The Study of the Successive Metal-ligand Binding Energies for Fe(+), Fe(-), V(+) and Co(+)

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Ricca, Alessandra; Maitre, Philippe; Langhoff, Stephen R. (Technical Monitor)

1994-01-01

The successive binding energies of CO and H2O to Fe(+), CO to Fe(-), and H2 to Co(+) and V(+) are presented. Overall the computed results are in good agreement with experiment. The trends in binding energies are analyzed in terms of metal to ligand donation, ligand to metal donation, ligand-ligand repulsion, and changes in the metal atom, such as hybridization, promotion, and spin multiplicity. The geometry and vibrational frequencies are also shown to be directly affected by these effects.

The Study Of The Successive Metal-Ligand Binding Energies For Fe+, Fe-, V+ and Co+

NASA Technical Reports Server (NTRS)

Bauschicher, Charles W., Jr.; Ricca, Alessandra; Maitre, Philippe; Langhoff, Stephen R. (Technical Monitor)

1995-01-01

The successive binding energies of CO and H2O to Fe(+), CO to Fe(-), and H2 to Co(+) and V(+) are presented. Overall the computed results are in good agreement with experiment. The trends in binding energies are analyzed in terms of metal to ligand donation, ligand to metal donation, ligand-ligand repulsion, and changes in the metal atom, such as hybridization, promotion, and spin multiplicity. The geometry and vibrational frequencies are also shown to be directly affected by these effects.

RP-1776, a novel cyclic peptide produced by Streptomyces sp., inhibits the binding of PDGF to the extracellular domain of its receptor.

PubMed

Toki, S; Agatsuma, T; Ochiai, K; Saitoh, Y; Ando, K; Nakanishi, S; Lokker, N A; Giese, N A; Matsuda, Y

2001-05-01

RP-1776, a novel cyclic peptide, was isolated from the culture broth of Streptomyces sp. KY11784. RP-1776 selectively inhibited the binding of PDGF BB to the extracellular domain of the PDGF beta-receptor with an IC50 value of 11 +/- 6 microM. Detailed binding experiments suggested that RP-1776 directly interacts with PDGF BB. RP-1776 inhibited the phosphorylation of the PDGF beta-receptor induced by PDGF BB. These results suggested that RP-1776 antagonizes the signaling of PDGF BB probably through the inhibition of PDGF BB binding to the PDGF beta-receptor.

Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

PubMed

Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

2007-11-01

We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

Frequency of the first feature in action sequences influences feature binding.

PubMed

Mattson, Paul S; Fournier, Lisa R; Behmer, Lawrence P

2012-10-01

We investigated whether binding among perception and action feature codes is a preliminary step toward creating a more durable memory trace of an action event. If so, increasing the frequency of a particular event (e.g., a stimulus requiring a movement with the left or right hand in an up or down direction) should increase the strength and speed of feature binding for this event. The results from two experiments, using a partial-repetition paradigm, confirmed that feature binding increased in strength and/or occurred earlier for a high-frequency (e.g., left hand moving up) than for a low-frequency (e.g., right hand moving down) event. Moreover, increasing the frequency of the first-specified feature in the action sequence alone (e.g., "left" hand) increased the strength and/or speed of action feature binding (e.g., between the "left" hand and movement in an "up" or "down" direction). The latter finding suggests an update to the theory of event coding, as not all features in the action sequence equally determine binding strength. We conclude that action planning involves serial binding of features in the order of action feature execution (i.e., associations among features are not bidirectional but are directional), which can lead to a more durable memory trace. This is consistent with physiological evidence suggesting that serial order is preserved in an action plan executed from memory and that the first feature in the action sequence may be critical in preserving this serial order.

Specific Binding of Adamantane Drugs and Direction of their Polar Amines in the Pore of the Influenza M2 Transmembrane Domain in Lipid Bilayers and Dodecylphosphocholine Micelles Determined by NMR Spectroscopy

PubMed Central

Cady, Sarah D.; Wang, Jun; Wu, Yibing; DeGrado, William F.; Hong, Mei

2011-01-01

The transmembrane domain of the influenza M2 protein (M2TM) forms a tetrameric proton channel important for the virus lifecycle. The proton-channel activity is inhibited by amine-containing adamantyl drugs amantadine and rimantadine, which have been shown to bind specifically to the pore of M2TM near Ser31. However, whether the polar amine points to the N- or C-terminus of the channel has not yet been determined. Elucidating the polar group direction will shed light on the mechanism by which drug binding inhibits this proton channel and will facilitate rational design of new inhibitors. In this study, we determine the polar amine direction using M2TM reconstituted in lipid bilayers as well as DPC micelles. 13C-2H rotational-echo double-resonance NMR experiments of 13C-labeled M2TM and methyl-deuterated rimantadine in lipid bilayers showed that the polar amine pointed to the C-terminus of the channel, with the methyl group close to Gly34. Solution NMR experiments of M2TM in dodecylphosphocholine (DPC) micelles indicate that drug binding causes significant chemical shift perturbations of the protein that are very similar to those seen for M2TM and M2(18–60) bound to lipid bilayers. Specific 2H-labeling of the drugs permitted the assignment of drug-protein cross peaks, which indicate that amantadine and rimantadine bind to the pore in the same fashion as for bilayer-bound M2TM. These results strongly suggest that adamantyl inhibition of M2TM is achieved not only by direct physical occlusion of the pore but also by perturbing the equilibrium constant of the proton-sensing residue His37. The reproduction of the pharmacologically relevant specific pore-binding site in DPC micelles, which was not observed with a different detergent, DHPC, underscores the significant influence of the detergent environment on the functional structure of membrane proteins. PMID:21381693

In vitro DNA binding studies of Aspartame, an artificial sweetener.

PubMed

Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

2013-03-05

A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

Quantitative in vivo receptor binding. I. Theory and application to the muscarinic cholinergic receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frey, K.A.; Ehrenkaufer, R.L.; Beaucage, S.

1985-02-01

A novel approach to in vivo receptor binding experiments is presented which allows direct quantitation of binding site densities. The method is based on an equilibrium model of tracer uptake and is designed to produce a static distribution proportional to receptor density and to minimize possible confounding influences of regional blood flow, blood-brain barrier permeability, and nonspecific binding. This technique was applied to the measurement of regional muscarinic cholinergic receptor densities in rat brain using (/sup 3/H)scopolamine. Specific in vivo binding of scopolamine demonstrated saturability, a pharmacologic profile, and regional densities which are consistent with interaction of the tracer withmore » the muscarinic receptor. Estimates of receptor density obtained with the in vivo method and in vitro measurements in homogenates were highly correlated. Furthermore, reduction in striatal muscarinic receptors following ibotenic acid lesions resulted in a significant decrease in tracer uptake in vivo, indicating that the correlation between scopolamine distribution and receptor density may be used to demonstrate pathologic conditions. We propose that the general method presented here is directly applicable to investigation of high affinity binding sites for a variety of radioligands.« less

Involvement of the N-terminal part of cyclophilin B in the interaction with specific Jurkat T-cell binding sites.

PubMed

Mariller, C; Haendler, B; Allain, F; Denys, A; Spik, G

1996-07-15

Cyclophilin B (CyPB) is secreted in biological fluids such as blood or milk and binds to a specific receptor present on the human lymphoblastic cell line Jurkat and on human peripheral blood lymphocytes. This study was intended to specify the areas of CyPB that are involved in the interaction with the receptor. A synthetic peptide corresponding to the first 24 N-terminal amino acid residues of CyPB was shown to specifically recognize the receptor. Moreover, modification of Arg18 of CyPB by p-hydroxyphenlglyoxal led to a dramatic loss of affinity for the receptor. However, when this residue was replaced by an alanine residue using site-directed mutagenesis, no modification of the binding properties was found, suggesting that Arg18 is not directly involved but is sufficiently close to the interaction site to interfere with the binding when modified. Competitive binding experiments using a chimaeric protein made up of the 24 N-terminal amino acid residues of CyPB fused to the cyclophilin A core sequence confirmed the involvement of this region of CyPB in receptor binding.

What's in a "face file"? Feature binding with facial identity, emotion, and gaze direction.

PubMed

Fitousi, Daniel

2017-07-01

A series of four experiments investigated the binding of facial (i.e., facial identity, emotion, and gaze direction) and non-facial (i.e., spatial location and response location) attributes. Evidence for the creation and retrieval of temporary memory face structures across perception and action has been adduced. These episodic structures-dubbed herein "face files"-consisted of both visuo-visuo and visuo-motor bindings. Feature binding was indicated by partial-repetition costs. That is repeating a combination of facial features or altering them altogether, led to faster responses than repeating or alternating only one of the features. Taken together, the results indicate that: (a) "face files" affect both action and perception mechanisms, (b) binding can take place with facial dimensions and is not restricted to low-level features (Hommel, Visual Cognition 5:183-216, 1998), and (c) the binding of facial and non-facial attributes is facilitated if the dimensions share common spatial or motor codes. The theoretical contributions of these results to "person construal" theories (Freeman, & Ambady, Psychological Science, 20(10), 1183-1188, 2011), as well as to face recognition models (Haxby, Hoffman, & Gobbini, Biological Psychiatry, 51(1), 59-67, 2000) are discussed.

Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

PubMed Central

Yoder-Himes, Deborah R.; Kroos, Lee

2006-01-01

The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou,Z.; Zhen, J.; Karpowich, N.

2007-01-01

Tricyclic antidepressants exert their pharmacological effect -- inhibiting the reuptake of serotonin, norepinephrine, and dopamine -- by directly blocking neurotransmitter transporters (SERT, NET, and DAT, respectively) in the presynaptic membrane. The drug-binding site and the mechanism of this inhibition are poorly understood. We determined the crystal structure at 2.9 angstroms of the bacterial leucine transporter (LeuT), a homolog of SERT, NET, and DAT, in complex with leucine and the antidepressant desipramine. Desipramine binds at the inner end of the extracellular cavity of the transporter and is held in place by a hairpin loop and by a salt bridge. This bindingmore » site is separated from the leucine-binding site by the extracellular gate of the transporter. By directly locking the gate, desipramine prevents conformational changes and blocks substrate transport. Mutagenesis experiments on human SERT and DAT indicate that both the desipramine-binding site and its inhibition mechanism are probably conserved in the human neurotransmitter transporters.« less

Knowing in Your Gut and in Your Head: Doing Theater and My Underlying Epistemology of Communication. Playwright and Director Reflections on "Ties That Bind."

ERIC Educational Resources Information Center

Taylor, Steven S.

2003-01-01

Describes the author's experience in writing and directing a staged reading of "Ties That Bind" at the 2002 Academy of Management Meetings in Denver as an all-academy symposium. Presents an epistemology that includes knowing in your gut and knowing in your head. Hopes to facilitate a move within the audience from being a feeling but passive…

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Differential Binding Models for Direct and Reverse Isothermal Titration Calorimetry.

PubMed

Herrera, Isaac; Winnik, Mitchell A

2016-03-10

Isothermal titration calorimetry (ITC) is a technique to measure the stoichiometry and thermodynamics from binding experiments. Identifying an appropriate mathematical model to evaluate titration curves of receptors with multiple sites is challenging, particularly when the stoichiometry or binding mechanism is not available. In a recent theoretical study, we presented a differential binding model (DBM) to study calorimetry titrations independently of the interaction among the binding sites (Herrera, I.; Winnik, M. A. J. Phys. Chem. B 2013, 117, 8659-8672). Here, we build upon our DBM and show its practical application to evaluate calorimetry titrations of receptors with multiple sites independently of the titration direction. Specifically, we present a set of ordinary differential equations (ODEs) with the general form d[S]/dV that can be integrated numerically to calculate the equilibrium concentrations of free and bound species S at every injection step and, subsequently, to evaluate the volume-normalized heat signal (δQ(V) = δq/dV) of direct and reverse calorimetry titrations. Additionally, we identify factors that influence the shape of the titration curve and can be used to optimize the initial concentrations of titrant and analyte. We demonstrate the flexibility of our updated DBM by applying these differentials and a global regression analysis to direct and reverse calorimetric titrations of gadolinium ions with multidentate ligands of increasing denticity, namely, diglycolic acid (DGA), citric acid (CIT), and nitrilotriacetic acid (NTA), and use statistical tests to validate the stoichiometries for the metal-ligand pairs studied.

The Study of the Successive Metal-Ligand Binding Energies for Fe(sup +), Fe(sup -), V(sup +) and Co(sup +)

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Ricca, Alessandra; Maitre, Philippe; Langhoff, Stephen R. (Technical Monitor)

1995-01-01

The successive binding energies of CO and H2O to Fe(sup +), CO to Fe(sup -), and H2 to Co(sup +) and V(sup +) are presented. Overall the computed results are in good agreement with experiment. The trends in binding energies are analyzed in terms of metal to ligand donation, ligand to metal donation, ligand-ligand repulsion, and changes in the metal atom, such as hybridization, promotion, and spin multiplicity. The geometry and vibrational frequencies are also shown to be directly affected by these effects.

Synthetic Ubiquinones Specifically Bind to Mitochondrial Voltage-Dependent Anion Channel 1 (VDAC1) in Saccharomyces cerevisiae Mitochondria.

PubMed

Murai, Masatoshi; Okuda, Ayaka; Yamamoto, Takenori; Shinohara, Yasuo; Miyoshi, Hideto

2017-01-31

The role of the voltage-dependent anion channel (VDAC) as a metabolic gate of the mitochondrial outer membrane has been firmly established; however, its involvement in the regulation of mitochondrial permeability transition (PT) remains extremely controversial. Although some low-molecular-weight chemicals have been proposed to modulate the regulatory role of VDAC in the induction of PT, direct binding between these chemicals and VDAC has not yet been demonstrated. In the present study, we investigated whether the ubiquinone molecule directly binds to VDAC in Saccharomyces cerevisiae mitochondria through a photoaffinity labeling technique using two photoreactive ubiquinones (PUQ-1 and PUQ-2). The results of the labeling experiments demonstrated that PUQ-1 and PUQ-2 specifically bind to VDAC1 and that the labeled position is located in the C-terminal region Phe221-Lys234, connecting the 15th and 16th β-strand sheets. Mutations introduced in this region (R224A, Y225A, D228A, and Y225A/D228A) hardly affected the binding affinity of PUQ-1. PUQ-1 and PUQ-2 both significantly suppressed the Ca 2+ -induced mitochondrial PT (monitored by mitochondrial swelling) at the one digit μM level. Thus, the results of the present study provided, for the first time to our knowledge, direct evidence indicating that the ubiquinone molecule specifically binds to VDAC1 through its quinone-head ring.

Linking phytoplankton and bacterioplankton community dynamics to iron-binding ligand production in a microcosm experiment

NASA Astrophysics Data System (ADS)

Hogle, S. L.; Bundy, R.; Barbeau, K.

2016-02-01

Several significant lines of evidence implicate heterotrophic bacterioplankton as agents of iron cycling and sources of iron-binding ligands in seawater, but direct and mechanistic linkages have mostly remained elusive. Currently, it is unknown how microbial community composition varies during the course of biogenic particle remineralization and how shifts in community structure are related to sources and sinks of Fe-binding ligands. In order to simulate the rise, decline, and ultimate remineralization of a phytoplankton bloom, we followed the production of different classes of Fe-binding ligands as measured by electrochemical techniques, Fe concentrations, and macronutrient concentrations in a series of iron-amended whole seawater incubations over a period of six days during a California Current Ecosystem Long Term Ecological Research (CCE-LTER) process cruise. At the termination of the experiment phytoplankton communities were similar across iron treatments, but high iron conditions generated greater phytoplankton biomass and increased nutrient drawdown suggesting that phytoplankton communities were in different phases of bloom development. Strikingly, L1 ligands akin to siderophores in binding strength were only observed in high iron treatments implicating phytoplankton bloom phase as an important control. Using high-throughput 16S rRNA gene surveys, we observed that the abundance of transiently dominant copiotroph bacteria were strongly correlated with L1 concentrations. However, incubations with similar L1 concentrations and binding strengths produced distinct copiotroph community profiles dominated by a few strains. We suggest that phytoplankton bloom maturity influences algal-associated heterotrophic community succession, and that L1 production is either directly or indirectly tied to the appearance and eventual dominance of rarely abundant copiotroph bacterial strains.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.

PubMed

Hu, Xiaotang; Li, Hongbin

2014-10-01

Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

PubMed Central

2016-01-01

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

PubMed

Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

2017-01-26

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.

A Cross-Species Study of PI3K Protein-Protein Interactions Reveals the Direct Interaction of P85 and SHP2

NASA Astrophysics Data System (ADS)

Breitkopf, Susanne B.; Yang, Xuemei; Begley, Michael J.; Kulkarni, Meghana; Chiu, Yu-Hsin; Turke, Alexa B.; Lauriol, Jessica; Yuan, Min; Qi, Jie; Engelman, Jeffrey A.; Hong, Pengyu; Kontaridis, Maria I.; Cantley, Lewis C.; Perrimon, Norbert; Asara, John M.

2016-02-01

Using a series of immunoprecipitation (IP) - tandem mass spectrometry (LC-MS/MS) experiments and reciprocal BLAST, we conducted a fly-human cross-species comparison of the phosphoinositide-3-kinase (PI3K) interactome in a drosophila S2R+ cell line and several NSCLC and human multiple myeloma cell lines to identify conserved interacting proteins to PI3K, a critical signaling regulator of the AKT pathway. Using H929 human cancer cells and drosophila S2R+ cells, our data revealed an unexpected direct binding of Corkscrew, the drosophila ortholog of the non-receptor protein tyrosine phosphatase type II (SHP2) to the Pi3k21B (p60) regulatory subunit of PI3K (p50/p85 human ortholog) but no association with Pi3k92e, the human ortholog of the p110 catalytic subunit. The p85-SHP2 association was validated in human cell lines, and formed a ternary regulatory complex with GRB2-associated-binding protein 2 (GAB2). Validation experiments with knockdown of GAB2 and Far-Western blots proved the direct interaction of SHP2 with p85, independent of adaptor proteins and transfected FLAG-p85 provided evidence that SHP2 binding on p85 occurred on the SH2 domains. A disruption of the SHP2-p85 complex took place after insulin/IGF1 stimulation or imatinib treatment, suggesting that the direct SHP2-p85 interaction was both independent of AKT activation and positively regulates the ERK signaling pathway.

Absence of C-type natriuretic peptide receptors in hamster glomeruli.

PubMed

Luk, J K; Wong, E F; Wong, N L

1994-01-01

The distribution of atrial natriuretic peptide receptor B (ANPR-B) varies between tissues and species. The aim of this study is to determine whether ANPR-B is present in the hamster glomeruli. In vitro C-type natriuretic peptide (CNP)- and atrial natriuretic factor (ANF)-stimulated cGMP accumulation studies were performed in hamster glomeruli. Elevated cGMP accumulations were observed upon ANF addition. No cGMP response was seen with CNP. Competitive receptor-binding experiments were performed with 125I-CNP and 125I-ANF against their respective cold peptides in hamster glomeruli. Although no CNP binding was detected, positive ANF binding was found and two types of ANF receptor were demonstrated. The affinity (Kdl) and maximum binding capacity (Bmaxl) of the high-affinity ANF receptor were 0.014 +/- 0.001 nM and 60.4 +/- 10.2 fmol/mg protein, respectively. Those of the low-affinity receptor (Kd2 and Bmax2) were 45.7 +/- 6.2 nM and 28.3 +/- 6.3 pmol/mg protein, respectively. Similarly, saturation binding experiments also failed to show any CNP receptor binding in hamster glomeruli. This finding suggests that ANPR-B is not present in hamster glomeruli and CNP is not a direct physiological regulator of hamster renal function.

The investigation of the binding of 6-mercaptopurine to site I on human serum albumin.

PubMed

Sochacka, Jolanta; Baran, Wojciech

2012-12-01

6-Mercaptopurine (6-MP) is one of a large series of purine analogues which has been found active against human leukemias. The equilibrium dialysis, circular dichroism (CD) and molecular docking were employed to study the binding of 6-MP to human serum albumin (HSA). The binding of 6-MP to HSA in the equilibrium dialysis experiment was detected by measuring the displacement of 6-MP by specific markers for site I on HSA, warfarin (RWF), phenylbutazone (PhB) and n-butyl p-aminobenzoate (ABE). It was shown, according to CD data, that binding of 6-MP to HSA leads to alteration of HSA secondary structure. Based on the findings from displacement experiment and molecular docking simulation it was found that 6-MP was located within binding cavity of subdomain IIA and the space occupied by site markers overlapped with that of 6-MP. Displacement of 6-MP by the RWF or PhB was not up the level expected for a competitive mechanism, therefore displacement of 6-MP was rather by non-cooperative than that the direct competition. Instead, in case of the interaction between ABE and 6-MP, when the little enhancement of the binding of ABE by 6-MP was found, the interaction could be via a positively cooperative mechanism.

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

PubMed

Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

2008-05-15

Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Structure of AadA from Salmonella enterica: a monomeric aminoglycoside (3′′)(9) adenyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yang; Näsvall, Joakim; Wu, Shiying

The crystal structure of the aminoglycoside-adenylating enzyme AadA is reported together with functional experiments providing insights into its oligomeric state, ligand binding and catalysis. Aminoglycoside resistance is commonly conferred by enzymatic modification of drugs by aminoglycoside-modifying enzymes such as aminoglycoside nucleotidyltransferases (ANTs). Here, the first crystal structure of an ANT(3′′)(9) adenyltransferase, AadA from Salmonella enterica, is presented. AadA catalyses the magnesium-dependent transfer of adenosine monophosphate from ATP to the two chemically dissimilar drugs streptomycin and spectinomycin. The structure was solved using selenium SAD phasing and refined to 2.5 Å resolution. AadA consists of a nucleotidyltransferase domain and an α-helical bundlemore » domain. AadA crystallizes as a monomer and is a monomer in solution as confirmed by small-angle X-ray scattering, in contrast to structurally similar homodimeric adenylating enzymes such as kanamycin nucleotidyltransferase. Isothermal titration calorimetry experiments show that ATP binding has to occur before binding of the aminoglycoside substrate, and structure analysis suggests that ATP binding repositions the two domains for aminoglycoside binding in the interdomain cleft. Candidate residues for ligand binding and catalysis were subjected to site-directed mutagenesis. In vivo resistance and in vitro binding assays support the role of Glu87 as the catalytic base in adenylation, while Arg192 and Lys205 are shown to be critical for ATP binding.« less

Combinatorial activation and concentration-dependent repression of the Drosophila even skipped stripe 3+7 enhancer

PubMed Central

Struffi, Paolo; Corado, Maria; Kaplan, Leah; Yu, Danyang; Rushlow, Christine; Small, Stephen

2011-01-01

Despite years of study, the precise mechanisms that control position-specific gene expression during development are not understood. Here, we analyze an enhancer element from the even skipped (eve) gene, which activates and positions two stripes of expression (stripes 3 and 7) in blastoderm stage Drosophila embryos. Previous genetic studies showed that the JAK-STAT pathway is required for full activation of the enhancer, whereas the gap genes hunchback (hb) and knirps (kni) are required for placement of the boundaries of both stripes. We show that the maternal zinc-finger protein Zelda (Zld) is absolutely required for activation, and present evidence that Zld binds to multiple non-canonical sites. We also use a combination of in vitro binding experiments and bioinformatics analysis to redefine the Kni-binding motif, and mutational analysis and in vivo tests to show that Kni and Hb are dedicated repressors that function by direct DNA binding. These experiments significantly extend our understanding of how the eve enhancer integrates positive and negative transcriptional activities to generate sharp boundaries in the early embryo. PMID:21865322

Physical and mental effort disrupts the implicit sense of agency.

PubMed

Howard, Emma E; Edwards, S Gareth; Bayliss, Andrew P

2016-12-01

We investigated the effect of effort on implicit agency ascription for actions performed under varying levels of physical effort or cognitive load. People are able to estimate the interval between two events accurately, but they underestimate the interval between their own actions and their outcomes. This effect is known as 'intentional binding', and may provide feedback regarding the consequences of our actions. Concurrently with the interval reproduction task, our participants pulled sports resistance bands at high and low resistance levels (Experiments 1 and 2), or performed a working memory task with high and low set-sizes (Experiment 3). Intentional binding was greater under low than high effort. When the effort was task-related (Experiment 1), this effect depended on the individual's explicit appraisal of exertion, while the effect of effort was evident at the group level when the effort was task-unrelated (physical, Experiment 2; mental, Experiment 3). These findings imply that the process of intentional binding is compromised when cognitive resources are depleted, either through physical or mental strain. We discuss this notion in relation to the integration of direct sensorimotor feedback with signals of agency and other instances of cognitive resource depletion and action control during strain. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

PubMed

Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

2009-11-01

The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

Phosphoinositide-interacting regulator of TRP (PIRT) has opposing effects on human and mouse TRPM8 ion channels.

PubMed

Hilton, Jacob K; Salehpour, Taraneh; Sisco, Nicholas J; Rath, Parthasarathi; Van Horn, Wade D

2018-06-15

Transient receptor potential melastatin 8 (TRPM8) is a cold-sensitive ion channel with diverse physiological roles. TRPM8 activity is modulated by many mechanisms, including an interaction with the small membrane protein phosphoinositide-interacting regulator of TRP (PIRT). Here, using comparative electrophysiology experiments, we identified species-dependent differences between the human and mouse TRPM8-PIRT complexes. We found that human PIRT attenuated human TPRM8 conductance, unlike mouse PIRT, which enhanced mouse TRPM8 conductance. Quantitative Western blot analysis demonstrates that this effect does not arise from decreased trafficking of TRPM8 to the plasma membrane. Chimeric human/mouse TRPM8 channels were generated to probe the molecular basis of the PIRT modulation, and the effect was recapitulated in a pore domain chimera, demonstrating the importance of this region for PIRT-mediated regulation of TRPM8. Moreover, recombinantly expressed and purified human TRPM8 S1-S4 domain (comprising transmembrane helices S1-S4, also known as the sensing domain, ligand-sensing domain, or voltage sensing-like domain) and full-length human PIRT were used to investigate binding between the proteins. NMR experiments, supported by a pulldown assay, indicated that PIRT binds directly and specifically to the TRPM8 S1-S4 domain. Binding became saturated as the S1-S4:PIRT mole ratio approached 1. Our results have uncovered species-specific TRPM8 modulation by PIRT. They provide evidence for a direct interaction between PIRT and the TRPM8 S1-S4 domain with a 1:1 binding stoichiometry, suggesting that a functional tetrameric TRPM8 channel has four PIRT-binding sites. © 2018 Hilton et al.

The binding domain of the HMGB1 inhibitor carbenoxolone: Theory and experiment

NASA Astrophysics Data System (ADS)

Mollica, Luca; Curioni, Alessandro; Andreoni, Wanda; Bianchi, Marco E.; Musco, Giovanna

2008-05-01

We present a combined computational and experimental study of the interaction of the Box A of the HMGB1 protein and carbenoxolone, an inhibitor of its pro-inflammatory activity. The computational approach consists of classical molecular dynamics (MD) simulations based on the GROMOS force field with quantum-refined (QRFF) atomic charges for the ligand. Experimental data consist of fluorescence intensities, chemical shift displacements, saturation transfer differences and intermolecular Nuclear Overhauser Enhancement signals. Good agreement is found between observations and the conformation of the ligand-protein complex resulting from QRFF-MD. In contrast, simple docking procedures and MD based on the unrefined force field provide models inconsistent with experiment. The ligand-protein binding is dominated by non-directional interactions.

Supramolecular binding and separation of hydrocarbons within a functionalized porous metal–organic framework

DOE PAGES

Yang, Sihai; Ramirez-Cuesta, Anibal J.; Newby, Ruth; ...

2014-12-01

Supramolecular interactions are fundamental to host–guest binding in many chemical and biological processes. Direct visualization of such supramolecular interactions within host–guest systems is extremely challenging, but crucial to understanding their function. Within this paper, we report a comprehensive study that combines neutron scattering, synchrotron X-ray and neutron diffraction, and computational modelling to define the detailed binding at a molecular level of acetylene, ethylene and ethane within the porous host NOTT-300. This study reveals simultaneous and cooperative hydrogen-bonding, π···π stacking interactions and intermolecular dipole interactions in the binding of acetylene and ethylene to give up to 12 individual weak supramolecular interactionsmore » aligned within the host to form an optimal geometry for the selective binding of hydrocarbons. In addition, we also report the cooperative binding of a mixture of acetylene and ethylene within the porous host, together with the corresponding breakthrough experiments and analysis of adsorption isotherms of gas mixtures.« less

Protein unfolding as a switch from self-recognition to high-affinity client binding

PubMed Central

Groitl, Bastian; Horowitz, Scott; Makepeace, Karl A. T.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.; Reichmann, Dana; Bardwell, James C. A.; Jakob, Ursula

2016-01-01

Stress-specific activation of the chaperone Hsp33 requires the unfolding of a central linker region. This activation mechanism suggests an intriguing functional relationship between the chaperone's own partial unfolding and its ability to bind other partially folded client proteins. However, identifying where Hsp33 binds its clients has remained a major gap in our understanding of Hsp33's working mechanism. By using site-specific Fluorine-19 nuclear magnetic resonance experiments guided by in vivo crosslinking studies, we now reveal that the partial unfolding of Hsp33's linker region facilitates client binding to an amphipathic docking surface on Hsp33. Furthermore, our results provide experimental evidence for the direct involvement of conditionally disordered regions in unfolded protein binding. The observed structural similarities between Hsp33's own metastable linker region and client proteins present a possible model for how Hsp33 uses protein unfolding as a switch from self-recognition to high-affinity client binding. PMID:26787517

Antibody humanization by molecular dynamics simulations-in-silico guided selection of critical backmutations.

PubMed

Margreitter, Christian; Mayrhofer, Patrick; Kunert, Renate; Oostenbrink, Chris

2016-06-01

Monoclonal antibodies represent the fastest growing class of biotherapeutic proteins. However, as they are often initially derived from rodent organisms, there is a severe risk of immunogenic reactions, hampering their applicability. The humanization of these antibodies remains a challenging task in the context of rational drug design. "Superhumanization" describes the direct transfer of the complementarity determining regions to a human germline framework, but this humanization approach often results in loss of binding affinity. In this study, we present a new approach for predicting promising backmutation sites using molecular dynamics simulations of the model antibody Ab2/3H6. The simulation method was developed in close conjunction with novel specificity experiments. Binding properties of mAb variants were evaluated directly from crude supernatants and confirmed using established binding affinity assays for purified antibodies. Our approach provides access to the dynamical features of the actual binding sites of an antibody, based solely on the antibody sequence. Thus we do not need structural data on the antibody-antigen complex and circumvent cumbersome methods to assess binding affinities. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd.

Stephen Schneider and the "Double Ethical Bind" of Climate Change Communication

ERIC Educational Resources Information Center

Russill, Chris

2010-01-01

Stephen Schneider's perspective on climate change communication is distinguished by its longevity, a keen anticipation of research findings, historical understanding, and grounding in first-person experience. In this article, the author elaborates Schneider's work in terms of its key claims, suggestive research directions, and lessons for…

Hypotonic activation of short ClC3 isoform is modulated by direct interaction between its cytosolic C-terminal tail and subcortical actin filaments.

PubMed

McCloskey, Diana T; Doherty, Lynda; Dai, Yan-Ping; Miller, Lisa; Hume, Joseph R; Yamboliev, Ilia A

2007-06-08

Short ClC3 isoform (sClC3) functions as a volume-sensitive outwardly rectifying anion channel (VSOAC) in some cell types. In previous studies, we have shown that the hypotonic activation of sClC3 is linked to cell swelling-mediated remodeling of the actin cytoskeleton. In the present study, we have tested the hypothesis that the cytosolic tails of sClC3 bind to actin directly and that binding modulates the hypotonic activation of the channel. Co-sedimentation assays in vitro demonstrated a strong binding between the glutathione S-transferase-fused cytosolic C terminus of sClC3 (GST-sClC3-CT) to filamentous actin (F-actin) but not to globular monomeric actin (G-actin). The GST-fused N terminus (GST-sClC3-NT) exhibited low binding affinity to both G- and F-actin. Co-sedimentation experiments with progressively truncated GST-sClC3-CT indicated that the F-actin binding region is located between amino acids 690 and 760 of sClC3. Two synthetic peptides mapping basic clusters of the cytosolic sClC3-CT (CTP2, isoleucine 716 to leucine 734; and CTP3, proline 688 to proline 709) prevented binding of GST-sClC3-CT to F-actin in vitro. Dialysis into NIH/3T3 cells of these two peptides (but not of synthetic peptide CTP1 (isoleucine 737 to glutamine 748)) reduced the maximal current density by 60 and 38%, respectively. Based on these results, we have concluded that, by direct interaction with subcortical actin filaments, sClC3 contributes to the hypotonic stress-induced VSOACs in NIH/3T3 cells.

Substance P analogs displace sigma binding differentially in the brain and spinal cord of the adult mouse.

PubMed

Mousseau, D D; Larson, A A

1994-09-01

We have previously observed similarities in the behavioral effects produced by the NH2-terminus of the undecapeptide substance P (SP) and by 1,3-di(2-tolyl)-guanidine (DTG) in the adult mouse. The present series of experiments indicate differences in the rank-order of potency of sigma ligands [DTG; haloperidol (HAL)], SP analogs [SP; SP(1-7); SP(5-11); [D-Pro2, D-Phe7]-SP(1-7) (D-SP(1-7))] and miscellaneous compounds [morphine (MOR), naloxone (NAL)] at competing for [3H]-DTG binding sites in the mouse brain and spinal cord in vitro: Brain; DTG = HAL > SP = MOR = NAL > SP(1-7) > D-SP(1-7) > SP(5-11): Spinal cord; DTG = HAL > SP(1-7) = MOR = NAL > SP > D-SP(1-7) = SP(5-11). The observed difference in the rank-order potencies of the displacing ligands at these same binding sites supports the notion of two distinct populations of sigma binding sites in these tissues in the adult mouse. Given the low (micromolar) potency of SP analogs at displacing [3H]-DTG binding in the present series of experiments, it is unlikely that the similar behavioral effects we have previously observed elicited by SP(1-7) and DTG in the adult mouse are a result of a direct action of SP(1-7) at the sigma binding site.

Au-Interaction of Slp1 Polymers and Monolayer from Lysinibacillus sphaericus JG-B53 - QCM-D, ICP-MS and AFM as Tools for Biomolecule-metal Studies

PubMed Central

Suhr, Matthias; Raff, Johannes; Pollmann, Katrin

2016-01-01

In this publication the gold sorption behavior of surface layer (S-layer) proteins (Slp1) of Lysinibacillus sphaericus JG-B53 is described. These biomolecules arrange in paracrystalline two-dimensional arrays on surfaces, bind metals, and are thus interesting for several biotechnical applications, such as biosorptive materials for the removal or recovery of different elements from the environment and industrial processes. The deposition of Au(0) nanoparticles on S-layers, either by S-layer directed synthesis 1 or adsorption of nanoparticles, opens new possibilities for diverse sensory applications. Although numerous studies have described the biosorptive properties of S-layers 2-5, a deeper understanding of protein-protein and protein-metal interaction still remains challenging. In the following study, inductively coupled mass spectrometry (ICP-MS) was used for the detection of metal sorption by suspended S-layers. This was correlated to measurements of quartz crystal microbalance with dissipation monitoring (QCM-D), which allows the online detection of proteinaceous monolayer formation and metal deposition, and thus, a more detailed understanding on metal binding. The ICP-MS results indicated that the binding of Au(III) to the suspended S-layer polymers is pH dependent. The maximum binding of Au(III) was obtained at pH 4.0. The QCM-D investigations enabled the detection of Au(III) sorption as well as the deposition of Au(0)-NPs in real-time during the in situ experiments. Further, this method allowed studying the influence of metal binding on the protein lattice stability of Slp1. Structural properties and protein layer stability could be visualized directly after QCM-D experiment using atomic force microscopy (AFM). In conclusion, the combination of these different methods provides a deeper understanding of metal binding by bacterial S-layer proteins in suspension or as monolayers on either bacterial cells or recrystallized surfaces. PMID:26863150

CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

PubMed Central

Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

2011-01-01

The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

Dynamic binding of visual features by neuronal/stimulus synchrony.

PubMed

Iwabuchi, A

1998-05-01

When people see a visual scene, certain parts of the visual scene are treated as belonging together and we regard them as a perceptual unit, which is called a "figure". People focus on figures, and the remaining parts of the scene are disregarded as "ground". In Gestalt psychology this process is called "figure-ground segregation". According to current perceptual psychology, a figure is formed by binding various visual features in a scene, and developments in neuroscience have revealed that there are many feature-encoding neurons, which respond to such features specifically. It is not known, however, how the brain binds different features of an object into a coherent visual object representation. Recently, the theory of binding by neuronal synchrony, which argues that feature binding is dynamically mediated by neuronal synchrony of feature-encoding neurons, has been proposed. This review article portrays the problem of figure-ground segregation and features binding, summarizes neurophysiological and psychophysical experiments and theory relevant to feature binding by neuronal/stimulus synchrony, and suggests possible directions for future research on this topic.

General odorant-binding proteins and sex pheromone guide larvae of Plutella xylostella to better food.

PubMed

Zhu, Jiao; Ban, Liping; Song, Li-Mei; Liu, Yang; Pelosi, Paolo; Wang, Guirong

2016-05-01

Olfaction of Lepidopteran larvae has received little attention, compared to the damage to crops done by insects at this stage. We report that larvae of the diamondback moth Plutella xylostella are attracted to their natural sex pheromone and to their major component (Z)-11-hexadecenal, but only in a food context. For such task they use two general odorant-binding proteins (GOBPs), abundantly expressed in the three major sensilla basiconica of the larval antenna, as shown by whole-mount immunostaining and immunocytochemistry experiments. None of the three genes encoding pheromone-binding proteins (PBPs) are expressed at this stage. Both recombinant GOBPs bind (Z)-11-hexadecenal and the corresponding alcohol, but not the acetate. Binding experiments performed with five mutants of GOBP2, where aromatic residues in the binding pocket were replaced with leucine showed that only one or two amino acid substitutions can completely abolish binding to the pheromone shifting the affinity to plant-derived compounds. We hypothesise that detection of their species-specific pheromone may direct larvae to the sites of foraging chosen by their mother when laying eggs, to find better food, as well as to reduce competition with individuals of the same or other species sharing the same host plant. We also provide evidence that GOBP2 is a narrowly tuned binding protein, whose affinity can be easily switched from linear pheromones to branched plants terpenoids, representing a tool better suited for the simple olfactory system of larvae, as compared to the more sophisticated organ of adults. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Polybasic Region of the Polysialyltransferase ST8Sia-IV Binds Directly to the Neural Cell Adhesion Molecule, NCAM.

PubMed

Bhide, Gaurang P; Prehna, Gerd; Ramirez, Benjamin E; Colley, Karen J

2017-03-14

Polysialic acid (polySia) is a unique post-translational modification found on a small set of mammalian glycoproteins. Composed of long chains of α2,8-linked sialic acid, this large, negatively charged polymer attenuates protein and cell adhesion and modulates signaling mediated by its carriers and proteins that interact with these carriers. PolySia is crucial for the proper development of the nervous system and is upregulated during tissue regeneration and in highly invasive cancers. Our laboratory has previously shown that the neural cell adhesion molecule, NCAM, has an acidic surface patch in its first fibronectin type III repeat (FN1) that is critical for the polysialylation of N-glycans on the adjacent immunoglobulin domain (Ig5). We have also identified a polysialyltransferase (polyST) polybasic region (PBR) that may mediate substrate recognition. However, a direct interaction between the NCAM FN1 acidic patch and the polyST PBR has yet to be demonstrated. Here, we have probed this interaction using isothermal titration calorimetry and nuclear magnetic resonance (NMR) spectroscopy. We observe direct and specific binding between FN1 and the PBR peptide that is dependent upon acidic residues in FN1 and basic residues of the PBR. NMR titration experiments verified the role of the FN1 acidic patch in the recognition of the PBR and suggest a conformational change of the Ig5-FN1 linker region following binding of the PBR to the acidic patch. Finally, mutation of residues identified by NMR titration experiments impacts NCAM polysialylation, supporting their mechanistic role in protein-specific polysialylation.

CovalentDock Cloud: a web server for automated covalent docking.

PubMed

Ouyang, Xuchang; Zhou, Shuo; Ge, Zemei; Li, Runtao; Kwoh, Chee Keong

2013-07-01

Covalent binding is an important mechanism for many drugs to gain its function. We developed a computational algorithm to model this chemical event and extended it to a web server, the CovalentDock Cloud, to make it accessible directly online without any local installation and configuration. It provides a simple yet user-friendly web interface to perform covalent docking experiments and analysis online. The web server accepts the structures of both the ligand and the receptor uploaded by the user or retrieved from online databases with valid access id. It identifies the potential covalent binding patterns, carries out the covalent docking experiments and provides visualization of the result for user analysis. This web server is free and open to all users at http://docking.sce.ntu.edu.sg/.

Empirical entropic contributions in computational docking: evaluation in APS reductase complexes.

PubMed

Chang, Max W; Belew, Richard K; Carroll, Kate S; Olson, Arthur J; Goodsell, David S

2008-08-01

The results from reiterated docking experiments may be used to evaluate an empirical vibrational entropy of binding in ligand-protein complexes. We have tested several methods for evaluating the vibrational contribution to binding of 22 nucleotide analogues to the enzyme APS reductase. These include two cluster size methods that measure the probability of finding a particular conformation, a method that estimates the extent of the local energetic well by looking at the scatter of conformations within clustered results, and an RMSD-based method that uses the overall scatter and clustering of all conformations. We have also directly characterized the local energy landscape by randomly sampling around docked conformations. The simple cluster size method shows the best performance, improving the identification of correct conformations in multiple docking experiments. 2008 Wiley Periodicals, Inc.

CovalentDock Cloud: a web server for automated covalent docking

PubMed Central

Ouyang, Xuchang; Zhou, Shuo; Ge, Zemei; Li, Runtao; Kwoh, Chee Keong

2013-01-01

Covalent binding is an important mechanism for many drugs to gain its function. We developed a computational algorithm to model this chemical event and extended it to a web server, the CovalentDock Cloud, to make it accessible directly online without any local installation and configuration. It provides a simple yet user-friendly web interface to perform covalent docking experiments and analysis online. The web server accepts the structures of both the ligand and the receptor uploaded by the user or retrieved from online databases with valid access id. It identifies the potential covalent binding patterns, carries out the covalent docking experiments and provides visualization of the result for user analysis. This web server is free and open to all users at http://docking.sce.ntu.edu.sg/. PMID:23677616

DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

PubMed Central

Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

2009-01-01

Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

The MTA family proteins as novel histone H3 binding proteins.

PubMed

Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

2013-01-03

The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

The MTA family proteins as novel histone H3 binding proteins

PubMed Central

2013-01-01

Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

Cloning of an SNF2/SWI2-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter.

PubMed

Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A

1995-03-03

We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.

A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

NASA Technical Reports Server (NTRS)

Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

2001-01-01

The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

Visual feature binding in younger and older adults: encoding and suffix interference effects.

PubMed

Brown, Louise A; Niven, Elaine H; Logie, Robert H; Rhodes, Stephen; Allen, Richard J

2017-02-01

Three experiments investigated younger (18-25 yrs) and older (70-88 yrs) adults' temporary memory for colour-shape combinations (binding). We focused upon estimating the magnitude of the binding cost for each age group across encoding time (Experiment 1; 900/1500 ms), presentation format (Experiment 2; simultaneous/sequential), and interference (Experiment 3; control/suffix) conditions. In Experiment 1, encoding time did not differentially influence binding in the two age groups. In Experiment 2, younger adults exhibited poorer binding performance with sequential relative to simultaneous presentation, and serial position analyses highlighted a particular age-related difficulty remembering the middle item of a series (for all memory conditions). Experiments 1-3 demonstrated small to medium binding effect sizes in older adults across all encoding conditions, with binding less accurate than shape memory. However, younger adults also displayed negative effects of binding (small to large) in two of the experiments. Even when older adults exhibited a greater suffix interference effect in Experiment 3, this was for all memory types, not just binding. We therefore conclude that there is no consistent evidence for a visual binding deficit in healthy older adults. This relative preservation contrasts with the specific and substantial deficits in visual feature binding found in several recent studies of Alzheimer's disease.

