically incompatible with simultaneous ATP binding. A22 negatively affects both the time course and extent of MreB polymerization in vitro in the presence of ATP. A22 prevents assembly of MreB into long, rigid polymers, as determined by both fluorescence microscopy and sedimentation assays. A22 increases the critical concentration of ATP-bound MreB assembly from 500 nM to approximately 2000 nM. We therefore conclude that A22 is a competitive inhibitor of ATP binding to MreB. A22-bound MreB is capable of polymerization, but with assembly properties that more closely resemble those of the ADP-bound state. Because the cellular concentration of MreB is in the low micromolar range, this mechanism explains the ability of A22 to largely disassemble the actin cytoskeleton in bacterial cells. It also represents a novel mode of action for a cytoskeletal drug and the first biochemical characterization of the interaction between a small molecule inhibitor of the bacterial cytoskeleton and its target.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Laboratory Testing for von Willebrand Disease: The Past, Present, and Future State of Play for von Willebrand Factor Assays that Measure Platelet Binding Activity, with or without Ristocetin.

PubMed

Just, Sarah

2017-02-01

von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Diagnostics for Yaws Eradication: Insights From Direct Next-Generation Sequencing of Cutaneous Strains of Treponema pallidum

PubMed Central

Marks, Michael; Fookes, Maria; Wagner, Josef; Butcher, Robert; Ghinai, Rosanna; Sokana, Oliver; Sarkodie, Yaw-Adu; Lukehart, Sheila A; Solomon, Anthony W; Mabey, David C W; Thomson, Nicholas

2018-01-01

Abstract Background Yaws-like chronic ulcers can be caused by Treponema pallidum subspecies pertenue, Haemophilus ducreyi, or other, still-undefined bacteria. To permit accurate evaluation of yaws elimination efforts, programmatic use of molecular diagnostics is required. The accuracy and sensitivity of current tools remain unclear because our understanding of T. pallidum diversity is limited by the low number of sequenced genomes. Methods We tested samples from patients with suspected yaws collected in the Solomon Islands and Ghana. All samples were from patients whose lesions had previously tested negative using the Centers for Disease Control and Prevention (CDC) diagnostic assay in widespread use. However, some of these patients had positive serological assays for yaws on blood. We used direct whole-genome sequencing to identify T. pallidum subsp pertenue strains missed by the current assay. Results From 45 Solomon Islands and 27 Ghanaian samples, 11 were positive for T. pallidum DNA using the species-wide quantitative polymerase chain reaction (PCR) assay, from which we obtained 6 previously undetected T. pallidum subsp pertenue whole-genome sequences. These show that Solomon Islands sequences represent distinct T. pallidum subsp pertenue clades. These isolates were invisible to the CDC diagnostic PCR assay, due to sequence variation in the primer binding site. Conclusions Our data double the number of published T. pallidum subsp pertenue genomes. We show that Solomon Islands strains are undetectable by the PCR used in many studies and by health ministries. This assay is therefore not adequate for the eradication program. Next-generation genome sequence data are essential for these efforts. PMID:29045605

Pathogenic Leptospira Species Acquire Factor H and Vitronectin via the Surface Protein LcpA

PubMed Central

da Silva, Ludmila Bezerra; Miragaia, Lidia dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima

2014-01-01

Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn2+-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. PMID:25534939

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Pathogenic Leptospira species acquire factor H and vitronectin via the surface protein LcpA.

PubMed

da Silva, Ludmila Bezerra; Miragaia, Lidia Dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima; Barbosa, Angela Silva

2015-03-01

Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn(2+)-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

Mechanistic Insights into Elastin Degradation by Pseudolysin, the Major Virulence Factor of the Opportunistic Pathogen Pseudomonas aeruginosa

PubMed Central

Yang, Jie; Zhao, Hui-Lin; Ran, Li-Yuan; Li, Chun-Yang; Zhang, Xi-Ying; Su, Hai-Nan; Shi, Mei; Zhou, Bai-Cheng; Chen, Xiu-Lan; Zhang, Yu-Zhong

2015-01-01

Pseudolysin is the most abundant protease secreted by Pseudomonas aeruginosa and is the major extracellular virulence factor of this opportunistic human pathogen. Pseudolysin destroys human tissues by solubilizing elastin. However, the mechanisms by which pseudolysin binds to and degrades elastin remain elusive. In this study, we investigated the mechanism of action of pseudolysin on elastin binding and degradation by biochemical assay, microscopy and site-directed mutagenesis. Pseudolysin bound to bovine elastin fibers and preferred to attack peptide bonds with hydrophobic residues at the P1 and P1’ positions in the hydrophobic domains of elastin. The time-course degradation processes of both bovine elastin fibers and cross-linked human tropoelastin by pseudolysin were further investigated by microscopy. Altogether, the results indicate that elastin degradation by pseudolysin began with the hydrophobic domains on the fiber surface, followed by the progressive disassembly of macroscopic elastin fibers into primary structural elements. Moreover, our site-directed mutational results indicate that five hydrophobic residues in the S1-S1’ sub-sites played key roles in the binding of pseudolysin to elastin. This study sheds lights on the pathogenesis of P. aeruginosa infection. PMID:25905792

BAG3 Directly Interacts with Mutated alphaB-Crystallin to Suppress Its Aggregation and Toxicity

PubMed Central

Hishiya, Akinori; Salman, Mortada Najem; Carra, Serena; Kampinga, Harm H.; Takayama, Shinichi

2011-01-01

A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein αB-crystallin gene (CRYAB) are reported to be responsible for myofibrillar myopathy. Here, we demonstrate that BAG3 directly binds to wild-type αB-crystallin and the αB-crystallin mutant R120G, via the intermediate domain of BAG3. Peptides that inhibit this interaction in an in vitro binding assay indicate that two conserved Ile-Pro-Val regions of BAG3 are involved in the interaction with αB-crystallin, which is similar to results showing BAG3 binding to HspB8 and HspB6. BAG3 overexpression increased αB-crystallin R120G solubility and inhibited its intracellular aggregation in HEK293 cells. BAG3 suppressed cell death induced by αB-crystallin R120G overexpression in differentiating C2C12 mouse myoblast cells. Our findings indicate a novel function for BAG3 in inhibiting protein aggregation caused by the genetic mutation of CRYAB responsible for human myofibrillar myopathy. PMID:21423662