Non-Native Metal Ion Reveals the Role of Electrostatics in Synaptotagmin 1-Membrane Interactions.

PubMed

Katti, Sachin; Nyenhuis, Sarah B; Her, Bin; Srivastava, Atul K; Taylor, Alexander B; Hart, P John; Cafiso, David S; Igumenova, Tatyana I

2017-06-27

C2 domains are independently folded modules that often target their host proteins to anionic membranes in a Ca 2+ -dependent manner. In these cases, membrane association is triggered by Ca 2+ binding to the negatively charged loop region of the C2 domain. Here, we used a non-native metal ion, Cd 2+ , in lieu of Ca 2+ to gain insight into the contributions made by long-range Coulombic interactions and direct metal ion-lipid bridging to membrane binding. Using X-ray crystallography, NMR, Förster resonance energy transfer, and vesicle cosedimentation assays, we demonstrate that, although Cd 2+ binds to the loop region of C2A/B domains of synaptotagmin 1 with high affinity, long-range Coulombic interactions are too weak to support membrane binding of individual domains. We attribute this behavior to two factors: the stoichiometry of Cd 2+ binding to the loop regions of the C2A and C2B domains and the impaired ability of Cd 2+ to directly coordinate the lipids. In contrast, electron paramagnetic resonance experiments revealed that Cd 2+ does support membrane binding of the C2 domains in full-length synaptotagmin 1, where the high local lipid concentrations that result from membrane tethering can partially compensate for lack of a full complement of divalent metal ions and specific lipid coordination in Cd 2+ -complexed C2A/B domains. Our data suggest that long-range Coulombic interactions alone can drive the initial association of C2A/B with anionic membranes and that Ca 2+ further augments membrane binding by the formation of metal ion-lipid coordination bonds and additional Ca 2+ ion binding to the C2 domain loop regions.

Extended HSR/CARD domain mediates AIRE binding to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

Zinc(II) binds to the neuroprotective peptide humanin.

PubMed

Armas, Ambar; Sonois, Vanessa; Mothes, Emmanuelle; Mazarguil, Honoré; Faller, Peter

2006-10-01

The abnormal accumulation of the peptide amyloid-beta in the form of senile (or amyloid) plaques is one of the hallmarks of Alzheimer's disease (AD). Zinc ions have been implicated in AD and plaques formation. Recently, the peptide humanin has been discovered. Humanin showed neuroprotective activity against amyloid-beta insults. Here the question investigated is if humanin could interact directly with Zn(II). It is shown that Zn(II) and its substitutes Cd(II)/Co(II) bind to humanin via a thiolate bond from the side chain of the single cysteine at position 8. The low intensity of the d-d bands of Co(II)-humanin indicated an octahedral coordination geometry. Titration experiments suggest that Zn(II) binds to humanin with an apparent affinity in the low muM range. This apparent Zn-binding affinity is in the same order as for amyloid-beta and glutathione and could thus be of physiological relevance.

The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

PubMed Central

Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

2017-01-01

Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

Feature bindings are maintained in visual short-term memory without sustained focused attention.

PubMed

Delvenne, Jean-François; Cleeremans, Axel; Laloyaux, Cédric

2010-01-01

Does the maintenance of feature bindings in visual short-term memory (VSTM) require sustained focused attention? This issue was investigated in three experiments, in which memory for single features (i.e., colors or shapes) was compared with memory for feature bindings (i.e., the link between the color and shape of an object). Attention was manipulated during the memory retention interval with a retro-cue, which allows attention to be directed and focused on a subset of memory items. The retro-cue was presented 700 ms after the offset of the memory display and 700 ms before the onset of the test display. If the maintenance of feature bindings - but not of individual features - in memory requires sustained focused attention, the retro-cue should not affect memory performance. Contrary to this prediction, we found that both memory for feature bindings and memory for individual features were equally improved by the retro-cue. Therefore, this finding does not support the view that the sustained focused attention is needed to properly maintain feature bindings in VSTM.

Functional Dynamics of PDZ Binding Domains: A Normal-Mode Analysis

PubMed Central

De Los Rios, Paolo; Cecconi, Fabio; Pretre, Anna; Dietler, Giovanni; Michielin, Olivier; Piazza, Francesco; Juanico, Brice

2005-01-01

Postsynaptic density-95/disks large/zonula occludens-1 (PDZ) domains are relatively small (80–120 residues) protein binding modules central in the organization of receptor clusters and in the association of cellular proteins. Their main function is to bind C-terminals of selected proteins that are recognized through specific amino acids in their carboxyl end. Binding is associated with a deformation of the PDZ native structure and is responsible for dynamical changes in regions not in direct contact with the target. We investigate how this deformation is related to the harmonic dynamics of the PDZ structure and show that one low-frequency collective normal mode, characterized by the concerted movements of different secondary structures, is involved in the binding process. Our results suggest that even minimal structural changes are responsible for communication between distant regions of the protein, in agreement with recent NMR experiments. Thus, PDZ domains are a very clear example of how collective normal modes are able to characterize the relation between function and dynamics of proteins, and to provide indications on the precursors of binding/unbinding events. PMID:15821164

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Assembly of the stator in Escherichia coli ATP synthase. Complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha

PubMed Central

Senior, Alan E.; Muharemagi, Alma; Wilke-Mounts, Susan

2008-01-01

Alpha subunit of Escherichia coli ATP synthase was expressed with a C-terminal 6-His tag and purified. Pure alpha was monomeric, competent in nucleotide binding, and had normal N-terminal sequence. In F1-subunit dissociation/reassociation experiments it supported full reconstitution of ATPase, and reassociated complexes were able to bind to F1-depleted membranes with restoration of ATP-driven proton pumping. Therefore interaction between the stator delta subunit and the N-terminal residue 1-22 region of alpha occurred normally when pure alpha was complexed with other F1 subunits. On the other hand, three different types of experiment showed that no interaction occurred between pure delta and isolated alpha subunit. Unlike in F1, the N-terminal region of isolated alpha was not susceptible to trypsin cleavage. Therefore, during assembly of ATP synthase, complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha. We suggest that the N-terminal 1-22 residues of alpha are sequestered in isolated alpha until released by binding of beta to alpha subunit. This prevents 1/1 delta/alpha complexes from forming, and provides a satisfactory explanation of the stoichiometry of one delta per three alpha seen in the F1 sector of ATP synthase, assuming that steric hindrance prevents binding of more than one delta to the alpha3/beta3 hexagon. The cytoplasmic fragment of the b subunit (bsol) did not bind to isolated alpha. It might also be that complexation of alpha with beta subunits is prerequisite for direct binding of stator b subunit to the F1-sector. PMID:17176112

Homocysteine directly interacts and activates the angiotensin II type I receptor to aggravate vascular injury.

PubMed

Li, Tuoyi; Yu, Bing; Liu, Zhixin; Li, Jingyuan; Ma, Mingliang; Wang, Yingbao; Zhu, Mingjiang; Yin, Huiyong; Wang, Xiaofeng; Fu, Yi; Yu, Fang; Wang, Xian; Fang, Xiaohong; Sun, Jinpeng; Kong, Wei

2018-01-02

Hyperhomocysteinemia (HHcy) is a risk factor for various cardiovascular diseases. However, the mechanism underlying HHcy-aggravated vascular injury remains unclear. Here we show that the aggravation of abdominal aortic aneurysm by HHcy is abolished in mice with genetic deletion of the angiotensin II type 1 (AT1) receptor and in mice treated with an AT1 blocker. We find that homocysteine directly activates AT1 receptor signalling. Homocysteine displaces angiotensin II and limits its binding to AT1 receptor. Bioluminescence resonance energy transfer analysis reveals distinct conformational changes of AT1 receptor upon binding to angiotensin II and homocysteine. Molecular dynamics and site-directed mutagenesis experiments suggest that homocysteine regulates the conformation of the AT1 receptor both orthosterically and allosterically by forming a salt bridge and a disulfide bond with its Arg 167 and Cys 289 residues, respectively. Together, these findings suggest that strategies aimed at blocking the AT1 receptor may mitigate HHcy-associated aneurysmal vascular injuries.

Structural and functional characterization of a new recombinant histidine-tagged acyl coenzyme A binding protein (ACBP) from mouse

PubMed Central

Petrescu, Anca D.; Huang, Huan; Hostetler, Heather A.; Schroeder, Friedhelm; Kier, Ann B.

2008-01-01

Acyl-coenzyme A binding protein (ACBP) has been proposed to transport fatty acyl-CoAs intracellularly, facilitating their metabolism. In this study, a new mouse recombinant ACBP was produced by insertion of a histidine (his) tag at the C-terminus to allow efficient purification by Ni-affinity chromatography. The his-tag was inserted at the C-terminus since ACBP is a small molecular size (10 kDa) protein whose structure and activity are sensitive to amino acid substitutions in the N-terminus. The his tag had no or little effect on ACBP structure or ligand binding affinity and specificity. His-ACBP bound the naturally-occurring fluorescent cis-parinaroyl-CoA with very high affinity (Kd=2.15 nM), but exhibited no affinity for non-esterified cis-parinaric acid. To determine if the presence of the C-terminal his tag altered ACBP interactions with other proteins, direct binding to hepatocyte nuclear factor 4α (HNF-4α), a nuclear receptor regulating transcription of genes involved in lipid metabolism, was examined. His-ACBP and HNF-4α were labeled with Cy5 and Cy3, respectively, and direct interaction was determined by a novel fluorescence resonance energy transfer (FRET) binding assay. FRET analysis showed that his-ACBP directly interacted with HNF-4α (intermolecular distance of 73 Å) at high affinity (Kd=64-111 nM) similar to native ACBP. The his-tag also had no effect on ACBPs ability to interact with and stimulate microsomal enzymes utilizing or forming fatty acyl CoA. Thus, C-terminal his-tagged-ACBP maintained very similar structural and functional features of the untagged native protein and can be used in further in vitro experiments that require pure recombinant ACBP. PMID:18178100

Enantioselective binding of L, D-phenylalanine to ct DNA

NASA Astrophysics Data System (ADS)

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-01

The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

Enantioselective binding of L,D-phenylalanine to ct DNA.

PubMed

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-15

The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

Coactivator-associated arginine methyltransferase 1 enhances transcriptional activity of the human T-cell lymphotropic virus type 1 long terminal repeat through direct interaction with Tax.

PubMed

Jeong, Soo-Jin; Lu, Hanxin; Cho, Won-Kyung; Park, Hyeon Ung; Pise-Masison, Cynthia; Brady, John N

2006-10-01

In this study, we demonstrate that the coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3 and other proteins such as p300/CBP, is positively involved in the regulation of Tax transactivation. First, transfection studies demonstrated that overexpression of CARM1 wild-type protein resulted in increased Tax transactivation of the human T-cell lymphotropic virus type 1 (HTLV-1) long terminal repeat (LTR). In contrast, transfection of a catalytically inactive CARM1 methyltransferase mutant did not enhance Tax transactivation. CARM1 facilitated Tax transactivation of the CREB-dependent cellular GEM promoter. A direct physical interaction between HTLV-1 Tax and CARM1 was demonstrated using in vitro glutathione S-transferase-Tax binding assays, in vivo coimmunoprecipitation, and confocal microscopy experiments. Finally, chromatin immunoprecipitation analysis of the activated HTLV-1 LTR promoter showed the association of CARM1 and methylated histone H3 with the template DNA. In vitro, Tax facilitates the binding of CARM1 to the transcription complex. Together, our data provide evidence that CARM1 enhances Tax transactivation of the HTLV-1 LTR through a direct interaction between CARM1 and Tax and this binding promotes methylation of histone H3 (R2, R17, and R26).

Direct Ca2+-dependent Heterophilic Interaction between Desmosomal Cadherins, Desmoglein and Desmocollin, Contributes to Cell–Cell Adhesion

PubMed Central

Chitaev, Nikolai A.; Troyanovsky, Sergey M.

1997-01-01

Human fibrosarcoma cells, HT-1080, feature extensive adherens junctions, lack mature desmosomes, and express a single known desmosomal protein, Desmoglein 2 (Dsg2). Transfection of these cells with bovine Desmocollin 1a (Dsc1a) caused dramatic changes in the subcellular distribution of endogenous Dsg2. Both cadherins clustered in the areas of the adherens junctions, whereas only a minor portion of Dsg2 was seen in these areas in the parental cells. Deletion mapping showed that intact extracellular cadherin-like repeats of Dsc1a (Arg1-Thr170) are required for the translocation of Dsg2. Deletion of the intracellular C-domain that mediates the interaction of Dsc1a with plakoglobin, or the CSI region that is involved in the binding to desmoplakin, had no effect. Coimmunoprecipitation experiments of cell lysates stably expressing Dsc1a with anti-Dsc or -Dsg antibodies demonstrate that the desmosomal cadherins, Dsg2 and Dsc1a, are involved in a direct Ca2+-dependent interaction. This conclusion was further supported by the results of solid phase binding experiments. These showed that the Dsc1a fragment containing cadherin-like repeats 1 and 2 binds directly to the extracellular portion of Dsg in a Ca2+-dependent manner. The contribution of the Dsg/ Dsc interaction to cell–cell adhesion was tested by coculturing HT-1080 cells expressing Dsc1a with HT-1080 cells lacking Dsc but expressing myc-tagged plakoglobin (MPg). In the latter cells, MPg and the endogenous Dsg form stable complexes. The observed specific coimmunoprecipitation of MPg by anti-Dsc antibodies in coculture indicates that an intercellular interaction between Dsc1 and Dsg is involved in cell–cell adhesion. PMID:9214392

Presence of IgT-C and I-A subregion-encoded determinants on distinct chains of monoclonal antigen-specific augmenting factor derived from a T cell hybridoma

PubMed Central

1983-01-01

Monoclonal antibodies specific for mouse T cell alloantigens, Tindd and Tsud, linked to the Igh-1 locus on chromosome 12, were used to directly define the antigen-binding molecule produced by a cloned hybridoma. The T cell hybridoma, FL10, was established from antigen-binding T cells of A/J mice. FL10 produces an antigen-specific augmenting T cell factor (TaF) that bears a unique I region-controlled determinant (I-A) and has antigen-binding capacity. The Tindd, but not the Tsud, determinant was detected on the surface of FL10. The presence of both Tindd and I-A subregion-controlled determinants on FL10-derived TaF was directly demonstrated by the adsorption of TaF with immunoadsorbents prepared with monoclonal antibodies. The Igh-1-linked T cell alloantigen, Tsud, was not found on TaF. Further experiments indicated that Tindd is present on the antigen-binding polypeptide chain and not on the second chain bearing the I-A determinant. Despite the presence of the Tindd determinant on hybridoma-derived TaF, augmentation induced by TaF was restricted by the H-2 type of the responding mice and not by the Igh-1 allotype. PMID:6189953

Ultrafast Dynamics of 1,3-Cyclohexadiene in Highly Excited States

DOE PAGES

Bühler, Christine C.; Minitti, Michael P.; Deb, Sanghamitra; ...

2011-01-01

The ultrafast dynamics of 1,3-cyclohexadiene has been investigated via structurally sensitive Rydberg electron binding energies and shown to differ upon excitation to the 1B state and the 3p Rydberg state. Excitation of the molecule with 4.63 eV photons into the ultrashort-lived 1B state yields the well-known ring opening to 1,3,5-hexatriene, while a 5.99 eV photon lifts the molecule directly into the 3p-Rydberg state. Excitation to 3p does not induce ring opening. In both experiments, time-dependent shifts of the Rydberg electron binding energy reflect the structural dynamics of the molecular core. Structural distortions associated with 3p-excitation cause a dynamical shift in the -more » and -binding energies by 10 and 26 meV/ps, respectively, whereas after excitation into 1B, more severe structural transformations along the ring-opening coordinate produce shifts at a rate of 40 to 60 meV/ps. The experiment validates photoionization-photoelectron spectroscopy via Rydberg states as a powerful technique to observe structural dynamics of polyatomic molecules.« less

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

Determinants of the Differential Antizyme-Binding Affinity of Ornithine Decarboxylase

PubMed Central

Liu, Yen-Chin; Hsu, Den-Hua; Huang, Chi-Liang; Liu, Yi-Liang; Liu, Guang-Yaw; Hung, Hui-Chih

2011-01-01

Ornithine decarboxylase (ODC) is a ubiquitous enzyme that is conserved in all species from bacteria to humans. Mammalian ODC is degraded by the proteasome in a ubiquitin-independent manner by direct binding to the antizyme (AZ). In contrast, Trypanosoma brucei ODC has a low binding affinity toward AZ. In this study, we identified key amino acid residues that govern the differential AZ binding affinity of human and Trypanosoma brucei ODC. Multiple sequence alignments of the ODC putative AZ-binding site highlights several key amino acid residues that are different between the human and Trypanosoma brucei ODC protein sequences, including residue 119, 124,125, 129, 136, 137 and 140 (the numbers is for human ODC). We generated a septuple human ODC mutant protein where these seven bases were mutated to match the Trypanosoma brucei ODC protein sequence. The septuple mutant protein was much less sensitive to AZ inhibition compared to the WT protein, suggesting that these amino acid residues play a role in human ODC-AZ binding. Additional experiments with sextuple mutants suggest that residue 137 plays a direct role in AZ binding, and residues 119 and 140 play secondary roles in AZ binding. The dissociation constants were also calculated to quantify the affinity of the ODC-AZ binding interaction. The K d value for the wild type ODC protein-AZ heterodimer ([ODC_WT]-AZ) is approximately 0.22 μM, while the K d value for the septuple mutant-AZ heterodimer ([ODC_7M]-AZ) is approximately 12.4 μM. The greater than 50-fold increase in [ODC_7M]-AZ binding affinity shows that the ODC-7M enzyme has a much lower binding affinity toward AZ. For the mutant proteins ODC_7M(-Q119H) and ODC_7M(-V137D), the K d was 1.4 and 1.2 μM, respectively. These affinities are 6-fold higher than the WT_ODC K d, which suggests that residues 119 and 137 play a role in AZ binding. PMID:22073206

GlpR is a direct transcriptional repressor of fructose metabolic genes in Haloferax volcanii.

PubMed

Martin, Jonathan H; Rawls, Katie Sherwood; Chan, Jou Chin; Hwang, Sungmin; Martinez-Pastor, Mar; McMillan, Lana J; Prunetti, Laurence; Schmid, Amy K; Maupin-Furlow, Julie A

2018-06-18

DeoR-type helix-turn-helix (HTH) domain proteins are transcriptional regulators of sugar and nucleoside metabolism in diverse bacteria and occur in select archaea. In the model archaeon Haloferax volcanii , previous work implicated GlpR, a DeoR-type transcriptional regulator, in transcriptional repression of glpR and the gene encoding the fructose-specific phosphofructokinase ( pfkB ) during growth on glycerol. However, the global regulon governed by GlpR remained unclear. Here we compared transcriptomes of wild type and Δ glpR mutant strains grown on glycerol and glucose to detect significant transcript level differences for nearly 50 new genes regulated by GlpR. By coupling computational prediction of GlpR binding sequences with in vivo and in vitro DNA binding experiments, we determined that GlpR directly controls genes encoding enzymes in fructose degradation, including fructose bisphosphate aldolase, a central control point in glycolysis. GlpR also directly controls other transcription factors. In contrast, other metabolic pathways appear to be under indirect influence of GlpR. In vitro experiments demonstrated that GlpR purifies as a tetramer that binds the effector molecule fructose-1-phosphate (F1P). These results suggest that Hfx. volcanii GlpR functions as a direct negative regulator of fructose degradation during growth on carbon sources other than fructose, such as glucose and glycerol, and that GlpR bears striking functional similarity to bacterial DeoR-type regulators. IMPORTANCE Many archaea are extremophiles, able to thrive in habitats of extreme salinity, pH and temperature. These biological properties are ideal for applications in biotechnology. However, limited knowledge of archaeal metabolism is a bottleneck that prevents broad use of archaea as microbial factories for industrial products. Here we characterize how sugar uptake and use is regulated in a species that lives in high salinity. We demonstrate that a key sugar regulatory protein in this archaeal species functions using molecular mechanisms conserved with distantly related bacterial species. Copyright © 2018 American Society for Microbiology.

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

Revealing Ligand Binding Sites and Quantifying Subunit Variants of Noncovalent Protein Complexes in a Single Native Top-Down FTICR MS Experiment

NASA Astrophysics Data System (ADS)

Li, Huilin; Wongkongkathep, Piriya; Van Orden, Steve L.; Ogorzalek Loo, Rachel R.; Loo, Joseph A.

2014-12-01

"Native" mass spectrometry (MS) has been proven to be increasingly useful for structural biology studies of macromolecular assemblies. Using horse liver alcohol dehydrogenase (hADH) and yeast alcohol dehydrogenase (yADH) as examples, we demonstrate that rich information can be obtained in a single native top-down MS experiment using Fourier transform ion cyclotron mass spectrometry (FTICR MS). Beyond measuring the molecular weights of the protein complexes, isotopic mass resolution was achieved for yeast ADH tetramer (147 kDa) with an average resolving power of 412,700 at m/z 5466 in absorption mode, and the mass reflects that each subunit binds to two zinc atoms. The N-terminal 89 amino acid residues were sequenced in a top-down electron capture dissociation (ECD) experiment, along with the identifications of the zinc binding site at Cys46 and a point mutation (V58T). With the combination of various activation/dissociation techniques, including ECD, in-source dissociation (ISD), collisionally activated dissociation (CAD), and infrared multiphoton dissociation (IRMPD), 40% of the yADH sequence was derived directly from the native tetramer complex. For hADH, native top-down ECD-MS shows that both E and S subunits are present in the hADH sample, with a relative ratio of 4:1. Native top-down ISD of the hADH dimer shows that each subunit (E and S chains) binds not only to two zinc atoms, but also the NAD/NADH ligand, with a higher NAD/NADH binding preference for the S chain relative to the E chain. In total, 32% sequence coverage was achieved for both E and S chains.

Stress, chemical defense agents, and cholinergic receptors. Midterm report, 1 November 1987-31 July 1989

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, J.D.

1989-11-30

This project is assessing the affects of exposure to a chemical defense agent on anxiety and stress, by using rat models of anxiety (conditioned emotional response (CER); conditioned suppression) and unconditioned non-specific stres (exposure to footshock). The specific experiments determined the plasticity of muscarinic cholinergic binding sites in the central nervous system. The neuroanatomical locus and neuropharmacological profile of changes in binding sites were assessed in brain areas enriched in cholinergic markers. Acetylcholine turnover was measured to determine if the receptor response is compensatory or independent. The effects of acute exposure to doses of a chemical defense agent (soman--XGD) onmore » lethality and behaviors were examined. The experiments involved training and conditioning adult rats to CER using standard operant/respondent techniques. The binding of radiolabelled ligand was studied in vitro using brain membranes and tissue sections (autoradiography). The major findings are that CER produces increases in acetylcholine turnover in brain areas involved in anxiety, and that primarily post-synaptic M1 receptors compensatorly decrease in response. These neurochemical phenomena are directly correlated with several behaviors, including onset and extinction of CER and non-specific stress. Followup experiments have been designed to test the interaction of CER, XGD and neurochemistry.« less

Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae)

PubMed Central

Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

2016-01-01

Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703

Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

PubMed Central

Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

2015-01-01

Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

U1 small nuclear ribonucleoprotein particle-specific proteins interact with the first and second stem-loops of U1 RNA, with the A protein binding directly to the RNA independently of the 70K and Sm proteins.

PubMed Central

Patton, J R; Habets, W; van Venrooij, W J; Pederson, T

1989-01-01

The U1 small nuclear ribonucleoprotein particle (U1 snRNP), a cofactor in pre-mRNA splicing, contains three proteins, termed 70K, A, and C, that are not present in the other spliceosome-associated snRNPs. We studied the binding of the A and C proteins to U1 RNA, using a U1 snRNP reconstitution system and an antibody-induced nuclease protection technique. Antibodies that reacted with the A and C proteins induced nuclease protection of the first two stem-loops of U1 RNA in reconstituted U1 snRNP. Detailed analysis of the antibody-induced nuclease protection patterns indicated the existence of relatively long-range protein-protein interactions in the U1 snRNP, with the 5' end of U1 RNA and its associated specific proteins interacting with proteins bound to the Sm domain near the 3' end. UV cross-linking experiments in conjunction with an A-protein-specific antibody demonstrated that the A protein bound directly to the U1 RNA rather than assembling in the U1 snRNP exclusively via protein-protein interactions. This conclusion was supported by additional experiments revealing that the A protein could bind to U1 RNA in the absence of bound 70K and Sm core proteins. Images PMID:2529425

[The mechanism of the transport of organophosphorus compounds across the histo-hematic barriers].

PubMed

Miroshkina, V N; Kosmachev, A B; Salova, L S

1999-01-01

It was demonstrated in experiments on mice [correction of rats] that the transport of organophosphorus compounds (OPC) through membranes of the histohematic barriers (HHB) of the organism occurs by means of diffusion. The rate of this process depends on the interaction of OPC with the specific sites of binding with the tissues, among which the enzyme carboxylesterase plays an important part. It is suggested that both the rate and direction of OPC diffusion are determined by the relationship between the values of affinity of the ligands for the sites of their specific binding found on both sides of the HHB.

Simultaneous addition of two ligands: a potential strategy for estimating divalent ion affinities in EF-hand proteins by isothermal titration calorimetry.

PubMed

Henzl, Michael T; Markus, Lindsey A; Davis, Meredith E; McMillan, Andrew T

2013-03-01

Capable of providing a detailed thermodynamic picture of noncovalent association reactions, isothermal titration calorimetry (ITC) has become a popular method for studying protein-ligand interactions. We routinely employ the technique to study divalent ion-binding by two-site EF-hand proteins from the parvalbumin- and polcalcin lineages. The combination of high Ca(2+) affinity and relatively low Mg(2+) affinity, and the attendant complication of parameter correlation, conspire to make the simultaneous extraction of binding constants and -enthalpies for both ions challenging. Although global analysis of multiple ITC experiments can overcome these hurdles, our current experimental protocol includes upwards of 10 titrations - requiring a substantial investment in labor, machine time, and material. This paper explores the potential for using a smaller suite of experiments that includes simultaneous titrations with Ca(2+) and Mg(2+) at different ratios of the two ions. The results obtained for four proteins, differing substantially in their divalent ion-binding properties, suggest that the approach has merit. The Ca(2+)- and Mg(2+)-binding constants afforded by the streamlined analysis are in reasonable agreement with those obtained from the standard analysis protocol. Likewise, the abbreviated analysis provides comparable values for the Ca(2+)-binding enthalpies. However, the streamlined analysis can yield divergent values for the Mg(2+)-binding enthalpies - particularly those for lower affinity sites. This shortcoming can be remedied, in large measure, by including data from a direct Ca(2+) titration in the presence of a high, fixed Mg(2+) concentration. Copyright © 2013. Published by Elsevier Inc.

The role of the temporoparietal junction in implicit and explicit sense of agency.

PubMed

Hughes, Gethin

2018-05-01

The experience of being in control of one's actions and thier outcomes is called the sense of agency. This is a fundamental feature of our human experience, and may underpin important social functions such as morality and responsibility. Sense of agency can be measured explicitly, by asking people to report their experience, or implicitly by recording the perceived time interval between actions and outcomes (intentional binding). The current studies used transcranial direct current stimulation to assess the role of left and right temporoparietal junction in both implicit and explicit sense of agency. Participants were informed that they could control the volume output of the computer with one of two buttons. Participants experienced reduced sense of agency when the outcome was inconsistent with their action. However, binding did not differ between congruent and incongruent action-outcomes. The modulation of explicit agency ratings by action-outcome congruency was significantly reduced by right TPJ stimulation (experiment 1) but not left TPJ stimulation (experiment 2). Implicit agency was not affected in either stimulation condition. These findings are discussed in terms of the possible neural mechanisms of implicit and explicit sense of agency. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyn, Rodney K.; Department of Chemistry, University of Ottawa, Ottawa; Kennedy, David C.

Research highlights: {yields} Hepatitis C virus uses lipid droplets (LD) onto which HCV core proteins bind. {yields} HCV core proteins on LDs facilitate viral particle assembly. {yields} We used a novel combination of CARS, two-photon fluorescence, and DIC microscopies. {yields} Particle tracking experiments show that core slowly affects LD localization. {yields} Particle tracking measured the change in speed and directionality of LD movement. -- Abstract: The hepatitis C virus (HCV) is a global health problem, with limited treatment options and no vaccine available. HCV uses components of the host cell to proliferate, including lipid droplets (LD) onto which HCV coremore » proteins bind and facilitate viral particle assembly. We have measured the dynamics of HCV core protein-mediated changes in LDs and rates of LD movement on microtubules using a combination of coherent anti-Stokes Raman scattering (CARS), two-photon fluorescence (TPF), and differential interference contrast (DIC) microscopies. Results show that the HCV core protein induces rapid increases in LD size. Particle tracking experiments show that HCV core protein slowly affects LD localization by controlling the directionality of LD movement on microtubules. These dynamic processes ultimately aid HCV in propagating and the molecules and interactions involved represent novel targets for potential therapeutic intervention.« less

Characterization of lithium coordination sites with magic-angle spinning NMR

NASA Astrophysics Data System (ADS)

Haimovich, A.; Goldbourt, A.

2015-05-01

Lithium, in the form of lithium carbonate, is one of the most common drugs for bipolar disorder. Lithium is also considered to have an effect on many other cellular processes hence it possesses additional therapeutic as well as side effects. In order to quantitatively characterize the binding mode of lithium, it is required to identify the interacting species and measure their distances from the metal center. Here we use magic-angle spinning (MAS) solid-state NMR to study the binding site of lithium in complex with glycine and water (LiGlyW). Such a compound is a good enzyme mimetic since lithium is four-coordinated to one water molecule and three carboxylic groups. Distance measurements to carbons are performed using a 2D transferred echo double resonance (TEDOR) MAS solid-state NMR experiment, and water binding is probed by heteronuclear high-resolution proton-lithium and proton-carbon correlation (wPMLG-HETCOR) experiments. Both HETCOR experiments separate the main complex from impurities and non-specifically bound lithium species, demonstrating the sensitivity of the method to probe the species in the binding site. Optimizations of the TEDOR pulse scheme in the case of a quadrupolar nucleus with a small quadrupole coupling constant show that it is most efficient when pulses are positioned on the spin-1/2 (carbon-13) nucleus. Since the intensity of the TEDOR signal is not normalized, careful data analysis that considers both intensity and dipolar oscillations has to be performed. Nevertheless we show that accurate distances can be extracted for both carbons of the bound glycine and that these distances are consistent with the X-ray data and with lithium in a tetrahedral environment. The lithium environment in the complex is very similar to the binding site in inositol monophosphatase, an enzyme associated with bipolar disorder and the putative target for lithium therapy. A 2D TEDOR experiment applied to the bacterial SuhB gene product of this enzyme was designed to probe direct correlations between lithium, the enzyme inhibitor, and the closest carboxyl carbons of the binding site. At this point, the chemical shift of the bound carboxyl groups in this 29 kDa enzyme could be determined.

Electrostatic forces govern the binding mechanism of intrinsically disordered histone chaperones

PubMed Central

Liu, Chuanbo; Wang, Tianshu; Bai, Yawen; Wang, Jin

2017-01-01

A unified picture to understand the protein recognition and function must include the native binding complex structure ensembles and the underlying binding mechanisms involved in specific biological processes. However, quantifications of both binding complex structures and dynamical mechanisms are still challenging for IDP. In this study, we have investigated the underlying molecular mechanism of the chaperone Chz1 and histone H2A.Z-H2B association by equilibrium and kinetic stopped-flow fluorescence spectroscopy. The dependence of free energy and kinetic rate constant on electrolyte mean activity coefficient and urea concentration are uncovered. Our results indicate a previous unseen binding kinetic intermediate. An initial conformation selection step of Chz1 is also revealed before the formation of this intermediate state. Based on these observations, a mixed mechanism of three steps including both conformation selection and induced fit is proposed. By combination of the ion- and denaturant-induced experiments, we demonstrate that electrostatic forces play a dominant role in the recognition of bipolar charged intrinsically disordered protein Chz1 to its preferred partner H2A.Z-H2B. Both the intra-chain and inter-chain electrostatic interactions have direct impacts on the native collapsed structure and binding mechanism. PMID:28552960

Non-competitive inhibition by active site binders.

PubMed

Blat, Yuval

2010-06-01

Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.

ITC-derived binding affinity may be biased due to titrant (nano)-aggregation. Binding of halogenated benzotriazoles to the catalytic domain of human protein kinase CK2

PubMed Central

Winiewska, Maria; Bugajska, Ewa

2017-01-01

The binding of four bromobenzotriazoles to the catalytic subunit of human protein kinase CK2 was assessed by two complementary methods: Microscale Thermophoresis (MST) and Isothermal Titration Calorimetry (ITC). New algorithm proposed for the global analysis of MST pseudo-titration data enabled reliable determination of binding affinities for two distinct sites, a relatively strong one with the Kd of the order of 100 nM and a substantially weaker one (Kd > 1 μM). The affinities for the strong binding site determined for the same protein-ligand systems using ITC were in most cases approximately 10-fold underestimated. The discrepancy was assigned directly to the kinetics of ligand nano-aggregates decay occurring upon injection of the concentrated ligand solution to the protein sample. The binding affinities determined in the reverse ITC experiment, in which ligands were titrated with a concentrated protein solution, agreed with the MST-derived data. Our analysis suggests that some ITC-derived Kd values, routinely reported together with PDB structures of protein-ligand complexes, may be biased due to the uncontrolled ligand (nano)-aggregation, which may occur even substantially below the solubility limit. PMID:28273138

Misuse of thermodynamics in the interpretation of isothermal titration calorimetry data for ligand binding to proteins.

PubMed

Pethica, Brian A

2015-03-01

Isothermal titration calorimetry (ITC) has given a mass of data on the binding of small molecules to proteins and other biopolymers, with particular interest in drug binding to proteins chosen as therapeutic indicators. Interpretation of the enthalpy data usually follows an unsound protocol that uses thermodynamic relations in circumstances where they do not apply. Errors of interpretation include incomplete definitions of ligand binding and equilibrium constants and neglect of the non-ideality of the solutions under study, leading to unreliable estimates of standard free energies and entropies of binding. The mass of reported thermodynamic functions for ligand binding to proteins estimated from ITC enthalpies alone is consequently of uncertain thermodynamic significance and utility. ITC and related experiments to test the protocol assumptions are indicated. A thermodynamic procedure avoiding equilibrium constants or other reaction models and not requiring protein activities is given. The discussion draws attention to the fundamental but neglected relation between the thermodynamic activity and bioactivity of drugs and to the generally unknown thermodynamic status of ligand solutions, which for drugs relates directly to effective therapeutic dosimetry. Copyright © 2014 Elsevier Inc. All rights reserved.

Lectin-binding histochemistry of non-decalcified growth plate cartilage: a postembedment method for light microscopy of epon-embedded tissue.

PubMed

Farnum, C E; Wilsman, N J

1984-06-01

A postembedment method for the localization of lectin-binding glycoconjugates was developed using Epon-embedded growth plate cartilage from Yucatan miniature swine. By testing a variety of etching, blocking, and incubation procedures, a standard protocol was developed for 1 micron thick sections that allowed visualization of both intracellular and extracellular glycoconjugates with affinity for wheat germ agglutinin and concanavalin A. Both fluorescent and peroxidase techniques were used, and comparisons were made between direct methods and indirect methods using the biotin-avidin bridging system. Differential extracellular lectin binding allowed visualization of interterritorial , territorial, and pericellular matrices. Double labeling experiments showed the precision with which intracellular binding could be localized to specific cytoplasmic compartments, with resolution of binding to the Golgi apparatus, endoplasmic reticulum, and nuclear membrane at the light microscopic level. This method allows the localization of both intracellular and extracellular lectin-binding glycoconjugates using fixation and embedment procedures that are compatible with simultaneous ultrastructural analysis. As such it should have applicability both to the morphological analysis of growth plate organization during normal endochondral ossification, as well as to the diagnostic pathology of matrix abnormalities in disease states of growing cartilage.

Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

NASA Astrophysics Data System (ADS)

David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

2010-09-01

Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

Direct observation of gold nanoparticle assemblies with the porin MspA on mica.

PubMed

Basel, Matthew T; Dani, Raj Kumar; Kang, Myungshim; Pavlenok, Mikhail; Chikan, Viktor; Smith, Paul E; Niederweis, Michael; Bossmann, Stefan H

2009-02-24

The octameric porin MspA from Mycobacterium smegmatis is sufficiently stable to form a nonmembrane-supported stand-alone porin on mica surfaces. About 98% of all MspA octamers were found to stand upright on mica, with their periplasmic loop regions bound to the hydrophilic mica surface. Both, small (d = 3.7 nm) and large (d = 17 nm) gold nanoparticles bind to MspA, however, in different positions: small gold nanoparticles bind within the MspA pore, whereas the large gold nanoparticles bind to the upper region of MspA. These experiments demonstrate that gold nanoparticles can be positioned at different, well-defined distances from the underlying surface using the MspA pore as a template. These findings represent a significant step toward the use of electrically insulating stable proteins in combination with metal nanoparticles in nanodevices.

Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-binding Module*

PubMed Central

Taylor, Courtney B.; Talib, M. Faiz; McCabe, Clare; Bu, Lintao; Adney, William S.; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

2012-01-01

Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3–6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function. PMID:22147693

An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

Has Work Replaced Home as a Haven? Re-examining Arlie Hochschild's Time Bind Proposition with Objective Stress Data

PubMed Central

Damaske, Sarah; Smyth, Joshua M.; Zawadzki, Matthew J.

2014-01-01

Using innovative data with objective and subjective measures of stress collected from 122 employed men and women, this paper tests the thesis of the Time Bind by asking whether people report lower stress levels at work than at home. The study finds consistent support for the Time Bind hypothesis when examining objective stress data: when participants were at work they had lower values of the stress hormone cortisol than when they were at home. Two variables moderated this association – income and children at home – such that the work as haven effect was stronger for those with lower incomes and no children living at home. Participants also, however, consistently reported higher subjective stress levels on work days than on non-work days, which is in direct contrast to the Time Bind hypothesis. Although our overall findings support Hochschild's hypothesis that stress levels are lower at work, it appears that combining work and home increases people's subjective experience of daily stress. PMID:24869785

Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

PubMed Central

Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

2011-01-01

Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Salt modulates the stability and lipid binding affinity of the adipocyte lipid-binding proteins

NASA Technical Reports Server (NTRS)

Schoeffler, Allyn J.; Ruiz, Carmen R.; Joubert, Allison M.; Yang, Xuemei; LiCata, Vince J.

2003-01-01

Adipocyte lipid-binding protein (ALBP or aP2) is an intracellular fatty acid-binding protein that is found in adipocytes and macrophages and binds a large variety of intracellular lipids with high affinity. Although intracellular lipids are frequently charged, biochemical studies of lipid-binding proteins and their interactions often focus most heavily on the hydrophobic aspects of these proteins and their interactions. In this study, we have characterized the effects of KCl on the stability and lipid binding properties of ALBP. We find that added salt dramatically stabilizes ALBP, increasing its Delta G of unfolding by 3-5 kcal/mol. At 37 degrees C salt can more than double the stability of the protein. At the same time, salt inhibits the binding of the fluorescent lipid 1-anilinonaphthalene-8-sulfonate (ANS) to the protein and induces direct displacement of the lipid from the protein. Thermodynamic linkage analysis of the salt inhibition of ANS binding shows a nearly 1:1 reciprocal linkage: i.e. one ion is released from ALBP when ANS binds, and vice versa. Kinetic experiments show that salt reduces the rate of association between ANS and ALBP while simultaneously increasing the dissociation rate of ANS from the protein. We depict and discuss the thermodynamic linkages among stability, lipid binding, and salt effects for ALBP, including the use of these linkages to calculate the affinity of ANS for the denatured state of ALBP and its dependence on salt concentration. We also discuss the potential molecular origins and potential intracellular consequences of the demonstrated salt linkages to stability and lipid binding in ALBP.

Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serganov, A.; Huang, L; Patel, D

2009-01-01

The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains.more » FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.« less

ATP Binding to p97/VCP D1 Domain Regulates Selective Recruitment of Adaptors to Its Proximal N-Domain

PubMed Central

Chia, Wei Sheng; Chia, Diana Xueqi; Rao, Feng; Bar Nun, Shoshana; Geifman Shochat, Susana

2012-01-01

p97/Valosin-containing protein (VCP) is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD). It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell. PMID:23226521

Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

PubMed

Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

2017-05-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

PubMed Central

Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

2017-01-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

ATP binding to p97/VCP D1 domain regulates selective recruitment of adaptors to its proximal N-domain.

PubMed

Chia, Wei Sheng; Chia, Diana Xueqi; Rao, Feng; Bar Nun, Shoshana; Geifman Shochat, Susana

2012-01-01

p97/Valosin-containing protein (VCP) is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD). It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell.

A region rich in aspartic acid, arginine, tyrosine, and glycine (DRYG) mediates eukaryotic initiation factor 4B (eIF4B) self-association and interaction with eIF3.

PubMed Central

Méthot, N; Song, M S; Sonenberg, N

1996-01-01

The binding of mRNA to the ribosome is mediated by eukaryotic initiation factors eukaryotic initiation factor 4F (eIF4F), eIF4B, eIF4A, and eIF3, eIF4F binds to the mRNA cap structure and, in combination with eIF4B, is believed to unwind the secondary structure in the 5' untranslated region to facilitate ribosome binding. eIF3 associates with the 40S ribosomal subunit prior to mRNA binding. eIF4B copurifies with eIF3 and eIF4F through several purification steps, suggesting the involvement of a multisubunit complex during translation initiation. To understand the mechanism by which eIF4B promotes 40S ribosome binding to the mRNA, we studied its interactions with partner proteins by using a filter overlay (protein-protein [far Western]) assay and the two-hybrid system. In this report, we show that eIF4B self-associates and also interacts directly with the p170 subunit of eIF3. A region rich in aspartic acid, arginine, tyrosine, and glycine, termed the DRYG domain, is sufficient for self-association of eIF4B, both in vitro and in vivo, and for interaction with the p170 subunit of eIF3. These experiments suggest that eIF4B participates in mRNA-ribosome binding by acting as an intermediary between the mRNA and eIF3, via a direct interaction with the p170 subunit of eIF3. PMID:8816444

Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

PubMed Central

Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

2015-01-01

The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

Diffusion Monte Carlo method for evaluating Hamaker constants

NASA Astrophysics Data System (ADS)

Maezono, Ryo; Hongo, Kenta

We evaluated Hamaker's constants for Si6H12 (CHS) to investigate its wettability, which is industrially useful but no references available. The constant is fundamental for wettability, but not directly accessible by experiments. Ab initio estimations are therefore in demand, and surely give an impact for broader fields such as tribology where the wettability plays an important role. The evaluation of binding curves itself could be a big challenge if it is applied to a practical molecule such as CHS, because highly accurate descriptions of electron correlations in vdW bindings get tough for such larger sizes with anisotropy. We applied DMC to overcome this difficulty, showing a new direction for wettability issues. Since ab intio estimations rely on simple assumptions such as additivity (and hence we denote it as Aadd), it would include biases. Taking a benzene as a benchmark, we compared Aadd evaluated from several available binding curves with other reported AL (estimations based on Lifshitz theory). By the comparison, we get trends of biases in Aa dd due to non-additivity and anisotropy because AL is expected to capture these effects to some extent in macroscopic manner. The expected trends here surprisingly well explain the series of results for CHS.