Assessment of ability of murine and human anti-lipid A monoclonal antibodies to bind and neutralize lipopolysaccharide

PubMed Central

1993-01-01

The use of monoclonal antibodies (mAbs) directed to lipid A for the therapy of gram-negative sepsis is controversial. In an attempt to understand their biologic basis of action, we used a fluid-phase radioimmunoassay to measure binding between bacterial lipopolysaccharide (LPS) and two IgM mAbs directed to lipid A that are being evaluated for the treatment of gram-negative bacterial sepsis. Both antibodies bound 3H-LPS prepared from multiple strains of gram- negative bacteria when large excesses of antibody were used, although binding was modest and only slightly greater than control preparations. We also studied the ability of each anti-lipid A antibody to neutralize some of the biological effects of LPS in vitro. Despite large molar excesses, neither antibody neutralized LPS as assessed by the limulus lysate test, by a mitogenic assay for murine splenocytes, or by the production of cytokines interleukin (IL)-1, IL-6, or tumor necrosis factor from human monocytes in culture medium or in whole blood. Our experiments do not support the hypothesis that either of these anti- lipid A mAbs function by neutralizing the toxic effects of LPS. PMID:8418211

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

The RNA binding protein CsrA controls c-di-GMP metabolism by directly regulating the expression of GGDEF proteins

PubMed Central

Jonas, Kristina; Edwards, Adrianne N.; Simm, Roger; Romeo, Tony; Römling, Ute; Melefors, Öjar

2009-01-01

Summary The carbon storage regulator CsrA is an RNA binding protein that controls carbon metabolism, biofilm formation and motility in various eubacteria. Nevertheless, in Escherichia coli only five target mRNAs have been shown to be directly regulated by CsrA at the post-transcriptional level. Here we identified two new direct targets for CsrA, ycdT and ydeH, both of which encode proteins with GGDEF domains. A csrA mutation caused mRNA levels of ycdT and ydeH to increase more than 10-fold. RNA mobility shift assays confirmed the direct and specific binding of CsrA to the mRNA leaders of ydeH and ycdT. Overexpression of ycdT and ydeH resulted in a more than 20-fold increase in the cellular concentration of the second messenger c-di-GMP, implying that both proteins possess diguanylate cyclase activity. Phenotypic characterization revealed that both proteins are involved in the regulation of motility in a c-di-GMP dependent manner. CsrA was also found to regulate the expression of five additional GGDEF/EAL proteins and a csrA mutation led to modestly increased cellular levels of c-di-GMP. All together, these data demonstrate a global role for CsrA in the regulation of c-di-GMP metabolism by regulating the expression of GGDEF proteins at the post-transcriptional level. PMID:18713317

Direct binding to antigen-coated beads refines the specificity and cross-reactivity of four monoclonal antibodies that recognize polymorphic epitopes of HLA class I molecules.

PubMed

Hilton, H G; Parham, P

2013-04-01

Monoclonal antibodies with specificity for human leukocyte antigen (HLA) class I determinants of HLA were originally characterized using serological assays in which the targets were cells expressing three to six HLA class I variants. Because of this complexity, the specificities of the antibodies were defined indirectly by correlation. Here we use a direct binding assay, in which the targets are synthetic beads coated with 1 of 111 HLA class I variants, representing the full range of HLA-A, -B and -C variation. We studied one monoclonal antibody with monomorphic specificity (W6/32) and four with polymorphic specificity (MA2.1, PA2.1, BB7.2 and BB7.1) and compared the results with those obtained previously. W6/32 reacted with all HLA class I variants. MA2.1 not only exhibits high specificity for HLA-A*02, -B*57 and -B*58, but also exhibited cross-reactivity with HLA-A*11 and -B*15:16. At low concentration (1 µg/ml), PA2.1 and BB7.2 were both specific for HLA-A*02 and -A*69, and at high concentration (50 µg/ml) exhibited significant cross-reactions with HLA-A*68, -A*23 and -A*24. BB7.1 exhibits specificity for HLA-B*07 and -B*42, as previously described, but reacts equally well with HLA-B*81, a rare allotype defined some 16 years after the description of BB7.1. The results obtained with cell-based and bead-based assays are consistent and, in combination with amino acid sequence comparison, increase understanding of the polymorphic epitopes recognized by the MA2.1, PA2.1, BB7.2 and BB7.1 antibodies. Comparison of two overlapping but distinctive bead sets from two sources gave similar results, but the overall levels of binding were significantly different. Several weaker reactions were observed with only one of the bead sets. © 2013 John Wiley & Sons A/S.

Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

EPA Science Inventory

The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

Preclinical Evaluation of [(18)F]THK-5105 Enantiomers: Effects of Chirality on Its Effectiveness as a Tau Imaging Radiotracer.

PubMed

Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka

2016-04-01

Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.

The role of dimension in multivalent binding events: structure-activity relationship of dendritic polyglycerol sulfate binding to L-selectin in correlation with size and surface charge density.