Assessment of ability of murine and human anti-lipid A monoclonal antibodies to bind and neutralize lipopolysaccharide

PubMed Central

1993-01-01

The use of monoclonal antibodies (mAbs) directed to lipid A for the therapy of gram-negative sepsis is controversial. In an attempt to understand their biologic basis of action, we used a fluid-phase radioimmunoassay to measure binding between bacterial lipopolysaccharide (LPS) and two IgM mAbs directed to lipid A that are being evaluated for the treatment of gram-negative bacterial sepsis. Both antibodies bound 3H-LPS prepared from multiple strains of gram- negative bacteria when large excesses of antibody were used, although binding was modest and only slightly greater than control preparations. We also studied the ability of each anti-lipid A antibody to neutralize some of the biological effects of LPS in vitro. Despite large molar excesses, neither antibody neutralized LPS as assessed by the limulus lysate test, by a mitogenic assay for murine splenocytes, or by the production of cytokines interleukin (IL)-1, IL-6, or tumor necrosis factor from human monocytes in culture medium or in whole blood. Our experiments do not support the hypothesis that either of these anti- lipid A mAbs function by neutralizing the toxic effects of LPS. PMID:8418211

Transportin acts to regulate mitotic assembly events by target binding rather than Ran sequestration

PubMed Central

Bernis, Cyril; Swift-Taylor, Beth; Nord, Matthew; Carmona, Sarah; Chook, Yuh Min; Forbes, Douglass J.

2014-01-01

The nuclear import receptors importin β and transportin play a different role in mitosis: both act phenotypically as spatial regulators to ensure that mitotic spindle, nuclear membrane, and nuclear pore assembly occur exclusively around chromatin. Importin β is known to act by repressing assembly factors in regions distant from chromatin, whereas RanGTP produced on chromatin frees factors from importin β for localized assembly. The mechanism of transportin regulation was unknown. Diametrically opposed models for transportin action are as follows: 1) indirect action by RanGTP sequestration, thus down-regulating release of assembly factors from importin β, and 2) direct action by transportin binding and inhibiting assembly factors. Experiments in Xenopus assembly extracts with M9M, a superaffinity nuclear localization sequence that displaces cargoes bound by transportin, or TLB, a mutant transportin that can bind cargo and RanGTP simultaneously, support direct inhibition. Consistently, simple addition of M9M to mitotic cytosol induces microtubule aster assembly. ELYS and the nucleoporin 107–160 complex, components of mitotic kinetochores and nuclear pores, are blocked from binding to kinetochores in vitro by transportin, a block reversible by M9M. In vivo, 30% of M9M-transfected cells have spindle/cytokinesis defects. We conclude that the cell contains importin β and transportin “global positioning system”or “GPS” pathways that are mechanistically parallel. PMID:24478460

Functional Targets of the Monogenic Diabetes Transcription Factors HNF-1α and HNF-4α Are Highly Conserved Between Mice and Humans

PubMed Central

Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge

2009-01-01

OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435

Object-based attention underlies the rehearsal of feature binding in visual working memory.

PubMed

Shen, Mowei; Huang, Xiang; Gao, Zaifeng

2015-04-01

Feature binding is a core concept in many research fields, including the study of working memory (WM). Over the past decade, it has been debated whether keeping the feature binding in visual WM consumes more visual attention than the constituent single features. Previous studies have only explored the contribution of domain-general attention or space-based attention in the binding process; no study so far has explored the role of object-based attention in retaining binding in visual WM. We hypothesized that object-based attention underlay the mechanism of rehearsing feature binding in visual WM. Therefore, during the maintenance phase of a visual WM task, we inserted a secondary mental rotation (Experiments 1-3), transparent motion (Experiment 4), or an object-based feature report task (Experiment 5) to consume the object-based attention available for binding. In line with the prediction of the object-based attention hypothesis, Experiments 1-5 revealed a more significant impairment for binding than for constituent single features. However, this selective binding impairment was not observed when inserting a space-based visual search task (Experiment 6). We conclude that object-based attention underlies the rehearsal of binding representation in visual WM. (c) 2015 APA, all rights reserved.

Bindings in working memory: The role of object-based attention.

PubMed

Gao, Zaifeng; Wu, Fan; Qiu, Fangfang; He, Kaifeng; Yang, Yue; Shen, Mowei

2017-02-01

Over the past decade, it has been debated whether retaining bindings in working memory (WM) requires more attention than retaining constituent features, focusing on domain-general attention and space-based attention. Recently, we proposed that retaining bindings in WM needs more object-based attention than retaining constituent features (Shen, Huang, & Gao, 2015, Journal of Experimental Psychology: Human Perception and Performance, doi: 10.1037/xhp0000018 ). However, only unitized visual bindings were examined; to establish the role of object-based attention in retaining bindings in WM, more emperical evidence is required. We tested 4 new bindings that had been suggested requiring no more attention than the constituent features in the WM maintenance phase: The two constituent features of binding were stored in different WM modules (cross-module binding, Experiment 1), from auditory and visual modalities (cross-modal binding, Experiment 2), or temporally (cross-time binding, Experiments 3) or spatially (cross-space binding, Experiments 4-6) separated. In the critical condition, we added a secondary object feature-report task during the delay interval of the change-detection task, such that the secondary task competed for object-based attention with the to-be-memorized stimuli. If more object-based attention is required for retaining bindings than for retaining constituent features, the secondary task should impair the binding performance to a larger degree relative to the performance of constituent features. Indeed, Experiments 1-6 consistently revealed a significantly larger impairment for bindings than for the constituent features, suggesting that object-based attention plays a pivotal role in retaining bindings in WM.

Identification of cisplatin-binding sites on the large cytoplasmic loop of the Na+/K+-ATPase.

PubMed

Šeflová, Jaroslava; Čechová, Petra; Štenclová, Tereza; Šebela, Marek; Kubala, Martin

2018-12-01

Cisplatin is the most widely used chemotherapeutic drug for the treatment of various types of cancer; however, its administration brings also numerous side effects. It was demonstrated that cisplatin can inhibit the Na + /K + -ATPase (NKA), which can explain a large part of the adverse effects. In this study, we have identified five cysteinyl residues (C452, C456, C457, C577, and C656) as the cisplatin binding sites on the cytoplasmic loop connecting transmembrane helices 4 and 5 (C45), using site-directed mutagenesis and mass spectrometry experiments. The identified residues are known to be susceptible to glutathionylation indicating their involvement in a common regulatory mechanism.

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Direct Observation of Gold Nanoparticle Assemblies with the Porin MspA on Mica

PubMed Central

Basel, Matthew T.; Dani, Raj Kumar; Kang, Myungshim; Pavlenok, Mikhail; Chikan, Viktor; Smith, Paul E.; Niederweis, Michael

2009-01-01

The octameric porin MspA from Mycobacterium smegmatis is sufficiently stable to form a non-membrane-supported stand-alone porin on Mica surfaces. About 98% of all MspA octamers were found to stand upright on Mica, with their periplasmic loop regions bound to the hydrophilic Mica surface. Both, small (d = 3.7 nm) and large (d = 17 nm) gold nanoparticles bind to MspA, however in different positions: small gold nanoparticles bind within the MspA pore, whereas the large gold nanoparticles bind to the upper region of MspA. These experiments demonstrate that gold nanoparticles can be positioned at different, well-defined distances from the underlying surface using the MspA pore as a template. These findings represent a significant step towards the use of electrically insulating stable proteins in combination with metal nanoparticles in nanodevices. PMID:19236086

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

PubMed

Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

2018-05-04

Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional and structural analysis of the sialic acid-binding domain of rotaviruses.

PubMed Central

Isa, P; López, S; Segovia, L; Arias, C F

1997-01-01

The infectivity of most animal rotaviruses is dependent on the interaction of the virus spike protein VP4 with a sialic acid (SA)-containing cell receptor, and the SA-binding domain of this protein has been mapped between amino acids 93 and 208 of its trypsin cleavage fragment VP8. To identify which residues in this region are essential for the SA-binding activity, we performed alanine mutagenesis of the rotavirus RRV VP8 expressed in bacteria as a fusion polypeptide with glutathione S-transferase. Tyrosines were primarily targeted since tyrosine has been involved in the interaction of other viral hemagglutinins with SA. Of the 15 substitutions carried out, 10 abolished the SA-dependent hemagglutination activity of the protein, as well as its ability to bind to glycophorin A in a solid-phase assay. However, only alanine substitutions for tyrosines 155 and 188 and for serine 190 did not affect the overall conformation of the protein, as judged by their interaction with a panel of conformationally sensitive neutralizing VP8 monoclonal antibodies (MAbs). These findings suggest that these three amino acids play an essential role in the SA-binding activity of the protein, presumably by interacting directly with the SA molecule. The predicted secondary structure of VP8 suggests that it is organized as 11 beta-strands separated by loops; in this model, Tyr-155 maps to loop 7 while Tyr-188 and Ser-190 map to loop 9. The close proximity of these two loops is also supported by previous results from competition experiments with neutralizing MAbs directed at RRV VP8. PMID:9261399

Direct photoassociation of halo molecules in ultracold 86 Sr

NASA Astrophysics Data System (ADS)

Aman, J. A.; Hill, Joshua; Killian, T. C.

2017-04-01

We investigate the creation of 1S0 +1S0 halo molecules in strontium 86 through direct photoassociation in an optical dipole trap. We drive two photon Raman transitions near-resonance with a molecular level of the 1S0 +3P1 interatomic potential as the intermediate state. This provides large Frank-Condon factors and allows us to observe resonances for the creation of halo molecules through higher order Raman processes. The halo molecule is bound by EB 85 kHz at low excitation-laser intensity, but experiments show large AC Stark shifts of the molecular binding energy. These conditions suggest that STIRAP should be very effective for improving molecular conversion efficiency. Further experiments in a 3D lattice will explore molecular lifetimes and collision rates. Travel support provided by Shell Corporation.

Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less

Functional and Selective Bacterial Interfaces Using Cross-Scaffold Gold Binding Peptides

NASA Astrophysics Data System (ADS)

Adams, Bryn L.; Hurley, Margaret M.; Jahnke, Justin P.; Stratis-Cullum, Dimitra N.

2015-11-01

We investigated the functional and selective activity of three phage-derived gold-binding peptides on the Escherichia coli ( E. coli) bacterial cell surface display scaffold (eCPX) for the first time. Gold-binding peptides, p3-Au12 (LKAHLPPSRLPS), p8#9 (VSGSSPDS), and Midas-2 (TGTSVLIATPYV), were compared side-by-side through experiment and simulation. All exhibited strong binding to an evaporated gold film, with approximately a 4-log difference in binding between each peptide and the control sample. The increased affinity for gold was also confirmed by direct visualization of samples using Scanning Electron Microscopy (SEM). Peptide dynamics in solution were performed to analyze innate structure, and all three were found to have a high degree of flexibility. Preferential binding to gold over silicon for all three peptides was demonstrated, with up to four orders of magnitude selectivity exhibited by p3-Au12. The selectivity was also clearly evident through SEM analysis of the boundary between the gold film and silicon substrate. Functional activity of bound E. coli cells was further demonstrated by stimulating filamentation and all three peptides were characterized as prolific relative to control samples. This work shows great promise towards functional and active bacterial-hybrid gold surfaces and the potential to enable the next generation living material interfaces.

Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

PubMed

DasGupta, G; White, J; Cheung, P; Reisler, E

1990-09-11

The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

Direct Binding of the Corrector VX-809 to Human CFTR NBD1: Evidence of an Allosteric Coupling between the Binding Site and the NBD1:CL4 Interface.

PubMed

Hudson, Rhea P; Dawson, Jennifer E; Chong, P Andrew; Yang, Zhengrong; Millen, Linda; Thomas, Philip J; Brouillette, Christie G; Forman-Kay, Julie D

2017-08-01

Understanding the mechanism of action of modulator compounds for the cystic fibrosis transmembrane conductance regulator (CFTR) is key for the optimization of therapeutics as well as obtaining insights into the molecular mechanisms of CFTR function. We demonstrate the direct binding of VX-809 to the first nucleotide-binding domain (NBD1) of human CFTR. Disruption of the interaction between C-terminal helices and the NBD1 core upon VX-809 binding is observed from chemical shift changes in the NMR spectra of residues in the helices and on the surface of β -strands S3, S9, and S10. Binding to VX-809 leads to a significant negative shift in NBD1 thermal melting temperature (T m ), pointing to direct VX-809 interaction shifting the NBD1 conformational equilibrium. An inter-residue correlation analysis of the chemical shift changes provides evidence of allosteric coupling between the direct binding site and the NBD1:CL4 interface, thus enabling effects on the interface in the absence of direct binding in that location. These NMR binding data and the negative T m shifts are very similar to those previously reported by us for binding of the dual corrector-potentiator CFFT-001 to NBD1 (Hudson et al., 2012), suggesting that the two compounds may share some aspects of their mechanisms of action. Although previous studies have shown an important role for VX-809 in modulating the conformation of the first membrane spanning domain (Aleksandrov et al., 2012; Ren et al., 2013), this additional mode of VX-809 binding provides insight into conformational dynamics and allostery within CFTR. Copyright © 2017 by The Author(s).

On the binding energy and the charge symmetry breaking in A ≤ 16 Λ-hypernuclei

NASA Astrophysics Data System (ADS)

Botta, E.; Bressani, T.; Feliciello, A.

2017-04-01

In recent years, several experiments using magnetic spectrometers provided high precision results in the field of Hypernuclear Physics. In particular, the accurate determination of the Λ-binding energy, BΛ, contributed to stimulate considerably the discussion about the Charge Symmetry Breaking effect in Λ-hypernuclei isomultiplets. We have reorganized the results from the FINUDA experiment and we have obtained a series of BΛ values for Λ-hypernuclei with A≤ 16 by taking into account data only from magnetic spectrometers implementing an absolute calibration of the energy scale (FINUDA at DAΦNE and electroproduction experiments at JLab and at MaMi). We have then critically revisited the results obtained at KEK by the SKS Collaboration in order to make possible a direct comparison between data from experiments with and without such an absolute energy scale. A synopsis of recent spectrometric measurements of BΛ is presented, including also emulsion experiment results. Several interesting conclusions are drawn, among which the equality within the errors of BΛ for the A = 7 , 12 , 16 isomultiplets, based only on recent spectrometric data. This observation is in nice agreement with a recent theoretical prediction. Ideas for possible new measurements which should improve the present experimental knowledge are finally put forward.

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

Interaction between the phage HK022 Nun protein and the nut RNA of phage lambda.

PubMed

Chattopadhyay, S; Hung, S C; Stuart, A C; Palmer, A G; Garcia-Mena, J; Das, A; Gottesman, M E

1995-12-19

The nun gene product of prophage HK022 excludes phage lambda infection by blocking the expression of genes downstream from the lambda nut sequence. The Nun protein functions both by competing with lambda N transcription-antitermination protein and by actively inducing transcription termination on the lambda chromosome. We demonstrate that Nun binds directly to a stem-loop structure within nut RNA, boxB, which is also the target for the N antiterminator. The two proteins show comparable affinities for boxB and they compete with each other. Their interactions with boxB are similar, as shown by RNase protection experiments, NMR spectroscopy, and analysis of boxB mutants. Each protein binds the 5' strand of the boxB stem and the adjacent loop. The stem does not melt upon the binding of Nun or N, as the 3' strand remains sensitive to a double-strand-specific RNase. The binding of RNA partially protects Nun from proteolysis and changes its NMR spectra. Evidently, although Nun and N bind to the same surface of boxB RNA, their respective complexes interact differently with RNA polymerase, inducing transcription termination or antitermination, respectively.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

The IκBα/NF-κB complex has two hot spots, one at either end of the interface

PubMed Central

Bergqvist, Simon; Ghosh, Gourisankar; Komives, Elizabeth A.

2008-01-01

IκBα binds to and inhibits the transcriptional activity of NF-κB family members via its ankyrin repeat (AR) domain. The binding affinity of IκBα with NF-κB(p50/p65) heterodimers and NF-κB(p65/65) homodimers is in the picomolar range, and in the cell, this results in long half-lives of the complexes. Direct binding experiments have been performed using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) on a series of truncations and mutations in order to understand what regions of the interface are most important for the tight binding affinity of this complex. We previously showed that interactions between residues 305 and 321 of NF-κB(p65) with the first AR of IκBα are critical for the binding energy. Interactions in this region are responsible for more than 7 kcal/mol of the binding energy. Here we show equally drastic consequences for the binding energy occur upon truncation of even a few residues at the C terminus of IκBα. Thus, the interface actually has two hot spots, one at either end of the elongated and large surface of interaction. These results suggest a “squeeze” mechanism that leads to the extremely high affinity of the IκBα•NF-κB complex through stabilization of the ankyrin repeat domain. PMID:18824506

Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study

PubMed Central

Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

2011-01-01

Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570

Core Histones and HIRIP3, a Novel Histone-Binding Protein, Directly Interact with WD Repeat Protein HIRA

PubMed Central

Lorain, Stéphanie; Quivy, Jean-Pierre; Monier-Gavelle, Frédérique; Scamps, Christine; Lécluse, Yann; Almouzni, Geneviève; Lipinski, Marc

1998-01-01

The human HIRA gene has been named after Hir1p and Hir2p, two corepressors which together appear to act on chromatin structure to control gene transcription in Saccharomyces cerevisiae. HIRA homologs are expressed in a regulated fashion during mouse and chicken embryogenesis, and the human gene is a major candidate for the DiGeorge syndrome and related developmental disorders caused by a reduction to single dose of a fragment of chromosome 22q. Western blot analysis and double-immunofluorescence experiments using a specific antiserum revealed a primary nuclear localization of HIRA. Similar to Hir1p, HIRA contains seven amino-terminal WD repeats and probably functions as part of a multiprotein complex. HIRA and core histone H2B were found to physically interact in a yeast double-hybrid protein interaction trap, in GST pull-down assays, and in coimmunoprecipitation experiments performed from cellular extracts. In vitro, HIRA also interacted with core histone H4. H2B- and H4-binding domains were overlapping but distinguishable in the carboxy-terminal region of HIRA, and the region for HIRA interaction was mapped to the amino-terminal tail of H2B and the second α helix of H4. HIRIP3 (HIRA-interacting protein 3) is a novel gene product that was identified from its HIRA-binding properties in the yeast protein interaction trap. In vitro, HIRIP3 directly interacted with HIRA but also with core histones H2B and H3, suggesting that a HIRA-HIRIP3-containing complex could function in some aspects of chromatin and histone metabolism. Insufficient production of HIRA, which we report elsewhere interacts with homeodomain-containing DNA-binding factors during mammalian embryogenesis, could perturb the stoichiometric assembly of multimolecular complexes required for normal embryonic development. PMID:9710638

The Actin Nucleator Cobl Is Controlled by Calcium and Calmodulin

PubMed Central

Haag, Natja; Kessels, Michael M.; Qualmann, Britta

2015-01-01

Actin nucleation triggers the formation of new actin filaments and has the power to shape cells but requires tight control in order to bring about proper morphologies. The regulation of the members of the novel class of WASP Homology 2 (WH2) domain-based actin nucleators, however, thus far has largely remained elusive. Our study reveals signal cascades and mechanisms regulating Cordon-Bleu (Cobl). Cobl plays some, albeit not fully understood, role in early arborization of neurons and nucleates actin by a mechanism that requires a combination of all three of its actin monomer–binding WH2 domains. Our experiments reveal that Cobl is regulated by Ca2+ and multiple, direct associations of the Ca2+ sensor Calmodulin (CaM). Overexpression analyses and rescue experiments of Cobl loss-of-function phenotypes with Cobl mutants in primary neurons and in tissue slices demonstrated the importance of CaM binding for Cobl’s functions. Cobl-induced dendritic branch initiation was preceded by Ca2+ signals and coincided with local F-actin and CaM accumulations. CaM inhibitor studies showed that Cobl-mediated branching is strictly dependent on CaM activity. Mechanistic studies revealed that Ca2+/CaM modulates Cobl’s actin binding properties and furthermore promotes Cobl’s previously identified interactions with the membrane-shaping F-BAR protein syndapin I, which accumulated with Cobl at nascent dendritic protrusion sites. The findings of our study demonstrate a direct regulation of an actin nucleator by Ca2+/CaM and reveal that the Ca2+/CaM-controlled molecular mechanisms we discovered are crucial for Cobl’s cellular functions. By unveiling the means of Cobl regulation and the mechanisms, by which Ca2+/CaM signals directly converge on a cellular effector promoting actin filament formation, our work furthermore sheds light on how local Ca2+ signals steer and power branch initiation during early arborization of nerve cells—a key process in neuronal network formation. PMID:26334624

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA.

PubMed

Iakhiaeva, Elena; Iakhiaev, Alexei; Zwieb, Christian

2010-11-13

Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed.

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA

PubMed Central

2010-01-01

Background Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. Results We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. Conclusions The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed. PMID:21073748

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

PubMed

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-01

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

An ‘environment to nucleus’ signaling system operates in B lymphocytes: redox status modulates BSAP/Pax-5 activation through Ref-1 nuclear translocation

PubMed Central

Tell, Gianluca; Zecca, Alessandro; Pellizzari, Lucia; Spessotto, Paola; Colombatti, Alfonso; Kelley, Mark R.; Damante, Giuseppe; Pucillo, Carlo

2000-01-01

The Ref-1 (also called APE or HAP1) protein is a bifunctional enzyme impacting on a wide variety of important cellular functions. It acts as a major member of the DNA base excision repair pathway. Moreover, Ref-1 stimulates the DNA-binding activity of several transcription factors (TFs) through the reduction of highly reactive cysteine residues. Therefore, it represents a mechanism that regulates eukaryotic gene expression in a fast way. However, it has been demonstrated that external stimuli directly act on Ref-1 by increasing its expression levels, a time-consuming mechanism representing a paradox in terms of rapidity of TF regulation. In this paper we demonstrate that this is only an apparent paradox. Exposure of B lymphocytes to H2O2 induced a rapid and sustained increase in Ref-1 protein levels in the nucleus as evaluated by both western blot analysis and by pulse–chase experiments. A time course, two color in situ immunocytochemistry indicated that the up-regulation of Ref-1 in the nucleus at <30 min was primarily the consequence of translocation of its cytoplasmic form. This early nuclear accumulation is effective in modulating the DNA-binding activity of the B cell-specific activator protein BSAP/Pax-5. In fact, EMSA experiments demonstrate that a transient interaction with Ref-1 up-regulates the DNA-binding activity of BSAP/Pax-5. Moreover, in a co-transfection experiment, Ref-1 increased the BSAP/Pax-5 activating effect on an oligomerized BSAP/Pax-5 binding site of the CD19 promoter by 5- to 8-fold. Thus, Ref-1 mediates its effect by up-regulating the DNA-binding activity of BSAP/Pax-5, accounting for a new and fast outside/inside pathway of signaling in B cells. PMID:10666449

Leveraging non-binding instruments for global health governance: reflections from the Global AIDS Reporting Mechanism for WHO reform.

PubMed

Taylor, A L; Alfven, T; Hougendobler, D; Tanaka, S; Buse, K

2014-02-01

As countries contend with an increasingly complex global environment with direct implications for population health, the international community is seeking novel mechanisms to incentivize coordinated national and international action towards shared health goals. Binding legal instruments have garnered increasing attention since the World Health Organization adopted its first convention in 2003. This paper seeks to expand the discourse on future global health lawmaking by exploring the potential value of non-binding instruments in global health governance, drawing on the case of the 2001 United Nations General Assembly Special Session Declaration of Commitment on HIV/AIDS. In other realms of international concern ranging from the environment to human rights to arms control, non-binding instruments are increasingly used as effective instruments of international cooperation. The experience of the Global AIDS Reporting Mechanism, established pursuant to the Declaration, evidences that, at times, non-binding legal instruments can offer benefits over slower, more rigid binding legal approaches to governance. The global AIDS response has demonstrated that the use of a non-binding instrument can be remarkably effective in galvanizing increasingly deep commitments, action, reporting compliance and ultimately accountability for results. Based on this case, the authors argued that non-binding instruments deserve serious consideration by the international community for the future of global health governance, including in the context of WHO reform. Copyright © 2013 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Has work replaced home as a haven? Re-examining Arlie Hochschild's Time Bind proposition with objective stress data.

PubMed

Damaske, Sarah; Smyth, Joshua M; Zawadzki, Matthew J

2014-08-01

Using innovative data with objective and subjective measures of stress collected from 122 employed men and women, this paper tests the thesis of the Time Bind by asking whether people report lower stress levels at work than at home. The study finds consistent support for the Time Bind hypothesis when examining objective stress data: when participants were at work they had lower values of the stress hormone cortisol than when they were at home. Two variables moderated this association - income and children at home - such that the work as haven effect was stronger for those with lower incomes and no children living at home. Participants also, however, consistently reported higher subjective stress levels on work days than on non-work days, which is in direct contrast to the Time Bind hypothesis. Although our overall findings support Hochschild's hypothesis that stress levels are lower at work, it appears that combining work and home increases people's subjective experience of daily stress. Copyright © 2014 Elsevier Ltd. All rights reserved.

NMR unfolding studies on a liver bile acid binding protein reveal a global two-state unfolding and localized singular behaviors.

PubMed

D'Onofrio, Mariapina; Ragona, Laura; Fessas, Dimitrios; Signorelli, Marco; Ugolini, Raffaella; Pedò, Massimo; Assfalg, Michael; Molinari, Henriette

2009-01-01

The folding properties of a bile acid binding protein, belonging to a subfamily of the fatty acid binding proteins, have been here investigated both by hydrogen exchange measurements, using the SOFAST NMR approach, and urea denaturation experiments. The urea unfolding profiles of individual residues, acting as single probes, were simultaneously analyzed through a global fit, according to a two-state unfolding model. The resulting conformational stability DeltaG(U)(H(2)O)=7.2+/-0.25kcal mol(-1) is in good agreement with hydrogen exchange stability DeltaG(op). While the majority of protein residues satisfy this model, few amino-acids display a singular behavior, not directly amenable to the presence of a folding intermediate, as reported for other fatty acid binding proteins. These residues are part of a protein patch characterized by enhanced plasticity. To explain this singular behavior a tentative model has been proposed which takes into account the interplay between the dynamic features and the formation of transient aggregates. A functional role for this plasticity, related to translocation across the nuclear membrane, is discussed.

Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

PubMed

Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

2017-11-27

Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Crystal structures of ryanodine receptor SPRY1 and tandem-repeat domains reveal a critical FKBP12 binding determinant

NASA Astrophysics Data System (ADS)

Yuchi, Zhiguang; Yuen, Siobhan M. Wong King; Lau, Kelvin; Underhill, Ainsley Q.; Cornea, Razvan L.; Fessenden, James D.; van Petegem, Filip

2015-08-01

Ryanodine receptors (RyRs) form calcium release channels located in the membranes of the sarcoplasmic and endoplasmic reticulum. RyRs play a major role in excitation-contraction coupling and other Ca2+-dependent signalling events, and consist of several globular domains that together form a large assembly. Here we describe the crystal structures of the SPRY1 and tandem-repeat domains at 1.2-1.5 Å resolution, which reveal several structural elements not detected in recent cryo-EM reconstructions of RyRs. The cryo-EM studies disagree on the position of SPRY domains, which had been proposed based on homology modelling. Computational docking of the crystal structures, combined with FRET studies, show that the SPRY1 domain is located next to FK506-binding protein (FKBP). Molecular dynamics flexible fitting and mutagenesis experiments suggest a hydrophobic cluster within SPRY1 that is crucial for FKBP binding. A RyR1 disease mutation, N760D, appears to directly impact FKBP binding through interfering with SPRY1 folding.

Direct binding of F actin to the cytoplasmic domain of the alpha 2 integrin chain in vitro

NASA Technical Reports Server (NTRS)

Kieffer, J. D.; Plopper, G.; Ingber, D. E.; Hartwig, J. H.; Kupper, T. S.

1995-01-01

The transmembrane integrins have been shown to interact with the cytoskeleton via noncovalent binding between cytoplasmic domains (CDs) of integrin beta chains and various actin binding proteins within the focal adhesion complex. Direct or indirect integrin alpha chain CD binding to the actin cytoskeleton has not been reported. We show here that actin, as an abundant constituent of focal adhesion complex proteins isolated from fibroblasts, binds strongly and specifically to alpha 2 CD, but not to alpha 1 CD peptide. Similar specific binding to alpha 2 CD peptide was seen for highly purified F actin, free of putative actin-binding proteins. The bound complex of actin and peptide was visualized directly by coprecipitation, and actin binding was abrogated by removal of a five amino acid sequence from the alpha 2 CD peptide. Our findings may explain the earlier observation that, while integrins alpha 2 beta 1 and alpha 1 beta 1 both bind to collagen, only alpha 2 beta 1 can mediate contraction of extracellular collagen matrices.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

The role of attention in binding visual features in working memory: evidence from cognitive ageing.

PubMed

Brown, Louise A; Brockmole, James R

2010-10-01

Two experiments were conducted to assess the costs of attentional load during a feature (colour-shape) binding task in younger and older adults. Experiment 1 showed that a demanding backwards counting task, which draws upon central executive/general attentional resources, reduced binding to a greater extent than individual feature memory, but the effect was no greater in older than in younger adults. Experiment 2 showed that presenting memory items sequentially rather than simultaneously, such that items are required to be maintained while new representations are created, selectively affects binding performance in both age groups. Although this experiment exhibited an age-related binding deficit overall, both age groups were affected by the attention manipulation to an equal extent. While a role for attentional processes in colour-shape binding was apparent across both experiments, manipulations of attention exerted equal effects in both age groups. We therefore conclude that age-related binding deficits neither emerge nor are exacerbated under conditions of high attentional load. Implications for theories of visual working memory and cognitive ageing are discussed.

Laboratory evolution of artificially expanded DNA gives redesignable aptamers that target the toxic form of anthrax protective antigen

PubMed Central

Biondi, Elisa; Lane, Joshua D.; Das, Debasis; Dasgupta, Saurja; Piccirilli, Joseph A.; Hoshika, Shuichi; Bradley, Kevin M.; Krantz, Bryan A.; Benner, Steven A.

2016-01-01

Reported here is a laboratory in vitro evolution (LIVE) experiment based on an artificially expanded genetic information system (AEGIS). This experiment delivers the first example of an AEGIS aptamer that binds to an isolated protein target, the first whose structural contact with its target has been outlined and the first to inhibit biologically important activities of its target, the protective antigen from Bacillus anthracis. We show how rational design based on secondary structure predictions can also direct the use of AEGIS to improve the stability and binding of the aptamer to its target. The final aptamer has a dissociation constant of ∼35 nM. These results illustrate the value of AEGIS-LIVE for those seeking to obtain receptors and ligands without the complexities of medicinal chemistry, and also challenge the biophysical community to develop new tools to analyze the spectroscopic signatures of new DNA folds that will emerge in synthetic genetic systems replacing standard DNA and RNA as platforms for LIVE. PMID:27701076

Rational Design of a New Class of Toll-Like Receptor 4 (TLR4) Tryptamine Related Agonists by Means of the Structure- and Ligand-Based Virtual Screening for Vaccine Adjuvant Discovery.

PubMed

Honegr, Jan; Dolezal, Rafael; Malinak, David; Benkova, Marketa; Soukup, Ondrej; Almeida, Joyce S F D de; Franca, Tanos C C; Kuca, Kamil; Prymula, Roman

2018-01-04

In order to identify novel lead structures for human toll-like receptor 4 ( h TLR4) modulation virtual high throughput screening by a peta-flops-scale supercomputer has been performed. Based on the in silico studies, a series of 12 compounds related to tryptamine was rationally designed to retain suitable molecular geometry for interaction with the h TLR4 binding site as well as to satisfy general principles of drug-likeness. The proposed compounds were synthesized, and tested by in vitro and ex vivo experiments, which revealed that several of them are capable to stimulate h TLR4 in vitro up to 25% activity of Monophosphoryl lipid A. The specific affinity of the in vitro most potent substance was confirmed by surface plasmon resonance direct-binding experiments. Moreover, two compounds from the series show also significant ability to elicit production of interleukin 6.

Attention to Attributes and Objects in Working Memory

PubMed Central

Cowan, Nelson; Blume, Christopher L.; Saults, J. Scott

2013-01-01

It has been debated on the basis of change-detection procedures whether visual working memory is limited by the number of objects, task-relevant attributes within those objects, or bindings between attributes. This debate, however, has been hampered by several limitations, including the use of conditions that vary between studies and the absence of appropriate mathematical models to estimate the number of items in working memory in different stimulus conditions. We re-examined working memory limits in two experiments with a wide array of conditions involving color and shape attributes, relying on a set of new models to fit various stimulus situations. In Experiment 2, a new procedure allowed identical retrieval conditions across different conditions of attention at encoding. The results show that multiple attributes compete for attention, but that retaining the binding between attributes is accomplished only by retaining the attributes themselves. We propose a theoretical account in which a fixed object capacity limit contains within it the possibility of the incomplete retention of object attributes, depending on the direction of attention. PMID:22905929

Multitargeting by curcumin as revealed by molecular interaction studies

PubMed Central

Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

2012-01-01

Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

Native Hydrophobic Binding Interactions at the Transition State for Association between the TAZ1 Domain of CBP and the Disordered TAD-STAT2 Are Not a Requirement.

PubMed

Lindström, Ida; Dogan, Jakob

2017-08-15

A significant fraction of the eukaryotic proteome consists of proteins that are either partially or completely disordered under native-like conditions. Intrinsically disordered proteins (IDPs) are common in protein-protein interactions and are involved in numerous cellular processes. Although many proteins have been identified as disordered, much less is known about the binding mechanisms of the coupled binding and folding reactions involving IDPs. Here we have analyzed the rate-limiting transition state for binding between the TAZ1 domain of CREB binding protein and the intrinsically disordered transactivation domain of STAT2 (TAD-STAT2) by site-directed mutagenesis and kinetic experiments (Φ-value analysis) and found that the native protein-protein binding interface is not formed at the transition state for binding. Instead, native hydrophobic binding interactions form late, after the rate-limiting barrier has been crossed. The association rate constant in the absence of electrostatic enhancement was determined to be rather high. This is consistent with the Φ-value analysis, which showed that there are few or no obligatory native contacts. Also, linear free energy relationships clearly demonstrate that native interactions are cooperatively formed, a scenario that has usually been observed for proteins that fold according to the so-called nucleation-condensation mechanism. Thus, native hydrophobic binding interactions at the rate-limiting transition state for association between TAD-STAT2 and TAZ1 are not a requirement, which is generally in agreement with previous findings on other IDP systems and might be a common mechanism for IDPs.

The Fur-Iron Complex Modulates Expression of the Quorum-Sensing Master Regulator, SmcR, To Control Expression of Virulence Factors in Vibrio vulnificus

PubMed Central

Kim, In Hwang; Wen, Yancheng; Son, Jee-Soo; Lee, Kyu-Ho

2013-01-01

The gene vvpE, encoding the virulence factor elastase, is a member of the quorum-sensing regulon in Vibrio vulnificus and displays enhanced expression at high cell density. We observed that this gene was repressed under iron-rich conditions and that the repression was due to a Fur (ferric uptake regulator)-dependent repression of smcR, a gene encoding a quorum-sensing master regulator with similarity to luxR in Vibrio harveyi. A gel mobility shift assay and a footprinting experiment demonstrated that the Fur-iron complex binds directly to two regions upstream of smcR (−82 to −36 and −2 to +27, with respect to the transcription start site) with differing affinities. However, binding of the Fur-iron complex is reversible enough to allow expression of smcR to be induced by quorum sensing at high cell density under iron-rich conditions. Under iron-limiting conditions, Fur fails to bind either region and the expression of smcR is regulated solely by quorum sensing. These results suggest that two biologically important environmental signals, iron and quorum sensing, converge to direct the expression of smcR, which then coordinates the expression of virulence factors. PMID:23716618

Energetics of subdomain movements and fluorescence probe solvation environment change in ATP-bound myosin.

PubMed

Harris, Michael J; Woo, Hyung-June

2008-11-01

Energetics of conformational changes experienced by an ATP-bound myosin head detached from actin was studied by all-atom explicit water umbrella sampling simulations. The statistics of coupling between large scale domain movements and smaller scale structural features were examined, including the closing of the ATP binding pocket, and a number of key hydrogen bond formations shown to play roles in structural and biochemical studies. The statistics for the ATP binding pocket open/close transition show an evolution of the relative stability from the open state in the early stages of the recovery stroke to the stable closed state after the stroke. The change in solvation environment of the fluorescence probe Trp507 (scallop numbering; 501 in Dictyostelium discoideum) indicates that the probe faithfully reflects the closing of the binding pocket as previously shown in experimental studies, while being directly coupled to roughly the early half of the overall large scale conformational change of the converter domain rotation. The free energy change of this solvation environment change, in particular, is -1.3 kcal/mol, in close agreement with experimental estimates. In addition, our results provide direct molecular level data allowing for interpretations of the fluorescence experiments of myosin conformational change in terms of the de-solvation of Trp side chain.

Observation of Binding and Rotation of Methane and Hydrogen within a Functional Metal–Organic Framework

PubMed Central

2016-01-01

The key requirement for a portable store of natural gas is to maximize the amount of gas within the smallest possible space. The packing of methane (CH4) in a given storage medium at the highest possible density is, therefore, a highly desirable but challenging target. We report a microporous hydroxyl-decorated material, MFM-300(In) (MFM = Manchester Framework Material, replacing the NOTT designation), which displays a high volumetric uptake of 202 v/v at 298 K and 35 bar for CH4 and 488 v/v at 77 K and 20 bar for H2. Direct observation and quantification of the location, binding, and rotational modes of adsorbed CH4 and H2 molecules within this host have been achieved, using neutron diffraction and inelastic neutron scattering experiments, coupled with density functional theory (DFT) modeling. These complementary techniques reveal a very efficient packing of H2 and CH4 molecules within MFM-300(In), reminiscent of the condensed gas in pure component crystalline solids. We also report here, for the first time, the experimental observation of a direct binding interaction between adsorbed CH4 molecules and the hydroxyl groups within the pore of a material. This is different from the arrangement found in CH4/water clathrates, the CH4 store of nature. PMID:27410670

ZBTB48 is both a vertebrate telomere-binding protein and a transcriptional activator.

PubMed

Jahn, Arne; Rane, Grishma; Paszkowski-Rogacz, Maciej; Sayols, Sergi; Bluhm, Alina; Han, Chung-Ting; Draškovič, Irena; Londoño-Vallejo, José Arturo; Kumar, Alan Prem; Buchholz, Frank; Butter, Falk; Kappei, Dennis

2017-06-01

Telomeres constitute the ends of linear chromosomes and together with the shelterin complex form a structure essential for genome maintenance and stability. In addition to the constitutive binding of the shelterin complex, other direct, yet more transient interactions are mediated by the CST complex and HOT1/HMBOX1, while subtelomeric variant repeats are recognized by NR2C/F transcription factors. Recently, the Kruppel-like zinc finger protein ZBTB48/HKR3/TZAP has been described as a novel telomere-associated factor in the vertebrate lineage. Here, we show that ZBTB48 binds directly both to telomeric and to subtelomeric variant repeat sequences. ZBTB48 is found at telomeres of human cancer cells regardless of the mode of telomere maintenance and it acts as a negative regulator of telomere length. In addition to its telomeric function, we demonstrate through a combination of RNAseq, ChIPseq and expression proteomics experiments that ZBTB48 acts as a transcriptional activator on a small set of target genes, including mitochondrial fission process 1 (MTFP1). This discovery places ZBTB48 at the interface of telomere length regulation, transcriptional control and mitochondrial metabolism. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Statistical-Mechanical Studies of the Collective Binding of Proteins to DNA

NASA Astrophysics Data System (ADS)

Zhang, Houyin

My dissertation work focuses on the microscopic statistical-mechanical studies of DNA-protein interactions and mainly comprises of three projects. In living cells, binding of proteins to DNA controls gene expression and packaging of the genome. Single-DNA stretching and twisting experiments provide a powerful tool to detect binding of proteins, via detection of their modification of DNA mechanical properties. However, it is often difficult or impossible to determine the numbers of proteins bound in such experiments, especially when the proteins interact nonspecifically with DNA. In the first project, we developed single-molecule versions of classical thermodynamic Maxwell relations and proposed that these relations could be used to measure DNA-bound protein numbers, changes in DNA double-helix torque with force, and many other quantities which are hard to directly measure. This approach does not need any theoretical assumptions beyond the existence of thermodynamic equilibrium and has been used in single-DNA experiments. Many single-molecule experiments associated with DNA-bending proteins suggest the existence of cooperative interactions between adjacent DNA-bound proteins. In the second project, we studied a statistical-mechanical worm-like chain model including binding cooperativity effects and found that the intrinsic cooperativity of binding sharpens force-extension curves and causes enhancement of fluctuation of extension and protein occupation. This model also allows us to estimate the intrinsic cooperativity in experiments. We also analyzed force-generated cooperativity and found that the related interaction between proteins is always attractive. This suggests that tension in DNA in vivo could alter the distribution of proteins bound along DNA, causing chromosome refolding, or changes in gene expression. In the third project, we investigated the correlations along DNA-protein complexes. We found there are two different correlation lengths corrected to the geometry of DNA bending - the shorter “longitudinal” correlation length ξ∥(f, μ) and the longer “transverse” correlation length ξ⊥( f, μ). In the high-force limit, ξ∥(f, μ) = ξ⊥(f, μ)/2 = A/4bf . Surprisingly, the range of the interaction between DNA-bending proteins is controlled by the second-longest correlation length. The effect arises from the protein-bend contribution to the Hamiltonian having an axial rotational symmetry which eliminates its coupling to the transverse bending fluctuations.

Bacteroides gingivalis-Actinomyces viscosus cohesive interactions as measured by a quantitative binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, S.; Ellen, R.P.; Grove, D.A.

1987-10-01

There is limited evidence, mostly indirect, to suggest that the adherence of Bacteroides gingivalis to teeth may be enhanced by the presence of gram-positive dental plaque bacteria like Actinomyces viscosus. The purpose of this study was to carry out direct quantitative assessments of the cohesion of B gingivalis and A. viscosus by using an in vitro assay modeled on the natural sequence in which these two species colonize the teeth. The assay allowed comparisons to be made of the adherence of /sup 3/H-labeled B. gingivalis 2561 and 381 to saliva-coated hydroxyapatite beads (S-HA) and A. viscosus WVU627- or T14V-coated S-HAmore » (actinobeads) in equilibrium and kinetics binding studies. A series of preliminary binding studies with 3H-labeled A. viscosus and parallel studies by scanning electron microscopy with unlabeled A. viscosus were conducted to establish a protocol by which actinobeads suitable for subsequent Bacteroides adherence experiments could be prepared. By scanning electron microscopy, the actinobeads had only small gaps of exposed S-HA between essentially irreversibly bound A. viscosus cells. Furthermore, B. gingivalis cells appeared to bind preferentially to the Actinomyces cells instead of the exposed S-HA. B. gingivalis binding to both S-HA and actinobeads was saturable with at least 2 X 10(9) to 3 X 10(9) cells per ml, and equilibrium with saturating concentrations was reached within 10 to 20 min. B. gingivalis always bound in greater numbers to the actinobeads than to S-HA. These findings provide direct measurements supporting the concept that cohesion with dental plaque bacteria like A. viscosus may foster the establishment of B. gingivalis on teeth by enhancing its adherence.« less

Performance of MDockPP in CAPRI rounds 28-29 and 31-35 including the prediction of water-mediated interactions.

PubMed

Xu, Xianjin; Qiu, Liming; Yan, Chengfei; Ma, Zhiwei; Grinter, Sam Z; Zou, Xiaoqin

2017-03-01

Protein-protein interactions are either through direct contacts between two binding partners or mediated by structural waters. Both direct contacts and water-mediated interactions are crucial to the formation of a protein-protein complex. During the recent CAPRI rounds, a novel parallel searching strategy for predicting water-mediated interactions is introduced into our protein-protein docking method, MDockPP. Briefly, a FFT-based docking algorithm is employed in generating putative binding modes, and an iteratively derived statistical potential-based scoring function, ITScorePP, in conjunction with biological information is used to assess and rank the binding modes. Up to 10 binding modes are selected as the initial protein-protein complex structures for MD simulations in explicit solvent. Water molecules near the interface are clustered based on the snapshots extracted from independent equilibrated trajectories. Then, protein-ligand docking is employed for a parallel search for water molecules near the protein-protein interface. The water molecules generated by ligand docking and the clustered water molecules generated by MD simulations are merged, referred to as the predicted structural water molecules. Here, we report the performance of this protocol for CAPRI rounds 28-29 and 31-35 containing 20 valid docking targets and 11 scoring targets. In the docking experiments, we predicted correct binding modes for nine targets, including one high-accuracy, two medium-accuracy, and six acceptable predictions. Regarding the two targets for the prediction of water-mediated interactions, we achieved models ranked as "excellent" in accordance with the CAPRI evaluation criteria; one of these two targets is considered as a difficult target for structural water prediction. Proteins 2017; 85:424-434. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Protein interference applications in cellular and developmental biology using DARPins that recognize GFP and mCherry

PubMed Central

Brauchle, Michael; Hansen, Simon; Caussinus, Emmanuel; Lenard, Anna; Ochoa-Espinosa, Amanda; Scholz, Oliver; Sprecher, Simon G.; Plückthun, Andreas; Affolter, Markus

2014-01-01

ABSTRACT Protein–protein interactions are crucial for cellular homeostasis and play important roles in the dynamic execution of biological processes. While antibodies represent a well-established tool to study protein interactions of extracellular domains and secreted proteins, as well as in fixed and permeabilized cells, they usually cannot be functionally expressed in the cytoplasm of living cells. Non-immunoglobulin protein-binding scaffolds have been identified that also function intracellularly and are now being engineered for synthetic biology applications. Here we used the Designed Ankyrin Repeat Protein (DARPin) scaffold to generate binders to fluorescent proteins and used them to modify biological systems directly at the protein level. DARPins binding to GFP or mCherry were selected by ribosome display. For GFP, binders with KD as low as 160 pM were obtained, while for mCherry the best affinity was 6 nM. We then verified in cell culture their specific binding in a complex cellular environment and found an affinity cut-off in the mid-nanomolar region, above which binding is no longer detectable in the cell. Next, their binding properties were employed to change the localization of the respective fluorescent proteins within cells. Finally, we performed experiments in Drosophila melanogaster and Danio rerio and utilized these DARPins to either degrade or delocalize fluorescently tagged fusion proteins in developing organisms, and to phenocopy loss-of-function mutations. Specific protein binders can thus be selected in vitro and used to reprogram developmental systems in vivo directly at the protein level, thereby bypassing some limitations of approaches that function at the DNA or the RNA level. PMID:25416061

Physical and genetic interactions of yeast Cwc21p, an ortholog of human SRm300/SRRM2, suggest a role at the catalytic center of the spliceosome

PubMed Central

Grainger, Richard J.; Barrass, J. David; Jacquier, Alain; Rain, Jean-Christophe; Beggs, Jean D.

2009-01-01

In Saccharomyces cerevisiae, Cwc21p is a protein of unknown function that is associated with the NineTeen Complex (NTC), a group of proteins involved in activating the spliceosome to promote the pre-mRNA splicing reaction. Here, we show that Cwc21p binds directly to two key splicing factors—namely, Prp8p and Snu114p—and becomes the first NTC-related protein known to dock directly to U5 snRNP proteins. Using a combination of proteomic techniques we show that the N-terminus of Prp8p contains an intramolecular fold that is a Snu114p and Cwc21p interacting domain (SCwid). Cwc21p also binds directly to the C-terminus of Snu114p. Complementary chemical cross-linking experiments reveal reciprocal protein footprints between the interacting Prp8 and Cwc21 proteins, identifying the conserved cwf21 domain in Cwc21p as a Prp8p binding site. Genetic and functional interactions between Cwc21p and Isy1p indicate that they have related functions at or prior to the first catalytic step of splicing, and suggest that Cwc21p functions at the catalytic center of the spliceosome, possibly in response to environmental or metabolic changes. We demonstrate that SRm300, the only SR-related protein known to be at the core of human catalytic spliceosomes, is a functional ortholog of Cwc21p, also interacting directly with Prp8p and Snu114p. Thus, the function of Cwc21p is likely conserved from yeast to humans. PMID:19854871

Photoreduction of Hg(II) and photodemethylation of methylmercury: the key role of thiol sites on dissolved organic matter

USGS Publications Warehouse

Jeremiason, Jeffrey D.; Portner, Joshua C.; Aiken, George R.; Hiranaka, Amber J.; Dvorak, Michelle T.; Tran, Khuyen T.; Latch, Douglas E.

2015-01-01

This study examined the kinetics of photoreduction of Hg(II) and photodemethylation of methylmercury (MeHg+) attached to, or in the presence of, dissolved organic matter (DOM). Both Hg(II) and MeHg+ are principally bound to reduced sulfur groups associated with DOM in many freshwater systems. We propose that a direct photolysis mechanism is plausible for reduction of Hg(II) bound to reduced sulfur groups on DOM while an indirect mechanism is supported for photodemethylation of MeHg+ bound to DOM. UV spectra of Hg(II) and MeHg+ bound to thiol containing molecules demonstrate that the Hg(II)–S bond is capable of absorbing UV-light in the solar spectrum to a much greater extent than MeHg+–S bonds. Experiments with chemically distinct DOM isolates suggest that concentration of DOM matters little in the photochemistry if there are enough reduced S sites present to strongly bind MeHg+ and Hg(II); DOM concentration does not play a prominent role in photodemethylation other than to screen light, which was demonstrated in a field experiment in the highly colored St. Louis River where photodemethylation was not observed at depths ≥10 cm. Experiments with thiol ligands yielded slower photodegradation rates for MeHg+ than in experiments with DOM and thiols; rates in the presence of DOM alone were the fastest supporting an intra-DOM mechanism. Hg(II) photoreduction rates, however, were similar in experiments with only DOM, thiols plus DOM, or only thiols suggesting a direct photolysis mechanism. Quenching experiments also support the existence of an intra-DOM photodemethylation mechanism for MeHg+. Utilizing the difference in photodemethylation rates measured for MeHg+ attached to DOM or thiol ligands, the binding constant for MeHg+ attached to thiol groups on DOM was estimated to be 1016.7.

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

2010-10-28

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; G Buchko; L Qin

2011-12-31

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Structural and Histone Binding Ability Characterizations of Human PWWP Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

2013-09-25

The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less

The Kinetic Mechanism for Cytochrome P450 Metabolism of Type II Binding Compounds: Evidence Supporting Direct Reduction

PubMed Central

Pearson, Joshua; Dahal, Upendra P.; Rock, Daniel; Peng, Chi-Chi; Schenk, James O.; Joswig-Jones, Carolyn; Jones, Jeffrey P.

2011-01-01

The metabolic stability of a drug is an important property that should be optimized during drug design and development. Nitrogen incorporation is hypothesized to increase the stability by coordination of nitrogen to the heme iron of cytochrome P450, a binding mode that is referred to as type II binding. However, we noticed that the type II binding compound 1 has less metabolic stability at subsaturating conditions than a closely related type I binding compound 3. Three kinetic models will be presented for type II binder metabolism; 1) Dead-end type II binding, 2) a rapid equilibrium between type I and II binding modes before reduction, and 3) a direct reduction of the type II coordinated heme. Data will be presented on reduction rates of iron, the off rates of substrate (using surface plasmon resonance) and the catalytic rate constants. These data argue against the dead-end, and rapid equilibrium models, leaving the direct reduction kinetic mechanism for metabolism of the type II binding compound 1. PMID:21530484

Developing Single-Molecule TPM Experiments for Direct Observation of Successful RecA-Mediated Strand Exchange Reaction

PubMed Central

Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen

2011-01-01

RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895

Thermodynamic Exploration of Eosin-Lysozyme Binding: A Physical Chemistry and Biochemistry Laboratory Experiment

ERIC Educational Resources Information Center

Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.

2010-01-01

We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…

Step-By-Step In Vitro Mutagenesis: Lessons From Fucose-Binding Lectin PA-IIL.

PubMed

Mrázková, Jana; Malinovská, Lenka; Wimmerová, Michaela

2017-01-01

Site-directed mutagenesis is a powerful technique which is used to understand the basis of interactions between proteins and their binding partners, as well as to modify these interactions. Methods of rational design that are based on detailed knowledge of the structure of a protein of interest are often used for preliminary investigations of the possible outcomes which can result from the practical application of site-directed mutagenesis. Also, random mutagenesis can be used in tandem with site-directed mutagenesis for an examination of amino acid "hotspots."Lectins are sugar-binding proteins which, among other functions, mediate the recognition of host cells by a pathogen and its adhesion to the host cell surface. Hence, lectins and their binding properties are studied and engineered using site-directed mutagenesis.In this chapter, we describe a site-directed mutagenesis method used for investigating the sugar binding pattern of the PA-IIL lectin from the pathogenic bacterium Pseudomonas aeruginosa. Moreover, procedures for the production and purification of PA-IIL mutants are described, and several basic methods for characterizing the mutants are discussed.

Binding of volatile anesthetics to serum albumin: measurements of enthalpy and solvent contributions.

PubMed

Sawas, Abdul H; Pentyala, Srinivas N; Rebecchi, Mario J

2004-10-05

This study directly examines the enthalpic contributions to binding in aqueous solution of closely related anesthetic haloethers (desflurane, isoflurane, enflurane, and sevoflurane), a haloalkane (halothane), and an intravenous anesthetic (propofol) to bovine and human serum albumin (BSA and HSA) using isothermal titration calorimetry. Binding to serum albumin is exothermic, yielding enthalpies (DeltaH(obs)) of -3 to -6 kcal/mol for BSA with a rank order of apparent equilibrium association constants (K(a) values): desflurane > isoflurane approximately enflurane > halothane >or= sevoflurane, with the differences being largely ascribed to entropic contributions. Competition experiments indicate that volatile anesthetics, at low concentrations, share the same sites in albumin previously identified in crystallographic and photo-cross-linking studies. The magnitude of the observed DeltaH increased linearly with increased reaction temperature, reflecting negative changes in heat capacities (DeltaC(p)). These -DeltaC(p) values significantly exceed those calculated for burial of each anesthetic in a hydrophobic pocket. The enhanced stabilities of the albumin/anesthetic complexes and -DeltaC(p) are consistent with favorable solvent rearrangements that promote binding. This idea is supported by substitution of D(2)O for H(2)O that significantly reduces the favorable binding enthalpy observed for desflurane and isoflurane, with an opposing increase of DeltaS(obs). From these results, we infer that solvent restructuring, resulting from release of water weakly bound to anesthetic and anesthetic-binding sites, is a dominant and favorable contributor to the enthalpy and entropy of binding to proteins.

Sulfated Polysaccharide, Curdlan Sulfate, Efficiently Prevents Entry/Fusion and Restricts Antibody-Dependent Enhancement of Dengue Virus Infection In Vitro: A Possible Candidate for Clinical Application

PubMed Central

Zhang, Li Feng; Chin, Wei Xin; Muschin, Tegshi; Heinig, Lars; Suzuki, Youichi; Nanjundappa, Haraprasad; Yoshinaka, Yoshiyuki; Ryo, Akihide; Nomura, Nobuo; Ooi, Eng Eong; Vasudevan, Subhash G.; Yoshida, Takashi; Yamamoto, Naoki

2013-01-01

Curdlan sulfate (CRDS), a sulfated 1→3-β-D glucan, previously shown to be a potent HIV entry inhibitor, is characterized in this study as a potent inhibitor of the Dengue virus (DENV). CRDS was identified by in silico blind docking studies to exhibit binding potential to the envelope (E) protein of the DENV. CRDS was shown to inhibit the DENV replication very efficiently in different cells in vitro. Minimal effective concentration of CRDS was as low as 0.1 µg/mL in LLC-MK2 cells, and toxicity was observed only at concentrations over 10 mg/mL. CRDS can also inhibit DENV-1, 3, and 4 efficiently. CRDS did not inhibit the replication of DENV subgenomic replicon. Time of addition experiments demonstrated that the compound not only inhibited viral infection at the host cell binding step, but also at an early post-attachment step of entry (membrane fusion). The direct binding of CRDS to DENV was suggested by an evident reduction in the viral titers after interaction of the virus with CRDS following an ultrafiltration device separation, as well as after virus adsorption to an alkyl CRDS-coated membrane filter. The electron microscopic features also showed that CRDS interacted directly with the viral envelope, and caused changes to the viral surface. CRDS also potently inhibited DENV infection in DC-SIGN expressing cells as well as the antibody-dependent enhancement of DENV-2 infection. Based on these data, a probable binding model of CRDS to DENV E protein was constructed by a flexible receptor and ligand docking study. The binding site of CRDS was predicted to be at the interface between domains II and III of E protein dimer, which is unique to this compound, and is apparently different from the β-OG binding site. Since CRDS has already been tested in humans without serious side effects, its clinical application can be considered. PMID:23658845

Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

PubMed

Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

2017-08-01

We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

PubMed

Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

2014-10-01

The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.

Characterization of an RNA Aptamer Against HPV-16 L1 Virus-Like Particles

PubMed Central

Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores

2014-01-01

The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3′end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection. PMID:25111024

Acquisition of Complement Inhibitor Serine Protease Factor I and Its Cofactors C4b-Binding Protein and Factor H by Prevotella intermedia

PubMed Central

Malm, Sven; Jusko, Monika; Eick, Sigrun; Potempa, Jan; Riesbeck, Kristian; Blom, Anna M.

2012-01-01

Infection with the Gram-negative pathogen Prevotella intermedia gives rise to periodontitis and a growing number of studies implies an association of P. intermedia with rheumatoid arthritis. The serine protease Factor I (FI) is the central inhibitor of complement degrading complement components C3b and C4b in the presence of cofactors such as C4b-binding protein (C4BP) and Factor H (FH). Yet, the significance of complement inhibitor acquisition in P. intermedia infection and FI binding by Gram-negative pathogens has not been addressed. Here we show that P. intermedia isolates bound purified FI as well as FI directly from heat-inactivated human serum. FI bound to bacteria retained its serine protease activity as shown in degradation experiments with 125I-labeled C4b. Since FI requires cofactors for its activity we also investigated the binding of purified cofactors C4BP and FH and found acquisition of both proteins, which retained their activity in FI mediated degradation of C3b and C4b. We propose that FI binding by P. intermedia represents a new mechanism contributing to complement evasion by a Gram-negative bacterial pathogen associated with chronic diseases. PMID:22514678

Acquisition of complement inhibitor serine protease factor I and its cofactors C4b-binding protein and factor H by Prevotella intermedia.

PubMed

Malm, Sven; Jusko, Monika; Eick, Sigrun; Potempa, Jan; Riesbeck, Kristian; Blom, Anna M

2012-01-01

Infection with the Gram-negative pathogen Prevotella intermedia gives rise to periodontitis and a growing number of studies implies an association of P. intermedia with rheumatoid arthritis. The serine protease Factor I (FI) is the central inhibitor of complement degrading complement components C3b and C4b in the presence of cofactors such as C4b-binding protein (C4BP) and Factor H (FH). Yet, the significance of complement inhibitor acquisition in P. intermedia infection and FI binding by Gram-negative pathogens has not been addressed. Here we show that P. intermedia isolates bound purified FI as well as FI directly from heat-inactivated human serum. FI bound to bacteria retained its serine protease activity as shown in degradation experiments with (125)I-labeled C4b. Since FI requires cofactors for its activity we also investigated the binding of purified cofactors C4BP and FH and found acquisition of both proteins, which retained their activity in FI mediated degradation of C3b and C4b. We propose that FI binding by P. intermedia represents a new mechanism contributing to complement evasion by a Gram-negative bacterial pathogen associated with chronic diseases.

Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

PubMed

Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

2014-08-01

Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

A highly selective and sensitive fluorescent chemosensor and its application for rapid on-site detection of Al3 +

NASA Astrophysics Data System (ADS)

Yue, Xiao-li; Wang, Zhao-qing; Li, Chao-rui; Yang, Zheng-yin

2018-03-01

In this paper, a simple naphthalene-based derivative (HL) has been designed and synthesized as a Al3 +-selective fluorescent chemosensor based on the PET mechanism. HL exhibited high selectivity and sensitivity towards Al3 + over other commonly coexisting metal ions in ethanol with a detection limit of 2.72 nM. The 1:1 binding stoichiometry of the complex (HL-Al3 +) was determined from the Job's plot based on fluorescence titrations and the ESI-MS spectrum data. Moreover, the binding site of HL with Al3 + was assured by the 1H NMR titration experiment. The binding constant (Ka) of the complex (HL-Al3 +) was calculated to be 5.06 × 104 M- 1 according to the Benesi-Hildebrand equation. In addition, the recognizing process of HL towards Al3 + was chemically reversible by adding Na2EDTA. Importantly, HL could directly and rapidly detect aluminum ion through the filter paper without resorting to additional instrumental analysis.

The force-dependent mechanism of DnaK-mediated mechanical folding

PubMed Central

Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2018-01-01

It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

Time-resolved absorbance changes induced by fast acidification of bacteriorhodopsin in vesicle systems.

PubMed Central

Druckmann, S; Ottolenghi, M; Korenstein, R

1985-01-01

The direction of the accessibility to protons of the binding site in bacteriorhodopsin is of primary importance in elucidating the proton-pump mechanism. The problem is approached via the pH-dependent equilibrium bR560 in equilibrium bR605 in vesicles with preferentially oriented purple membranes. Fast acidification (stopped-flow) experiments with inside-out, monomeric, bR vesicles were carried out with and without a buffer enclosed in the vesicle interior. The results, showing a buffer-induced delay in the formation of bR605, indicate that the binding site is accessible to protons from the inside of the vesicles. We arrive at this conclusion also by working with inside-out trimeric vesicles in the presence and in the absence of H+ (and K+) ionophores. The results suggest that in Halobacterium halobium, the binding site and thus the retinal Schiff base are exposed to the outside of the cell. This conclusion is consistent with a pumping mechanism based on a light-induced pK change. PMID:3978185

Metal Binding Studies and EPR Spectroscopy of the Manganese Transport Regulator MntR†

PubMed Central

Golynskiy, Misha V.; Gunderson, William A.; Hendrich, Michael P.; Cohen, Seth M.

2007-01-01

Manganese transport regulator (MntR) is a member of the diphtheria toxin repressor (DtxR) family of transcription factors that is responsible for manganese homeostasis in Bacillus subtilis. Prior biophysical studies have focused on the metal-mediated DNA binding of MntR [Lieser, S. A., Davis, T. C., Helmann, J. D., and Cohen, S. M. (2003) Biochemistry 42, 12634-12642], as well as metal stabilization of the MntR structure [Golynskiy, M. V., Davis, T. C., Helmann, J. D., and Cohen, S. M. (2005) Biochemistry 44, 3380-3389], but only limited data on the metal-binding affinities for MntR are available. Herein, the metal-binding affinities of MntR were determined by using electron paramagnetic resonance (EPR) spectroscopy, as well as competition experiments with the fluorimetric dyes Fura-2 and Mag-fura-2. MntR was not capable of competing with Fura-2 for the binding of transition metal ions. Therefore, the metal-binding affinities and stoichiometries of Mag-fura-2 for Mn2+, Co2+, Ni2+, Zn2+, and Cd2+ were determined and utilized in MntR/Mag-fura-2 competition experiments. The measured Kd values for MntR metal binding are comparable to those reported for DtxR metal binding [Kd from 10-7 to 10-4 M; D’Aquino, J. A., et al. (2005) Proc. Natl. Acad. Sci. U.S.A. 102, 18408-18413], AntR [a homologue from Bacillus anthracis; Sen, K. I. et al. (2006) Biochemistry 45, 4295-4303], and generally follow the Irving-Williams series. Direct detection of the dinuclear Mn2+ site in MntR with EPR spectroscopy is presented, and the exchange interaction was determined, J = -0.2 cm-1. This value is lower in magnitude than most known dinuclear Mn2+ sites in proteins and synthetic complexes and is consistent with a dinuclear Mn2+ site with a longer Mn···Mn distance (4.4 Å) observed in some of the available crystal structures. MntR is found to have a surprisingly low binding affinity (∼160 μM) for its cognate metal ion Mn2+. Moreover, the results of DNA binding studies in the presence of limiting metal ion concentrations were found to be consistent with the measured metal-binding constants. The metal-binding affinities of MntR reported here help to elucidate the regulatory mechanism of this metal-dependent transcription factor. PMID:17176058

The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

PubMed Central

Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

2009-01-01

PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

Specific electrostatic interactions between charged amino acid residues regulate binding of von Willebrand factor to blood platelets.

PubMed

Interlandi, Gianluca; Yakovenko, Olga; Tu, An-Yue; Harris, Jeff; Le, Jennie; Chen, Junmei; López, José A; Thomas, Wendy E

2017-11-10

The plasma protein von Willebrand factor (VWF) is essential for hemostasis initiation at sites of vascular injury. The platelet-binding A1 domain of VWF is connected to the VWF N-terminally located D'D3 domain through a relatively unstructured amino acid sequence, called here the N-terminal linker. This region has previously been shown to inhibit the binding of VWF to the platelet surface receptor glycoprotein Ibα (GpIbα). However, the molecular mechanism underlying the inhibitory function of the N-terminal linker has not been elucidated. Here, we show that an aspartate at position 1261 is the most critical residue of the N-terminal linker for inhibiting binding of the VWF A1 domain to GpIbα on platelets in blood flow. Through a combination of molecular dynamics simulations, mutagenesis, and A1-GpIbα binding experiments, we identified a network of salt bridges between Asp 1261 and the rest of A1 that lock the N-terminal linker in place such that it reduces binding to GpIbα. Mutations aimed at disrupting any of these salt bridges activated binding unless the mutated residue also formed a salt bridge with GpIbα, in which case the mutations inhibited the binding. These results show that interactions between charged amino acid residues are important both to directly stabilize the A1-GpIbα complex and to indirectly destabilize the complex through the N-terminal linker. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Feature binding in visual short-term memory is unaffected by task-irrelevant changes of location, shape, and color.

PubMed

Logie, Robert H; Brockmole, James R; Jaswal, Snehlata

2011-01-01

Three experiments used a change detection paradigm across a range of study-test intervals to address the respective contributions of location, shape, and color to the formation of bindings of features in sensory memory and visual short-term memory (VSTM). In Experiment 1, location was designated task irrelevant and was randomized between study and test displays. The task was to detect changes in the bindings between shape and color. In Experiments 2 and 3, shape and color, respectively, were task irrelevant and randomized, with bindings tested between location and color (Experiment 2) and location and shape (Experiment 3). At shorter study-test intervals, randomizing location was most disruptive, followed by shape and then color. At longer intervals, randomizing any task-irrelevant feature had no impact on change detection for bindings between features, and location had no special role. Results suggest that location is crucial for initial perceptual binding but loses that special status once representations are formed in VSTM, which operates according to different principles, than do visual attention and perception.

Crystal structures of the transpeptidase domain of the Mycobacterium tuberculosis penicillin-binding protein PonA1 reveal potential mechanisms of antibiotic resistance.

PubMed

Filippova, Ekaterina V; Kieser, Karen J; Luan, Chi-Hao; Wawrzak, Zdzislaw; Kiryukhina, Olga; Rubin, Eric J; Anderson, Wayne F

2016-06-01

Mycobacterium tuberculosis is a human respiratory pathogen that causes the deadly disease tuberculosis. The rapid global spread of antibiotic-resistant M. tuberculosis makes tuberculosis infections difficult to treat. To overcome this problem new effective antimicrobial strategies are urgently needed. One promising target for new therapeutic approaches is PonA1, a class A penicillin-binding protein, which is required for maintaining physiological cell wall synthesis and cell shape during growth in mycobacteria. Here, crystal structures of the transpeptidase domain, the enzymatic domain responsible for penicillin binding, of PonA1 from M. tuberculosis in the inhibitor-free form and in complex with penicillin V are reported. We used site-directed mutagenesis, antibiotic profiling experiments, and fluorescence thermal shift assays to measure PonA1's sensitivity to different classes of β-lactams. Structural comparison of the PonA1 apo-form and the antibiotic-bound form shows that binding of penicillin V induces conformational changes in the position of the loop β4'-α3 surrounding the penicillin-binding site. We have also found that binding of different antibiotics including penicillin V positively impacts protein stability, while other tested β-lactams such as clavulanate or meropenem resulted in destabilization of PonA1. Our antibiotic profiling experiments indicate that the transpeptidase activity of PonA1 in both M. tuberculosis and M. smegmatis mediates tolerance to specific cell wall-targeting antibiotics, particularly to penicillin V and meropenem. Because M. tuberculosis is an important human pathogen, these structural data provide a template to design novel transpeptidase inhibitors to treat tuberculosis infections. Structural data are available in the PDB database under the accession numbers 5CRF and 5CXW. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Pyrrole-indolinone SU11652 targets the nucleoside diphosphate kinase from Leishmania parasites.

PubMed

Vieira, Plínio Salmazo; Souza, Tatiana de Arruda Campos Brasil; Honorato, Rodrigo Vargas; Zanphorlin, Letícia Maria; Severiano, Kelven Ulisses; Rocco, Silvana Aparecida; de Oliveira, Arthur Henrique Cavalcante; Cordeiro, Artur Torres; Oliveira, Paulo Sérgio Lopes; de Giuseppe, Priscila Oliveira; Murakami, Mário Tyago

2017-07-01

Nucleoside diphosphate kinases (NDKs) are key enzymes in the purine-salvage pathway of trypanosomatids and have been associated with the maintenance of host-cell integrity for the benefit of the parasite, being potential targets for rational drug discovery and design. The NDK from Leishmania major (LmNDK) and mutants were expressed and purified to homogeneity. Thermal shift assays were employed to identify potential inhibitors for LmNDK. Calorimetric experiments, site-directed mutagenesis and molecular docking analysis were performed to validate the interaction and to evaluate the structural basis of ligand recognition. Furthermore, the anti-leishmanial activity of the newly identified and validated compound was tested in vitro against different Leishmania species. The molecule SU11652, a Sunitinib analog, was identified as a potential inhibitor for LmNDK and structural studies indicated that this molecule binds to the active site of LmNDK in a similar conformation to nucleotides, mimicking natural substrates. Isothermal titration calorimetry experiments combined with site-directed mutagenesis revealed that the residues H50 and H117, considered essential for catalysis, play an important role in ligand binding. In vitro cell studies showed that SU11652 had similar efficacy to Amphotericin b against some Leishmania species. Together, our results indicate the pyrrole-indolinone SU11652 as a promising scaffold for the rational design of new drugs targeting the enzyme NDK from Leishmania parasites. Copyright © 2017 Elsevier Inc. All rights reserved.

Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

PubMed

Volkán-Kacsó, Sándor; Marcus, Rudolph A

2016-10-25

A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

A Raf-competitive K-Ras binder can fail to functionally antagonize signaling.

PubMed

Kauke, Monique J; Tisdale, Alison W; Kelly, Ryan L; Braun, Christian J; Hemann, Michael T; Wittrup, K Dane

2018-05-02

Mutated in approximately 30% of human cancers, Ras GTPases are the most common drivers of oncogenesis and render tumors unresponsive to many standard therapies. Despite decades of research, no drugs directly targeting Ras are currently available. We have previously characterized a small protein antagonist of K-Ras, R11.1.6, and demonstrated its direct competition with Raf for Ras binding. Here we evaluate the effects of R11.1.6 on Ras signaling and cellular proliferation in a panel of human cancer cell lines. Through lentiviral transduction, we generated cell lines that constitutively or through induction with doxycycline express R11.1.6 or a control protein YW1 and show specific binding by R11.1.6 to endogenous Ras through microscopy and co-immunoprecipitation experiments. Genetically-encoded intracellular expression of this high-affinity Ras antagonist, however, fails to measurably disrupt signaling through either the MAPK or PI3K pathway. Consistently, cellular proliferation was unaffected as well. To understand this lack of signaling inhibition, we quantified the number of molecules of R11.1.6 expressed by the inducible cell lines and developed a simple mathematical model describing the competitive binding of Ras by R11.1.6 and Raf. This model supports a potential mechanism for the lack of biological effects that we observed, suggesting stoichiometric and thermodynamic barriers that should be overcome in pharmacological efforts to directly compete with downstream effector proteins localized to membranes at very high effective concentrations. Copyright ©2018, American Association for Cancer Research.

Transcription factor FBI-1 acts as a dual regulator in adipogenesis by coordinated regulation of cyclin-A and E2F-4.

PubMed

Laudes, Matthias; Bilkovski, Roman; Oberhauser, Frank; Droste, Andrea; Gomolka, Matthias; Leeser, Uschi; Udelhoven, Michael; Krone, Wilhelm

2008-05-01

Generation of new adipocytes plays a major role in the development of obesity. We previously have shown that transcriptional repressor factor that binds to IST (FBI)-1 exerts a dual effect in the process of adipogenesis by inhibiting proliferation and promoting differentiation of preadipocytes. The aim of the present study was to identify FBI-1 regulated molecular effectors that could account for these effects. Overexpressing FBI-1 in preadipocytes resulted in reduced expression of the cell cycle regulator cyclin A, which may explain FBI-1 induced inhibition of proliferation. Interestingly, FBI-1 repressed cyclin A promoter activity through an indirect mechanisms that did not involve direct binding of FBI-1 to the promoter sequence, but rather FBI-1 inhibition of transcriptional activator Sp1 binding to a regulatory element at -452 to -443. We also show that FBI-1 promotes terminal preadipocyte differentiation through a mechanism involving decreased levels of expression of the PPARgamma inhibitor E2F-4. FBI-1 significantly reduced E2F-4 promoter activity. Contrary to cyclin A, we found FBI-1-induced repression of E2F-4 is mediated by a direct mechanism via a FBI-1 regulatory element at -11 to -5. As function of transcriptional repressors normally depends on the presence of regulatory co-factors we also performed expression profiling of potential FBI-1 co-repressors throughout adipogenesis. In these experiments Sin3A and histon deacetylase (HDAC)-1 showed a similar expression pattern compared to FBI-1. Strikingly, co-immunoprecipitation studies revealed that FBI-1 binds Sin3A and HDAC-1 to form a repressor complex. Furthermore, by mutational analysis the amino terminal Poxvirus (POZ) domain of FBI-1 was found to be important for Sin3A and HDAC-1 binding. Taken together, FBI-1 is the first transcriptional repressor shown to act as a dual regulator in adipogenesis exerting repressor activities on target genes by both, direct and indirect mechanisms.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Binding Isotherms and Time Courses Readily from Magnetic Resonance.

PubMed

Xu, Jia; Van Doren, Steven R

2016-08-16

Evidence is presented that binding isotherms, simple or biphasic, can be extracted directly from noninterpreted, complex 2D NMR spectra using principal component analysis (PCA) to reveal the largest trend(s) across the series. This approach renders peak picking unnecessary for tracking population changes. In 1:1 binding, the first principal component captures the binding isotherm from NMR-detected titrations in fast, slow, and even intermediate and mixed exchange regimes, as illustrated for phospholigand associations with proteins. Although the sigmoidal shifts and line broadening of intermediate exchange distorts binding isotherms constructed conventionally, applying PCA directly to these spectra along with Pareto scaling overcomes the distortion. Applying PCA to time-domain NMR data also yields binding isotherms from titrations in fast or slow exchange. The algorithm readily extracts from magnetic resonance imaging movie time courses such as breathing and heart rate in chest imaging. Similarly, two-step binding processes detected by NMR are easily captured by principal components 1 and 2. PCA obviates the customary focus on specific peaks or regions of images. Applying it directly to a series of complex data will easily delineate binding isotherms, equilibrium shifts, and time courses of reactions or fluctuations.

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

Utilization of extracellular information before ligand-receptor binding reaches equilibrium expands and shifts the input dynamic range

PubMed Central

Ventura, Alejandra C.; Bush, Alan; Vasen, Gustavo; Goldín, Matías A.; Burkinshaw, Brianne; Bhattacharjee, Nirveek; Folch, Albert; Brent, Roger; Chernomoretz, Ariel; Colman-Lerner, Alejandro

2014-01-01

Cell signaling systems sense and respond to ligands that bind cell surface receptors. These systems often respond to changes in the concentration of extracellular ligand more rapidly than the ligand equilibrates with its receptor. We demonstrate, by modeling and experiment, a general “systems level” mechanism cells use to take advantage of the information present in the early signal, before receptor binding reaches a new steady state. This mechanism, pre-equilibrium sensing and signaling (PRESS), operates in signaling systems in which the kinetics of ligand-receptor binding are slower than the downstream signaling steps, and it typically involves transient activation of a downstream step. In the systems where it operates, PRESS expands and shifts the input dynamic range, allowing cells to make different responses to ligand concentrations so high as to be otherwise indistinguishable. Specifically, we show that PRESS applies to the yeast directional polarization in response to pheromone gradients. Consideration of preexisting kinetic data for ligand-receptor interactions suggests that PRESS operates in many cell signaling systems throughout biology. The same mechanism may also operate at other levels in signaling systems in which a slow activation step couples to a faster downstream step. PMID:25172920

Characterization of the Saccharomyces cerevisiae ATP-Interactome using the iTRAQ-SPROX Technique

NASA Astrophysics Data System (ADS)

Geer, M. Ariel; Fitzgerald, Michael C.

2016-02-01

The stability of proteins from rates of oxidation (SPROX) technique was used in combination with an isobaric mass tagging strategy to identify adenosine triphosphate (ATP) interacting proteins in the Saccharomyces cerevisiae proteome. The SPROX methodology utilized in this work enabled 373 proteins in a yeast cell lysate to be assayed for ATP interactions (both direct and indirect) using the non-hydrolyzable ATP analog, adenylyl imidodiphosphate (AMP-PNP). A total of 28 proteins were identified with AMP-PNP-induced thermodynamic stability changes. These protein hits included 14 proteins that were previously annotated as ATP-binding proteins in the Saccharomyces Genome Database (SGD). The 14 non-annotated ATP-binding proteins included nine proteins that were previously found to be ATP-sensitive in an earlier SPROX study using a stable isotope labeling with amino acids in cell culture (SILAC)-based approach. A bioinformatics analysis of the protein hits identified here and in the earlier SILAC-SPROX experiments revealed that many of the previously annotated ATP-binding protein hits were kinases, ligases, and chaperones. In contrast, many of the newly discovered ATP-sensitive proteins were not from these protein classes, but rather were hydrolases, oxidoreductases, and nucleic acid-binding proteins.

DNA-Directed Assembly of Capture Tools for Constitutional Studies of Large Protein Complexes.

PubMed

Meyer, Rebecca; Faesen, Alex; Vogel, Katrin; Jeganathan, Sadasivam; Musacchio, Andrea; Niemeyer, Christof M

2015-06-10

Large supramolecular protein complexes, such as the molecular machinery involved in gene regulation, cell signaling, or cell division, are key in all fundamental processes of life. Detailed elucidation of structure and dynamics of such complexes can be achieved by reverse-engineering parts of the complexes in order to probe their interactions with distinctive binding partners in vitro. The exploitation of DNA nanostructures to mimic partially assembled supramolecular protein complexes in which the presence and state of two or more proteins are decisive for binding of additional building blocks is reported here. To this end, four-way DNA Holliday junction motifs bearing a fluorescein and a biotin tag, for tracking and affinity capture, respectively, are site-specifically functionalized with centromeric protein (CENP) C and CENP-T. The latter serves as baits for binding of the so-called KMN component, thereby mimicking early stages of the assembly of kinetochores, structures that mediate and control the attachment of microtubules to chromosomes in the spindle apparatus. Results from pull-down experiments are consistent with the hypothesis that CENP-C and CENP-T may bind cooperatively to the KMN network. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Predicting DNA binding proteins using support vector machine with hybrid fractal features.

PubMed

Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

2014-02-21

DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

PubMed Central

Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

2012-01-01

F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

Examining the neural correlates of active and passive forms of verbal-spatial binding in working memory.

PubMed

Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David

2018-05-23

We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.

Radiative decay rate of excitons in square quantum wells: Microscopic modeling and experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khramtsov, E. S.; Grigoryev, P. S.; Ignatiev, I. V.

The binding energy and the corresponding wave function of excitons in GaAs-based finite square quantum wells (QWs) are calculated by the direct numerical solution of the three-dimensional Schrödinger equation. The precise results for the lowest exciton state are obtained by the Hamiltonian discretization using the high-order finite-difference scheme. The microscopic calculations are compared with the results obtained by the standard variational approach. The exciton binding energies found by two methods coincide within 0.1 meV for the wide range of QW widths. The radiative decay rate is calculated for QWs of various widths using the exciton wave functions obtained by direct andmore » variational methods. The radiative decay rates are confronted with the experimental data measured for high-quality GaAs/AlGaAs and InGaAs/GaAs QW heterostructures grown by molecular beam epitaxy. The calculated and measured values are in good agreement, though slight differences with earlier calculations of the radiative decay rate are observed.« less

Identification of ERdj3 and OBF-1/BOB-1/OCA-B as direct targets of XBP-1 during plasma cell differentiation.

PubMed

Shen, Ying; Hendershot, Linda M

2007-09-01

Plasma cell differentiation is accompanied by a modified unfolded protein response (UPR), which involves activation of the Ire1 and activating transcription factor 6 branches, but not the PKR-like endoplasmic reticulum kinase branch. Ire1-mediated splicing of XBP-1 (XBP-1(S)) is required for terminal differentiation, although the direct targets of XBP-1(S) in this process have not been identified. We demonstrate that XBP-1(S) binds to the promoter of ERdj3 in plasmacytoma cells and in LPS-stimulated primary splenic B cells, which corresponds to increased expression of ERdj3 transcripts in both cases. When small hairpin RNA was used to decrease XBP-1 expression in plasmacytoma lines, ERdj3 transcripts were concomitantly reduced. The accumulation of Ig gamma H chain protein was also diminished, but unexpectedly this occurred at the transcriptional level as opposed to effects on H chain stability. The decrease in H chain transcripts correlated with a reduction in mRNA encoding the H chain transcription factor, OBF-1/BOB-1/OCA-B. Chromatin immunoprecipitation experiments revealed that XBP-1(S) binds to the OBF-1/BOB-1/OCA-B promoter in the plasmacytoma line and in primary B cells not only during plasma cell differentiation, but also in response to classical UPR activation. Gel shift assays suggest that XBP-1(S) binding occurs through a UPR element conserved in both murine and human OBF-1/BOB-1/OCA-B promoters as opposed to endoplasmic reticulum stress response elements. Our studies are the first to identify direct downstream targets of XBP-1(S) during either plasma cell differentiation or the UPR. In addition, our data further define the XBP-1(S)-binding sequence and provide yet another role for this protein as a master regulator of plasma cell differentiation.

Oxysterol-binding protein-related protein (ORP) 9 is a PDK-2 substrate and regulates Akt phosphorylation.

PubMed

Lessmann, Eva; Ngo, Mike; Leitges, Michael; Minguet, Susana; Ridgway, Neale D; Huber, Michael

2007-02-01

The oxysterol-binding protein and oxysterol-binding protein-related protein family has been implicated in lipid transport and metabolism, vesicle trafficking and cell signaling. While investigating the phosphorylation of Akt/protein kinase B in stimulated bone marrow-derived mast cells, we observed that a monoclonal antibody directed against phospho-S473 Akt cross-reacted with oxysterol-binding protein-related protein 9 (ORP9). Further analysis revealed that mast cells exclusively express ORP9S, an N-terminal truncated version of full-length ORP9L. A PDK-2 consensus phosphorylation site in ORP9L and OPR9S at S287 (VPEFS(287)Y) was confirmed by site-directed mutagenesis. In contrast to Akt, increased phosphorylation of ORP9S S287 in stimulated mast cells was independent of phosphatidylinositol 3-kinase but sensitive to inhibition of conventional PKC isotypes. PKC-beta dependence was confirmed by lack of ORP9S phosphorylation at S287 in PKC-beta-deficient, but not PKC-alpha-deficient, mast cells. Moreover, co-immunoprecipitation of PKC-beta and ORP9S, and in vitro phosphorylation of ORP9S in this complex, argued for direct phosphorylation of ORP9S by PKC-beta, introducing ORP9S as a novel PKC-beta substrate. Akt was also detected in a PKC-beta/ORP9S immune complex and phosphorylation of Akt on S473 was delayed in PKC-deficient mast cells. In HEK293 cells, RNAi experiments showed that depletion of ORP9L increased Akt S473 phosphorylation 3-fold without affecting T308 phosphorylation in the activation loop. Furthermore, mammalian target of rapamycin was implicated in ORP9L phosphorylation in HEK293 cells. These studies identify ORP9 as a PDK-2 substrate and negative regulator of Akt phosphorylation at the PDK-2 site.

Impact of protein pre-coating on the protein corona composition and nanoparticle cellular uptake.

PubMed

Mirshafiee, Vahid; Kim, Raehyun; Park, Soyun; Mahmoudi, Morteza; Kraft, Mary L

2016-01-01

Nanoparticles (NPs) are functionalized with targeting ligands to enable selectively delivering drugs to desired locations in the body. When these functionalized NPs enter the blood stream, plasma proteins bind to their surfaces, forming a protein corona that affects NP uptake and targeting efficiency. To address this problem, new strategies for directing the formation of a protein corona that has targeting capabilities are emerging. Here, we have investigated the feasibility of directing corona composition to promote targeted NP uptake by specific types of cells. We used the well-characterized process of opsonin-induced phagocytosis by macrophages as a simplified model of corona-mediated NP uptake by a desired cell type. We demonstrate that pre-coating silica NPs with gamma-globulins (γ-globulins) produced a protein corona that was enriched with opsonins, such as immunoglobulins. Although immunoglobulins are ligands that bind to receptors on macrophages and elicit phagocytois, the opsonin-rich protein corona did not increase NP uptake by macrophage RAW 264.7 cells. Immunolabeling experiments indicated that the binding of opsonins to their target cell surface receptors was impeded by other proteins in the corona. Thus, corona-mediated NP targeting strategies must optimize both the recruitment of the desired plasma proteins as well as their accessibility and orientation in the corona layer. Copyright © 2015 Elsevier Ltd. All rights reserved.

Direct Determination of Vibrational Density of States Change on Ligand Binding to a Protein

NASA Astrophysics Data System (ADS)

Balog, Erika; Becker, Torsten; Oettl, Martin; Lechner, Ruep; Daniel, Roy; Finney, John; Smith, Jeremy C.

2004-07-01

The change in the vibrational density of states of a protein (dihydrofolate reductase) on binding a ligand (methotrexate) is determined using inelastic neutron scattering. The vibrations of the complex soften significantly relative to the unbound protein. The resulting free-energy change, which is directly determined by the density of states change, is found to contribute significantly to the binding equilibrium.

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex*

PubMed Central

Douglas, Max E.

2016-01-01

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

Analyzing Ligand Depletion in a Saturation Equilibrium Binding Experiment

ERIC Educational Resources Information Center

Claro, Enrique

2006-01-01

I present a proposal for a laboratory practice to generate and analyze data from a saturation equilibrium binding experiment addressed to advanced undergraduate students. [[superscript 3]H]Quinuclidinyl benzilate is a nonselective muscarinic ligand with very high affinity and very low nonspecific binding to brain membranes, which contain a high…

Cross-reactivity and epitope analysis of Pru a 1, the major cherry allergen.