PubMed

Weinhart, Marie; Gröger, Dominic; Enders, Sven; Riese, Sebastian B; Dernedde, Jens; Kainthan, Rajesh K; Brooks, Donald E; Haag, Rainer

2011-08-11

L-, P-, and E-Selectin are cell adhesion molecules that play a crucial role in leukocyte recruitment from the blood stream to the afflicted tissue in an acute and chronic inflammatory setting. Since selectins mediate the initial contact of leukocytes to the vascular endothelium, they have evolved as a valuable therapeutic target in diseases related to inflammation by inhibition of the physiological selectin-ligand interactions. In a previous study, it was demonstrated that dPGS, a fully synthetic heparin analogue, works as an efficient inhibitor towards L- and P-selectin in vitro as well as in vivo. Herein, the focus is directed towards the effect of size and charge density of the polyanion. The efficiency of L-selectin inhibition via an SPR-based in vitro assay and a cell-based flow chamber assay is investigated with dPGS ranging from approximately 4 to 2000 kDa. SPR measurements show that the inhibitory potential of highly sulfated dPGS increases with size and charge density. Thereby, IC(50) values from the micromolar to the low picomolar range are determined. The same tendency could be observed in a cell-based flow chamber assay with three representative dPGS samples. This structure-affinity relationship of dPGS suggests that the strong inhibitory potential of dPGS is not only based on the strong electrostatic interaction with areas of cationic surface potential on L-selectin but is also due to a steric shielding of the carbohydrate binding site by large, flexible dPGS particles. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An Extended Structure–Activity Relationship of Nondioxin-Like PCBs Evaluates and Supports Modeling Predictions and Identifies Picomolar Potency of PCB 202 Towards Ryanodine Receptors

PubMed Central

Feng, Wei; Zheng, Jing; Dong, Yao; Li, Xueshu; Lehmler, Hans-Joachim; Pessah, Isaac N.

2017-01-01

Nondioxin-like polychlorinated biphenyls (NDL PCBs) activate ryanodine-sensitive Ca2+ channels (RyRs) and this activation has been associated with neurotoxicity in exposed animals. RyR-active congeners follow a distinct structure–activity relationship and a quantitative structure–activity relationship (QSAR) predicts that a large number of PCBs likely activate the receptor, which requires validation. Additionally, previous structural based conclusions have been established using receptor ligand binding assays but the impact of varying PCB structures on ion channel gating behavior is not understood. We used [3H]Ryanodine ([3H]Ry) binding to assess the RyR-activity of 14 previously untested PCB congeners evaluating the predictability of the QSAR. Congeners determined to display widely varying potency were then assayed with single channel voltage clamp analysis to assess direct influences on channel gating kinetics. The RyR-activity of individual PCBs assessed in in vitro assays followed the general pattern predicted by the QSAR but binding and lipid bilayer experiments demonstrated higher potency than predicted. Of the 49 congeners tested to date, tetra-ortho PCB 202 was found to be the most potent RyR-active congener increasing channel open probability at 200 pM. Shifting meta-substitutions to the para-position resulted in a > 100-fold reduction in potency as seen with PCB 197. Non-ortho PCB 11 was found to lack activity at the receptor supporting a minimum mono-ortho substitution for PCB RyR activity. These findings expand and support previous SAR assessments; where out of the 49 congeners tested to date 42 activate the receptor demonstrating that the RyR is a sensitive and common target of PCBs. PMID:27655348

Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

PubMed

Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

2018-06-01

Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

PubMed

Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

2017-11-21

The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

Surface plasmon resonance as a tool for ligand-binding assay reagent characterization in bioanalysis of biotherapeutics.

PubMed

Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J

2018-04-01

Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.

A Comparison of Protein Kinases Inhibitor Screening Methods Using Both Enzymatic Activity and Binding Affinity Determination

PubMed Central

Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens

2014-01-01

Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177

Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

PubMed

Machida, Kazuya; Liu, Bernard

2017-01-01

Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

PubMed

Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

2017-01-01

One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

Circulating Immune Complexes in Lyme Arthritis

PubMed Central

Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.

1979-01-01

We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566

Two-way communication between SecY and SecA suggests a Brownian ratchet mechanism for protein translocation.

PubMed

Allen, William John; Corey, Robin Adam; Oatley, Peter; Sessions, Richard Barry; Baldwin, Steve A; Radford, Sheena E; Tuma, Roman; Collinson, Ian

2016-05-16

The essential process of protein secretion is achieved by the ubiquitous Sec machinery. In prokaryotes, the drive for translocation comes from ATP hydrolysis by the cytosolic motor-protein SecA, in concert with the proton motive force (PMF). However, the mechanism through which ATP hydrolysis by SecA is coupled to directional movement through SecYEG is unclear. Here, we combine all-atom molecular dynamics (MD) simulations with single molecule FRET and biochemical assays. We show that ATP binding by SecA causes opening of the SecY-channel at long range, while substrates at the SecY-channel entrance feed back to regulate nucleotide exchange by SecA. This two-way communication suggests a new, unifying 'Brownian ratchet' mechanism, whereby ATP binding and hydrolysis bias the direction of polypeptide diffusion. The model represents a solution to the problem of transporting inherently variable substrates such as polypeptides, and may underlie mechanisms of other motors that translocate proteins and nucleic acids.

SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

PubMed

Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

2018-05-22

Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

A binding site for non-steroidal anti-inflammatory drugs in FAAH

PubMed Central

Bertolacci, Laura; Romeo, Elisa; Veronesi, Marina; Magotti, Paola; Albani, Clara; Dionisi, Mauro; Lambruschini, Chiara; Scarpelli, Rita; Cavalli, Andrea; Vivo, Marco De; Piomelli, Daniele; Garau, Gianpiero

2013-01-01

In addition to inhibiting the cyclooxygenasemediated biosynthesis of prostanoids, various widely used non-steroidal anti-inflammatory drugs (NSAIDs) enhance endocannabinoid signaling by blocking the anandamidedegrading membrane enzyme, fatty acid amide hydrolase (FAAH). The X-ray structure of FAAH in complex with the NSAID carprofen, along with studies of site-directed mutagenesis, enzyme activity assays, and nuclear magnetic resonance, now reveal the molecular details of this interaction, providing information that may guide the design of dual FAAH-cyclooxygenase inhibitors with superior analgesic efficacy. PMID:23240907

Development of a Novel Method for Analyzing Pseudomonas aeruginosa Twitching Motility and Its Application to Define the AmrZ Regulon

PubMed Central

Xu, Binjie; Wozniak, Daniel J.

2015-01-01

Twitching motility is an important migration mechanism for the Gram-negative bacterium Pseudomonas aeruginosa. In the commonly used subsurface twitching assay, the sub-population of P. aeruginosa with active twitching motility is difficult to harvest for high-throughput studies. Here we describe the development of a novel method that allows efficient isolation of bacterial sub-populations conducting highly active twitching motility. The transcription factor AmrZ regulates multiple P. aeruginosa virulence factors including twitching motility, yet the mechanism of this activation remains unclear. We therefore set out to understand this mechanism by defining the AmrZ regulon using DNA microarrays in combination with the newly developed twitching motility method. We discovered 112 genes in the AmrZ regulon and many encode virulence factors. One gene of interest and the subsequent focus was lecB, which encodes a fucose-binding lectin. DNA binding assays revealed that AmrZ activates lecB transcription by directly binding to its promoter. The lecB gene was previously shown to be required for twitching motility in P. aeruginosa strain PAK; however, our lecB deletion had no effect on twitching motility in strain PAO1. Collectively, in this study a novel condition was developed for quantitative studies of twitching motility, under which the AmrZ regulon was defined. PMID:26309248

Identification of lipid-phosphatidylserine (PS) as the target of unbiasedly selected cancer specific peptide-peptoid hybrid PPS1.

PubMed

Desai, Tanvi J; Toombs, Jason E; Minna, John D; Brekken, Rolf A; Udugamasooriya, Damith Gomika

2016-05-24

Phosphatidylserine (PS) is an anionic phospholipid maintained on the inner-leaflet of the cell membrane and is externalized in malignant cells. We previously launched a careful unbiased selection targeting biomolecules (e.g. protein, lipid or carbohydrate) distinct to cancer cells by exploiting HCC4017 lung cancer and HBEC30KT normal epithelial cells derived from the same patient, identifying HCC4017 specific peptide-peptoid hybrid PPS1. In this current study, we identified PS as the target of PPS1. We validated direct PPS1 binding to PS using ELISA-like assays, lipid dot blot and liposome based binding assays. In addition, PPS1 recognized other negatively charged and cancer specific lipids such as phosphatidic acid, phosphatidylinositol and phosphatidylglycerol. PPS1 did not bind to neutral lipids such as phosphatidylethanolamine found in cancer and phosphatidylcholine and sphingomyelin found in normal cells. Further we found that the dimeric version of PPS1 (PPS1D1) displayed strong cytotoxicity towards lung cancer cell lines that externalize PS, but not normal cells. PPS1D1 showed potent single agent anti-tumor activity and enhanced the efficacy of docetaxel in mice bearing H460 lung cancer xenografts. Since PS and anionic phospholipid externalization is common across many cancer types, PPS1 may be an alternative to overcome limitations of protein targeted agents.

Combinatorial chemoenzymatic synthesis and high-throughput screening of sialosides.

PubMed

Chokhawala, Harshal A; Huang, Shengshu; Lau, Kam; Yu, Hai; Cheng, Jiansong; Thon, Vireak; Hurtado-Ziola, Nancy; Guerrero, Juan A; Varki, Ajit; Chen, Xi

2008-09-19

Although the vital roles of structures containing sialic acid in biomolecular recognition are well documented, limited information is available on how sialic acid structural modifications, sialyl linkages, and the underlying glycan structures affect the binding or the activity of sialic acid-recognizing proteins and related downstream biological processes. A novel combinatorial chemoenzymatic method has been developed for the highly efficient synthesis of biotinylated sialosides containing different sialic acid structures and different underlying glycans in 96-well plates from biotinylated sialyltransferase acceptors and sialic acid precursors. By transferring the reaction mixtures to NeutrAvidin-coated plates and assaying for the yields of enzymatic reactions using lectins recognizing sialyltransferase acceptors but not the sialylated products, the biotinylated sialoside products can be directly used, without purification, for high-throughput screening to quickly identify the ligand specificity of sialic acid-binding proteins. For a proof-of-principle experiment, 72 biotinylated alpha2,6-linked sialosides were synthesized in 96-well plates from 4 biotinylated sialyltransferase acceptors and 18 sialic acid precursors using a one-pot three-enzyme system. High-throughput screening assays performed in NeutrAvidin-coated microtiter plates show that whereas Sambucus nigra Lectin binds to alpha2,6-linked sialosides with high promiscuity, human Siglec-2 (CD22) is highly selective for a number of sialic acid structures and the underlying glycans in its sialoside ligands.

Monitoring the function of membrane transport proteins in detergent-solubilized form

PubMed Central

Quick, Matthias; Javitch, Jonathan A.

2007-01-01

Transport proteins constitute ≈10% of most proteomes and play vital roles in the translocation of solutes across membranes of all organisms. Their (dys)function is implicated in many disorders, making them frequent targets for pharmacotherapy. The identification of substrates for members of this large protein family, still replete with many orphans of unknown function, has proven difficult, in part because high-throughput screening is greatly complicated by endogenous transporters present in many expression systems. In addition, direct structural studies require that transporters be extracted from the membrane with detergent, thereby precluding transport measurements because of the lack of a vectorial environment and necessitating reconstitution into proteoliposomes for activity measurements. Here, we describe a direct scintillation proximity-based radioligand-binding assay for determining transport protein function in crude cell extracts and in purified form. This rapid and universally applicable assay with advantages over cell-based platforms will greatly facilitate the identification of substrates for many orphan transporters and allows monitoring the function of transport proteins in a nonmembranous environment. PMID:17360689

Screening for epitope specificity directly on culture supernatants in the early phase of monoclonal antibody production by an ELISA with biotin-labeled antigen.