PubMed

Scheurer, S; Son, D Y; Boehm, M; Karamloo, F; Franke, S; Hoffmann, A; Haustein, D; Vieths, S

1999-02-01

A high percentage of birch pollen allergic patients experiences food hypersensivity after ingestion of fresh fruits and vegetables. The cross-reactivity of the major allergens of sweet cherry (Pru a 1), apple (Mal d 1), pear (Pyr c 1), celery tuber (Api g 1) and carrot (Dau c 1) is due to structural similarities which are reflected by high amino acid sequence identities with Bet v 1a, the major birch pollen allergen. Apart from a strong cross-reactivity to Bet v 1a, IgE inhibition experiments with Mal d 1, Pru a 1 and Api g 1 demonstrated the presence of common and different epitopes among the tested food allergens. Secondary structure prediction of all investigated allergens indicated the presence of almost identical structural elements. In particular, the 'P-loop' region is a common domain of the pollen related food allergens and of pathogenesis related proteins. To identify the IgE binding epitopes, five overlapping recombinant Pru a 1 fragments representing the entire amino acid sequence with lengths of approximately 60-120 residues were investigated. Weak IgE binding capacity was measured exclusively with Pru a IF4 (1-120) by immunoblotting, whereas none of the fragments showed allergenicity in the rat basophil leukaemia cell mediator release assay. Site-directed mutagenesis experiments with Pru a 1 revealed that amino acid S112 is critical for IgE binding of almost all patients sera tested. This reduced IgE binding was also observed with a single point mutant of Bet v 1a (S112P) and thus indicated serine 112 as an essential residue for preserving the structure of a cross-reactive IgE epitope. Moreover, two Pru a 1 mutants with an altered 'P-loop' region, showed a lowered IgE binding capacity for IgE from a subgroup of allergic patients. The investigation of essential features for preserving cross-reactive IgE-epitopes provides the structural basis for understanding the clinically observed cross-allergenicity between pollen and fruits. Moreover, non-anaphylactic allergen fragments or variants derived from the IgE-inducing pollen allergens may serve as useful tools for a new strategy of specific immunotherapy.

Fluctuating capacity and advance decision-making in Bipolar Affective Disorder - Self-binding directives and self-determination.

PubMed

Gergel, Tania; Owen, Gareth S

2015-01-01

For people with Bipolar Affective Disorder, a self-binding (advance) directive (SBD), by which they commit themselves to treatment during future episodes of mania, even if unwilling, can seem the most rational way to deal with an imperfect predicament. Knowing that mania will almost certainly cause enormous damage to themselves, their preferred solution may well be to allow trusted others to enforce treatment and constraint, traumatic though this may be. No adequate provision exists for drafting a truly effective SBD and efforts to establish such provision are hampered by very valid, but also paralysing ethical, clinical and legal concerns. Effectively, the autonomy and rights of people with bipolar are being 'protected' through being denied an opportunity to protect themselves. From a standpoint firmly rooted in the clinical context and experience of mania, this article argues that an SBD, based on a patient-centred evaluation of capacity to make treatment decisions (DMC-T) and grounded within the clinician-patient relationship, could represent a legitimate and ethically coherent form of self-determination. After setting out background information on fluctuating capacity, mania and advance directives, this article proposes a framework for constructing such an SBD, and considers common objections, possible solutions and suggestions for future research. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Fluctuating capacity and advance decision-making in Bipolar Affective Disorder — Self-binding directives and self-determination

PubMed Central

Gergel, Tania; Owen, Gareth S.

2015-01-01

For people with Bipolar Affective Disorder, a self-binding (advance) directive (SBD), by which they commit themselves to treatment during future episodes of mania, even if unwilling, can seem the most rational way to deal with an imperfect predicament. Knowing that mania will almost certainly cause enormous damage to themselves, their preferred solution may well be to allow trusted others to enforce treatment and constraint, traumatic though this may be. No adequate provision exists for drafting a truly effective SBD and efforts to establish such provision are hampered by very valid, but also paralysing ethical, clinical and legal concerns. Effectively, the autonomy and rights of people with bipolar are being ‘protected’ through being denied an opportunity to protect themselves. From a standpoint firmly rooted in the clinical context and experience of mania, this article argues that an SBD, based on a patient-centred evaluation of capacity to make treatment decisions (DMC-T) and grounded within the clinician–patient relationship, could represent a legitimate and ethically coherent form of self-determination. After setting out background information on fluctuating capacity, mania and advance directives, this article proposes a framework for constructing such an SBD, and considers common objections, possible solutions and suggestions for future research. PMID:25939286

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

The Binding Interface between Human APOBEC3F and HIV-1 Vif Elucidated by Genetic and Computational Approaches.

PubMed

Richards, Christopher; Albin, John S; Demir, Özlem; Shaban, Nadine M; Luengas, Elizabeth M; Land, Allison M; Anderson, Brett D; Holten, John R; Anderson, John S; Harki, Daniel A; Amaro, Rommie E; Harris, Reuben S

2015-12-01

APOBEC3 family DNA cytosine deaminases provide overlapping defenses against pathogen infections. However, most viruses have elaborate evasion mechanisms such as the HIV-1 Vif protein, which subverts cellular CBF-β and a polyubiquitin ligase complex to neutralize these enzymes. Despite advances in APOBEC3 and Vif biology, a full understanding of this direct host-pathogen conflict has been elusive. We combine virus adaptation and computational studies to interrogate the APOBEC3F-Vif interface and build a robust structural model. A recurring compensatory amino acid substitution from adaptation experiments provided an initial docking constraint, and microsecond molecular dynamic simulations optimized interface contacts. Virus infectivity experiments validated a long-lasting electrostatic interaction between APOBEC3F E289 and HIV-1 Vif R15. Taken together with mutagenesis results, we propose a wobble model to explain how HIV-1 Vif has evolved to bind different APOBEC3 enzymes and, more generally, how pathogens may evolve to escape innate host defenses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Direct versus indirect many-body methods for calculating vertical electron affinities: applications to F -, OH - , NH 2-, CN -, Cl -, SH - and PH 2-

NASA Astrophysics Data System (ADS)

Ortiz, J. V.

1987-05-01

Electron propagator theory (EPT) is applied to calculating vertical ionization energies of the anions F -, Cl -, OH -,SH -, NH 2-, PH 2- and CN -. Third-order and outer valence approximation (OVA) quasiparticle calculations are compared with ΔMBPT(4) (MBPT, many-body perturbation theory) results using the same basis sets. Agreement with experiment is satisfactory for EPT calculations except for F - and OH -, while the ΔMBPT treatments fail for CN -. EPT(OVA) estimates are reliable when the discrepancy between second- and third-order results is small. Computational aspects are discussed, showing relative merits of direct and indirect methods for evaluating electron binding energies.

How Robust Is the Mechanism of Folding-Upon-Binding for an Intrinsically Disordered Protein?

PubMed

Bonetti, Daniela; Troilo, Francesca; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano

2018-04-24

The mechanism of interaction of an intrinsically disordered protein (IDP) with its physiological partner is characterized by a disorder-to-order transition in which a recognition and a binding step take place. Even if the mechanism is quite complex, IDPs tend to bind their partner in a cooperative manner such that it is generally possible to detect experimentally only the disordered unbound state and the structured complex. The interaction between the disordered C-terminal domain of the measles virus nucleoprotein (N TAIL ) and the X domain (XD) of the viral phosphoprotein allows us to detect and quantify the two distinct steps of the overall reaction. Here, we analyze the robustness of the folding of N TAIL upon binding to XD by measuring the effect on both the folding and binding steps of N TAIL when the structure of XD is modified. Because it has been shown that wild-type XD is structurally heterogeneous, populating an on-pathway intermediate under native conditions, we investigated the binding to 11 different site-directed variants of N TAIL of one particular variant of XD (I504A XD) that populates only the native state. Data reveal that the recognition and the folding steps are both affected by the structure of XD, indicating a highly malleable pathway. The experimental results are briefly discussed in the light of previous experiments on other IDPs. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

PubMed Central

Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

2012-01-01

Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

Charge effects in the selection of NPF motifs by the EH domain of EHD1.

PubMed

Henry, Gillian D; Corrigan, Daniel J; Dineen, Joseph V; Baleja, James D

2010-04-27

The Eps15 homology (EH) domain is found in proteins associated with endocytosis and vesicle trafficking. EH domains bind to their target proteins through an asparagine-proline-phenylalanine (NPF) motif. We have measured the interaction energetics of the EH domain from EHD1 with peptides derived from two of its binding partners: Rabenosyn-5 (Ac-GPSLNPFDEED-NH(2)) and Rab11-Fip2 (Ac-YESTNPFTAK-NH(2)). Heteronuclear single quantum coherence (HSQC) spectroscopy shows that both peptides bind in the canonical binding pocket of EHD1 EH and induce identical structural changes, yet the affinity of the negatively charged Ac-GPSLNPFDEED-NH(2) (K(a) = 8 x 10(5) M(-1)) is tighter by 2 orders of magnitude. The thermodynamic profiles (DeltaG, DeltaH, DeltaS) were measured for both peptides as a function of temperature. The enthalpies of binding are essentially identical, and the difference in affinity is a consequence of the difference in entropic cost. Ac-GPSLNPFDEED-NH(2) binding is salt-dependent, demonstrating an electrostatic component to the interaction, whereas Ac-YESTNPFTAK-NH(2) binding is independent of salt. Successive replacement of acidic residues in Ac-GPSLNPFDEED-NH(2) with neutral residues showed that all are important. Lysine side chains in EHD1 EH create a region of strong positive surface potential near the NPF binding pocket. Contributions by lysine epsilon-amino groups to complex formation with Ac-GPSLNPFDEED-NH(2) was shown using direct-observe (15)N NMR spectroscopy. These experiments have enabled us to define a new extended interaction motif for EHD proteins, N-P-F-[DE]-[DE]-[DE], which we have used to predict new interaction partners and hence broaden the range of cellular activities involving the EHD proteins.

Prediction of the binding mode of N2-phenylguanine derivative inhibitors to herpes simplex virus type 1 thymidine kinase

NASA Astrophysics Data System (ADS)

Gaudio, Anderson Coser; Takahata, Yuji; Richards, William Graham

1998-01-01

The probable binding mode of the herpes simplex virus thymidine kinase (HSV1 TK) N2-[substituted]-phenylguanine inhibitors is proposed. A computational experiment was designed to check some qualitative binding parameters and to calculate the interaction binding energies of alternative binding modes of N2-phenylguanines. The known binding modes of the HSV1 TK natural substrate deoxythymidine and one of its competitive inhibitors ganciclovir were used as templates. Both the qualitative and quantitative parts of the computational experiment indicated that the N2-phenylguanine derivatives bind to the HSV1 TK active site in the deoxythymidine-like binding mode. An experimental observation that N2-phenylguanosine derivatives are not phosphorylated during the interaction with the HSV1 TK gives support to the proposed binding mode.

Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

PubMed Central

Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

2013-01-01

IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

Preliminary Work in Obtaining Site-Directed Mutants of Hen Egg White Lysozyme

NASA Technical Reports Server (NTRS)

Holmes, Leonard D.

1996-01-01

Protein crystal growth studies are recognized as a critical endeavor in the field of molecular biotechnology. The scientific applications of this field include the understanding of how enzymes function and the accumulation of accurate information of atomic structures, a key factor in the process of rational drug design. NASA has committed substantial investment and resources to the field of protein crystal growth and has conducted many microgravity protein crystal growth experiments aboard shuttle flights. Crystals grown in space tend to be larger, denser and have a more perfect habit and geometry. These improved properties gained in the microgravity environment of space result largely from the reduction of solutal convection, and the elimination of sedimentation at the growing crystal surface. Shuttle experiments have yielded many large, high quality crystals that are suitable for high resolution X-ray diffraction analysis. Examples of biologically important macromolecules which have been successfully crystallized during shuttle missions include: lysozyme, isocitrate lyase, gamma-interferon, insulin, human serum albumin and canavalin. Numerous other examples are also available. In addition to obtaining high quality crystals, investigators are also interested in learning the mechanisms by which the growth events take place. Crystallization experiments indicate that for the enzyme HEWL, measured growth rates do not follow mathematical models for 2D nucleation and dislocation-led growth of tetragonal protein crystals. As has been suggested by the laboratory of Marc L. Pusey, a possible explanation for the disagreement between observation and data is that HEWL tetraconal crystals form by aggregated units of lysozyme in supersaturated solutions. Surface measurement data was shown to fit very well with a model using an octamer unit cell as the growth unit. According to this model, the aggregation pathway and subsequent crystal growth is described by: monomer < ------ > dimer < ------- > tetramer < ------ > octamer < ------ > higher order. It is believed that multimer aggregation of lysozyme occurs by interaction at specific binding sites on the surface of the protein crystals. If the presence of discrete binding sites and the aggregation hypothesis is true, then it follows that the alteration of the binding site(s) should have significant effect on the measurements obtained during growth experiments. Site-directed mutagenesis allows the specific alteration of proteins by replacement, deletion or addition of specific amino acid residues. This report outlines the approach for this strategy and the progress made thus far toward that end.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Concentration-Dependent Inhibitory Effect of Baicalin on the Plasma Protein Binding and Metabolism of Chlorzoxazone, a CYP2E1 Probe Substrate, in Rats In Vitro and In Vivo

PubMed Central

Gao, Na; Zou, Dan; Qiao, Hai-Ling

2013-01-01

Some of the components found in herbs may be inhibitors or inducers of cytochrome P450 enzymes, which may therefore result in undesired herb-drug interactions. As a component extracted from Radix Scutellariae, the direct effect of baicalin on cytochrome P450 has not been investigated sufficiently. In this study, we investigated concentration-dependent inhibitory effect of baicalin on the plasma protein binding and metabolism of chlorzoxazone (CZN), a model CYP2E1 probe substrate, in rats in vitro and in vivo. Animal experiment was a randomized, three-period crossover design. Significant changes in pharmacokinetic parameters of CZN such as Cmax, t1/2 and Vd were observed after treatment with baicalin in vivo (P<0.05). Cmax decreased by 25% and 33%, whereas t1/2 increased by 34% and 53%, Vd increased by 37% and 50% in 225 mg/kg and 450 mg/kg baicalin-treated rats, respectively. The AUC and CL of CZN were not affected (P>0.05). Correlation analysis showed that the changes in CZN concentrations and baicalin concentrations were in good correlation (r>0.99). In vitro experiments, baicalin decreased the formation of 6-OH-chlorzoxazone in a concentration-dependent manner and exhibited a competitive inhibition in rat liver microsomes, with a Ki value of 145.8 µM. The values of Cmax/Ki were 20 and 39 after treatment with baicalin (225 and 450 mg/kg), respectively. Protein binding experiments in vivo showed that the plasma free-fraction (fu) of CZN increased 2.6-fold immediately after baicalin treatment (450 mg/kg) and in vitro showed that baicalin (125–2500 mg/L) increased the unbound CZN from 1.63% to 3.58%. The results indicate that pharmacokinetic changes in CZN are induced by inhibitory effect of baicalin on the plasma protein binding of CZN and CYP2E1 activity. PMID:23301016

Using Three-color Single-molecule FRET to Study the Correlation of Protein Interactions.

PubMed

Götz, Markus; Wortmann, Philipp; Schmid, Sonja; Hugel, Thorsten

2018-01-30

Single-molecule Förster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For many molecular machines in a cell proteins have to act together with interaction partners in a functional cycle to fulfill their task. The extension of two-color to multi-color smFRET makes it possible to simultaneously probe more than one interaction or conformational change. This not only adds a new dimension to smFRET experiments but it also offers the unique possibility to directly study the sequence of events and to detect correlated interactions when using an immobilized sample and a total internal reflection fluorescence microscope (TIRFM). Therefore, multi-color smFRET is a versatile tool for studying biomolecular complexes in a quantitative manner and in a previously unachievable detail. Here, we demonstrate how to overcome the special challenges of multi-color smFRET experiments on proteins. We present detailed protocols for obtaining the data and for extracting kinetic information. This includes trace selection criteria, state separation, and the recovery of state trajectories from the noisy data using a 3D ensemble Hidden Markov Model (HMM). Compared to other methods, the kinetic information is not recovered from dwell time histograms but directly from the HMM. The maximum likelihood framework allows us to critically evaluate the kinetic model and to provide meaningful uncertainties for the rates. By applying our method to the heat shock protein 90 (Hsp90), we are able to disentangle the nucleotide binding and the global conformational changes of the protein. This allows us to directly observe the cooperativity between the two nucleotide binding pockets of the Hsp90 dimer.

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

RNA-protein binding motifs mining with a new hybrid deep learning based cross-domain knowledge integration approach.

PubMed

Pan, Xiaoyong; Shen, Hong-Bin

2017-02-28

RNAs play key roles in cells through the interactions with proteins known as the RNA-binding proteins (RBP) and their binding motifs enable crucial understanding of the post-transcriptional regulation of RNAs. How the RBPs correctly recognize the target RNAs and why they bind specific positions is still far from clear. Machine learning-based algorithms are widely acknowledged to be capable of speeding up this process. Although many automatic tools have been developed to predict the RNA-protein binding sites from the rapidly growing multi-resource data, e.g. sequence, structure, their domain specific features and formats have posed significant computational challenges. One of current difficulties is that the cross-source shared common knowledge is at a higher abstraction level beyond the observed data, resulting in a low efficiency of direct integration of observed data across domains. The other difficulty is how to interpret the prediction results. Existing approaches tend to terminate after outputting the potential discrete binding sites on the sequences, but how to assemble them into the meaningful binding motifs is a topic worth of further investigation. In viewing of these challenges, we propose a deep learning-based framework (iDeep) by using a novel hybrid convolutional neural network and deep belief network to predict the RBP interaction sites and motifs on RNAs. This new protocol is featured by transforming the original observed data into a high-level abstraction feature space using multiple layers of learning blocks, where the shared representations across different domains are integrated. To validate our iDeep method, we performed experiments on 31 large-scale CLIP-seq datasets, and our results show that by integrating multiple sources of data, the average AUC can be improved by 8% compared to the best single-source-based predictor; and through cross-domain knowledge integration at an abstraction level, it outperforms the state-of-the-art predictors by 6%. Besides the overall enhanced prediction performance, the convolutional neural network module embedded in iDeep is also able to automatically capture the interpretable binding motifs for RBPs. Large-scale experiments demonstrate that these mined binding motifs agree well with the experimentally verified results, suggesting iDeep is a promising approach in the real-world applications. The iDeep framework not only can achieve promising performance than the state-of-the-art predictors, but also easily capture interpretable binding motifs. iDeep is available at http://www.csbio.sjtu.edu.cn/bioinf/iDeep.

Role of Reversible Histidine Coordination in Hydroxylamine Reduction by Plant Hemoglobins (Phytoglobins).

PubMed

Athwal, Navjot Singh; Alagurajan, Jagannathan; Andreotti, Amy H; Hargrove, Mark S

2016-10-18

Reduction of hydroxylamine to ammonium by phytoglobin, a plant hexacoordinate hemoglobin, is much faster than that of other hexacoordinate hemoglobins or pentacoordinate hemoglobins such as myoglobin, leghemoglobin, and red blood cell hemoglobin. The reason for differences in reactivity is not known but could be intermolecular electron transfer between protein molecules in support of the required two-electron reduction, hydroxylamine binding, or active site architecture favoring the reaction. Experiments were conducted with phytoglobins from rice, tomato, and soybean along with human neuroglobin and soybean leghemoglobin that reveal hydroxylamine binding as the rate-limiting step. For hexacoordinate hemoglobins, binding is limited by the dissociation rate constant for the distal histidine, while leghemoglobin is limited by an intrinsically low affinity for hydroxylamine. When the distal histidine is removed from rice phytoglobin, a hydroxylamine-bound intermediate is formed and the reaction rate is diminished, indicating that the distal histidine imidazole side chain is critical for the reaction, albeit not for electron transfer but rather for direct interaction with the substrate. Together, these results demonstrate that phytoglobins are superior at hydroxylamine reduction because they have distal histidine coordination affinity constants near 1, and facile rate constants for binding and dissociation of the histidine side chain. Hexacoordinate hemoglobins such as neuroglobin are limited by tighter histidine coordination that blocks hydroxylamine binding, and pentacoordinate hemoglobins have intrinsically lower hydroxylamine affinities.

BASIC PENTACYSTEINE Proteins Mediate MADS Domain Complex Binding to the DNA for Tissue-Specific Expression of Target Genes in Arabidopsis[W

PubMed Central

Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M.

2012-01-01

BASIC PENTACYSTEINE (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)–rich consensus sequences in the SEEDSTICK (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that SHORT VEGETATIVE PHASE (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs’ wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472

Celastrol reverses palmitic acid (PA)-caused TLR4-MD2 activation-dependent insulin resistance via disrupting MD2-related cellular binding to PA.

PubMed

Zhang, Xue; Wang, Ying; Ge, Hui-Ya; Gu, Yi-Jun; Cao, Fan-Fan; Yang, Chun-Xin; Uzan, Georges; Peng, Bin; Zhang, Deng-Hai

2018-04-18

Elevated plasma statured fatty acids (FFAs) cause TLR4/MD2 activation-dependent inflammation and insulin tolerance, which account for the occurrence and development of obesity. It has been confirmed that statured palmitic acid (PA) (the most abundant FFA) could bind MD2 to cause cellular inflammation. The natural compound celastrol could improve obesity, which is suggested via inhibiting inflammation, yet the detailed mechanism for celastrol is still unclear. As celastrol is reported to directly target MD2, we thought disrupting the binding between FFAs and MD2 might be one of the ways for celastrol to inhibit FFAs-caused inflammation and insulin resistance. In this study, we found evidence to support our hypothesis: celastrol could reverse PA-caused TLR4/MD2 activation-dependent insulin resistance, as determined by glucose-lowering ability, cellular glucose uptake, insulin action-related proteins and TLR4/MD2/NF-κB activation. Bioinformatics and cellular experiments showed that both celastrol and PA could bind MD2, and that celastrol could expel PA from cells. Finally, celastrol could reverse high fat diet caused hyperglycemia and obesity, and liver NF-kB activations. Taking together, we proved that celastrol could reverses PA-caused TLR4-MD2 activation-dependent insulin resistance via disrupting PA binding to MD2. © 2018 Wiley Periodicals, Inc.

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode.

PubMed

Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

2015-11-20

The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this interaction have not been elucidated. Here, we used phosphorylated ER peptide and semisynthetic protein constructs in a combined biochemical and structural study to, for the first time, provide a quantitative and structural characterization of the cSrc SH2-ER interaction. Fluorescence polarization experiments delineated the SH2 binding motif in the ER sequence. Chemical shift perturbation analysis by nuclear magnetic resonance (NMR) together with molecular dynamics (MD) simulations allowed us to put forward a 3D model of the ER-SH2 interaction. The structural basis of this protein-protein interaction has been compared with that of the high affinity SH2 binding sequence GpYEEI. The ER features a different binding mode from that of the "two-pronged plug two-hole socket" model in the so-called specificity determining region. This alternative binding mode is modulated via the folding of ER helix 12, a structural element directly C-terminal of the key phosphorylated tyrosine. The present findings provide novel molecular entries for understanding nongenomic ER signaling and targeting the corresponding disease states.

Structure of Boron Nitride Nanotubes: Tube Closing Vs. Chirality

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu

1998-01-01

The structure of boron nitride nanotubes is investigated using a generalized tight-binding molecular dynamics method. It is shown that dynamic relaxation results in a wavelike or "rippled" surface in which the B atoms rotate inward and the N atoms move outward, reminiscent of the surface relaxation of the III-V semiconductors. More importantly, the three different morphologies of the tube closing with flat, conical and amorphous ends, as observed in experiments, are shown to be directly related to the tube chiralities. The abundance of flat end tubes observed in experiments is, thus, shown to be an indication of the greater stability of "zig-zag" BN tubes over the "arm-chair" tubes under experimental conditions.

Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

NASA Astrophysics Data System (ADS)

Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

2018-03-01

Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

Nanopore Device for Reversible Ion and Molecule Sensing or Migration

NASA Technical Reports Server (NTRS)

Seger, R. Adam (Inventor); Pourmand, Nader (Inventor); Actis, Paolo (Inventor); Singaram, Bakthan (Inventor); Vilozny, Boaz (Inventor)

2015-01-01

Disclosed are methods and devices for detection of ion migration and binding, utilizing a nanopipette adapted for use in an electrochemical sensing circuit. The nanopipette may be functionalized on its interior bore with metal chelators for binding and sensing metal ions or other specific binding molecules such as boronic acid for binding and sensing glucose. Such a functionalized nanopipette is comprised in an electrical sensor that detects when the nanopipette selectively and reversibly binds ions or small molecules. Also disclosed is a nanoreactor, comprising a nanopipette, for controlling precipitation in aqueous solutions by voltage-directed ion migration, wherein ions may be directed out of the interior bore by a repulsing charge in the bore.

Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

NASA Astrophysics Data System (ADS)

Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

2017-03-01

Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

Interactions of the Metalloregulatory Protein SloR from Streptococcus mutans with Its Metal Ion Effectors and DNA Binding Site

PubMed Central

Corbett, John; Cornacchione, Louis; Daly, William; Galan, Diego; Wysota, Michael; Tivnan, Patrick; Collins, Justin; Nye, Dillon; Levitz, Talya; Breyer, Wendy A.; Glasfeld, Arthur

2015-01-01

ABSTRACT Streptococcus mutans is the causative agent of dental caries, a significant concern for human health, and therefore an attractive target for therapeutics development. Previous work in our laboratory has identified a homodimeric, manganese-dependent repressor protein, SloR, as an important regulator of cariogenesis and has used site-directed mutagenesis to map functions to specific regions of the protein. Here we extend those studies to better understand the structural interaction between SloR and its operator and its effector metal ions. The results of DNase I assays indicate that SloR protects a 42-bp region of DNA that overlaps the sloABC promoter on the S. mutans UA159 chromosome, while electrophoretic mobility shift and solution binding assays indicate that each of two SloR dimers binds to this region. Real-time semiquantitative reverse transcriptase PCR (real-time semi-qRT-PCR) experiments were used to determine the individual base pairs that contribute to SloR-DNA binding specificity. Solution studies indicate that Mn2+ is better than Zn2+ at specifically activating SloR to bind DNA, and yet the 2.8-Å resolved crystal structure of SloR bound to Zn2+ provides insight into the means by which selective activation by Mn2+ may be achieved and into how SloR may form specific interactions with its operator. Taken together, these experimental observations are significant because they can inform rational drug design aimed at alleviating and/or preventing S. mutans-induced caries formation. IMPORTANCE This report focuses on investigating the SloR protein as a regulator of essential metal ion transport and virulence gene expression in the oral pathogen Streptococcus mutans and on revealing the details of SloR binding to its metal ion effectors and binding to DNA that together facilitate this expression. We used molecular and biochemical approaches to characterize the interaction of SloR with Mn2+ and with its SloR recognition element to gain a clearer picture of the regulatory networks that optimize SloR-mediated metal ion homeostasis and virulence gene expression in S. mutans. These experiments can have a significant impact on caries treatment and/or prevention by revealing the S. mutans SloR-DNA binding interface as an appropriate target for the development of novel therapeutic interventions. PMID:26350131

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE PAGES

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...

2016-03-28

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Prediction of site-specific interactions in antibody-antigen complexes: the proABC method and server.

PubMed

Olimpieri, Pier Paolo; Chailyan, Anna; Tramontano, Anna; Marcatili, Paolo

2013-09-15

Antibodies or immunoglobulins are proteins of paramount importance in the immune system. They are extremely relevant as diagnostic, biotechnological and therapeutic tools. Their modular structure makes it easy to re-engineer them for specific purposes. Short of undergoing a trial and error process, these experiments, as well as others, need to rely on an understanding of the specific determinants of the antibody binding mode. In this article, we present a method to identify, on the basis of the antibody sequence alone, which residues of an antibody directly interact with its cognate antigen. The method, based on the random forest automatic learning techniques, reaches a recall and specificity as high as 80% and is implemented as a free and easy-to-use server, named prediction of Antibody Contacts. We believe that it can be of great help in re-design experiments as well as a guide for molecular docking experiments. The results that we obtained also allowed us to dissect which features of the antibody sequence contribute most to the involvement of specific residues in binding to the antigen. http://www.biocomputing.it/proABC. anna.tramontano@uniroma1.it or paolo.marcatili@gmail.com Supplementary data are available at Bioinformatics online.

The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

PubMed

Jiang, Yanjuan; Yu, Diqiu

2016-08-01

Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. © 2016 American Society of Plant Biologists. All Rights Reserved.

Low Expression of lncRNA-GAS5 Is Implicated in Human Primary Varicose Great Saphenous Veins

PubMed Central

Yuan, Tian-You; Wang, Shi-Yi; Feng, Jing; Wang, Jing; Liu, Yuan; Wu, Ya-Han; Ma, Xiu-E; Ge, Jin; Cui, Ying-Yu; Jiang, Xiao-Yan

2015-01-01

The cellular mechanisms of primary varicose great saphenous veins (GSVs) involve inflammation, apoptosis, and proliferation of local cells and extracellular matrix degradation. Long non-coding RNAs (lncRNAs) play important roles in these cellular processes; however, which and how lncRNAs related to these mechanisms take effect on GSVs remain unclear. By screening lncRNAs that might experience changes in GSV varicosities, we selected the lower expressed lncRNA-GAS5 (growth arrest specific transcript 5) for functional assessments. Silencing of lncRNA-GAS5 promoted cell proliferation and migration, and cell cycle of the human saphenous vein smooth muscle cells (HSVSMCs), whereas overexpressing it inhibited these cellular behaviors and reduced apoptosis of HSVSMCs. RNA pull-down experiment revealed a direct bind of lncRNA-GAS5 to a Ca2+-dependent RNA-binding protein, Annexin A2. Further experiments showed that silencing of Annexin A2 reduced the HSVSMCs proliferation and vice versa. In the context of lncRNA-GAS5 knockdown, silencing of Annexin A2 reduced the proliferation of HSVSMCs while overexpression of Annexin A2 increased the proliferation. Thus, the low expression of lncRNA-GAS5 may facilitate HSVSMCs proliferation and migration through Annexin A2 and thereby the pathogenesis of GSV varicosities. PMID:25806802

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Selective binding of lectins to normal and neoplastic urothelium in rat and mouse bladder carcinogenesis models.

PubMed

Zupančič, Daša; Kreft, Mateja Erdani; Romih, Rok

2014-01-01

Bladder cancer adjuvant intravesical therapy could be optimized by more selective targeting of neoplastic tissue via specific binding of lectins to plasma membrane carbohydrates. Our aim was to establish rat and mouse models of bladder carcinogenesis to investigate in vivo and ex vivo binding of selected lectins to the luminal surface of normal and neoplastic urothelium. Male rats and mice were treated with 0.05 % N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) in drinking water and used for ex vivo and in vivo lectin binding experiments. Urinary bladder samples were also used for paraffin embedding, scanning electron microscopy and immunofluorescence labelling of uroplakins. During carcinogenesis, the structure of the urinary bladder luminal surface changed from microridges to microvilli and ropy ridges and the expression of urothelial-specific glycoproteins uroplakins was decreased. Ex vivo and in vivo lectin binding experiments gave comparable results. Jacalin (lectin from Artocarpus integrifolia) exhibited the highest selectivity for neoplastic compared to normal urothelium of rats and mice. The binding of lectin from Amaranthus caudatus decreased in rat model and increased in mouse carcinogenesis model, indicating interspecies variations of plasma membrane glycosylation. Lectin from Datura stramonium showed higher affinity for neoplastic urothelium compared to the normal in rat and mouse model. The BBN-induced animal models of bladder carcinogenesis offer a promising approach for lectin binding experiments and further lectin-mediated targeted drug delivery research. Moreover, in vivo lectin binding experiments are comparable to ex vivo experiments, which should be considered when planning and optimizing future research.

Metabolic Control of Virulence Genes in Brucella abortus: HutC Coordinates virB Expression and the Histidine Utilization Pathway by Direct Binding to Both Promoters ▿ †

PubMed Central

Sieira, Rodrigo; Arocena, Gastón M.; Bukata, Lucas; Comerci, Diego J.; Ugalde, Rodolfo A.

2010-01-01

Type IV secretion systems (T4SS) are multicomponent machineries involved in the translocation of effector molecules across the bacterial cell envelope. The virB operon of Brucella abortus codes for a T4SS that is essential for virulence and intracellular multiplication of the bacterium in the host. Previous studies showed that the virB operon of B. abortus is tightly regulated within the host cells. In order to identify factors implicated in the control of virB expression, we searched for proteins of Brucella that directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-kDa protein that binds specifically to PvirB. This protein was identified as HutC, the transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut promoter activity revealed that HutC exerts two different roles: it acts as a coactivator of transcription of the virB operon, whereas it represses the hut genes. Such activities were observed both intracellularly and in bacteria incubated under conditions that resemble the intracellular environment. Electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments revealed the structure, affinity, and localization of the HutC-binding sites and supported the regulatory role of HutC in both hut and virB promoters. Taken together, these results indicate that Brucella coopted the function of HutC to coordinate the Hut pathway with transcriptional regulation of the virB genes, probably as a way to sense its own metabolic state and develop adaptive responses to overcome intracellular host defenses. PMID:19854911

Competitive Inhibition Mechanism of Acetylcholinesterase without Catalytic Active Site Interaction: Study on Functionalized C60 Nanoparticles via in Vitro and in Silico Assays.

PubMed

Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian

2017-06-07

Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.

Functional Divergence of FimX in PilZ Binding and Type IV Pilus Regulation

PubMed Central

Qi, Yaning; Xu, Linghui; Dong, Xueming; Yau, Yin Hoe; Ho, Chun Loong; Koh, Siew Lee; Shochat, Susana Geifman; Chou, Shan-Ho; Tang, Kai

2012-01-01

Type IV pili (T4P) are polar surface structures that play important roles in bacterial motility, biofilm formation, and pathogenicity. The protein FimX and its orthologs are known to mediate T4P formation in the human pathogen Pseudomonas aeruginosa and some other bacterial species. It was reported recently that FimXXAC2398 from Xanthomonas axonopodis pv. citri interacts with PilZXAC1133 directly through the nonenzymatic EAL domain of FimXXAC2398. Here we present experimental data to reveal that the strong interaction between FimXXAC2398 and PilZXAC1133 is not conserved in P. aeruginosa and likely other Pseudomonas species. In vitro and in vivo binding experiments showed that the interaction between FimX and PilZ in P. aeruginosa is below the measurable limit. Surface plasmon resonance assays further confirmed that the interaction between the P. aeruginosa proteins is at least more than 3 orders of magnitude weaker than that between the X. axonopodis pv. citri pair. The N-terminal lobe region of FimXXAC2398 was identified as the binding surface for PilZXAC1133 by amide hydrogen-deuterium exchange and site-directed mutagenesis studies. Lack of several key residues in the N-terminal lobe region of the EAL domain of FimX is likely to account for the greatly reduced binding affinity between FimX and PilZ in P. aeruginosa. All together, the results suggest that the interaction between PilZ and FimX in Xanthomonas species is not conserved in P. aeruginosa due to the evolutionary divergence among the FimX orthologs. The precise roles of FimX and PilZ in bacterial motility and T4P biogenesis are likely to vary among bacterial species. PMID:22942245

Allosteric Fine-Tuning of the Binding Pocket Dynamics in the ITK SH2 Domain by a Distal Molecular Switch: An Atomistic Perspective.

PubMed

Momin, Mohamed; Xin, Yao; Hamelberg, Donald

2017-06-29

Although the regulation of function of proteins by allosteric interactions has been identified in many subcellular processes, molecular switches are also known to induce long-range conformational changes in proteins. A less well understood molecular switch involving cis-trans isomerization of a peptidyl-prolyl bond could induce a conformational change directly to the backbone that is propagated to other parts of the protein. However, these switches are elusive and hard to identify because they are intrinsic to biomolecules that are inherently dynamic. Here, we explore the conformational dynamics and free energy landscape of the SH2 domain of interleukin-2-inducible T-cell or tyrosine kinase (ITK) to fully understand the conformational coupling between the distal cis-trans molecular switch and its binding pocket of the phosphotyrosine motif. We use multiple microsecond-long all-atom molecular dynamics simulations in explicit water for over a total of 60 μs. We show that cis-trans isomerization of the Asn286-Pro287 peptidyl-prolyl bond is directly coupled to the dynamics of the binding pocket of the phosphotyrosine motif, in agreement with previous NMR experiments. Unlike the cis state that is localized and less dynamic in a single free energy basin, the trans state samples two distinct conformations of the binding pocket-one that recognizes the phosphotyrosine motif and the other that is somewhat similar to that of the cis state. The results provide an atomic-level description of a less well understood allosteric regulation by a peptidyl-prolyl cis-trans molecular switch that could aid in the understanding of normal and aberrant subcellular processes and the identification of these elusive molecular switches in other proteins.

KU675, a Concomitant Heat-Shock Protein Inhibitor of Hsp90 and Hsc70 that Manifests Isoform Selectivity for Hsp90α in Prostate Cancer Cells

PubMed Central

Liu, Weiya; Vielhauer, George A.; Zhao, Huiping; Ghosh, Suman; Brown, Douglas; Lee, Eugene

2015-01-01

The 90-kDa heat-shock protein (Hsp90) assists in the proper folding of numerous mutated or overexpressed signal transduction proteins that are involved in cancer. Inhibiting Hsp90 consequently is an attractive strategy for cancer therapy as the concomitant degradation of multiple oncoproteins may lead to effective antineoplastic agents. Here we report a novel C-terminal Hsp90 inhibitor, designated KU675, that exhibits potent antiproliferative and cytotoxic activity along with client protein degradation without induction of the heat-shock response in both androgen-dependent and -independent prostate cancer cell lines. In addition, KU675 demonstrates direct inhibition of Hsp90 complexes as measured by the inhibition of luciferase refolding in prostate cancer cells. In direct binding studies, the internal fluorescence signal of KU675 was used to determine the binding affinity of KU675 to recombinant Hsp90α, Hsp90β, and Hsc70 proteins. The binding affinity (Kd) for Hsp90α was determined to be 191 μM, whereas the Kd for Hsp90β was 726 μM, demonstrating a preference for Hsp90α. Western blot experiments with four different prostate cancer cell lines treated with KU675 supported this selectivity by inducing the degradation of Hsp90α-dependent client proteins. KU675 also displayed binding to Hsc70 with a Kd value at 76.3 μM, which was supported in cellular by lower levels of Hsc70-specific client proteins on Western blot analyses. Overall, these findings suggest that KU675 is an Hsp90 C-terminal inhibitor, as well as a dual inhibitor of Hsc70, and may have potential use for the treatment of cancer. PMID:25939977

A heteronuclear zero quantum coherence Nz-exchange experiment that resolves resonance overlap and its application to measure the rates of heme binding to the IsdC protein.

PubMed

Robson, Scott A; Peterson, Robert; Bouchard, Louis-S; Villareal, Valerie A; Clubb, Robert T

2010-07-21

Chemical exchange phenomena in NMR spectra can be quantitatively interpreted to measure the rates of ligand binding, as well as conformational and chemical rearrangements. In macromolecules, processes that occur slowly on the chemical shift time scale are frequently studied using 2D heteronuclear ZZ or N(z)-exchange spectroscopy. However, to successfully apply this method, peaks arising from each exchanging species must have unique chemical shifts in both dimensions, a condition that is often not satisfied in protein-ligand binding equilibria for (15)N nuclei. To overcome the problem of (15)N chemical shift degeneracy we developed a heteronuclear zero-quantum (and double-quantum) coherence N(z)-exchange experiment that resolves (15)N chemical shift degeneracy in the indirect dimension. We demonstrate the utility of this new experiment by measuring the heme binding kinetics of the IsdC protein from Staphylococcus aureus. Because of peak overlap, we could not reliably analyze binding kinetics using conventional methods. However, our new experiment resulted in six well-resolved systems that yielded interpretable data. We measured a relatively slow k(off) rate of heme from IsdC (<10 s(-1)), which we interpret as necessary so heme loaded IsdC has time to encounter downstream binding partners to which it passes the heme. The utility of using this new exchange experiment can be easily expanded to (13)C nuclei. We expect our heteronuclear zero-quantum coherence N(z)-exchange experiment will expand the usefulness of exchange spectroscopy to slow chemical exchange events that involve ligand binding.

Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

PubMed Central

Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

2014-01-01

Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

Stiffening of flexible SUMO1 protein upon peptide-binding: Analysis with anisotropic network model.

PubMed

Sarkar, Ranja

2018-01-01

SUMO (small ubiquitin-like modifier) proteins interact with a large number of target proteins via a key regulatory event called sumoylation that encompasses activation, conjugation and ligation of SUMO proteins through specific E1, E2, and E3-type enzymes respectively. Single-molecule atomic force microscopic (AFM) experiments performed to unravel bound SUMO1 along its NC termini direction reveal that E3-ligases (in the form of small peptides) increase mechanical stability (along the axis) of the flexible protein upon binding. The experimental results are expected to correlate with the intrinsic flexibility of bound SUMO1 protein in the native state i.e., the bound conformation of SUMO1 without the binding peptide. The native protein flexibility/stiffness can be measured as a spring constant by normal mode analysis. In the present study, protein normal modes are computed from the protein structural data (as input from protein databank) via a simple anisotropic network model (ANM). ANM is computationally inexpensive and hence, can be explored to investigate and compare the native conformational dynamics of unbound and bound (without the binding partner) structures, if the corresponding structural data (NMR/X-ray) are available. The paper illustrates that SUMO1 stiffens (native flexibility decreases) along the NC termini (end-to-end) direction of the protein upon binding to small peptides; however, the degree of stiffening is peptide sequence-specific. The theoretical results are demonstrated for NMR structures of unbound SUMO1 and that bound to two peptides having short amino acid motifs and of similar size, one being an M-IR2 peptide derived from RanBP2 protein and the other one derived from PIASX protein. The peptide derived from PIASX stiffens SUMO1 remarkably which is evident from an atomic-level normal mode analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Binding biological motion and visual features in working memory.

PubMed

Ding, Xiaowei; Zhao, Yangfan; Wu, Fan; Lu, Xiqian; Gao, Zaifeng; Shen, Mowei

2015-06-01

Working memory mechanisms for binding have been examined extensively in the last decade, yet few studies have explored bindings relating to human biological motion (BM). Human BM is the most salient and biologically significant kinetic information encountered in everyday life and is stored independently from other visual features (e.g., colors). The current study explored 3 critical issues of BM-related binding in working memory: (a) how many BM binding units can be retained in working memory, (b) whether involuntarily object-based binding occurs during BM binding, and (c) whether the maintenance of BM bindings in working memory requires attention above and beyond that needed to maintain the constituent dimensions. We isolated motion signals of human BM from non-BM sources by using point-light displays as to-be-memorized BM and presented the participants colored BM in a change detection task. We found that working memory capacity for BM-color bindings is rather low; only 1 or 2 BM-color bindings could be retained in working memory regardless of the presentation manners (Experiments 1-3). Furthermore, no object-based encoding took place for colored BM stimuli regardless of the processed dimensions (Experiments 4 and 5). Central executive attention contributes to the maintenance of BM-color bindings, yet maintaining BM bindings in working memory did not require more central attention than did maintaining the constituent dimensions in working memory (Experiment 6). Overall, these results suggest that keeping BM bindings in working memory is a fairly resource-demanding process, yet central executive attention does not play a special role in this cross-module binding. (c) 2015 APA, all rights reserved).

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex.

PubMed

Douglas, Max E; Diffley, John F X

2016-03-11

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Biological role and structural mechanism of twinfilin–capping protein interaction

PubMed Central

Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

2004-01-01

Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

PubMed

Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

2018-05-15

The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is controlled by the Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator PimR, which binds a series of heptameric direct repeats in its promoter region. The structure and importance of such repeats in protein binding, transcriptional activation, and polyene production have been investigated. These findings should provide important clues to understand the regulatory machinery that modulates antibiotic biosynthesis in Streptomyces and open new possibilities for the manipulation of metabolite production. The presence of PimR orthologues encoded by gene clusters for different secondary metabolites and the conservation of their operators suggest that the improvements observed in the activation of pimaricin biosynthesis by Streptomyces natalensis could be extrapolated to the production of different compounds by other species. Copyright © 2018 Barreales et al.

Sorption of lead onto two gram-negative marine bacteria in seawater

USGS Publications Warehouse

Harvey, Ronald W.; Leckie, James O.

1985-01-01

Laboratory adsorption experiments performed at environmentally significant lead (Pb) and cell concentrations indicate that the marine bacteria examined have significant binding capacities for Pb. However, the behavior governing Pb sorption onto gram-negative bacteria in seawater may be quite complex. The sorption kinetics appear to involve two distinct phases, i.e., a rapid removal of Pb from solution within the first few minutes, followed by a slow but nearly constant removal over many hours. Also, the average binding coefficient, calculated for Pb sorption onto bacteria and a measure of binding intensity, increases with decreasing sorption density (amounts of bacteria-associated Pb per unit bacterial surface) at low cell concentrations (105 cells ml−1), but decreases with decreasing sorption density at higher cell concentrations (107 cells ml−1). The latter effect is apparently due to the production of significant amounts of extra-cellular organics at high cell concentrations that compete directly with bacterial surfaces for available lead. Lead toxicity and active uptake by marine bacteria did not appear significant at the Pb concentrations used.

Crystal Structure of a Fibroblast Growth Factor Homologous Factor (FHF) Defines a Conserved Surface on FHFs for Binding and Modulation of Voltage-gated Sodium Channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goetz, R.; Dover, K; Laezza, F

2009-01-01

Voltage-gated sodium channels (Nav) produce sodium currents that underlie the initiation and propagation of action potentials in nerve and muscle cells. Fibroblast growth factor homologous factors (FHFs) bind to the intracellular C-terminal region of the Nav alpha subunit to modulate fast inactivation of the channel. In this study we solved the crystal structure of a 149-residue-long fragment of human FHF2A which unveils the structural features of the homology core domain of all 10 human FHF isoforms. Through analysis of crystal packing contacts and site-directed mutagenesis experiments we identified a conserved surface on the FHF core domain that mediates channel bindingmore » in vitro and in vivo. Mutations at this channel binding surface impaired the ability of FHFs to co-localize with Navs at the axon initial segment of hippocampal neurons. The mutations also disabled FHF modulation of voltage-dependent fast inactivation of sodium channels in neuronal cells. Based on our data, we propose that FHFs constitute auxiliary subunits for Navs.« less

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

Preparation of diclofenac-imprinted polymer beads for selective molecular separation in water.

PubMed

Zhou, Tongchang; Kamra, Tripta; Ye, Lei

2018-03-01

Molecular imprinting technique is an attractive strategy to prepare materials for target recognition and rapid separation. In this work, a new type of diclofenac (DFC)-imprinted polymer beads was synthesized by Pickering emulsion polymerization using 2-(dimethylamino)ethyl methacrylate as the functional monomer. The selectivity and capacity of the molecularly imprinted polymers (MIPs) were investigated in aqueous solution. Equilibrium binding results show that the MIPs have a high selectivity to bind DFC in a wide range of pH values. Moreover, in liquid chromatography experiment, the imprinted polymer beads were packed into column to investigate the binding selectivity under nonequilibrium conditions. The retention time of DFC on the MIP column is significantly longer than its structural analogues. Also, retention of DFC on the MIP column was significantly longer than on the nonimprinted polymer column under aqueous condition. As the new MIP beads can be used to achieve direct separation of DFC from water, the synthetic method and the affinity beads developed in this work opened new possibilities for removing toxic chemicals from environmental and drinking water. Copyright © 2017 John Wiley & Sons, Ltd.

Profile of apalutamide in the treatment of metastatic castration-resistant prostate cancer: evidence to date.

PubMed

Chong, Julio T; Oh, William K; Liaw, Bobby C

2018-01-01

Advances in therapies have led to the approval of six therapeutic agents since 2004, each demonstrating overall survival benefit in randomized studies, and these have significantly improved the outlook for men facing metastatic castration-resistant prostate cancer (CRPC). More recently, efforts have been directed at trying to effect change at earlier phases of the disease. Apalutamide (ARN-509), a second-generation androgen receptor antagonist, recently received approval in the nonmetastatic (M0) CRPC space. Similar to enzalutamide, apalutamide inhibits the binding of androgen to androgen receptor (AR), nuclear translocation of the androgen-AR complex, and binding of AR transcription complex to DNA-binding sites and transcription elements. Phase I and II trial experience demonstrates the safety and tolerability of apalutamide, as well as its efficacy in effecting prostate-specific antigen response and radiographic-free survival in CRPC. US Food and Drug Administration approval in M0 CRPC was granted following positive results from the phase III SPARTAN study, where apalutamide demonstrated significant improvements in metastasis-free survival and time to symptomatic progression as compared to placebo.

Levetiracetam Reverses Synaptic Deficits Produced by Overexpression of SV2A

PubMed Central

Yao, Jia; Bleckert, Adam; Hill, Jessica; Bajjalieh, Sandra M.

2011-01-01

Levetiracetam is an FDA-approved drug used to treat epilepsy and other disorders of the nervous system. Although it is known that levetiracetam binds the synaptic vesicle protein SV2A, how drug binding affects synaptic functioning remains unknown. Here we report that levetiracetam reverses the effects of excess SV2A in autaptic hippocampal neurons. Expression of an SV2A-EGFP fusion protein produced a ∼1.5-fold increase in synaptic levels of SV2, and resulted in reduced synaptic release probability. The overexpression phenotype parallels that seen in neurons from SV2 knockout mice, which experience severe seizures. Overexpression of SV2A also increased synaptic levels of the calcium-sensor protein synaptotagmin, an SV2-binding protein whose stability and trafficking are regulated by SV2. Treatment with levetiracetam rescued normal neurotransmission and restored normal levels of SV2 and synaptotagmin at the synapse. These results indicate that changes in SV2 expression in either direction impact neurotransmission, and suggest that levetiracetam may modulate SV2 protein interactions. PMID:22220214

On the interaction of luminol with human serum albumin: Nature and thermodynamics of ligand binding

NASA Astrophysics Data System (ADS)

Moyon, N. Shaemningwar; Mitra, Sivaprasad

2010-09-01

The mechanism and thermodynamic parameters for the binding of luminol (LH 2) with human serum albumin was explored by steady state and picosecond time-resolved fluorescence spectroscopy. It was shown that out of two possible LH 2 conformers present is solution, only one is accessible for binding with HSA. The thermodynamic parameters like enthalpy (Δ H) and entropy (Δ S) change corresponding to the ligand binding process were also estimated by performing the experiment at different temperatures. The ligand replacement experiment with bilirubin confirms that LH 2 binds into the sub-domain IIA of the protein.

Progranulin Directly Binds to the CRD 2 and CRD3 of TNFR Extracellular Domains

PubMed Central

Jian, Jinlong; Zhao, Shuai; Tian, Qingyun; Gonzalez-Gugel, Elena; Mundra, Jyoti Joshi; Uddin, Sardar MZ; Liu, Ben; Richbourgh, Brendon; Brunetti, Ryan; Liu, Chuan-ju

2013-01-01

We previously reported that PGRN directly bound to TNF receptors (TNFR) in vitro and in chondrocytes (Tang, et al, Science, 2011). Here we report that PGRN also associated with TNFR in splenocytes, and inhibited the binding of TNFα to immune cells. Proper folding of PGRN is essential for its binding to TNFR, as DTT treatment abolished its binding to TNFR. In contrast, the binding of PGRN to Sortilin was enhanced by DTT. Protein interaction assays with mutants of the TNFR extracellular domain demonstrated that CRD2 and CRD3 of TNFR are important for the interaction with PGRN, similar to the binding to TNFα. Taken together, these findings provide the molecular basis underlying PGRN/TNFR interaction and PGRN-mediated anti-inflammatory activity in various autoimmune diseases and conditions. PMID:24070898

Occupancy of the Chromophore Binding Site of Opsin Activates Visual Transduction in Rod Photoreceptors

PubMed Central

Kefalov, Vladimir J.; Carter Cornwall, M.; Crouch, Rosalie K.

1999-01-01

The retinal analogue β-ionone was used to investigate possible physiological effects of the noncovalent interaction between rod opsin and its chromophore 11-cis retinal. Isolated salamander rod photoreceptors were exposed to bright light that bleached a significant fraction of their pigment, were allowed to recover to a steady state, and then were exposed to β-ionone. Our experiments show that in bleach-adapted rods β-ionone causes a decrease in light sensitivity and dark current and an acceleration of the dim flash photoresponse and the rate constants of guanylyl cyclase and cGMP phosphodiesterase. Together, these observations indicate that in bleach-adapted rods β-ionone activates phototransduction in the dark. Control experiments showed no effect of β-ionone in either fully dark-adapted or background light-adapted cells, indicating direct interaction of β-ionone with the free opsin produced by bleaching. We speculate that β-ionone binds specifically in the chromophore pocket of opsin to produce a complex that is more catalytically potent than free opsin alone. We hypothesize that a similar reaction may occur in the intact retina during pigment regeneration. We propose a model of rod pigment regeneration in which binding of 11-cis retinal to opsin leads to activation of the complex accompanied by a decrease in light sensitivity. The subsequent covalent attachment of retinal to opsin completely inactivates opsin and leads to the recovery of sensitivity. Our findings resolve the conflict between biochemical and physiological data concerning the effect of the occupancy of the chromophore binding site on the catalytic potency of opsin. We show that binding of β-ionone to rod opsin produces effects opposite to its previously described effects on cone opsin. We propose that this distinction is due to a fundamental difference in the interaction of rod and cone opsins with retinal, which may have implications for the different physiology of the two types of photoreceptors. PMID:10051522

T cell specific adaptor protein (TSAd) promotes interaction of Nck with Lck and SLP-76 in T cells.

PubMed

Hem, Cecilie Dahl; Sundvold-Gjerstad, Vibeke; Granum, Stine; Koll, Lise; Abrahamsen, Greger; Buday, Laszlo; Spurkland, Anne

2015-07-11

The Lck and Src binding adaptor protein TSAd (T cell specific adaptor) regulates actin polymerization in T cells and endothelial cells. The molecular details as to how TSAd regulates this process remain to be elucidated. To identify novel interaction partners for TSAd, we used a scoring matrix-assisted ligand algorithm (SMALI), and found that the Src homology 2 (SH2) domain of the actin regulator Non-catalytic region of tyrosine kinase adaptor protein (Nck) potentially binds to TSAd phosphorylated on Tyr(280) (pTyr(280)) and pTyr(305). These predictions were confirmed by peptide array analysis, showing direct binding of recombinant Nck SH2 to both pTyr(280) and pTyr(305) on TSAd. In addition, the SH3 domains of Nck interacted with the proline rich region (PRR) of TSAd. Pull-down and immunoprecipitation experiments further confirmed the Nck-TSAd interactions through Nck SH2 and SH3 domains. In line with this Nck and TSAd co-localized in Jurkat cells as assessed by confocal microscopy and imaging flow cytometry. Co-immunoprecipitation experiments in Jurkat TAg cells lacking TSAd revealed that TSAd promotes interaction of Nck with Lck and SLP-76, but not Vav1. TSAd expressing Jurkat cells contained more polymerized actin, an effect dependent on TSAd exon 7, which includes interactions sites for both Nck and Lck. TSAd binds to and co-localizes with Nck. Expression of TSAd increases both Nck-Lck and Nck-SLP-76 interaction in T cells. Recruitment of Lck and SLP-76 to Nck by TSAd could be one mechanism by which TSAd promotes actin polymerization in activated T cells.

Agonist-dependent consequences of proline to alanine substitution in the transmembrane helices of the calcitonin receptor

PubMed Central

Bailey, R J; Hay, D L

2007-01-01

Background and purpose: Transmembrane proline (P) residues in family A G protein-coupled receptors (GPCRs) form functionally important kinks in their helices. These residues are little studied in family B GPCRs but experiments with the VPAC1 receptor and calcitonin receptor-like receptor (CL) show parallels with family A receptors. We sought to determine the function of these residues in the insert negative form of the human calcitonin receptor, a close relative of CL. Experimental approach: Proline residues within the transmembrane domains of the calcitonin receptor (P246, P249, P280, P326, P336) were individually mutated to alanine (A) using site-directed mutagenesis. Receptors were transiently transfected into Cos-7 cells using polyethylenimine and salmon and human calcitonin-induced cAMP responses measured. Salmon and human calcitonin competition binding experiments were also performed and receptor cell-surface expression assessed by whole cell ELISA. Key results: P246A, P249A and P280A were wild-type in terms of human calcitonin-induced cAMP activation. P326A and P336A had reduced function (165 and 12-fold, respectively). In membranes, human calcitonin binding was not detectable for any mutant receptor but in whole cells, binding was detected for all mutants apart from P326A. Salmon calcitonin activated mutant and wild-type receptors equally, although Bmax values were reduced for all mutants apart from P326A. Conclusions and Implications: P326 and P336 are important for the function of human calcitonin receptors and are likely to be involved in generating receptor conformations appropriate for agonist binding and receptor activation. However, agonist-specific effects were observed , implying distinct conformations of the human calcitonin receptor. PMID:17486143

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin.

PubMed

Donohue, Elizabeth; Balgi, Aruna D; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy.

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin

PubMed Central

Donohue, Elizabeth; Balgi, Aruna D.; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy. PMID:25494214

Global Profiling of hnRNP A2/B1-RNA Binding on Chromatin Highlights LncRNA Interactions.

PubMed

Nguyen, Eric D; Balas, Maggie M; Griffin, April M; Roberts, Justin T; Johnson, Aaron M

2018-06-23

Long noncoding RNAs (lncRNAs) often carry out their functions through associations with adaptor proteins. We recently identified heterogeneous ribonucleoprotein (hnRNP) A2/B1 as an adaptor of the human HOTAIR lncRNA. hnRNP A2 and B1 are splice isoforms of the same gene. The spliced version of HOTAIR preferentially associates with the B1 isoform, which we hypothesize contributes to RNA-RNA matching between HOTAIR and transcripts of target genes in breast cancer. Here we used enhanced cross-linking immunoprecipitation (eCLIP) to map the direct interactions between A2/B1 and RNA in breast cancer cells. Despite differing by only twelve amino acids, the A2 and B1 splice isoforms associate preferentially with distinct populations of RNA in vivo. Through cellular fractionation experiments we characterize the pattern of RNA association in chromatin, nucleoplasm, and cytoplasm. We find that a majority of interactions occur on chromatin, even those that do not contribute to co-transcriptional splicing. A2/B1 binding site locations on multiple RNAs hint at a contribution to the regulation and function of lncRNAs. Surprisingly, the strongest A2/B1 binding site occurs in a retained intron of HOTAIR, which interrupts an RNA-RNA interaction hotspot. In vitro eCLIP experiments highlight additional exonic B1 binding sites in HOTAIR which also surround the RNA-RNA interaction hotspot. Interestingly, a version of HOTAIR with the intron retained is still capable of making RNA-RNA interactions in vitro through the hotspot region. Our data further characterize the multiple functions of a repurposed splicing factor with isoform-biased interactions, and highlight that the majority of these functions occur on chromatin-associated RNA.

Molecular basis for the Kallmann syndrome-linked fibroblast growth factor receptor mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thurman, Ryan D.; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy

Highlights: Black-Right-Pointing-Pointer The structural basis of the Kallmann syndrome is elucidated. Black-Right-Pointing-Pointer Kallmann syndrome mutation (A168S) induces a subtle conformational change(s). Black-Right-Pointing-Pointer Structural interactions mediated by beta-sheet G are most perturbed. Black-Right-Pointing-Pointer Ligand (FGF)-receptor interaction(s) is completely abolished by Kallmann mutation. Black-Right-Pointing-Pointer Kallmann mutation directly affects the FGF signaling process. -- Abstract: Kallmann syndrome (KS) is a developmental disease that expresses in patients as hypogonadotropic hypogonadism and anosmia. KS is commonly associated with mutations in the extracellular D2 domain of the fibroblast growth factor receptor (FGFR). In this study, for the first time, the molecular basis for the FGFR associatedmore » KS mutation (A168S) is elucidated using a variety of biophysical experiments, including multidimensional NMR spectroscopy. Secondary and tertiary structural analysis using far UV circular dichroism, fluorescence and limited trypsin digestion assays suggest that the KS mutation induces subtle tertiary structure change in the D2 domain of FGFR. Results of isothermal titration calorimetry experiments show the KS mutation causes a 10-fold decrease in heparin binding affinity and also a complete loss in ligand (FGF-1) binding. {sup 1}H-{sup 15}N chemical perturbation data suggest that complete loss in the ligand (FGF) binding affinity is triggered by a subtle conformational change that disrupts crucial structural interactions in both the heparin and the FGF binding sites in the D2 domain of FGFR. The novel findings reported in this study are expected to provide valuable clues toward a complete understanding of the other genetic diseases linked to mutations in the FGFR.« less

Design, production and molecular structure of a new family of artificial alpha-helicoidal repeat proteins (αRep) based on thermostable HEAT-like repeats.

PubMed

Urvoas, Agathe; Guellouz, Asma; Valerio-Lepiniec, Marie; Graille, Marc; Durand, Dominique; Desravines, Danielle C; van Tilbeurgh, Herman; Desmadril, Michel; Minard, Philippe

2010-11-26

Repeat proteins have a modular organization and a regular architecture that make them attractive models for design and directed evolution experiments. HEAT repeat proteins, although very common, have not been used as a scaffold for artificial proteins, probably because they are made of long and irregular repeats. Here, we present and validate a consensus sequence for artificial HEAT repeat proteins. The sequence was defined from the structure-based sequence analysis of a thermostable HEAT-like repeat protein. Appropriate sequences were identified for the N- and C-caps. A library of genes coding for artificial proteins based on this sequence design, named αRep, was assembled using new and versatile methodology based on circular amplification. Proteins picked randomly from this library are expressed as soluble proteins. The biophysical properties of proteins with different numbers of repeats and different combinations of side chains in hypervariable positions were characterized. Circular dichroism and differential scanning calorimetry experiments showed that all these proteins are folded cooperatively and are very stable (T(m) >70 °C). Stability of these proteins increases with the number of repeats. Detailed gel filtration and small-angle X-ray scattering studies showed that the purified proteins form either monomers or dimers. The X-ray structure of a stable dimeric variant structure was solved. The protein is folded with a highly regular topology and the repeat structure is organized, as expected, as pairs of alpha helices. In this protein variant, the dimerization interface results directly from the variable surface enriched in aromatic residues located in the randomized positions of the repeats. The dimer was crystallized both in an apo and in a PEG-bound form, revealing a very well defined binding crevice and some structure flexibility at the interface. This fortuitous binding site could later prove to be a useful binding site for other low molecular mass partners. Copyright © 2010 Elsevier Ltd. All rights reserved.

A Joint Theory and Experimental Project in the Synthesis and Testing of Porous COFs for On-Board Vehicular Hydrogen Storage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yaghi, Omar M.; Goddard, William A.

2013-06-29

Conventional storage of large amounts of hydrogen in its molecular form is difficult and expensive because it requires employing either extremely high pressure gas or very low temperature liquid. Because of the importance of hydrogen as a fuel, the DOE has set system targets for hydrogen storage of gravimetric (5.5 wt%) and volumetric (40 g/L) densities to be achieved by 2015. From our continuous efforts on hydrogen storage, it is believed that metalation of highly porous solids with high-valence metals is promising and provides a rational direction to realize high volumetric hydrogen density near room temperature. This grant was focusedmore » on the study of high surface area covalent organic frameworks (COFs) with these specific objectives (1) to introduce potential metal binding sites through the COF synthesis and (2) to implement metalation experiments and evaluate their respective hydrogen adsorption properties. To maximize our efforts, simulation calculations were also performed (prior to experiments) for the prediction of binding enthalpy of hydrogen for molecular building units containing transition metals and promising COF structures to increase volumetric hydrogen uptake at room temperature. In this effort, first molecular building units with optimal binding energy for hydrogen storage (20 kJ/mol) were designed by quantum mechanical (QM) methods. Employing these results, it was revealed that one of metalated COFs takes up 60 g/L (total) of H2 at 100 bar and 298 K. To realize proposed COF structures, chemistry of COF synthesis has been developed; for instance, new air stable COFs were synthesized via hydrazone (COF-41 to 43) and imine condensation (COF-301, 320, 340, and 366) and some of them were tested the effect on metalation. Finally, a new triazine COF with high volumetric hydrogen uptake capacity was presented as a proposed future direction.« less

Influence of E. coli endotoxin on ACTH induced adrenal cell steroidogenesis.

PubMed

Garcia, R; Viloria, M D; Municio, A M

1985-03-01

The effect of endotoxin (lipopolysaccharide from E. coli) on isolated adrenocortical cells was examined. Lipopolysaccharide decreased the ACTH-induced steroidogenesis. This effect was shown by all corticotropin concentrations studied, and the longer the incubation time, the higher the effect produced. The rate of decrease of ACTH-induced steroidogenesis was dependent on the concentration of lipopolysaccharide in the medium. Binding of [125I]ACTH to adrenocortical cells was modified by lipopolysaccharide; this modification was related to a decrease of the ACTH-induced steroidogenesis. This effect supports the hypothesis of a direct interaction between lipopolysaccharide and the cell membrane with a concomitant distortion of the cell surface affecting the ACTH receptor sites of their environment. [14C]Lipopolysaccharide binds to isolated adrenocortical cells. Binding specificity was investigated by competitive experiments in the presence of various types of endotoxins, polypeptide hormones and proteins. Unlabelled lipopolysaccharide from the same bacterial strain and isolated under identical conditions than the labelled lipopolysaccharide exerted the strongest inhibitory activity. Unlabelled lipopolysaccharide of various strains different from that originating the labelled lipopolysaccharide exerted the less displacement. It would imply a certain kind of specificity but the decrease in the binding of lipopolysaccharide produced by ACTH and glucagon suggests the existence of non-specific interactions between lipopolysaccharide and cell membrane.

Structure of the Nucleoprotein Binding Domain of Mokola Virus Phosphoprotein▿

PubMed Central

Assenberg, René; Delmas, Olivier; Ren, Jingshan; Vidalain, Pierre-Olivier; Verma, Anil; Larrous, Florence; Graham, Stephen C.; Tangy, Frédéric; Grimes, Jonathan M.; Bourhy, Hervé

2010-01-01

Mokola virus (MOKV) is a nonsegmented, negative-sense RNA virus that belongs to the Lyssavirus genus and Rhabdoviridae family. MOKV phosphoprotein P is an essential component of the replication and transcription complex and acts as a cofactor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. Here we present a structure for this domain of MOKV P, obtained by expression of full-length P in Escherichia coli, which was subsequently truncated during crystallization. The structure has a high degree of homology with P of rabies virus, another member of Lyssavirus genus, and to a lesser degree with P of vesicular stomatitis virus (VSV), a member of the related Vesiculovirus genus. In addition, analysis of the crystal packing of this domain reveals a potential binding site for the nucleoprotein N. Using both site-directed mutagenesis and yeast two-hybrid experiments to measure P-N interaction, we have determined the relative roles of key amino acids involved in this interaction to map the region of P that binds N. This analysis also reveals a structural relationship between the N-RNA binding domain of the P proteins of the Rhabdoviridae and the Paramyxoviridae. PMID:19906936

A novel functional domain of Cdc15 kinase is required for its interaction with Tem1 GTPase in Saccharomyces cerevisiae.

PubMed Central

Asakawa, K; Yoshida, S; Otake, F; Toh-e, A

2001-01-01

Exit from mitosis requires the inactivation of cyclin-dependent kinase (CDK) activity. In the budding yeast Saccharomyces cerevisiae, a number of gene products have been identified as components of the signal transduction network regulating inactivation of CDK (called the MEN, for the mitotic exit network). Cdc15, one of such components of the MEN, is an essential protein kinase. By the two-hybrid screening, we identified Cdc15 as a binding protein of Tem1 GTPase, another essential regulator of the MEN. Coprecipitation experiments revealed that Tem1 binds to Cdc15 in vivo. By deletion analysis, we found that the Tem1-binding domain resides near the conserved kinase domain of Cdc15. The cdc15-LF mutation, which was introduced into the Tem1-binding domain, reduced the interaction with Cdc15 and Tem1 and caused temperature-sensitive growth.The kinase activity of Cdc15 was not so much affected by the cdc15-LF mutation. However, Cdc15-LF failed to localize to the SPB at the restrictive temperature. Our data show that the interaction with Tem1 is important for the function of Cdc15 and that Cdc15 and Tem1 function in a complex to direct the exit from mitosis. PMID:11290702

Identification of a Cholesterol-Binding Pocket in Inward Rectifier K+ (Kir) Channels

PubMed Central

Fürst, Oliver; Nichols, Colin G.; Lamoureux, Guillaume; D’Avanzo, Nazzareno

2014-01-01

Cholesterol is the major sterol component of all mammalian plasma membranes. Recent studies have shown that cholesterol inhibits both bacterial (KirBac1.1 and KirBac3.1) and eukaryotic (Kir2.1) inward rectifier K+ (Kir) channels. Lipid-sterol interactions are not enantioselective, and the enantiomer of cholesterol (ent-cholesterol) does not inhibit Kir channel activity, suggesting that inhibition results from direct enantiospecific binding to the channel, and not indirect effects of changes to the bilayer. Furthermore, conservation of the effect of cholesterol among prokaryotic and eukaryotic Kir channels suggests an evolutionary conserved cholesterol-binding pocket, which we aimed to identify. Computational experiments were performed by docking cholesterol to the atomic structures of Kir2.2 (PDB: 3SPI) and KirBac1.1 (PDB: 2WLL) using Autodock 4.2. Poses were assessed to ensure biologically relevant orientation and then clustered according to location and orientation. The stability of cholesterol in each of these poses was then confirmed by molecular dynamics simulations. Finally, mutation of key residues (S95H and I171L) in this putative binding pocket found within the transmembrane domain of Kir2.1 channels were shown to lead to a loss of inhibition by cholesterol. Together, these data provide support for this location as a biologically relevant pocket. PMID:25517146

Novel L-Dopa and dopamine prodrugs containing a 2-phenyl-imidazopyridine moiety.

PubMed

Denora, Nunzio; Laquintana, Valentino; Lopedota, Angela; Serra, Mariangela; Dazzi, Laura; Biggio, Giovanni; Pal, Dhananjay; Mitra, Ashim K; Latrofa, Andrea; Trapani, Giuseppe; Liso, Gaetano

2007-07-01

The aim of this study was to gain insight into the feasibility of enhancing the delivery of L-Dopa and dopamine to the brain by linking these neurotransmitters and L-Dopa ethyl ester to 2-phenyl-3-carboxymethyl-imidazopyridine compounds giving rise to the so-called Dopimid compounds. A number of Dopimid compounds were synthesized and both stability and binding studies to dopaminergic and benzodiazepine receptors were performed. To evaluate whether Dopimid compounds are P-gp substrates, [(3)H]ritonavir uptake experiments and bi-directional transport studies on confluent MDCKII-MDR1 monolayers were carried out. The brain penetration properties of Dopimid compounds were estimated by the Clark's computational model and evaluated by investigation of their transport across BBMECs monolayers. The dopamine levels following the intraperitoneal administration of the selected Dopimid compounds were measured in vivo by using brain microdialysis in rat. Tested compounds were adequately stable in solution buffered at pH 7.4 but undergo faster cleavage in dilute rat serum at 37 degrees C. Receptor binding studies showed that Dopimid compounds are essentially devoid of affinity for dopaminergic and benzodiazepine receptors. [(3)H]ritonavir uptake experiments indicated that selected Dopimid compounds, like L-Dopa and dopamine hydrochloride, are not substrates of P-gp and it was also confirmed by bi-directional transport experiments across MDCKII-MDR1 monolayers. By Clark's model a significant brain penetration was deduced for L-Dopa ethyl ester and dopamine derivatives. Transport studies involving BBMECs monolayers indicated that some of these compounds should be able to cross the BBB. Interestingly, the rank order of apparent permeability (P (app)) values observed in these assays parallels that calculated by the computational approach. Brain microdialysis experiments in rat showed that intraperitoneal acute administration of some Dopimid compounds induced a dose-dependent increase in cortical dopamine output. Based on these results, it may be concluded that some Dopimid compounds can be proposed as novel L-Dopa and dopamine prodrugs.

Interaction of phenazinium dyes with double-stranded poly(A): Spectroscopy and isothermal titration calorimetry studies

NASA Astrophysics Data System (ADS)

Khan, Asma Yasmeen; Saha, Baishakhi; Kumar, Gopinatha Suresh

2014-10-01

A comprehensive study on the binding of phenazinium dyes viz. janus green B, indoine blue, safranine O and phenosafranine with double stranded poly(A) using various spectroscopic and calorimetric techniques is presented. A higher binding of janus green B and indoine blue over safranine O and phenosafranine to poly(A) was observed from all experiments. Intercalative mode of binding of the dyes was inferred from fluorescence polarization anisotropy, iodide quenching and viscosity experiments. Circular dichroism study revealed significant perturbation of the secondary structure of poly(A) on binding of these dyes. Results from isothermal titration calorimetry experiments suggested that the binding was predominantly entropy driven with a minor contribution of enthalpy to the standard molar Gibbs energy. The results presented here may open new opportunities in the application of these dyes as RNA targeted therapeutic agents.

Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

NASA Astrophysics Data System (ADS)

Lin, Hong; Kitova, Elena N.; Klassen, John S.

2014-01-01

Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

PubMed

Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

2018-03-28

Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

Direct Activation of Epac by Sulfonylurea is Isoform Selective

PubMed Central

Herbst, Katie J.; Coltharp, Carla; Amzel, L. Mario; Zhang, Jin

2011-01-01

Summary Commonly used as a treatment for Type II diabetes, sulfonylureas (SUs) stimulate insulin secretion from pancreatic β cells by binding to sulfonylurea receptors. Recently, SUs have been shown to also activate exchange protein directly activated by cAMP 2 (Epac2), however little is known about this molecular action. Using biosensor imaging and biochemical analysis, we show that SUs activate Epac2 and the downstream signaling via direct binding to Epac2. We further identify R447 of Epac2 to be critically involved in SU binding. This distinct binding site from cAMP points to a new mode of allosteric activation of Epac2. We also show that SUs selectively activate Epac2 isoform, but not the closely related Epac1, further establishing SUs as a new class of isoform-selective enzyme activators. PMID:21338921

Binding Direction-Based Two-Dimensional Flattened Contact Area Computing Algorithm for Protein-Protein Interactions.

PubMed

Kang, Beom Sik; Pugalendhi, GaneshKumar; Kim, Ku-Jin

2017-10-13

Interactions between protein molecules are essential for the assembly, function, and regulation of proteins. The contact region between two protein molecules in a protein complex is usually complementary in shape for both molecules and the area of the contact region can be used to estimate the binding strength between two molecules. Although the area is a value calculated from the three-dimensional surface, it cannot represent the three-dimensional shape of the surface. Therefore, we propose an original concept of two-dimensional contact area which provides further information such as the ruggedness of the contact region. We present a novel algorithm for calculating the binding direction between two molecules in a protein complex, and then suggest a method to compute the two-dimensional flattened area of the contact region between two molecules based on the binding direction.

Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV

PubMed Central

Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun

2013-01-01

Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868

Identification and Functional Characterization of a Novel Acetylcholine-binding Protein from the Marine Annelid Capitella teleta

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCormack, T.; Petrovich,; Mercier, K

2010-01-01

We identified a homologue of the molluscan acetylcholine-binding protein (AChBP) in the marine polychaete Capitella teleta, from the annelid phylum. The amino acid sequence of C. teleta AChBP (ct-AChBP) is 21-30% identical with those of known molluscan AChBPs. Sequence alignments indicate that ct-AChBP has a shortened Cys loop compared to other Cys loop receptors, and a variation on a conserved Cys loop triad, which is associated with ligand binding in other AChBPs and nicotinic ACh receptor (nAChR) {alpha} subunits. Within the D loop of ct-AChBP, a conserved aromatic residue (Tyr or Trp) in nAChRs and molluscan AChBPs, which has beenmore » implicated directly in ligand binding, is substituted with an isoleucine. Mass spectrometry results indicate that Asn122 and Asn216 of ct-AChBP are glycosylated when expressed using HEK293 cells. Small-angle X-ray scattering data suggest that the overall shape of ct-AChBP in the apo or unliganded state is similar to that of homologues with known pentameric crystal structures. NMR experiments show that acetylcholine, nicotine, and {alpha}-bungarotoxin bind to ct-AChBP with high affinity, with KD values of 28.7 {micro}M, 209 nM, and 110 nM, respectively. Choline bound with a lower affinity (K{sub D} = 163 {micro}M). Our finding of a functional AChBP in a marine annelid demonstrates that AChBPs may exhibit variations in hallmark motifs such as ligand-binding residues and Cys loop length and shows conclusively that this neurotransmitter binding protein is not limited to the phylum Mollusca.« less

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR

PubMed Central

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2012-01-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the 2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury, et. al. 2011). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. PMID:23000369

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR.

PubMed

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2013-02-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the β2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury et al., [32]). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. Copyright © 2012 Elsevier B.V. All rights reserved.

Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

ERIC Educational Resources Information Center

Kugel, Jennifer F.

2008-01-01

An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…

Cobra venom factor immunoconjugates: effects of carbohydrate-directed versus amino group-directed conjugation.

PubMed

Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W

1995-01-01

Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)

Regulatory elements involved in tax-mediated transactivation of the HTLV-I LTR.

PubMed

Seeler, J S; Muchardt, C; Podar, M; Gaynor, R B

1993-10-01

HTLV-I is the etiologic agent of adult T-cell leukemia. In this study, we investigated the regulatory elements and cellular transcription factors which function in modulating HTLV-I gene expression in response to the viral transactivator protein, tax. Transfection experiments into Jurkat cells of a variety of site-directed mutants in the HTLV-1 LTR indicated that each of the three motifs A, B, and C within the 21-bp repeats, the binding sites for the Ets family of proteins, and the TATA box all influenced the degree of tax-mediated activation. Tax is also able to activate gene expression of other viral and cellular promoters. Tax activation of the IL-2 receptor and the HIV-1 LTR is mediated through NF-kappa B motifs. Interestingly, sequences in the 21-bp repeat B and C motifs contain significant homology with NF-kappa B regulatory elements. We demonstrated that an NF-kappa B binding protein, PRDII-BF1, but not the rel protein, bound to the B and C motifs in the 21-bp repeat. PRDII-BF1 was also able to stimulate activation of HTLV-I gene expression by tax. The role of the Ets proteins on modulating tax activation was also studied. Ets 1 but not Ets 2 was capable of increasing the degree of tax activation of the HTLV-I LTR. These results suggest that tax activates gene expression by either direct or indirect interaction with several cellular transcription factors that bind to the HTLV-I LTR.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

Dual role of Zn2+ in maintaining structural integrity and suppressing deacetylase activity of SIRT1.

PubMed

Chen, Lei; Feng, Yu; Zhou, Yinqiu; Zhu, Weiliang; Shen, Xu; Chen, Kaixian; Jiang, Hualiang; Liu, Dongxiang

2010-02-01

Zn(2+) directly participates in catalysis of histone deacetylase (HDAC) Classes I, II, IV enzymes while its role in HDAC Class III activity is not well established. Herein we investigated the effects of Zn(2+) on the deacetylase activity of sirtuin 1 (silent mating type information regulation 2 homolog 1, SIRT1). We found that the inherent Zn(2+) at the zinc-finger motif of SIRT1 is essential for the structural integrity and the deacetylase activity of SIRT1, whereas the exogenous Zn(2+) strongly inhibits the deacetylase activity with an IC(50) of 0.82muM for Zn(Gly)(2). SIRT1 activity suppressed by the exogenous Zn(2+) can be fully recovered by the metal chelator EDTA but not by the activator resveratrol. We also identified Zn(2+) as a noncompetitive inhibitor for the substrates of NAD(+) and the acetyl peptide P53-AMC. The 8-anilino-1-naphthalenesulfonic acid (ANS) fluorescence titration experiments and site-directed mutagenesis study suggested that the exogenous Zn(2+) binds to SIRT1 but not at the zinc-finger motif. These results indicate that Zn(2+) plays a dual role in SIRT1 activity. Inherent Zn(2+) at the zinc-finger motif is structurally related and essential for SIRT1 activity. On the other hand, Zn(2+) may also bind to another site different from the zinc-finger motif or the binding sites for the substrates or resveratrol and act as a potent inhibitor of SIRT1.

Chlamydomonas Outer Arm Dynein Alters Conformation in Response to Ca2+

PubMed Central

Sakato, Miho; Sakakibara, Hitoshi

2007-01-01

We have previously shown that Ca2+ directly activates ATP-sensitive microtubule binding by a Chlamydomonas outer arm dynein subparticle containing the β and γ heavy chains (HCs). The γ HC–associated LC4 light chain is a member of the calmodulin family and binds 1-2 Ca2+ with KCa = 3 × 10−5 M in vitro, suggesting it may act as a Ca2+ sensor for outer arm dynein. Here we investigate interactions between the LC4 light chain and γ HC. Two IQ consensus motifs for binding calmodulin-like proteins are located within the stem domain of the γ heavy chain. In vitro experiments indicate that LC4 undergoes a Ca2+-dependent interaction with the IQ motif domain while remaining tethered to the HC. LC4 also moves into close proximity of the intermediate chain IC1 in the presence of Ca2+. The sedimentation profile of the γ HC subunit changed subtly upon Ca2+ addition, suggesting that the entire complex had become more compact, and electron microscopy of the isolated γ subunit revealed a distinct alteration in conformation of the N-terminal stem in response to Ca2+ addition. We propose that Ca2+-dependent conformational change of LC4 has a direct effect on the stem domain of the γ HC, which eventually leads to alterations in mechanochemical interactions between microtubules and the motor domain(s) of the outer dynein arm. PMID:17634291

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Carbohydrate binding specificity of pea lectin studied by NMR spectroscopy and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Cheong, Youngjoo; Shim, Gyuchang; Kang, Dongil; Kim, Yangmee

1999-02-01

The conformational details of Man( α1,6)Man( α)OMe are investigated through NMR spectroscopy in conjunction with molecular modeling. The lowest energy structure (M1) in the adiabatic energy map calculated with a dielectric constant of 50 has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=180°. The other low energy structure (M2) has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=-60°. Molecular dynamics simulations and NMR experiments prove that Man( α1,6)Man( α)OMe in the free form exists with conformational averaging of M1 and M2 conformers predominantly. Molecular dynamics simulations of the pea lectin-carbohydrate complex with explicit water molecules starting from the X-ray crystallographic structure of pea lectin show that the protein-carbohydrate interaction centers mainly on the hydrogen bonds and van der Waals interactions between protein and carbohydrate. From the molecular dynamics simulation, it is found that the M1 structure can bind to pea lectin better than the M2 structure. The origin of this selectivity is the water- mediated hydrogen bond interactions between the remote mannose and the binding site of pea lectin as well as the direct hydrogen bond interaction between the terminal mannose and pea lectin. Extensive networks of interactions in the carbohydrate binding site and the metal binding site are important in maintaining the carbohydrate binding properties of pea lectin. Especially, the predominant factors of mannose binding specificity of pea lectin are the hydrogen bond interactions between the 4th hydroxyl groups of the terminal sugar ring and the side chains of Asp-81 and Asn-125 in the carbohydrate binding site, and the additional interactions between these side chains of Asp-81 and Asn-125 and the calcium ion in the metal binding site of pea lectin.

DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

PubMed Central

Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

2017-01-01

APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

Rates and equilibrium constants of the ligand-induced conformational transition of an HCN ion channel protein domain determined by DEER spectroscopy.

PubMed

Collauto, Alberto; DeBerg, Hannah A; Kaufmann, Royi; Zagotta, William N; Stoll, Stefan; Goldfarb, Daniella

2017-06-14

Ligand binding can induce significant conformational changes in proteins. The mechanism of this process couples equilibria associated with the ligand binding event and the conformational change. Here we show that by combining the application of W-band double electron-electron resonance (DEER) spectroscopy with microfluidic rapid freeze quench (μRFQ) it is possible to resolve these processes and obtain both equilibrium constants and reaction rates. We studied the conformational transition of the nitroxide labeled, isolated carboxy-terminal cyclic-nucleotide binding domain (CNBD) of the HCN2 ion channel upon binding of the ligand 3',5'-cyclic adenosine monophosphate (cAMP). Using model-based global analysis, the time-resolved data of the μRFQ DEER experiments directly provide fractional populations of the open and closed conformations as a function of time. We modeled the ligand-induced conformational change in the protein using a four-state model: apo/open (AO), apo/closed (AC), bound/open (BO), bound/closed (BC). These species interconvert according to AC + L ⇌ AO + L ⇌ BO ⇌ BC. By analyzing the concentration dependence of the relative contributions of the closed and open conformations at equilibrium, we estimated the equilibrium constants for the two conformational equilibria and the open-state ligand dissociation constant. Analysis of the time-resolved μRFQ DEER data gave estimates for the intrinsic rates of ligand binding and unbinding as well as the rates of the conformational change. This demonstrates that DEER can quantitatively resolve both the thermodynamics and the kinetics of ligand binding and the associated conformational change.

Dissociation of binding and learning processes.

PubMed

Moeller, Birte; Frings, Christian

2017-11-01

A single encounter of a stimulus together with a response can result in a short-lived association between the stimulus and the response [sometimes called an event file, see Hommel, Müsseler, Aschersleben, & Prinz, (2001) Behavioral and Brain Sciences, 24, 910-926]. The repetition of stimulus-response pairings typically results in longer lasting learning effects indicating stimulus-response associations (e.g., Logan & Etherton, (1994) Journal of Experimental Psychology: Learning, Memory, and Cognition, 20, 1022-1050]. An important question is whether or not what has been described as stimulus-response binding in action control research is actually identical with an early stage of incidental learning (e.g., binding might be seen as single-trial learning). Here, we present evidence that short-lived binding effects can be distinguished from learning of longer lasting stimulus-response associations. In two experiments, participants always responded to centrally presented target letters that were flanked by response irrelevant distractor letters. Experiment 1 varied whether distractors flanked targets on the horizontal or vertical axis. Binding effects were larger for a horizontal than for a vertical distractor-target configuration, while stimulus configuration did not influence incidental learning of longer lasting stimulus-response associations. In Experiment 2, the duration of the interval between response n - 1 and presentation of display n (500 ms vs. 2000 ms) had opposing influences on binding and learning effects. Both experiments indicate that modulating factors influence stimulus-response binding and incidental learning effects in different ways. We conclude that distinct underlying processes should be assumed for binding and incidental learning effects.

Activating analytic thinking enhances the value given to individualizing moral foundations.

PubMed

Yilmaz, Onurcan; Saribay, S Adil

2017-08-01

Two central debates within Moral Foundations Theory concern (1) which moral foundations are core and (2) how conflict between ideological camps stemming from valuing different moral foundations can be resolved. Previous studies have attempted to answer the first question by imposing cognitive load on participants to direct them toward intuitive and automatic thought. However, this method has limitations and has produced mixed findings. In the present research, in two experiments, instead of directing participants toward intuitive thought, we tested the effects of activating high-effort, analytic thought on participants' moral foundations. In both experiments, analytic thought activation caused participants to value individualizing foundations greater than the control condition. This effect was not qualified by participants' political orientation. No effect was observed on binding foundations. The results are consistent with the idea that upholding individualizing foundations requires mental effort and may provide the basis for reconciliation between different ideological camps. Copyright © 2017 Elsevier B.V. All rights reserved.

Watching proteins function with picosecond X-ray crystallography and molecular dynamics simulations.