PubMed

Andersen, Ditte C; Jensen, Charlotte H; Gregersen, Annemette; Brandt, Jette; Kliem, Anette; Skjødt, Karsten; Koch, Claus; Teisner, Børge

2004-01-01

This report describes an assay for comparison of epitope specificity in groups of monoclonal antibodies against a given antigen. The only prerequisite is the biotin-labeled antigen. One of the monoclonal antibodies is captured onto a plastic surface via a rabbit anti-mouse Ig, and the other preincubated with biotinylated antigen. When the two antibodies react with the same epitope subsequent binding of the biotin-labeled antigen is abolished (inhibition). In the cases where no inhibition was observed, the two antibodies were considered to react with distinct, independent epitopes. The obvious advantages using this assay, are that it can be performed directly on culture supernatants in the early phase of monoclonal antibody production, and also works for antigens with repetitive epitopes. Moreover, the bonus effect, i.e., a signal in excess of the reference signal when sets of monoclonal antibodies with different epitope specificity are compared, gives a relative measure of affinity.

The long non-coding RNA MALAT1 promotes the migration and invasion of hepatocellular carcinoma by sponging miR-204 and releasing SIRT1.

PubMed

Hou, Zhouhua; Xu, Xuwen; Zhou, Ledu; Fu, Xiaoyu; Tao, Shuhui; Zhou, Jiebin; Tan, Deming; Liu, Shuiping

2017-07-01

Increasing evidence supports the significance of long non-coding RNA in cancer development. Several recent studies suggest the oncogenic activity of long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) in hepatocellular carcinoma. In this study, we explored the molecular mechanisms by which MALAT1 modulates hepatocellular carcinoma biological behaviors. We found that microRNA-204 was significantly downregulated in sh-MALAT1 HepG2 cell and 15 hepatocellular carcinoma tissues by quantitative real-time polymerase chain reaction analysis. Through bioinformatic screening, luciferase reporter assay, RNA-binding protein immunoprecipitation, and RNA pull-down assay, we identified microRNA-204 as a potential interacting partner for MALAT1. Functionally, wound-healing and transwell assays revealed that microRNA-204 significantly inhibited the migration and invasion of hepatocellular carcinoma cells. Notably, sirtuin 1 was recognized as a direct downstream target of microRNA-204 in HepG2 cells. Moreover, si-SIRT1 significantly inhibited cell invasion and migration process. These data elucidated, by sponging and competitive binding to microRNA-204, MALAT1 releases the suppression on sirtuin 1, which in turn promotes hepatocellular carcinoma migration and invasion. This study reveals a novel mechanism by which MALAT1 stimulates hepatocellular carcinoma progression and justifies targeting metastasis-associated lung adenocarcinoma transcript 1 as a potential therapy for hepatocellular carcinoma.

Development of a Strategy Based on the Surface Plasmon Resonance Technology for Platelet Compatibility Testing.

PubMed

Wu, Chang-Lin; He, Jian-An; Gu, Da-Yong; Shao, Chao-Peng; Zhu, Yi; Dang, Xin-Tang

2018-01-01

This study was aimed to establish a novel strategy based on the surface plasmon resonance (SPR) technology for platelet compatibility testing. A novel surface matrix was prepared based on poly (OEGMA-co-HEMA) via surface-initiated polymerization as a biosensor surface platform. Type O universal platelets and donor platelets were immobilized on these novel matrices via amine-coupling reaction and worked as a capturing ligand for binding the platelet antibody. Antibodies binding to platelets were monitored in real time by injecting the samples into a microfluidic channel. Clinical serum samples (n = 186) with multiple platelet transfusions were assayed for platelet antibodies using the SPR technology and monoclonal antibody-immobilized platelet antigen (MAIPA) assay. The novel biosensor surface achieved nonfouling background and high immobilization capacity and showed good repeatability and stability after regeneration. The limit of detection of the SPR biosensor for platelet antibody was estimated to be 50 ng/mL. The sensitivity and specificity were 92% and 98.7%. It could detect the platelet antibody directly in serum samples, and the results were similar to MAIPA assay. A novel strategy to facilitate the sensitive and reliable detection of platelet compatibility for developing an SPR-based biosensor was established in this study. The SPR-based biosensor combined with novel surface chemistry is a promising method for platelet compatibility testing.

Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

PubMed

Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

2014-07-01

Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

Alpha-enolase on apical surface of renal tubular epithelial cells serves as a calcium oxalate crystal receptor

NASA Astrophysics Data System (ADS)

Fong-Ngern, Kedsarin; Thongboonkerd, Visith

2016-10-01

To search for a strategy to prevent kidney stone formation/recurrence, this study addressed the role of α-enolase on apical membrane of renal tubular cells in mediating calcium oxalate monohydrate (COM) crystal adhesion. Its presence on apical membrane and in COM crystal-bound fraction was confirmed by Western blotting and immunofluorescence staining. Pretreating MDCK cells with anti-α-enolase antibody, not isotype-controlled IgG, dramatically reduced cell-crystal adhesion. Immunofluorescence staining also confirmed the direct binding of purified α-enolase to COM crystals at {121} > {100} > {010} crystal faces. Coating COM crystals with urinary proteins diminished the crystal binding capacity to cells and purified α-enolase. Moreover, α-enolase selectively bound to COM, not other crystals. Chemico-protein interactions analysis revealed that α-enolase interacted directly with Ca2+ and Mg2+. Incubating the cells with Mg2+ prior to cell-crystal adhesion assay significantly reduced crystal binding on the cell surface, whereas preincubation with EDTA, a divalent cation chelator, completely abolished Mg2+ effect, indicating that COM and Mg2+ competitively bind to α-enolase. Taken together, we successfully confirmed the role of α-enolase as a COM crystal receptor to mediate COM crystal adhesion at apical membrane of renal tubular cells. It may also serve as a target for stone prevention by blocking cell-crystal adhesion and stone nidus formation.

Two novel assays for the detection of haemin-binding properties of antimalarials evaluated with compounds isolated from medicinal plants.

PubMed

Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J

2002-07-01

Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.

Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

PubMed

Hayward, C P M; Moffat, K A; Graf, L

2014-06-01

Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

PubMed Central

Shiang, Rita

2008-01-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

Carbonic anhydrase II binds to and increases the activity of the epithelial sodium-proton exchanger, NHE3

PubMed Central

Krishnan, Devishree; Liu, Lei; Wiebe, Shane A.; Casey, Joseph R.; Cordat, Emmanuelle; Alexander, R. Todd

2016-01-01

Two-thirds of sodium filtered by the renal glomerulus is reabsorbed from the proximal tubule via a sodium/proton exchanger isoform 3 (NHE3)-dependent mechanism. Since sodium and bicarbonate reabsorption are coupled, we postulated that the molecules involved in their reabsorption [NHE3 and carbonic anhydrase II (CAII)] might physically and functionally interact. Consistent with this, CAII and NHE3 were closely associated in a renal proximal tubular cell culture model as revealed by a proximity ligation assay. Direct physical interaction was confirmed in solid-phase binding assays with immobilized CAII and C-terminal NHE3 glutathione-S-transferase fusion constructs. To assess the effect of CAII on NHE3 function, we expressed NHE3 in a proximal tubule cell line and measured NHE3 activity as the rate of intracellular pH recovery, following an acid load. NHE3-expressing cells had a significantly greater rate of intracellular pH recovery than controls. Inhibition of endogenous CAII activity with acetazolamide significantly decreased NHE3 activity, indicating that CAII activates NHE3. To ascertain whether CAII binding per se activates NHE3, we expressed NHE3 with wild-type CAII, a catalytically inactive CAII mutant (CAII-V143Y), or a mutant unable to bind other transporters (CAII-HEX). NHE3 activity increased upon wild-type CAII coexpression, but not in the presence of the CAII V143Y or HEX mutant. Together these studies support an association between CAII and NHE3 that alters the transporter’s activity. PMID:26041446

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Design and development of a field applicable gold nanosensor for the detection of luteinizing hormone.

PubMed

Zambre, Ajit; Chanda, Nripen; Prayaga, Sudhirdas; Almudhafar, Rosana; Afrasiabi, Zahra; Upendran, Anandhi; Kannan, Raghuraman

2012-11-06

In this paper, we describe a novel strategy for the fabrication of a nanosensor for detecting luteinizing hormone (LH) of sheep using a gold nanoparticle-peptide conjugate. A new peptide sequence "CDHPPLPDILFL" (leutinizing hormone peptide, LHP) has been identified, using BLAST and Clustal W analysis, to detect antibody of LH (sheep). LHP has been synthesized and characterized, and their affinity toward anti-LH was established using enzyme linked immunosorbant assay (ELISA) technique. The thiol group in LHP directly binds with gold nanoparticles (AuNPs) to yield AuNP-LHP construct. Detailed physicochemical analysis of AuNP-LHP construct was determined using various analytical techniques. Nanosensor using gold nanoparticle peptide conjugate was developed on the basis of competitive binding of AuNP-LHP and LH toward anti-LH. Nitrocellulose membrane, precoated with anti-LH, was soaked in the mixture of AuNP-LHP and sample of analysis (LH). In the absence of LH (sheep), anti-LH coated on the membrane binds with AuNP-LHP, leading to a distinctive red color, while in the presence of LH, no color appeared in the membrane due to the interaction of anti-LH with LH thereby preventing the binding of AuNP-LHP with membrane bound anti-LH. The sensor assay developed in this study can detect LH (sheep) up to a minimal concentration of ∼50 ppm with a high degree of reproducibility and selectivity. The gold-nanoparticle-peptide based nanosensor would be a simple, portable, effective, and low cost technique for infield applications.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

VraR Binding to the Promoter Region of agr Inhibits Its Function in Vancomycin-Intermediate Staphylococcus aureus (VISA) and Heterogeneous VISA.

PubMed

Dai, Yuanyuan; Chang, Wenjiao; Zhao, Changcheng; Peng, Jing; Xu, Liangfei; Lu, Huaiwei; Zhou, Shusheng; Ma, Xiaoling

2017-05-01

Acquisition of vancomycin resistance in Staphylococcus aureus is often accompanied by a reduction in virulence, but the mechanisms underlying this change remain unclear. The present study was undertaken to investigate this process in a clinical heterogeneous vancomycin-intermediate S. aureus (hVISA) strain, 10827; an hVISA reference strain, Mu3; and a VISA reference strain, Mu50, along with their respective series of vancomycin-induced resistant strains. In these strains, increasing MICs of vancomycin were associated with increased expression of the vancomycin resistance-associated regulator gene ( vraR ) and decreased expression of virulence genes ( hla , hlb , and coa ) and virulence-regulated genes (RNAIII, agrA , and saeR ). These results suggested that VraR might have a direct or indirect effect on virulence in S. aureus In electrophoretic mobility shift assays, VraR did not bind to promoter sequences of hla , hlb , and coa genes, but it did bind to the agr promoter region. In DNase I footprinting assays, VraR protected a 15-nucleotide (nt) sequence in the intergenic region between the agr P2 and P3 promoters. These results indicated that when S. aureus is subject to induction by vancomycin, expression of vraR is upregulated, and VraR binding inhibits the function of the Agr quorum-sensing system, causing reductions in the virulence of VISA/hVISA strains. Our results suggested that VraR in S. aureus is involved not only in the regulation of vancomycin resistance but also in the regulation of virulence. Copyright © 2017 American Society for Microbiology.

Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiles, T.C.; Liu, J.L.; Rothstein, T.L.