NASA Astrophysics Data System (ADS)

Anfinrud, Philip

2006-03-01

Time-resolved electron density maps of myoglobin, a ligand-binding heme protein, have been stitched together into movies that unveil with < 2-å spatial resolution and 150-ps time-resolution the correlated protein motions that accompany and/or mediate ligand migration within the hydrophobic interior of a protein. A joint analysis of all-atom molecular dynamics (MD) calculations and picosecond time-resolved X-ray structures provides single-molecule insights into mechanisms of protein function. Ensemble-averaged MD simulations of the L29F mutant of myoglobin following ligand dissociation reproduce the direction, amplitude, and timescales of crystallographically-determined structural changes. This close agreement with experiments at comparable resolution in space and time validates the individual MD trajectories, which identify and structurally characterize a conformational switch that directs dissociated ligands to one of two nearby protein cavities. This unique combination of simulation and experiment unveils functional protein motions and illustrates at an atomic level relationships among protein structure, dynamics, and function. In collaboration with Friedrich Schotte and Gerhard Hummer, NIH.

Direct measurement of torque and twist generated by a dye binding to DNA

NASA Astrophysics Data System (ADS)

Gore, Jeff; Bryant, Zev; Bustamante, Carlos

2004-03-01

Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

Rational Design of Peptide-Functionalized Surface Plasmon Resonance Sensor for Specific Detection of TNT Explosive.

PubMed

Wang, Jin; Muto, Masaki; Yatabe, Rui; Onodera, Takeshi; Tanaka, Masayoshi; Okochi, Mina; Toko, Kiyoshi

2017-09-30

In this study, a rationally-designed 2,4,6-trinitrotoluene (TNT) binding peptide derived from an amino acid sequence of the complementarity-determining region (CDR) of an anti-TNT monoclonal antibody was used for TNT detection based on a maleimide-functionalized surface plasmon resonance (SPR) sensor. By antigen-docking simulation and screening, the TNT binding candidate peptides were obtained as TNTHCDR1 derived from the heavy chain of CDR1, TNTHCDR2 derived from CDR2, and TNTHCDR3 from CDR3 of an anti-TNT antibody. The binding events between candidate peptides and TNT were evaluated using the SPR sensor by direct determination based on the 3-aminopropyltriethoxysilane (APTES) surface. The TNT binding peptide was directly immobilized on the maleimide-functionalized sensor chip surface from N-γ-maleimidobutyryl-oxysuccinimide ester (GMBS). The results demonstrated that peptide TNTHCDR3 was identified and selected as a TNT binding peptide among the other two candidate peptides. Five kinds of TNT analogues were also investigated to testify the selectivity of TNT binding peptide TNTHCDR3. Furthermore, the results indicated that the APTES-GMBS-based SPR sensor chip procedure featured a great potential application for the direct detection of TNT.

Rational Design of Peptide-Functionalized Surface Plasmon Resonance Sensor for Specific Detection of TNT Explosive

PubMed Central

Wang, Jin; Muto, Masaki; Yatabe, Rui; Onodera, Takeshi; Okochi, Mina; Toko, Kiyoshi

2017-01-01

In this study, a rationally-designed 2,4,6-trinitrotoluene (TNT) binding peptide derived from an amino acid sequence of the complementarity-determining region (CDR) of an anti-TNT monoclonal antibody was used for TNT detection based on a maleimide-functionalized surface plasmon resonance (SPR) sensor. By antigen-docking simulation and screening, the TNT binding candidate peptides were obtained as TNTHCDR1 derived from the heavy chain of CDR1, TNTHCDR2 derived from CDR2, and TNTHCDR3 from CDR3 of an anti-TNT antibody. The binding events between candidate peptides and TNT were evaluated using the SPR sensor by direct determination based on the 3-aminopropyltriethoxysilane (APTES) surface. The TNT binding peptide was directly immobilized on the maleimide-functionalized sensor chip surface from N-γ-maleimidobutyryl-oxysuccinimide ester (GMBS). The results demonstrated that peptide TNTHCDR3 was identified and selected as a TNT binding peptide among the other two candidate peptides. Five kinds of TNT analogues were also investigated to testify the selectivity of TNT binding peptide TNTHCDR3. Furthermore, the results indicated that the APTES-GMBS-based SPR sensor chip procedure featured a great potential application for the direct detection of TNT. PMID:28973962

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

NASA Astrophysics Data System (ADS)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

What Do We Learn from Binding Features? Evidence for Multilevel Feature Integration

ERIC Educational Resources Information Center

Colzato, Lorenza S.; Raffone, Antonino; Hommel, Bernhard

2006-01-01

Four experiments were conducted to investigate the relationship between the binding of visual features (as measured by their after-effects on subsequent binding) and the learning of feature-conjunction probabilities. Both binding and learning effects were obtained, but they did not interact. Interestingly, (shape-color) binding effects…

Poly(A) polymerase contains multiple functional domains.

PubMed Central

Raabe, T; Murthy, K G; Manley, J L

1994-01-01

Poly(A) polymerase (PAP) contains regions of similarity with several known protein domains. Through site-directed mutagenesis, we provide evidence that PAP contains a functional ribonucleoprotein-type RNA binding domain (RBD) that is responsible for primer binding, making it the only known polymerase to contain such a domain. The RBD is adjacent to, and probably overlaps with, an apparent catalytic region responsible for polymerization. Despite the presence of sequence similarities, this catalytic domain appears to be distinct from the conserved polymerase module found in a large number of RNA-dependent polymerases. PAP contains two nuclear localization signals (NLSs) in its C terminus, each by itself similar to the consensus bipartite NLS found in many nuclear proteins. Mutagenesis experiments indicate that both signals, which are separated by nearly 140 residues, play important roles in directing PAP exclusively to the nucleus. Surprisingly, basic amino acids in the N-terminal-most NLS are also essential for AAUAAA-dependent polyadenylation but not for nonspecific poly(A) synthesis, suggesting that this region of PAP is involved in interactions both with nuclear targeting proteins and with nuclear polyadenylation factors. The serine/threonine-rich C terminus is multiply phosphorylated, including at sites affected by mutations in either NLS. Images PMID:8164653

Lepidium meyenii (Maca) does not exert direct androgenic activities.

PubMed

Bogani, P; Simonini, F; Iriti, M; Rossoni, M; Faoro, F; Poletti, A; Visioli, F

2006-04-06

Maca is the edible root of the Peruvian plant Lepidum meyenii, traditionally employed for its purported aphrodisiac and fertility-enhancing properties. This study aimed at testing the hypothesis that Maca contains testosterone-like compounds, able to bind the human androgen receptor and promote transcription pathways regulated by steroid hormone signaling. Maca extracts (obtained with different solvents: methanol, ethanol, hexane and chloroform) are not able to regulate GRE (glucocorticoid response element) activation. Further experiments are needed to assess which compound, of the several Maca's components, is responsible of the observed in vivo effects.

Hungry irony

PubMed Central

Andrews, Nancy C.

2015-01-01

Iron-deficient individuals experience a loss of appetite that can be restored with iron supplementation. It has been proposed that iron influences the satiety hormone leptin; however, a direct link between iron and leptin has remained elusive. In this issue of the JCI, Gao and colleagues demonstrate an inverse relationship between adipocyte iron and leptin that is mediated by iron-dependent activation of cAMP-responsive element binding protein (CREB), the transcription factor that represses leptin transcription. Together, the results of this study provide a mechanistic connection between dietary iron and the appetite-regulating hormone leptin. PMID:26301806

Hungry irony.

PubMed

Andrews, Nancy C

2015-09-01

Iron-deficient individuals experience a loss of appetite that can be restored with iron supplementation. It has been proposed that iron influences the satiety hormone leptin; however, a direct link between iron and leptin has remained elusive. In this issue of the JCI, Gao and colleagues demonstrate an inverse relationship between adipocyte iron and leptin that is mediated by iron-dependent activation of cAMP-responsive element binding protein (CREB), the transcription factor that represses leptin transcription. Together, the results of this study provide a mechanistic connection between dietary iron and the appetite-regulating hormone leptin.

In vitro selection of RNA aptamer specific to Salmonella typhimurium.

PubMed

Han, Seung Ryul; Lee, Seong-Wook

2013-06-28

Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.

On-chip microlasers for biomolecular detection via highly localized deposition of a multifunctional phospholipid ink.

PubMed

Bog, Uwe; Laue, Thomas; Grossmann, Tobias; Beck, Torsten; Wienhold, Tobias; Richter, Benjamin; Hirtz, Michael; Fuchs, Harald; Kalt, Heinz; Mappes, Timo

2013-07-21

We report on a novel approach to realize on-chip microlasers, by applying highly localized and material-saving surface functionalization of passive photonic whispering gallery mode microresonators. We apply dip-pen nanolithography on a true three-dimensional structure. We coat solely the light-guiding circumference of pre-fabricated poly(methyl methacrylate) resonators with a multifunctional molecular ink. The functionalization is performed in one single fabrication step and simultaneously provides optical gain as well as molecular binding selectivity. This allows for a direct and flexible realization of on-chip microlasers, which can be utilized as biosensors in optofluidic lab-on-a-chip applications. In a proof-of-concept we show how this highly localized molecule deposition suffices for low-threshold lasing in air and water, and demonstrate the capability of the ink-lasers as biosensors in a biotin-streptavidin binding experiment.

Structural characterization of tetranortriterpenes from Pseudrocedrela kotschyi and Trichilia emetica and study of their activity towards the chaperone Hsp90.

PubMed

Piaz, Fabrizio Dal; Malafronte, Nicola; Romano, Adriana; Gallotta, Dario; Belisario, Maria Antonietta; Bifulco, Giuseppe; Gualtieri, Maria Josefine; Sanogo, Rokia; Tommasi, Nunziatina De; Pisano, Claudio

2012-03-01

Investigation of roots extracts Pseudrocedrela kotschyi and Trichilia emetica led to identification of 5 limonoid derivatives, Kotschyins D-H, and 11 known compounds. Their structures were elucidated by extensive 1D and 2D NMR experiments in conjunction with mass spectrometry. A surface plasmon resonance (SPR) approach was adopted to screen their Hsp90 binding capability and kotschyin D showed a significant affinity for the chaperone. Therefore, the characterization of the biological activity of kotschyin D by means of a panel of chemical and biological approaches, including limited proteolysis, molecular docking and biochemical and cellular assays, was performed. Our result indicated this compound as a type of client selective Hsp90 inhibitor, directly binding to the middle domain of the protein and possibly preventing its interaction with the activator of Hsp90 ATPase 1 (Aha1). Copyright © 2011 Elsevier Ltd. All rights reserved.

A sensitive capacitive immunosensor for direct detection of human heart fatty acid-binding protein (h-FABP).

PubMed

Mihailescu, Carmen-Marinela; Stan, Dana; Iosub, Rodica; Moldovan, Carmen; Savin, Mihaela

2015-01-01

The fabrication of a capacitive interdigitated immunosensor (CID) based on a mixed self-assembled monolayer (mSAM) film for the direct detection of heart fatty-acid binding protein (h-FABP) without any labeling is described. The capacitance changes of mSAMs vs. homogenous ordered self-assembled monolayers (hSAMs) on gold work electrodes/covalently bonded antibodies/buffered medium are utilized for monitoring the specific antibody-antigen interaction. Capacitance measurements in the absence and presence of Faradaic currents were performed. The electrochemical properties of mixed monolayers were compared with those of a pure monolayer of 11-mercaptoundecanoic acid (MUA) self-assembled on gold surfaces. Taking into account the stability of the studied monolayers during the electrochemical experiments with the Faradaic process, the best SAM functionalization method was used for developing a sensitive capacitive immunosensor with a non-Faradaic process for direct immune detection of human h-FABP. Under the optimized conditions, the proposed mixed self-assembled monolayer (mSAM1) on gold electrode exhibited good insulating properties such as a capacitive behavior when detecting h-FABP from human serum in the range of 98 pg ml(-1)-100 ng ml(-1), with a detection limit of 0.836 ng ml(-1) comparative with a homogenous self-assembled monolayer (hSAM). Copyright © 2014 Elsevier B.V. All rights reserved.

Functions and ATP-binding responses of the twelve histidine residues in the TF1-ATPase beta subunit.

PubMed

Tozawa, K; Yagi, H; Hisamatsu, K; Ozawa, K; Yoshida, M; Akutsu, H

2001-10-01

The C2 proton signals of all (twelve) histidine residues of the TF1 beta subunit in the 1H-NMR spectrum have been identified and assigned by means of pH change experiments and site-directed substitution of histidines by glutamines. pH and ligand titration experiments were carried out for these signals. Furthermore, the ATPase activity of the reconstituted alpha3beta3gamma complex was examined for the twelve mutant beta subunits. Two of three conserved histidines, namely, His-119 and 324, were found to be important for expression of the ATPase activity. The former fixes the N-terminal domain to the central domain. His-324 is involved in the formation of the interface essential for the alpha3beta3gamma complex assembly. The other conserved residue, His-363, showed a very low pK(a), suggesting that it is involved in the tertiary structure formation. On the binding of a nucleotide, only the signals of His-173, 179, 200, and 324 shifted. These histidines are located in the hinge region, and its proximity, of the beta subunit. This observation provided further support for the conformational change of the beta monomer from the open to the closed form on the binding of a nucleotide proposed by us [Yagi et al. (1999) Biophys. J. 77, 2175-2183]. This conformational change should be one of the essential driving forces in the rotation of the alpha3beta3gamma complex.

Multisensory Motion Perception in 3–4 Month-Old Infants

PubMed Central

Nava, Elena; Grassi, Massimo; Brenna, Viola; Croci, Emanuela; Turati, Chiara

2017-01-01

Human infants begin very early in life to take advantage of multisensory information by extracting the invariant amodal information that is conveyed redundantly by multiple senses. Here we addressed the question as to whether infants can bind multisensory moving stimuli, and whether this occurs even if the motion produced by the stimuli is only illusory. Three- to 4-month-old infants were presented with two bimodal pairings: visuo-tactile and audio-visual. Visuo-tactile pairings consisted of apparently vertically moving bars (the Barber Pole illusion) moving in either the same or opposite direction with a concurrent tactile stimulus consisting of strokes given on the infant’s back. Audio-visual pairings consisted of the Barber Pole illusion in its visual and auditory version, the latter giving the impression of a continuous rising or ascending pitch. We found that infants were able to discriminate congruently (same direction) vs. incongruently moving (opposite direction) pairs irrespective of modality (Experiment 1). Importantly, we also found that congruently moving visuo-tactile and audio-visual stimuli were preferred over incongruently moving bimodal stimuli (Experiment 2). Our findings suggest that very young infants are able to extract motion as amodal component and use it to match stimuli that only apparently move in the same direction. PMID:29187829

External electric field effect on the binding energy of a hydrogenic donor impurity in InGaAsP/InP concentric double quantum rings

NASA Astrophysics Data System (ADS)

Hu, Min; Wang, Hailong; Gong, Qian; Wang, Shumin

2018-04-01

Within the framework of effective-mass envelope-function theory, the ground state binding energy of a hydrogenic donor impurity is calculated in the InGaAsP/InP concentric double quantum rings (CDQRs) using the plane wave method. The effects of geometry, impurity position, external electric field and alloy composition on binding energy are considered. It is shown that the peak value of the binding energy appears in two rings with large gap as the donor impurity moves along the radial direction. The binding energy reaches the peak value at the center of ring height when the donor impurity moves along the axial direction. The binding energy shows nonlinear variation with the increase of ring height. With the external electric field applied along the z-axis, the binding energy of the donor impurity located at zi ≥ 0 decreases while that located at zi < 0 increases. In addition, the binding energy decreases with increasing Ga composition, but increases with the increasing As composition.

Relative binding affinities of monolignols to horseradish peroxidase

DOE PAGES

Sangha, Amandeep K.; Petridis, Loukas; Cheng, Xiaolin; ...

2016-07-22

Monolignol binding to the peroxidase active site is the first step in lignin polymerization in plant cell walls. Using molecular dynamics, docking, and free energy perturbation calculations, we investigate the binding of monolignols to horseradish peroxidase C. Our results suggest that p-coumaryl alcohol has the strongest binding affinity followed by sinapyl and coniferyl alcohol. Stacking interactions between the monolignol aromatic rings and nearby phenylalanine residues play an important role in determining the calculated relative binding affinities. p-Coumaryl and coniferyl alcohols bind in a pose productive for reaction in which a direct H-bond is formed between the phenolic –OH group andmore » a water molecule (W2) that may facilitate proton transfer during oxidation. In contrast, in the case of sinapyl alcohol there is no such direct interaction, the phenolic –OH group instead interacting with Pro139. Furthermore, since proton and electron transfer is the rate-limiting step in monolignol oxidation by peroxidase, the binding pose (and thus the formation of near attack conformation) appears to play a more important role than the overall binding affinity in determining the oxidation rate.« less

Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site.

PubMed

Braunger, J; Schleithoff, L; Schulz, A S; Kessler, H; Lammers, R; Ullrich, A; Bartram, C R; Janssen, J W

1997-06-05

Ufo/Axl belongs to a new family of receptor tyrosine kinases with an extracellular structure similar to that of neural cell adhesion molecules. In order to elucidate intracellular signaling, the cytoplasmic moiety of Ufo/Axl was used to screen an expression library according to the CORT (cloning of receptor targets) method. Three putative Ufo substrates were identified: phospholipase Cgamma1 (PLCgamma), as well as p85alpha and p85beta subunits of phosphatidylinositol 3'-kinase (PI3-kinase). Subsequently, chimeric EGFR/Ufo receptors consisting of the extracellular domains of the epidermal growth factor receptor (EGFR) and the transmembrane and intracellular moiety of Ufo were engineered. Using different far-Western blot analyses and coimmunoprecipitation assays, receptor binding of PLCgamma and p85 proteins as well as GRB2, c-src and lck was examined in vitro and in vivo. Competitive inhibition of substrate binding and mutagenesis experiments with EGFR/Ufo constructs revealed C-terminal tyrosine 821 (EILpYVNMDEG) as a docking site for multiple effectors, namely PLCgamma, p85 proteins, GRB2, c-src and lck. Tyrosine 779 (DGLpYALMSRC) demonstrated an additional, but lower binding affinity for the p85 proteins in vitro. In addition, binding of PLCgamma occurred through tyrosine 866 (AGRpYVLCPST). Moreover, our in vivo data indicate that further direct or indirect binding sites for PLCgamma, GRB2, c-src and lck on the human Ufo receptor may exist.

Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements.

PubMed

Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit

2015-03-09

We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

Theory of long binding events in single-molecule–controlled rotation experiments on F1-ATPase

PubMed Central

Volkán-Kacsó, Sándor; Marcus, Rudolph A.

2017-01-01

The theory of elastic group transfer for the binding and release rate constants for nucleotides in F1-ATPase as a function of the rotor angle is further extended in several respects. (i) A method is described for predicting the experimentally observed lifetime distribution of long binding events in the controlled rotation experiments by taking into account the hydrolysis and synthesis reactions occurring during these events. (ii) A method is also given for treating the long binding events in the experiments and obtaining the rate constants for the hydrolysis and synthesis reactions occurring during these events. (iii) The theory in the previous paper is given in a symmetric form, an extension that simplifies the application of the theory to experiments. It also includes a theory-based correction of the reported “on” and “off” rates by calculating the missed events. A near symmetry of the data about the angle of −40° and a “turnover” in the binding rate data vs. rotor angle for angles greater than ∼40° is also discussed. PMID:28652332

Nature of the high-binding-energy dip in the low-temperature photoemission spectra of Bi2Sr2CaCu2O8+δ

NASA Astrophysics Data System (ADS)

Dessau, D. S.; Shen, Z.-X.; Wells, B. O.; King, D. M.; Spicer, W. E.; Arko, A. J.; Lombardo, L. W.; Mitzi, D. B.; Kapitulnik, A.

1992-03-01

At the transition to superconductivity, an anomalous high-binding-energy (~=-90 meV) dip appears in the low-temperature photoemission spectra taken along the Γ-M¯ high-symmetry direction of Bi2Sr2CaCu2O8+δ. This paper details experiments which further characterize the energy and k-space dependence of this dip structure. The dip occurs over a wide portion of the Γ-M¯ zone diagonal (110), yet shows minimal energy dispersion. In the spectra taken along the Γ-X zone edge (100), the dip is very weak or not present. We show that these results imply that the dip is not an artifact dependent on the experiment or special features of the band structure and therefore is an intrinsic feature of the superconducting state of Bi2Sr2CaCu2O8+δ. The behavior of the normal-state bands along Γ-M¯ in relation to the local-density-approximation prediction of a Bi-O-based electron ``pocket'' is also discussed, with our data explained most naturally if the Bi-O band remains above the Fermi level for all k.

Direct replacement of antibodies with molecularly imprinted polymer (MIP) nanoparticles in ELISA – development of a novel assay for vancomycin

PubMed Central

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J. Sarah; Piletska, Elena V.; Perez De Vargas Sansalvador, Isabel M.; Whitcombe, Michael J.; Piletsky, Sergey A.

2016-01-01

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop ELISA type assays is presented here for the first time. NanoMIPs were synthesized by a solid phase approach with immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering and electron microscopy. Immobilization, blocking and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a HRP-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was three orders of magnitude better than a previously described ELISA based on antibodies. In these experiments nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA. PMID:23947402

Specificity in cationic interaction with poly(N-isopropylacrylamide).

PubMed

Du, Hongbo; Wickramasinghe, Sumith Ranil; Qian, Xianghong

2013-05-02

Classical molecular dynamics (MD) simulations were conducted for PNIPAM in 1 M monovalent alkali chloride salt solutions as well as in 0.5 M divalent Mg(2+) and Ca(2+) chloride salt solutions. It was found that the strength for the direct alkali ion-amide O binding is strongly correlated with the size of the ionic radius. The smallest Li(+) ion binds strongest to amide O, and the largest Cs(+) ion has the weakest interaction with the amide bond. For the divalent Mg(2+) and Ca(2+) ions, their interactions with the amide bond are weak and appear to be mediated by the water molecules, particularly in the case of Mg(2+), resulting from their strong hydration. The direct binding between the cations and amide O requires partial desovlation of the ions that is energetically unfavorable for Mg(2+) and also to a great extent for Ca(2+). The higher cation charge makes the electrostatic interaction more favorable but the dehydration process less favorable. This competition between electrostatic interaction and the dehydration process largely dictates whether the direct binding between the cation and amide O is energetically preferred or not. For monovalent alkali ions, it is energetically preferred to bind directly with the amide O. Moreover, Li(+) ion is also found to associate strongly with the hydrophobic residues on PNIPAM.

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

The ebolavirus VP24 interferon antagonist

PubMed Central

Zhang, Adrianna P.P.; Abelson, Dafna M.; Bornholdt, Zachary A.; Liu, Tong; Woods, Jr, Virgil L.; Saphire, Erica Ollmann

2012-01-01

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways.1,2 The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation.3 A more recent discovery is that VP24 also binds STAT1 directly,4 suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses. PMID:23076242

Force fields for describing the solution-phase synthesis of shape-selective metal nanoparticles

NASA Astrophysics Data System (ADS)

Zhou, Ya; Al-Saidi, Wissam; Fichthorn, Kristen

2013-03-01

Polyvinylpyrrolidone (PVP) and polyethylene oxide (PEO) are structure-directing agents that exhibit different performance in the polyol synthesis of Ag nanostructures. The success of these structure-directing agents in selective nanostructure synthesis is often attributed to their selective binding to Ag(100) facets. We use first-principles, density-functional theory (DFT) calculations in a vacuum environment to show that PVP has a stronger preference to bind to Ag(100) than to Ag(111), whereas PEO exhibits much weaker selectivity. To understand the role of solvent in the surface-sensitive binding, we develop classical force fields to describe the interactions of the structure-directing (PVP and PEO) and solvent (ethylene glycol) molecules with various Ag substrates. We parameterize the force fields through force-and-energy matching to DFT results using simulated annealing. We validate the force fields by comparisons to DFT and experimental binding energies. Our force fields reproduce the surface-sensitive binding predicted by DFT calculations. Molecular dynamics simulations based on these force fields can be used to reveal the role of solvent, polymer chain length, and polymer concentration in the selective synthesis of Ag nanostructures.

RNA binding protein Lin28B confers gastric cancer cells stemness via directly binding to NRP-1.

PubMed

Wang, Xiaocong; Hu, Huihua; Liu, Hebo

2018-05-19

This work aims to explore the roles and related mechanisms of RNA binding protein Lin28B in gastric cancer cells stemness. We found that Lin28B expression was negatively correlated with the overall survival (OS) of gastric cancer patients, and significantly increased in gastric cancer cells compared with that in gastric epithelial cells. Lin28B overexpression increased spheroid formation, expression of gastric cancer stemness-related markers, and decreased cisplatin sensitivity in gastric cancer cells. Mechanistically, Lin28B could directly bind to NRP-1 3'UTR, thus increasing NRP-1 mRNA stability and expression, and activate the downstream Wnt/β-catenin signaling. Knockdown of NRP-1 or treatment with Wnt/β-catenin antagonist could rescue the promotive effects of Lin28B on gastric cancer stemness. Thus, thes results indicate that Lin28B could facilitate gastric cancer stemness via directly binding to NRP-1 3'UTR and activating the downstream Wnt/β-catenin signaling. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

The ebolavirus VP24 interferon antagonist: know your enemy.

PubMed

Zhang, Adrianna P P; Abelson, Dafna M; Bornholdt, Zachary A; Liu, Tong; Woods, Virgil L; Saphire, Erica Ollmann

2012-08-15

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways. The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation. A more recent discovery is that VP24 also binds STAT1 directly, suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses.

Interaction of Tl +3 with mononucleotides: metal ion binding and sugar conformation

NASA Astrophysics Data System (ADS)

Nafisi, Sh.; Mohajerani, N.; Hadjiakhoondi, A.; Monajemi, M.; Garib, F.

2001-05-01

The interaction of Tl 3+ with sodium salts of adenosine-5'-monophosphate (5'-AMP), guanosine-5'-monophosphate (5'-GMP), cytidine-5'-monophosphate (5'-CMP), thymidine 5'-monophosphate (5'-dTMP) in ratios 1 and 2 have been studied in neutral pH. The solid complexes were isolated and characterized by Fourier transform infrared (FTIR) and 1H NMR spectroscopy. In the Tl 2(AMP) 3, Tl 3+ binds directly to N-7 and indirectly to the N-1 position of the pyrimidine ring and phosphate group with sugar moiety in C2'-endoanti. The crystalline salt of Tl 2(GMP) 3 show direct Tl-N-7 and Tl-PO 3(inner-sphere) binding. The conformation of ribose moiety in Tl 2(GMP) 3 is C3'-endoanti. In the Tl 2(CMP) 3, Tl 3+ bind directly to N-3 and PO32- (inner-sphere). The conformation of ribose moiety in Tl 2(CMP) 3 is C2'-endoanti. In the Tl 2(dTMP) 3, Tl 3+ bind indirectly to carbonyl group. The sugar moiety in Tl 2(dTMP) 3 is C3'-endoanti.

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

PubMed Central

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.

2015-01-01

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeastSaccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)]in vitroandin vivoand that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8more » is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation.« less

MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

PubMed

Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

2017-01-01

Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

Neuroscience: toward unbinding the binding problem.

PubMed

Whitney, David

2009-03-24

How the brain 'binds' information to create a coherent perceptual experience is an enduring question. Recent research in the psychophysics of perceptual binding and developments in fMRI analysis techniques are bringing us closer to an understanding of how the brain solves the binding problem.

The Binding Constant of Estradiol to Bovine Serum Albumin: An Upper-Level Experiment Utilizing Tritium-Labeled Estradiol and Liquid Scintillation Counting

ERIC Educational Resources Information Center

Peihong Liang; Adhyaru, Bhavin; Pearson, Wright L.; Williams, Kathryn R.

2006-01-01

The experiment used [to the third power]H-labeled estradiol to determine the binding constant of estradiol to bovine serum albumin. Estradiol must complex with serum proteins for the transport in the blood stream because of its low solubility in aqueous systems and estradiol-protein binding constant, where K[subscript B] is important to understand…

Using affinity capillary electrophoresis and computational models for binding studies of heparinoids with p-selectin and other proteins.

PubMed

Mozafari, Mona; Balasupramaniam, Shantheya; Preu, Lutz; El Deeb, Sami; Reiter, Christian G; Wätzig, Hermann

2017-06-01

A fast and precise affinity capillary electrophoresis (ACE) method has been developed and applied for the investigation of the binding interactions between P-selectin and heparinoids as potential P-selectin inhibitors in the presence and absence of calcium ions. Furthermore, model proteins and vitronectin were used to appraise the binding behavior of P-selectin. The normalized mobility ratios (∆R/R f ), which provided information about the binding strength and the overall charge of the protein-ligand complex, were used to evaluate the binding affinities. It was found that P-selectin interacts more strongly with heparinoids in the presence of calcium ions. P-selectin was affected by heparinoids at the concentration of 3 mg/L. In addition, the results of the ACE experiments showed that among other investigated proteins, albumins and vitronectin exhibited strong interactions with heparinoids. Especially with P-selectin and vitronectin, the interaction may additionally induce conformational changes. Subsequently, computational models were applied to interpret the ACE experiments. Docking experiments explained that the binding of heparinoids on P-selectin is promoted by calcium ions. These docking models proved to be particularly well suited to investigate the interaction of charged compounds, and are therefore complementary to ACE experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ligand-receptor binding affinities from saturation transfer difference (STD) NMR spectroscopy: the binding isotherm of STD initial growth rates.

PubMed

Angulo, Jesús; Enríquez-Navas, Pedro M; Nieto, Pedro M

2010-07-12

The direct evaluation of dissociation constants (K(D)) from the variation of saturation transfer difference (STD) NMR spectroscopy values with the receptor-ligand ratio is not feasible due to the complex dependence of STD intensities on the spectral properties of the observed signals. Indirect evaluation, by competition experiments, allows the determination of K(D), as long as a ligand of known affinity is available for the protein under study. Herein, we present a novel protocol based on STD NMR spectroscopy for the direct measurements of receptor-ligand dissociation constants (K(D)) from single-ligand titration experiments. The influence of several experimental factors on STD values has been studied in detail, confirming the marked impact on standard determinations of protein-ligand affinities by STD NMR spectroscopy. These factors, namely, STD saturation time, ligand residence time in the complex, and the intensity of the signal, affect the accumulation of saturation in the free ligand by processes closely related to fast protein-ligand rebinding and longitudinal relaxation of the ligand signals. The proposed method avoids the dependence of the magnitudes of ligand STD signals at a given saturation time on spurious factors by constructing the binding isotherms using the initial growth rates of the STD amplification factors, in a similar way to the use of NOE growing rates to estimate cross relaxation rates for distance evaluations. Herein, it is demonstrated that the effects of these factors are cancelled out by analyzing the protein-ligand association curve using STD values at the limit of zero saturation time, when virtually no ligand rebinding or relaxation takes place. The approach is validated for two well-studied protein-ligand systems: the binding of the saccharides GlcNAc and GlcNAcbeta1,4GlcNAc (chitobiose) to the wheat germ agglutinin (WGA) lectin, and the interaction of the amino acid L-tryptophan to bovine serum albumin (BSA). In all cases, the experimental K(D) measured under different experimental conditions converged to the thermodynamic values. The proposed protocol allows accurate determinations of protein-ligand dissociation constants, extending the applicability of the STD NMR spectroscopy for affinity measurements, which is of particular relevance for those proteins for which a ligand of known affinity is not available.

RanGTPase regulates the interaction between the inner nuclear membrane proteins, Samp1 and Emerin.

PubMed

Vijayaraghavan, Balaje; Figueroa, Ricardo A; Bergqvist, Cecilia; Gupta, Amit J; Sousa, Paulo; Hallberg, Einar

2018-06-01

Samp1, spindle associated membrane protein 1, is a type II integral membrane protein localized in the inner nuclear membrane. Recent studies have shown that the inner nuclear membrane protein, Emerin and the small monomeric GTPase, Ran are direct binding partners of Samp1. Here we addressed the question whether Ran could regulate the interaction between Samp1 and Emerin in the inner nuclear membrane. To investigate the interaction between Samp1 and Emerin in live cells, we performed FRAP experiments in cells overexpressing YFP-Emerin. We compared the mobility of YFP-Emerin in Samp1 knock out cells and cells overexpressing Samp1. The results showed that the mobility of YFP-Emerin was higher in Samp1 knock out cells and lower in cells overexpressing Samp1, suggesting that Samp1 significantly attenuates the mobility of Emerin in the nuclear envelope. FRAP experiments using tsBN2 cells showed that the mobility of Emerin depends on RanGTP. Consistently, in vitro binding experiments showed that the affinity between Samp1 and Emerin is decreased in the presence of Ran, suggesting that Ran attenuates the interaction between Samp1 and Emerin. This is the first demonstration that Ran can regulate the interaction between two proteins in the nuclear envelope. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Binding constants of membrane-anchored receptors and ligands depend strongly on the nanoscale roughness of membranes.

PubMed

Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

2013-09-17

Cell adhesion and the adhesion of vesicles to the membranes of cells or organelles are pivotal for immune responses, tissue formation, and cell signaling. The adhesion processes depend sensitively on the binding constant of the membrane-anchored receptor and ligand proteins that mediate adhesion, but this constant is difficult to measure in experiments. We have investigated the binding of membrane-anchored receptor and ligand proteins with molecular dynamics simulations. We find that the binding constant of the anchored proteins strongly decreases with the membrane roughness caused by thermally excited membrane shape fluctuations on nanoscales. We present a theory that explains the roughness dependence of the binding constant for the anchored proteins from membrane confinement and that relates this constant to the binding constant of soluble proteins without membrane anchors. Because the binding constant of soluble proteins is readily accessible in experiments, our results provide a useful route to compute the binding constant of membrane-anchored receptor and ligand proteins.

Differential Mechanisms of Activation of the Ang Peptide Receptors AT1, AT2, and MAS: Using In Silico Techniques to Differentiate the Three Receptors

PubMed Central

Prokop, Jeremy W.; Santos, Robson A. S.; Milsted, Amy

2013-01-01

The renin-angiotensin system is involved in multiple conditions ranging from cardiovascular disorders to cancer. Components of the pathway, including ACE, renin and angiotensin receptors are targets for disease treatment. This study addresses three receptors of the pathway: AT1, AT2, and MAS and how the receptors are similar and differ in activation by angiotensin peptides. Combining biochemical and amino acid variation data with multiple species sequence alignments, structural models, and docking site predictions allows for visualization of how angiotensin peptides may bind and activate the receptors; allowing identification of conserved and variant mechanisms in the receptors. MAS differs from AT1 favoring Ang-(1–7) and not Ang II binding, while AT2 recently has been suggested to preferentially bind Ang III. A new model of Ang peptide binding to AT1 and AT2 is proposed that correlates data from site directed mutagenesis and photolabled experiments that were previously considered conflicting. Ang II binds AT1 and AT2 through a conserved initial binding mode involving amino acids 111 (consensus 325) of AT1 (Asn) interacting with Tyr (4) of Ang II and 199 and 256 (consensus 512 and 621, a Lys and His respectively) interacting with Phe (8) of Ang II. In MAS these sites are not conserved, leading to differential binding and activation by Ang-(1–7). In both AT1 and AT2, the Ang II peptide may internalize through Phe (8) of Ang II propagating through the receptors’ conserved aromatic amino acids to the final photolabled positioning relative to either AT1 (amino acid 294, Asn, consensus 725) or AT2 (138, Leu, consensus 336). Understanding receptor activation provides valuable information for drug design and identification of other receptors that can potentially bind Ang peptides. PMID:23755216

Clinicians' Experience with and Attitudes toward Discussing Advance Directives with Terminally Ill Patients and Their Families in a Chinese Community.

PubMed

Luk, Yan; Ngai, Cheong; Chau, Shi San; Lam, Ming Yin Alison; Wong, On Wai; Holm, Marianne

2015-09-01

Although advance directives (ADs) are already exercised in many Western countries, cultural differences surrounding death and dying may potentially pose challenges to the implementation of ADs in a Chinese community. It is therefore relevant to explore the experience with and attitudes towards ADs of health care professionals, who are trained in Western medicine but working in a Chinese cultural setting. Hong Kong represents a unique setting for this. The study objective was to evaluate clinicians' experience with and attitudes towards discussing ADs with terminally ill patients and their families. In this descriptive pilot study, we conducted a cross-sectional questionnaire survey among doctors working in the largest teaching hospital at the University of Hong Kong. Seventy-seven out of 269 doctors working in the surveyed departments completed the questionnaire. The majority of participants (n=72; 94%) indicated willingness to initiate discussions about ADs and 62% (n=48) supported the AD to be recognized as a legally binding document but only 49% (n=38) had past experience of such discussions. Clinicians were generally receptive of the concept of the AD, willing to practice it clinically, and supported its legal recognition. However, AD discussions were an infrequent encounter, hence many clinicians lack experience and are unfamiliar with relevant guidelines. Large-scale studies within the health care professions as well as qualitative studies further exploring potential barriers should follow.

Evaluation of Phosphatidylserine-Binding Peptides Radiolabeled with Fluorine 18 for in vivo Imaging of Apoptosis

NASA Astrophysics Data System (ADS)

Kapty, Janice Sarah

We currently do not have a clinical method to directly assess apoptosis induced by cancer therapies. Phosphatidylserine (PS) is an attractive target for imaging apoptosis since it is on the exterior of the apoptotic cells and PS externalization is an early marker of apoptosis. PS-binding peptides are an attractive option for developing an imaging probe to detect apoptosis using positron emission tomography. In this study we evaluated binding characteristics of PS-binding peptides for ability to bind to PS, radiolabeled PS-binding peptides with fluorine-18, and performed in vitro and in vivo analysis of 18F radiolabeled PS-binding peptides including biodistribution analysis and dynamic PET imaging in a murine tumor model of apoptosis. Four peptides were evaluated for PS binding characteristics using a plate based assay system, a liposome mimic of cell membrane PS presentation, and a cell assay of apoptosis. The results indicate that all four peptides bind to PS and are specific to apoptotic cells. The widely used 18 F prosthetic group N-succinimidyl-4-[18F]fluorobenzoate ([18F]SFB) and the recently developed N-[6-(4-[ 18F]fluorobenzylidene) aminooxyhexyl]maleimide ([18F]FBAM) were investigated for radiolabeling of two representative phosphatidylserine-binding peptides. The prosthetic groups were compared with respect to required reaction conditions for optimum labeling, radiolabeling yield and chemoselectivity. The N-terminus labeled product produced by reaction of [18F]SFB with binding peptide LIKKPF was produced in 18% radiochemical yield while no N-terminus labeled product could be isolated following [18F]SFB reaction with PDGLSR. When the peptides were modified by addition of a cysteine residue at the N-terminus they provided almost quantitative radiochemical yields with [18F]FBAM. Results indicate that for the peptides in this study, [18F]FBAM is a more useful prosthetic group compared to [18F]SFB due to its excellent chemo-selectivity and high radiochemical yield. We report the first experiments where PS-binding peptides were radiolabeled with 18F and evaluated as possible radiotracers for imaging apoptosis. We investigated two radio-peptides ([ 18F]FBAM-CLIKKPF and [18F]FBAM-CPGDLSR) in vitro and in vivo as possible radiotracers able to bind to apoptotic cells and to image chemotherapy induced apoptosis.

Clinical role of protein binding of quinolones.

PubMed

Bergogne-Bérézin, Eugénie

2002-01-01

Protein binding of antibacterials in plasma and tissues has long been considered a component of their pharmacokinetic parameters, playing a potential role in distribution, excretion and therapeutic effectiveness. Since the beginning of the 'antibacterial era', this factor has been extensively analysed for all antibacterial classes, showing that wide variations of the degree of protein binding occur even in the same antibacterial class, as with beta-lactams. As the understanding of protein binding grew, the complexity of the binding system was increasingly perceived and its dynamic character described. Studies of protein binding of the fluoroquinolones have shown that the great majority of these drugs exhibit low protein binding, ranging from approximately 20 to 40% in plasma, and that they are bound predominantly to albumin. The potential role in pharmacokinetics-pharmacodynamics of binding of fluoroquinolones to plasma, tissue and intracellular proteins has been analysed, but it has not been established that protein binding has any significant direct or indirect impact on therapeutic effectiveness. Regarding the factors influencing the tissue distribution of antibacterials, physicochemical characteristics and the small molecular size of fluoroquinolones permit a rapid penetration into extravascular sites and intracellularly, with a rapid equilibrium being established between intravascular and extravascular compartments. The high concentrations of these drugs achieved in tissues, body fluids and intracellularly, in addition to their wide antibacterial spectrum, mean that fluoroquinolones have therapeutic effectiveness in a large variety of infections. The tolerability of quinolones has generally been reported as good, based upon long experience in using pefloxacin, ciprofloxacin and ofloxacin in clinical practice. Among more recently developed molecules, good tolerability has been reported for levofloxacin, moxifloxacin and gatifloxacin, but certain other new compounds have been removed from the market because of renal, hepatic and cardiac toxicity. To what extent the protein binding of fluoroquinolones can play a role in their tolerability is unclear. In terms of drug-drug interactions, the role of protein binding is questionable: several drug combinations can be responsible for toxicity, such as with beta-lactams, metronidazole, theophylline, nonsteroidal anti-inflammatory agents or a series of drugs used for cardiac diseases, but protein binding does not seem to be involved in these interactions. In conclusion, protein binding of fluoroquinolones appears to be a complex phenomenon, but has no clear role in therapeutic effectiveness or toxicity.

Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

PubMed

Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

1992-04-01

Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common feature which defines the capacity of these elements to confer T3 induction.

Occupancy of a C2-C2 type 'zinc-finger' protein domain by copper. Direct observation by electrospray ionization mass spectrometry.

PubMed

Hutchens, T W; Allen, M H; Li, C M; Yip, T T

1992-09-07

The metal ion specificity of most 'zinc-finger' metal binding domains is unknown. The human estrogen receptor protein contains two different C2-C2 type 'zinc-finger' sequences within its DNA-binding domain (ERDBD). Copper inhibits the function of this protein by mechanisms which remain unclear. We have used electrospray ionization mass spectrometry to evaluate directly the 71-residue ERDBD (K180-M250) in the absence and presence of Cu(II) ions. The ERDBD showed a high affinity for Cu and was completely occupied with 4 Cu bound; each Cu ion was evidently bound to only two ligand residues (net loss of only 2 Da per bound Cu). The Cu binding stoichiometry was confirmed by atomic absorption. These results (i) provide the first direct physical evidence for the ability of the estrogen receptor DNA-binding domain to bind Cu and (ii) document a twofold difference in the Zn- and Cu-binding capacity. Differences in the ERDBD domain structure with bound Zn and Cu are predicted. Given the relative intracellular contents of Zn and Cu, our findings demonstrate the need to investigate further the Cu occupancy of this and other zinc-finger domains both in vitro and in vivo.

Relational and conjunctive binding functions dissociate in short-term memory.

PubMed

Parra, Mario A; Fabi, Katia; Luzzi, Simona; Cubelli, Roberto; Hernandez Valdez, Maria; Della Sala, Sergio

2015-02-01

Remembering complex events requires binding features within unified objects (conjunctions) and holding associations between objects (relations). Recent studies suggest that the two functions dissociate in long-term memory (LTM). Less is known about their functional organization in short-term memory (STM). The present study investigated this issue in patient AE affected by a stroke which caused damage to brain regions known to be relevant for relational functions both in LTM and in STM (i.e., the hippocampus). The assessment involved a battery of standard neuropsychological tasks and STM binding tasks. One STM binding task (Experiment 1) presented common objects and common colors forming either pairs (relations) or integrated objects (conjunctions). Free recall of relations or conjunctions was assessed. A second STM binding task used random polygons and non-primary colors instead (Experiment 2). Memory was assessed by selecting the features that made up the relations or the conjunctions from a set of single polygons and a set of single colors. The neuropsychological assessment revealed impaired delayed memory in AE. AE's pronounced relational STM binding deficits contrasted with his completely preserved conjunctive binding functions in both Experiments 1 and 2. Only 2.35% and 1.14% of the population were expected to have a discrepancy more extreme than that presented by AE in Experiments 1 and 2, respectively. Processing relations and conjunctions of very elementary nonspatial features in STM led to dissociating performances in AE. These findings may inform current theories of memory decline such as those linked to cognitive aging.