1991-03-15

Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less

Mannan-binding lectin directly interacts with Toll-like receptor 4 and suppresses lipopolysaccharide-induced inflammatory cytokine secretion from THP-1 cells

PubMed Central

Wang, Mingyong; Chen, Yue; Zhang, Yani; Zhang, Liyun; Lu, Xiao; Chen, Zhengliang

2011-01-01

Mannan-binding lectin (MBL) plays a key role in the lectin pathway of complement activation and can influence cytokine expression. Toll-like receptor 4 (TLR4) is expressed extensively and has been demonstrated to be involved in lipopolysaccharide (LPS)-induced signaling. We first sought to determine whether MBL exposure could modulate LPS-induced inflammatory cytokine secretion and nuclear factor-κB (NF-κB) activity by using the monocytoid cell line THP-1. We then investigated the possible mechanisms underlying any observed regulatory effect. Using ELISA and reverse transcriptase polymerase chain reaction (RT-PCR) analysis, we found that at both the protein and mRNA levels, treatment with MBL suppresses LPS-induced tumor-necrosis factor (TNF)-α and IL-12 production in THP-1 cells. An electrophoretic mobility shift assay and western blot analysis revealed that MBL treatment can inhibit LPS-induced NF-κB DNA binding and translocation in THP-1 cells. While the binding of MBL to THP-1 cells was evident at physiological calcium concentrations, this binding occurred optimally in response to supraphysiological calcium concentrations. This binding can be partly inhibited by treatment with either a soluble form of recombinant TLR4 extracellular domain or anti-TLR4 monoclonal antibody (HTA125). Activation of THP-1 cells by LPS treatment resulted in increased MBL binding. We also observed that MBL could directly bind to the extracellular domain of TLR4 in a dose-dependent manner, and this interaction could attenuate the binding of LPS to cell surfaces. Taken together, these data suggest that MBL may affect cytokine expression through modulation of LPS-/TLR-signaling pathways. These findings suggest that MBL may play an important role in both immune regulation and the signaling pathways involved in cytokine networks. PMID:21383675

Evaluating Factor XIII Specificity for Glutamine-Containing Substrates Using a MALDI-TOF Mass Spectrometry Assay

PubMed Central

Doiphode, Prakash G.; Malovichko, Marina V.; Mouapi, Kelly Njine; Maurer, Muriel C.

2014-01-01

Activated Factor XIII (FXIIIa) catalyzes the formation of γ-glutamyl-ε-lysyl cross-links within the fibrin blood clot network. Although several cross-linking targets have been identified, the characteristic features that define FXIIIa substrate specificity are not well understood. To learn more about how FXIIIa selects its targets, a matrix-assisted laser desorption ionization – time of flight mass spectrometry (MALDI-TOF MS) based assay was developed that could directly follow the consumption of a glutamine-containing substrate and the formation of a cross-linked product with glycine ethylester. This FXIIIa kinetics assay is no longer reliant on a secondary coupled reaction, on substrate labeling, or on detecting the final deacylation portion of the transglutaminase reaction. With the MALDI-TOF MS assay, glutamine-containing peptides derived from α2-antiplasmin, S. Aureus fibronectin binding protein A, and thrombin activatable fibrinolysis inhibitor were examined directly. Results suggest that the FXIIIa active site surface responds to changes in substrate residues following the reactive glutamine. The P-1 substrate position is sensitive to charge character and the P-2 and P-3 to the broad FXIIIa substrate specificity pockets. The more distant P-8 to P-11 region serves as a secondary substrate anchoring point. New knowledge on FXIIIa specificity may be used to design better substrates or inhibitors of this transglutaminase. PMID:24751466

RNA Modulates the Interaction between Influenza A Virus NS1 and Human PABP1.

PubMed

Arias-Mireles, Bryan H; de Rozieres, Cyrus M; Ly, Kevin; Joseph, Simpson

2018-05-25

Nonstructural protein 1 (NS1) is a multifunctional protein involved in preventing host-interferon response in influenza A virus (IAV). Previous studies have indicated that NS1 also stimulates the translation of viral mRNA by binding to conserved sequences in the viral 5'-UTR. Additionally, NS1 binds to poly(A) binding protein 1 (PABP1) and eukaryotic initiation factor 4G (eIF4G). The interaction of NS1 with the viral 5'-UTR, PABP1, and eIF4G has been suggested to specifically enhance the translation of viral mRNAs. In contrast, we report that NS1 does not directly bind to sequences in the viral 5'-UTR, indicating that NS1 is not responsible for providing the specificity to stimulate viral mRNA translation. We also monitored the interaction of NS1 with PABP1 using a new, quantitative FRET assay. Our data show that NS1 binds to PABP1 with high affinity; however, the binding of double-stranded RNA (dsRNA) to NS1 weakens the binding of NS1 to PABP1. Correspondingly, the binding of PABP1 to NS1 weakens the binding of NS1 to double-stranded RNA (dsRNA). In contrast, the affinity of PABP1 for binding to poly(A) RNA is not significantly changed by NS1. We propose that the modulation of NS1·PABP1 interaction by dsRNA may be important for the viral cycle.

Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

PubMed Central

Alder, J Tracy; Hacksell, Uli; Strange, Philip G

2003-01-01

Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

Comparison of Chemical Binding to Recombinant Fathead minnow and Human Estrogen Receptor alpha (ERα) in Whole Cell and Cell-Free Assay Systems.

EPA Science Inventory

Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...

Measurement of Bluetongue Virus Binding to a Mammalian Cell Surface Receptor by an In Situ Immune Fluorescent Staining Technique

USDA-ARS?s Scientific Manuscript database

A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...

Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

PubMed

Dong, Q; Schuchman, J; Carey, G B

1994-07-01

The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

Performance evaluation and multicentre study of a von Willebrand factor activity assay based on GPIb binding in the absence of ristocetin.

PubMed

Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard

2014-12-01

The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Analysis of binding site for the novel small-molecule TLR4 signal transduction inhibitor TAK-242 and its therapeutic effect on mouse sepsis model

PubMed Central

Takashima, K; Matsunaga, N; Yoshimatsu, M; Hazeki, K; Kaisho, T; Uekata, M; Hazeki, O; Akira, S; Iizawa, Y; Ii, M

2009-01-01

Background and purpose: TAK-242, a novel synthetic small-molecule, suppresses production of multiple cytokines by inhibiting Toll-like receptor (TLR) 4 signalling. In this study, we investigated the target molecule of TAK-242 and examined its therapeutic effect in a mouse sepsis model. Experimental approach: Binding assay with [3H]-TAK-242 and nuclear factor-κB reporter assay were used to identify the target molecule and binding site of TAK-242. Bacillus calmette guerin (BCG)-primed mouse sepsis model using live Escherichia coli was used to estimate the efficacy of TAK-242 in sepsis. Key results: TAK-242 strongly bound to TLR4, but binding to TLR2, 3, 5, 9, TLR-related adaptor molecules and MD-2 was either not observed or marginal. Mutational analysis using TLR4 mutants indicated that TAK-242 inhibits TLR4 signalling by binding to Cys747 in the intracellular domain of TLR4. TAK-242 inhibited MyD88-independent pathway as well as MyD88-dependent pathway and its inhibitory effect was largely unaffected by lipopolysaccharide (LPS) concentration and types of TLR4 ligands. TAK-242 had no effect on the LPS-induced conformational change of TLR4-MD-2 and TLR4 homodimerization. In mouse sepsis model, although TAK-242 alone did not affect bacterial counts in blood, if co-administered with ceftazidime it inhibited the increases in serum cytokine levels and improved survival of mice. Conclusions and implications: TAK-242 suppressed TLR4 signalling by binding directly to a specific amino acid Cys747 in the intracellular domain of TLR4. When co-administered with antibiotics, TAK-242 showed potent therapeutic effects in an E. coli-induced sepsis model using BCG-primed mice. Thus, TAK-242 may be a promising therapeutic agent for sepsis. PMID:19563534

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

Holotrichia oblita Midgut Proteins That Bind to Bacillus thuringiensis Cry8-Like Toxin and Assembly of the H. oblita Midgut Tissue Transcriptome

PubMed Central

Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng

2017-01-01

ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549

Effect of single point mutations of the human tachykinin NK1 receptor on antagonist affinity.

PubMed

Lundstrom, K; Hawcock, A B; Vargas, A; Ward, P; Thomas, P; Naylor, A

1997-10-15

Molecular modelling and site-directed mutagenesis were used to identify eleven amino acid residues which may be involved in antagonist binding of the human tachykinin NK1 receptor. Recombinant receptors were expressed in mammalian cells using the Semliki Forest virus system. Wild type and mutant receptors showed similar expression levels in BHK and CHO cells, verified by metabolic labelling. Binding affinities were determined for a variety of tachykinin NK1 receptor antagonists in SFV-infected CHO cells. The binding affinity for GR203040, CP 99,994 and CP 96,345 was significantly reduced by mutant Q165A. The mutant F268A significantly reduced the affinity for GR203040 and CP 99,994 and the mutant H197A had reduced affinity for CP 96,345. All antagonists seemed to bind in a similar region of the receptor, but do not all rely on the same binding site interactions. Functional coupling to G-proteins was assayed by intracellular Ca2+ release in SFV-infected CHO cells. The wild type receptor and all mutants except A162L and F268A responded to substance P stimulation.

Metformin is a novel suppressor for transforming growth factor (TGF)-β1

NASA Astrophysics Data System (ADS)

Xiao, Han; Zhang, Jianshu; Xu, Zhonghe; Feng, Yenan; Zhang, Mingliang; Liu, Jianli; Chen, Ruifei; Shen, Jing; Wu, Jimin; Lu, Zhizhen; Fang, Xiaohong; Li, Jingyuan; Zhang, Youyi

2016-06-01

Metformin is a widely used first-line antidiabetic drug that has been shown to protect against a variety of specific diseases in addition to diabetes, including cardiovascular disorders, polycystic ovary syndrome, and cancer. However, the precise mechanisms underlying the diverse therapeutic effects of metformin remain elusive. Here, we report that transforming growth factor-β1 (TGF-β1), which is involved in the pathogenesis of numerous diseases, is a novel target of metformin. Using a surface plasmon resonance-based assay, we identified the direct binding of metformin to TGF-β1 and found that metformin inhibits [125I]-TGF-β1 binding to its receptor. Furthermore, based on molecular docking and molecular dynamics simulations, metformin was predicted to interact with TGF-β1 at its receptor-binding domain. Single-molecule force spectroscopy revealed that metformin reduces the binding probability but not the binding force of TGF-β1 to its type II receptor. Consequently, metformin suppresses type II TGF-β1 receptor dimerization upon exposure to TGF-β1, which is essential for downstream signal transduction. Thus, our results indicate that metformin is a novel TGF-β suppressor with therapeutic potential for numerous diseases in which TGF-β1 hyperfunction is indicated.

Binding of copper to lysozyme: Spectroscopic, isothermal titration calorimetry and molecular docking studies

NASA Astrophysics Data System (ADS)

Jing, Mingyang; Song, Wei; Liu, Rutao

2016-07-01

Although copper is essential to all living organisms, its potential toxicity to human health have aroused wide concerns. Previous studies have reported copper could alter physical properties of lysozyme. The direct binding of copper with lysozyme might induce the conformational and functional changes of lysozyme and then influence the body's resistance to bacterial attack. To better understand the potential toxicity and toxic mechanisms of copper, the interaction of copper with lysozyme was investigated by biophysical methods including multi-spectroscopic measurements, isothermal titration calorimetry (ITC), molecular docking study and enzyme activity assay. Multi-spectroscopic measurements proved that copper quenched the intrinsic fluorescence of lysozyme in a static process accompanied by complex formation and conformational changes. The ITC results indicated that the binding interaction was a spontaneous process with approximately three thermodynamical binding sites at 298 K and the hydrophobic force is the predominant driven force. The enzyme activity was obviously inhibited by the addition of copper with catalytic residues Glu 35 and Asp 52 locating at the binding sites. This study helps to elucidate the molecular mechanism of the interaction between copper and lysozyme and provides reference for toxicological studies of copper.