Free energy simulations and MM-PBSA analyses on the affinity and specificity of steroid binding to antiestradiol antibody.

PubMed

Laitinen, Tuomo; Kankare, Jussi A; Peräkylä, Mikael

2004-04-01

Antiestradiol antibody 57-2 binds 17beta-estradiol (E2) with moderately high affinity (K(a) = 5 x 10(8) M(-1)). The structurally related natural estrogens estrone and estriol as well synthetic 17-deoxy-estradiol and 17alpha-estradiol are bound to the antibody with 3.7-4.9 kcal mol(-1) lower binding free energies than E2. Free energy perturbation (FEP) simulations and the molecular mechanics-Poisson-Boltzmann surface area (MM-PBSA) method were applied to investigate the factors responsible for the relatively low cross-reactivity of the antibody with these four steroids, differing from E2 by the substituents of the steroid D-ring. In addition, computational alanine scanning of the binding site residues was carried out with the MM-PBSA method. Both the FEP and MM-PBSA methods reproduced the experimental relative affinities of the five steroids in good agreement with experiment. On the basis of FEP simulations, the number of hydrogen bonds formed between the antibody and steroids, which varied from 0 to 3 in the steroids studied, determined directly the magnitude of the steroid-antibody interaction free energies. One hydrogen bond was calculated to contribute about 3 kcal mol(-1) to the interaction energy. Because the relative binding free energies of estrone (two antibody-steroid hydrogen bonds), estriol (three hydrogen bonds), 17-deoxy-estradiol (no hydrogen bonds), and 17alpha-estradiol (two hydrogen bonds) are close to each other and clearly lower than that of E2 (three hydrogen bonds), the water-steroid interactions lost upon binding to the antibody make an important contribution to the binding free energies. The MM-PBSA calculations showed that the binding of steroids to the antiestradiol antibody is driven by van der Waals interactions, whereas specificity is solely due to electrostatic interactions. In addition, binding of steroids to the antiestradiol antibody 57-2 was compared to the binding to the antiprogesterone antibody DB3 and antitestosterone antibody 3-C4F5, studied earlier with the MM-PBSA method. Copyright 2004 Wiley-Liss, Inc.

Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

PubMed

Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

2010-01-01

The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

Stopped in its tracks: negative regulation of the dynein motor by the yeast protein She1

PubMed Central

Moore, Jeffrey K.

2013-01-01

Summary How do cells direct the microtubule motor protein dynein to move cellular components to the right place at the right time? Recent studies in budding yeast shed light on a new mechanism for directing dynein, involving the protein She1. She1 restricts where and when dynein moves the nucleus and mitotic spindle. Experiments with purified proteins show that She1 binds to microtubules and inhibits dynein by stalling the motor on its track. Here I describe what we have learned so far about She1, based on a combination of genetic, cell biology, and biophysical approaches. These findings set the stage for further interrogation of the She1 mechanism, and raise the question of whether similar mechanisms exist in other species. PMID:23666903

Towards the elucidation of molecular determinants of cooperativity in the liver bile acid binding protein.

PubMed

Pedò, Massimo; D'Onofrio, Mariapina; Ferranti, Pasquale; Molinari, Henriette; Assfalg, Michael

2009-11-15

Bile acid binding proteins (BABPs) are cytosolic lipid chaperones contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Liver BABPs act in parallel with ileal transporters to ensure vectorial transport of bile salts in hepatocytes and enterocytes, respectively. We describe the investigation of ligand binding to liver BABP, an essential step in the understanding of intracellular bile salt transport. Binding site occupancies were monitored in NMR titration experiments using (15)N-labelled ligand, while the relative populations of differently bound BABP forms were assessed by mass spectrometry. This site-specific information allowed the determination of intrinsic thermodynamic parameters and the identification of an extremely high cooperativity between two binding sites. Protein-observed NMR experiments revealed a global structural rearrangement which suggests an allosteric mechanism at the basis of the observed cooperativity. The view of a molecular tool capable of buffering against significant concentrations of free bile salts in a large range of solution conditions emerges from the observed pH-dependence of binding. We set to determine the molecular determinants of cooperativity by analysing the binding properties of a protein containing a mutated internal histidine. Both mass spectrometry and NMR experiments are consistent with an overall decreased binding affinity of the mutant, while the measured diffusion coefficients of ligand species reveal that the affinity loss concerns essentially one of the two binding sites. We therefore identified a mutation able to disrupt energetic communication functional to efficient binding and conclude that the buried histidine establishes contacts that stabilize the ternary complex. 2009 Wiley-Liss, Inc.

Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

NASA Astrophysics Data System (ADS)

Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

2016-06-01

Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

PubMed

Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

2006-11-01

The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

The Phosphorylation of Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2) by Engineered Surfaces with Electrostatically or Covalently Immobilized VEGF

PubMed Central

Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana

2010-01-01

Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581

High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors.

PubMed Central

Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G

1993-01-01

The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090

Multifunctional centromere binding factor 1 is essential for chromosome segregation in the human pathogenic yeast Candida glabrata.

PubMed

Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J

2001-08-01

The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.

Electrostatically Biased Binding of Kinesin to Microtubules

PubMed Central

Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

2011-01-01

The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

2014-02-01

The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

Huntingtin interacting protein 1 (HIP1) regulates clathrin assembly through direct binding to the regulatory region of the clathrin light chain.

PubMed

Legendre-Guillemin, Valerie; Metzler, Martina; Lemaire, Jean-Francois; Philie, Jacynthe; Gan, Lu; Hayden, Michael R; McPherson, Peter S

2005-02-18

Huntingtin interacting protein 1 (HIP1) is a component of clathrin coats. We previously demonstrated that HIP1 promotes clathrin assembly through its central helical domain, which binds directly to clathrin light chains (CLCs). To better understand the relationship between CLC binding and clathrin assembly we sought to dissect this interaction. Using C-terminal deletion constructs of the HIP1 helical domain, we identified a region between residues 450 and 456 that is required for CLC binding. Within this region, point mutations showed the importance of residues Leu-451, Leu-452, and Arg-453. Mutants that fail to bind CLC are unable to promote clathrin assembly in vitro but still mediate HIP1 homodimerization and heterodimerization with the family member HIP12/HIP1R. Moreover, HIP1 binding to CLC is necessary for HIP1 targeting to clathrin-coated pits and clathrin-coated vesicles. Interestingly, HIP1 binds to a highly conserved region of CLC previously demonstrated to regulate clathrin assembly. These results suggest a role for HIP1/CLC interactions in the regulation of clathrin assembly.

A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

PubMed

Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

2016-03-21

Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

Distractor-based stimulus-response bindings retrieve decisions independent of motor programs.

PubMed

Nett, Nadine; Bröder, Arndt; Frings, Christian

2016-11-01

Research on the distractor response binding (DRB) effect (Frings, Rothermund, & Wentura, 2007) suggests that distractors are integrated with target responses into an event file or stimulus-response (SR) episode. The whole event file is retrieved when the distractor is repeated and as a consequence distractors can retrieve previous responses. Nett, Bröder, and Frings (2015) argued that even decisions under uncertainty are integrated into event files and can later on be retrieved by distractors. However, their paradigm did not allow disentangling the retrieval of decisions from the retrieval of motor programs. Here we disentangled the retrieval of decisions and motor programs by assuring that retrieved decisions were not confounded by the repetitions of motor programs. In particular, in two experiments using a sequential prime-probe distractor priming task participants used other keys or other effectors for prime and probe responses; nevertheless repeated task-irrelevant distractors increased the probability that participants repeated the prime decision irrespective of motor programs. Thus, decision features can become part of an event-file and directly be retrieved by irrelevant information suggesting that bindings have an even higher flexibility and ubiquity than previously assumed. Copyright © 2016 Elsevier B.V. All rights reserved.

A low-molecular-weight galactofucan from the seaweed, Spatoglossum schröederi, binds fibronectin and inhibits capillary-like tube formation in vitro.

PubMed

Menezes, Maira Maria; Nobre, Leonardo Thiago Duarte Barreto; Rossi, Gustavo Rodrigues; Almeida-Lima, Jailma; Melo-Silveira, Raniere Fagundes; Franco, Celia Regina Cavichiolo; Trindade, Edvaldo Silva; Nader, Helena Bonciani; Rocha, Hugo Alexandre Oliveira

2018-05-01

A low-molecular-weight (LMW) heterofucan (designated fucan B) was obtained from the brown seaweed, Spatoglossum schröederi, and its activity as an inhibitor of capillary-like tube formation by endothelial cells (ECs) was analyzed. Chemical, infrared and electrophoretic analyses confirmed the identity of fucan B. In contrast to other LMW fucans, fucan B (0.012-0.1 mg/mL) inhibited ECs capillary-like tube formation in a concentration-dependent manner. In addition, fucan B (0.01-0.05 mg/mL) did not affect ECs proliferation. Fucan B also inhibited ECs migration on a fibronectin-coated surface, but not on laminin- or collagen-coated surfaces. Biotinylated fucan B was used as a probe to identify its localization. Confocal microscopy experiments revealed that biotinylated fucan did not bind to the cell surface, but rather only to fibronectin. Our findings suggest that fucan B inhibits ECs capillary-like tube formation and migration by binding directly to fibronectin and blocking fibronectin sites recognized by cell surface ligands. However, further studies are needed to evaluate the in vivo effects of fucan B. Copyright © 2018 Elsevier B.V. All rights reserved.

Ageing and feature binding in visual working memory: The role of presentation time.

PubMed

Rhodes, Stephen; Parra, Mario A; Logie, Robert H

2016-01-01

A large body of research has clearly demonstrated that healthy ageing is accompanied by an associative memory deficit. Older adults exhibit disproportionately poor performance on memory tasks requiring the retention of associations between items (e.g., pairs of unrelated words). In contrast to this robust deficit, older adults' ability to form and temporarily hold bound representations of an object's surface features, such as colour and shape, appears to be relatively well preserved. However, the findings of one set of experiments suggest that older adults may struggle to form temporary bound representations in visual working memory when given more time to study objects. However, these findings were based on between-participant comparisons across experimental paradigms. The present study directly assesses the role of presentation time in the ability of younger and older adults to bind shape and colour in visual working memory using a within-participant design. We report new evidence that giving older adults longer to study memory objects does not differentially affect their immediate memory for feature combinations relative to individual features. This is in line with a growing body of research suggesting that there is no age-related impairment in immediate memory for colour-shape binding.

The Role of Binding Site on the Mechanical Unfolding Mechanism of Ubiquitin

NASA Astrophysics Data System (ADS)

Cao, Penghui; Yoon, Gwonchan; Tao, Weiwei; Eom, Kilho; Park, Harold S.

2015-03-01

We apply novel atomistic simulations based on potential energy surface exploration to investigate the constant force-induced unfolding of ubiquitin. At the experimentally-studied force clamping level of 100 pN, we find a new unfolding mechanism starting with the detachment between β5 and β3 involving the binding site of ubiquitin, the Ile44 residue. This new unfolding pathway leads to the discovery of new intermediate configurations, which correspond to the end-to-end extensions previously seen experimentally. More importantly, it demonstrates the novel finding that the binding site of ubiquitin can be responsible not only for its biological functions, but also its unfolding dynamics. We also report in contrast to previous single molecule constant force experiments that when the clamping force becomes smaller than about 300 pN, the number of intermediate configurations increases dramatically, where almost all unfolding events at 100 pN involve an intermediate configuration. By directly calculating the life times of the intermediate configurations from the height of the barriers that were crossed on the potential energy surface, we demonstrate that these intermediate states were likely not observed experimentally due to their lifetimes typically being about two orders of magnitude smaller than the experimental temporal resolution.

Use of micro-emulsion technology for the directed evolution of antibodies.

PubMed

Buhr, Diane L; Acca, Felicity E; Holland, Erika G; Johnson, Katie; Maksymiuk, Gail M; Vaill, Ada; Kay, Brian K; Weitz, David A; Weiner, Michael P; Kiss, Margaret M

2012-09-01

Affinity reagents, such as antibodies, are needed to study protein expression patterns, sub-cellular localization, and post-translational modifications in complex mixtures and tissues. Phage Emulsion, Secretion, and Capture (ESCape) is a novel micro-emulsion technology that utilizes water-in-oil (W/O) emulsions for the identification and isolation of cells secreting phage particles that display desirable antibodies. Using this method, a large library of antibody-displaying phage will bind to beads in individual compartments. Rather than using biopanning on a large mixed population, phage micro-emulsion technology allows us to individually query clonal populations of amplified phage against the antigen. The use of emulsions to generate microdroplets has the promise of accelerating phage selection experiments by permitting fine discrimination of kinetic parameters for binding to targets. In this study, we demonstrate the ability of phage micro-emulsion technology to distinguish two scFvs with a 300-fold difference in binding affinities (100nM and 300pM, respectively). In addition, we describe the application of phage micro-emulsion technology for the selection of scFvs that are resistant to elevated temperatures. Copyright © 2012. Published by Elsevier Inc.

Color-motion feature-binding errors are mediated by a higher-order chromatic representation

PubMed Central

Shevell, Steven K.; Wang, Wei

2017-01-01

Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature 429, 262 (2004)]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A 31, A60 (2014)]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at every s level. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higherorder chromatic mechanism. PMID:26974945

A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes

PubMed Central

Yuan, Libin; Morales, Carlos R.

2010-01-01

Prosaposin, the precursor of four lysosomal cofactors required for the hydrolysis of sphingolipids, is transported to the lysosomes via the alternative receptor, sortilin. In this study, we identified a specific domain of 17 amino acids within the C terminus of prosaposin involved in binding to this sorting receptor. We generated six prosaposin deletion constructs and examined the effect of truncation by coimmunoprecipitation and confocal microscopy. The experiments revealed that the first half of the prosaposin C terminus (aa 524–540), containing a saposin-like motif, was required and necessary to bind sortilin and to transport it to the lysosomes. Based on this result, we introduced twelve site-directed point mutations within the first half of the C terminus. Although the interaction of prosaposin with sortilin was pH dependent, the mutation of hydrophilic amino acids that usually modulate pH-dependent protein interactions did not affect the binding of prosaposin to sortilin. Conversely, a tryptophan (W530) and two cysteines (C528 and C536) were essential for its interaction with sortilin and for its transport to the lysosomes. In conclusion, our investigation demonstrates that a saposin-like motif within the first half of the prosaposin C terminus contains the sortilin recognition site. (J Histochem Cytochem 58:287–300, 2010) PMID:19934382

Deletion mutants of Harvey ras p21 protein reveal the absolute requirement of at least two distant regions for GTP-binding and transforming activities.

PubMed Central

Lacal, J C; Anderson, P S; Aaronson, S A

1986-01-01

Deletions of small sequences from the viral Harvey ras gene have been generated, and resulting ras p21 mutants have been expressed in Escherichia coli. Purification of each deleted protein allowed the in vitro characterization of GTP-binding, GTPase and autokinase activity of the proteins. Microinjection of the highly purified proteins into quiescent NIH/3T3 cells, as well as transfection experiments utilizing a long terminal repeat (LTR)-containing vector, were utilized to analyze the biological activity of the deleted proteins. Two small regions located at 6-23 and 152-165 residues are shown to be absolutely required for in vitro and in vivo activities of the ras product. By contrast, the variable region comprising amino acids 165-184 was shown not to be necessary for either in vitro or in vivo activities. Thus, we demonstrate that: (i) amino acid sequences at positions 5-23 and 152-165 of ras p21 protein are probably directly involved in the GTP-binding activity; (ii) GTP-binding is required for the transforming activity of ras p21 and by extension for the normal function of the proto-oncogene product; and (iii) the variable region at the C-terminal end of the ras p21 molecule from amino acids 165 to 184 is not required for transformation. Images Fig.2. Fig.4. PMID:3011420

Structural and functional characterization of the interaction between cyclophilin B and a heparin-derived oligosaccharide.

PubMed

Hanoulle, Xavier; Melchior, Aurélie; Sibille, Nathalie; Parent, Benjamin; Denys, Agnès; Wieruszeski, Jean-Michel; Horvath, Dragos; Allain, Fabrice; Lippens, Guy; Landrieu, Isabelle

2007-11-23

The chemotaxis and integrin-mediated adhesion of T lymphocytes triggered by secreted cyclophilin B (CypB) depend on interactions with both cell surface heparan sulfate proteoglycans (HSPG) and the extracellular domain of the CD147 membrane receptor. Here, we use NMR spectroscopy to characterize the interaction of CypB with heparin-derived oligosaccharides. Chemical shift perturbation experiments allowed the precise definition of the heparan sulfate (HS) binding site of CypB. The N-terminal extremity of CypB, which contains a consensus sequence for heparin-binding proteins was modeled on the basis of our experimental NMR data. Because the HS binding site extends toward the CypB catalytic pocket, we measured its peptidyl-prolyl cis-trans isomerase (PPIase) activity in the absence or presence of a HS oligosaccharide toward a CD147-derived peptide. We report the first direct evidence that CypB is enzymatically active on CD147, as it is able to accelerate the cis/trans isomerization of the Asp(179)-Pro(180) bond in a CD147-derived peptide. However, HS binding has no significant influence on this PPIase activity. We thus conclude that the glycanic moiety of HSPG serves as anchor for CypB at the cell surface, and that the signal could be transduced by CypB via its PPIase activity toward CD147.

Converging free energies of binding in cucurbit[7]uril and octa-acid host-guest systems from SAMPL4 using expanded ensemble simulations

NASA Astrophysics Data System (ADS)

Monroe, Jacob I.; Shirts, Michael R.

2014-04-01

Molecular containers such as cucurbit[7]uril (CB7) and the octa-acid (OA) host are ideal simplified model test systems for optimizing and analyzing methods for computing free energies of binding intended for use with biologically relevant protein-ligand complexes. To this end, we have performed initially blind free energy calculations to determine the free energies of binding for ligands of both the CB7 and OA hosts. A subset of the selected guest molecules were those included in the SAMPL4 prediction challenge. Using expanded ensemble simulations in the dimension of coupling host-guest intermolecular interactions, we are able to show that our estimates in most cases can be demonstrated to fully converge and that the errors in our estimates are due almost entirely to the assigned force field parameters and the choice of environmental conditions used to model experiment. We confirm the convergence through the use of alternative simulation methodologies and thermodynamic pathways, analyzing sampled conformations, and directly observing changes of the free energy with respect to simulation time. Our results demonstrate the benefits of enhanced sampling of multiple local free energy minima made possible by the use of expanded ensemble molecular dynamics and may indicate the presence of significant problems with current transferable force fields for organic molecules when used for calculating binding affinities, especially in non-protein chemistries.

Converging free energies of binding in cucurbit[7]uril and octa-acid host-guest systems from SAMPL4 using expanded ensemble simulations.

PubMed

Monroe, Jacob I; Shirts, Michael R

2014-04-01

Molecular containers such as cucurbit[7]uril (CB7) and the octa-acid (OA) host are ideal simplified model test systems for optimizing and analyzing methods for computing free energies of binding intended for use with biologically relevant protein-ligand complexes. To this end, we have performed initially blind free energy calculations to determine the free energies of binding for ligands of both the CB7 and OA hosts. A subset of the selected guest molecules were those included in the SAMPL4 prediction challenge. Using expanded ensemble simulations in the dimension of coupling host-guest intermolecular interactions, we are able to show that our estimates in most cases can be demonstrated to fully converge and that the errors in our estimates are due almost entirely to the assigned force field parameters and the choice of environmental conditions used to model experiment. We confirm the convergence through the use of alternative simulation methodologies and thermodynamic pathways, analyzing sampled conformations, and directly observing changes of the free energy with respect to simulation time. Our results demonstrate the benefits of enhanced sampling of multiple local free energy minima made possible by the use of expanded ensemble molecular dynamics and may indicate the presence of significant problems with current transferable force fields for organic molecules when used for calculating binding affinities, especially in non-protein chemistries.

Identification of novel binding partners (annexins) for the cell death signal phosphatidylserine and definition of their recognition motif.

PubMed

Rosenbaum, Sabrina; Kreft, Sandra; Etich, Julia; Frie, Christian; Stermann, Jacek; Grskovic, Ivan; Frey, Benjamin; Mielenz, Dirk; Pöschl, Ernst; Gaipl, Udo; Paulsson, Mats; Brachvogel, Bent

2011-02-18

Identification and clearance of apoptotic cells prevents the release of harmful cell contents thereby suppressing inflammation and autoimmune reactions. Highly conserved annexins may modulate the phagocytic cell removal by acting as bridging molecules to phosphatidylserine, a characteristic phagocytosis signal of dying cells. In this study five members of the structurally and functionally related annexin family were characterized for their capacity to interact with phosphatidylserine and dying cells. The results showed that AnxA3, AnxA4, AnxA13, and the already described interaction partner AnxA5 can bind to phosphatidylserine and apoptotic cells, whereas AnxA8 lacks this ability. Sequence alignment experiments located the essential amino residues for the recognition of surface exposed phosphatidylserine within the calcium binding motifs common to all annexins. These amino acid residues were missing in the evolutionary young AnxA8 and when they were reintroduced by site directed mutagenesis AnxA8 gains the capability to interact with phosphatidylserine containing liposomes and apoptotic cells. By defining the evolutionary conserved amino acid residues mediating phosphatidylserine binding of annexins we show that the recognition of dying cells represent a common feature of most annexins. Hence, the individual annexin repertoire bound to the cell surface of dying cells may fulfil opsonin-like function in cell death recognition.

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

PubMed

Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

2018-04-06

Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

A simple and efficient method to enhance audiovisual binding tendencies

PubMed Central

Wozny, David R.; Shams, Ladan

2017-01-01

Individuals vary in their tendency to bind signals from multiple senses. For the same set of sights and sounds, one individual may frequently integrate multisensory signals and experience a unified percept, whereas another individual may rarely bind them and often experience two distinct sensations. Thus, while this binding/integration tendency is specific to each individual, it is not clear how plastic this tendency is in adulthood, and how sensory experiences may cause it to change. Here, we conducted an exploratory investigation which provides evidence that (1) the brain’s tendency to bind in spatial perception is plastic, (2) that it can change following brief exposure to simple audiovisual stimuli, and (3) that exposure to temporally synchronous, spatially discrepant stimuli provides the most effective method to modify it. These results can inform current theories about how the brain updates its internal model of the surrounding sensory world, as well as future investigations seeking to increase integration tendencies. PMID:28462016

An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

ERIC Educational Resources Information Center

John, Nancy J.; Firestone, Gary L.

1987-01-01

Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

ERp57 interacts with conserved cysteine residues in the MHC class I peptide-binding groove.

PubMed

Antoniou, Antony N; Santos, Susana G; Campbell, Elaine C; Lynch, Sarah; Arosa, Fernando A; Powis, Simon J

2007-05-15

The oxidoreductase ERp57 is a component of the major histocompatibility complex (MHC) class I peptide-loading complex. ERp57 can interact directly with MHC class I molecules, however, little is known about which of the cysteine residues within the MHC class I molecule are relevant to this interaction. MHC class I molecules possess conserved disulfide bonds between cysteines 101-164, and 203-259 in the peptide-binding and alpha3 domain, respectively. By studying a series of mutants of these conserved residues, we demonstrate that ERp57 predominantly associates with cysteine residues in the peptide-binding domain, thus indicating ERp57 has direct access to the peptide-binding groove of MHC class I molecules during assembly.

Regulation of Blood Pressure by Targeting CaV1.2-Galectin-1 Protein Interaction.

PubMed

Hu, Zhenyu; Li, Guang; Wang, Jiong-Wei; Chong, Suet Yen; Yu, Dejie; Wang, Xiaoyuan; Soon, Jia Lin; Liang, Mui Cheng; Wong, Yuk Peng; Huang, Na; Colecraft, Henry M; Liao, Ping; Soong, Tuck Wah

2018-04-12

Background -L-type Ca V 1.2 channels play crucial roles in regulation of blood pressure. Galectin-1 (Gal-1), has been reported to bind to the I-II loop of Ca V 1.2 channels to reduce their current density. However, the mechanistic understanding for the down-regulation of Ca V 1.2 channels by Gal-1, and whether Gal-1 plays a direct role in blood pressure regulation remain unclear. Methods - In vitro experiments involving co-IP, western blot, patch-clamp recordings, immunohistochemistry and pressure myography were used to evaluate the molecular mechanisms by which Gal-1 down-regulates Ca V 1.2 channel in transfected HEK 293 cells, smooth muscle cells, arteries from Lgasl1 -/- mice, rat and human patients. In vivo experiments involving delivery of Tat-e9c peptide and AAV5-Gal-1 into rats were performed to investigate the effect of targeting Ca V 1.2-Gal-1 interaction on blood pressure monitored by tail cuff or telemetry methods. Results -Our study reveals that Gal-1 is a key regulator for proteasomal degradation of Ca V 1.2 channels. Gal-1 competed allosterically with Ca V β subunit for binding to the I-II loop of Ca V 1.2 channel. This competitive disruption of Ca V β binding led to Ca V 1.2 degradation by exposing the channels to poly-ubiquitination. Notably, we demonstrated that the inverse relationship of reduced Gal-1 and increased Ca V 1.2 protein levels in arteries was associated with hypertension in hypertensive rats and patients, and Gal-1 deficiency induces higher blood pressure in mice due to up-regulated Ca V 1.2 protein level in arteries. To directly regulate blood pressure by targeting the Ca V 1.2-Gal-1 interaction, we administered Tat-e9c, a peptide that competed for binding of Gal-1, by a mini-osmotic pump and this specific disruption of Ca V 1.2-Gal-1 coupling increased smooth muscle Ca V 1.2 currents, induced larger arterial contraction and caused hypertension in rats. In contrasting experiments, over-expression of Gal-1 in smooth muscle by a single bolus of AAV5-Gal-1 significantly reduced blood pressure in spontaneously hypertensive rats. Conclusions -We have defined molecularly that Gal-1 promotes Ca V 1.2 degradation by replacing Ca V β and thereby exposing specific lysines for poly-ubiquitination, and by masking I-II loop ER export signals. This mechanistic understanding provided the basis for targeting Ca V 1.2-Gal-1 interaction to demonstrate clearly the modulatory role Gal-1 plays in regulating blood pressure, and offering a potential approach for therapeutic management of hypertension.

Mapping the signal peptide binding and oligomer contact sites of the core subunit of the pea twin arginine protein translocase.

PubMed

Ma, Xianyue; Cline, Kenneth

2013-03-01

Twin arginine translocation (Tat) systems of thylakoid and bacterial membranes transport folded proteins using the proton gradient as the sole energy source. Tat substrates have hydrophobic signal peptides with an essential twin arginine (RR) recognition motif. The multispanning cpTatC plays a central role in Tat operation: It binds the signal peptide, directs translocase assembly, and may facilitate translocation. An in vitro assay with pea (Pisum sativum) chloroplasts was developed to conduct mutagenesis and analysis of cpTatC functions. Ala scanning mutagenesis identified mutants defective in substrate binding and receptor complex assembly. Mutations in the N terminus (S1) and first stromal loop (S2) caused specific defects in signal peptide recognition. Cys matching between substrate and imported cpTatC confirmed that S1 and S2 directly and specifically bind the RR proximal region of the signal peptide. Mutations in four lumen-proximal regions of cpTatC were defective in receptor complex assembly. Copurification and Cys matching analyses suggest that several of the lumen proximal regions may be important for cpTatC-cpTatC interactions. Surprisingly, RR binding domains of adjacent cpTatCs directed strong cpTatC-cpTatC cross-linking. This suggests clustering of binding sites on the multivalent receptor complex and explains the ability of Tat to transport cross-linked multimers. Transport of substrate proteins cross-linked to the signal peptide binding site tentatively identified mutants impaired in the translocation step.

Molecular Mechanotransduction: how forces trigger cytoskeletal dynamics

NASA Astrophysics Data System (ADS)

Ehrlicher, Allen

2012-02-01

Mechanical stresses elicit cellular reactions mediated by chemical signals. Defective responses to forces underlie human medical disorders, such as cardiac failure and pulmonary injury. Despite detailed knowledge of the cytoskeleton's structure, the specific molecular switches that convert mechanical stimuli into chemical signals have remained elusive. Here we identify the actin-binding protein, filamin A (FLNa) as a central mechanotransduction element of the cytoskeleton by using Fluorescence Loss After photoConversion (FLAC), a novel high-speed alternative to FRAP. We reconstituted a minimal system consisting of actin filaments, FLNa and two FLNa-binding partners: the cytoplasmic tail of ß-integrin, and FilGAP. Integrins form an essential mechanical linkage between extracellular and intracellular environments, with ß integrin tails connecting to the actin cytoskeleton by binding directly to filamin. FilGAP is a FLNa-binding GTPase-activating protein specific for Rac, which in vivo regulates cell spreading and bleb formation. We demonstrate that both externally-imposed bulk shear and myosin II driven forces differentially regulate the binding of integrin and FilGAP to FLNa. Consistent with structural predictions, strain increases ß-integrin binding to FLNa, whereas it causes FilGAP to dissociate from FLNa, providing a direct and specific molecular basis for cellular mechanotransduction. These results identify the first molecular mechanotransduction element within the actin cytoskeleton, revealing that mechanical strain of key proteins regulates the binding of signaling molecules. Moreover, GAP activity has been shown to switch cell movement from mesenchymal to amoeboid motility, suggesting that mechanical forces directly impact the invasiveness of cancer.

The effects of value on context-item associative memory in younger and older adults.

PubMed

Hennessee, Joseph P; Knowlton, Barbara J; Castel, Alan D

2018-02-01

Valuable items are often remembered better than items that are less valuable by both older and younger adults, but older adults typically show deficits in binding. Here, we examine whether value affects the quality of recognition memory and the binding of incidental details to valuable items. In Experiment 1, participants learned English words each associated with a point-value they earned for correct recognition with the goal of maximizing their score. In Experiment 2, value was manipulated by presenting items that were either congruent or incongruent with an imagined state of physiological need (e.g., hunger). In Experiment 1, point-value was associated with enhanced recollection in both age groups. Memory for the color associated with the word was in fact reduced for high-value recollected items compared with low-value recollected items, suggesting value selectively enhances binding of task-relevant details. In Experiment 2, memory for learned images was enhanced by value in both age groups. However, value differentially enhanced binding of an imagined context to the item in younger and older adults, with a strong trend for increased binding in younger adults only. These findings suggest that value enhances episodic encoding in both older and younger adults but that binding of associated details may be reduced for valuable items compared to less valuable items, particularly in older adults. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

The role of attention in item-item binding in visual working memory.

PubMed

Peterson, Dwight J; Naveh-Benjamin, Moshe

2017-09-01

An important yet unresolved question regarding visual working memory (VWM) relates to whether or not binding processes within VWM require additional attentional resources compared with processing solely the individual components comprising these bindings. Previous findings indicate that binding of surface features (e.g., colored shapes) within VWM is not demanding of resources beyond what is required for single features. However, it is possible that other types of binding, such as the binding of complex, distinct items (e.g., faces and scenes), in VWM may require additional resources. In 3 experiments, we examined VWM item-item binding performance under no load, articulatory suppression, and backward counting using a modified change detection task. Binding performance declined to a greater extent than single-item performance under higher compared with lower levels of concurrent load. The findings from each of these experiments indicate that processing item-item bindings within VWM requires a greater amount of attentional resources compared with single items. These findings also highlight an important distinction between the role of attention in item-item binding within VWM and previous studies of long-term memory (LTM) where declines in single-item and binding test performance are similar under divided attention. The current findings provide novel evidence that the specific type of binding is an important determining factor regarding whether or not VWM binding processes require attention. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase.

PubMed

Levin, Mikhail K; Gurjar, Madhura; Patel, Smita S

2005-05-01

Helicases translocate along their nucleic acid substrates using the energy of ATP hydrolysis and by changing conformations of their nucleic acid-binding sites. Our goal is to characterize the conformational changes of hepatitis C virus (HCV) helicase at different stages of ATPase cycle and to determine how they lead to translocation. We have reported that ATP binding reduces HCV helicase affinity for nucleic acid. Now we identify the stage of the ATPase cycle responsible for translocation and unwinding. We show that a rapid directional movement occurs upon helicase binding to DNA in the absence of ATP, resulting in opening of several base pairs. We propose that HCV helicase translocates as a Brownian motor with a simple two-stroke cycle. The directional movement step is fueled by single-stranded DNA binding energy while ATP binding allows for a brief period of random movement that prepares the helicase for the next cycle.

Site-directed antibody immobilization using a protein A-gold binding domain fusion protein for enhanced SPR immunosensing.

PubMed

de Juan-Franco, Elena; Caruz, Antonio; Pedrajas, J R; Lechuga, Laura M

2013-04-07

We have implemented a novel strategy for the oriented immobilization of antibodies onto a gold surface based on the use of a fusion protein, the protein A-gold binding domain (PAG). PAG consists of a gold binding peptide (GBP) coupled to the immunoglobulin-binding domains of staphylococcal protein A. This fusion protein provides an easy and fast oriented immobilization of antibodies preserving its native structure, while leaving the antigen binding sites (Fab) freely exposed. Using this immobilization strategy, we have demonstrated the performance of the immunosensing of the human Growth Hormone by SPR. A limit of detection of 90 ng mL(-1) was obtained with an inter-chip variability lower than 7%. The comparison of this method with other strategies for the direct immobilization of antibodies over gold surfaces has showed the enhanced sensitivity provided by the PAG approach.

Hormone Binding to Recombinant Estrogen Receptors from Human, Alligator, Quail, Salamander, and Fathead Minnow

EPA Science Inventory

In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...

Lanthanide-based NMR: a tool to investigate component distribution in mixed-monolayer-protected nanoparticles.

PubMed

Guarino, Gaetano; Rastrelli, Federico; Scrimin, Paolo; Mancin, Fabrizio

2012-05-02

Gd(3+) ions, once bound to the monolayer of organic molecules coating the surface of gold nanoparticles, produce a paramagnetic relaxation enhancement (PRE) that broadens and eventually cancels the signals of the nuclear spins located nearby (within 1.6 nm distance). In the case of nanoparticles coated with mixed monolayers, the signals arising from the different coating molecules experience different PRE, depending on their distance from the binding site. As a consequence, observation of the signal broadening patterns provides direct information on the monolayer organization. © 2012 American Chemical Society

Aqueous light driven hydrogen production by a Ru–ferredoxin–Co biohybrid

DOE PAGES

Soltau, Sarah R.; Niklas, Jens; Dahlberg, Peter D.; ...

2015-06-08

In this paper, we report the creation of a novel solar fuel biohybrid for light-driven H 2 production utilizing the native electron transfer protein ferredoxin (Fd) as a scaffold for binding of a ruthenium photosensitizer (PS) and a molecular cobaloxime catalyst (Co). Finally, EPR and transient optical experiments provide direct evidence of a long-lived (>1.5 ms) Ru(III)–Fd–Co(I) charge separated state formed via an electron relay through the Fd [2Fe–2S] cluster, initiating the catalytic cycle for 2H + + 2e - → H 2.

The body unbound: vestibular-motor hallucinations and out-of-body experiences.

PubMed

Cheyne, J Allan; Girard, Todd A

2009-02-01

Among the varied hallucinations associated with sleep paralysis (SP), out-of-body experiences (OBEs) and vestibular-motor (V-M) sensations represent a distinct factor. Recent studies of direct stimulation of vestibular cortex report a virtually identical set of bodily-self hallucinations. Both programs of research agree on numerous details of OBEs and V-M experiences and suggest similar hypotheses concerning their association. In the present study, self-report data from two on-line surveys of SP-related experiences were employed to assess hypotheses concerning the causal structure of relations among V-M experiences and OBEs during SP episodes. The results complement neurophysiological evidence and are consistent with the hypothesis that OBEs represent a breakdown in the normal binding of bodily-self sensations and suggest that out-of-body feelings (OBFs) are consequences of anomalous V-M experiences and precursors to a particular form of autoscopic experience, out-of-body autoscopy (OBA). An additional finding was that vestibular and motor experiences make relatively independent contributions to OBE variance. Although OBEs are superficially consistent with universal dualistic and supernatural intuitions about the nature of the soul and its relation to the body, recent research increasingly offers plausible alternative naturalistic explanations of the relevant phenomenology.

The RNA Hydrolysis and the Cytokinin Binding Activities of PR-10 Proteins Are Differently Performed by Two Isoforms of the Pru p 1 Peach Major Allergen and Are Possibly Functionally Related[W

PubMed Central

Zubini, Paola; Zambelli, Barbara; Musiani, Francesco; Ciurli, Stefano; Bertolini, Paolo; Baraldi, Elena

2009-01-01

PR-10 proteins are a family of pathogenesis-related (PR) allergenic proteins playing multifunctional roles. The peach (Prunus persica) major allergen, Pru p 1.01, and its isoform, Pru p 1.06D, were found highly expressed in the fruit skin at the pit hardening stage, when fruits transiently lose their susceptibility to the fungal pathogen Monilinia spp. To investigate the possible role of the two Pru p 1 isoforms in plant defense, the recombinant proteins were expressed in Escherichia coli and purified. Light scattering experiments and circular dichroism spectroscopy showed that both proteins are monomers in solution with secondary structures typical of PR-10 proteins. Even though the proteins do not display direct antimicrobial activity, they both act as RNases, a function possibly related to defense. The RNase activity is different for the two proteins, and only that of Pru p 1.01 is affected in the presence of the cytokinin zeatin, suggesting a physiological correlation between Pru p 1.01 ligand binding and enzymatic activity. The binding of zeatin to Pru p 1.01 was evaluated using isothermal titration calorimetry, which provided information on the stoichiometry and on the thermodynamic parameters of the interaction. The structural architecture of Pru p 1.01 and Pru p 1.06D was obtained by homology modeling, and the differences in the binding pockets, possibly accounting for the observed difference in binding activity, were evaluated. PMID:19474212

PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.

PubMed

Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L

2013-06-14

Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

Complexes of horseradish peroxidase with formate, acetate, and carbon monoxide.

PubMed

Carlsson, Gunilla H; Nicholls, Peter; Svistunenko, Dimitri; Berglund, Gunnar I; Hajdu, Janos

2005-01-18

Carbon monoxide, formate, and acetate interact with horseradish peroxidase (HRP) by binding to subsites within the active site. These ligands also bind to catalases, but their interactions are different in the two types of enzymes. Formate (notionally the "hydrated" form of carbon monoxide) is oxidized to carbon dioxide by compound I in catalase, while no such reaction is reported to occur in HRP, and the CO complex of ferrocatalase can only be obtained indirectly. Here we describe high-resolution crystal structures for HRP in its complexes with carbon monoxide and with formate, and compare these with the previously determined HRP-acetate structure [Berglund, G. I., et al. (2002) Nature 417, 463-468]. A multicrystal X-ray data collection strategy preserved the correct oxidation state of the iron during the experiments. Absorption spectra of the crystals and electron paramagnetic resonance data for the acetate and formate complexes in solution correlate electronic states with the structural results. Formate in ferric HRP and CO in ferrous HRP bind directly to the heme iron with iron-ligand distances of 2.3 and 1.8 A, respectively. CO does not bind to the ferric iron in the crystal. Acetate bound to ferric HRP stacks parallel with the heme plane with its carboxylate group 3.6 A from the heme iron, and without an intervening solvent molecule between the iron and acetate. The positions of the oxygen atoms in the bound ligands outline a potential access route for hydrogen peroxide to the iron. We propose that interactions in this channel ensure deprotonation of the proximal oxygen before binding to the heme iron.

Contingency blindness: location-identity binding mismatches obscure awareness of spatial contingencies and produce profound interference in visual working memory.

PubMed

Fiacconi, Chris M; Milliken, Bruce

2012-08-01

The purpose of the present study was to highlight the role of location-identity binding mismatches in obscuring explicit awareness of a strong contingency. In a spatial-priming procedure, we introduced a high likelihood of location-repeat trials. Experiments 1, 2a, and 2b demonstrated that participants' explicit awareness of this contingency was heavily influenced by the local match in location-identity bindings. In Experiment 3, we sought to determine why location-identity binding mismatches produce such low levels of contingency awareness. Our results suggest that binding mismatches can interfere substantially with visual-memory performance. We attribute the low levels of contingency awareness to participants' inability to remember the critical location-identity binding in the prime on a trial-to-trial basis. These results imply a close interplay between object files and visual working memory.

The carboxyl terminus of the alpha-subunit of the amiloride-sensitive epithelial sodium channel binds to F-actin.

PubMed

Mazzochi, Christopher; Bubien, James K; Smith, Peter R; Benos, Dale J

2006-03-10

The activity of the amiloride-sensitive epithelial sodium channel (ENaC) is modulated by F-actin. However, it is unknown if there is a direct interaction between alpha-ENaC and actin. We have investigated the hypothesis that the actin cytoskeleton directly binds to the carboxyl terminus of alpha-ENaC using a combination of confocal microscopy, co-immunoprecipitation, and protein binding studies. Confocal microscopy of Madin-Darby canine kidney cell monolayers stably transfected with wild type, rat isoforms of alpha-, beta-, and gamma-ENaC revealed co-localization of alpha-ENaC with the cortical F-actin cytoskeleton both at the apical membrane and within the subapical cytoplasm. F-actin was found to co-immunoprecipitate with alpha-ENaC from whole cell lysates of this cell line. Gel overlay assays demonstrated that F-actin specifically binds to the carboxyl terminus of alpha-ENaC. A direct interaction between F-actin and the COOH terminus of alpha-ENaC was further corroborated by F-actin co-sedimentation studies. This is the first study to report a direct and specific biochemical interaction between F-actin and ENaC.

Binding of integrin α1 to bone morphogenetic protein receptor IA suggests a novel role of integrin α1β1 in bone morphogenetic protein 2 signalling.

PubMed

Zu, Yan; Liang, Xudong; Du, Jing; Zhou, Shuai; Yang, Chun

2015-11-05

Here, we observed that integrin α1β1 and bone morphogenetic protein receptor (BMPR) IA formed a complex and co-localised in several cell types. However, the molecular interaction between these two molecules was not studied in detail to date and the role of the interaction in BMPR signalling remains unknown; thus, these were investigated here. In a steered molecular dynamics (SMD) simulation, the observed development of the rupture force related to the displacement between the A-domain of integrin α1 and the extracellular domain of BMPR IA indicated a strong molecular interaction within the integrin-BMPR complex. Analysis of the intermolecular forces revealed that hydrogen bonds, rather than salt bridges, are the major contributors to these intermolecular interactions. By using Enzyme-linked immunosorbent assay (ELISA) and co-immunoprecipitation (co-IP) experiments with site-directed mutants, we found that residues 85-89 in BMPR IA play the most important role for BMPR IA binding to integrin α1β1. These residues are the same as those responsible for bone morphogenetic protein 2 (BMP-2)/BMPR IA binding. In our experiments, we also found that the interference of integrin α1β1 up regulated the level of phosphorylated Smad1, 5, 8, which is the downstream of BMP/BMPR signalling. Therefore, our results suggest that integrin α1β1/BMPR IA may block BMP-2/BMPR IA complex information and interfere with the BMP-2 signalling pathway in cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

Deuterium Labeling Together with Contrast Variation Small-angle Neutron Scattering Suggests How Skp Captures and Releases Unfolded Outer Membrane Proteins

PubMed Central

Zaccai, Nathan R.; Sandlin, Clifford W.; Hoopes, James T.; Curtis, Joseph E.; Fleming, Patrick J.; Fleming, Karen G.; Krueger, Susan

2016-01-01

In gram-negative bacteria, the chaperone protein Skp forms specific and stable complexes with membrane proteins while they are transported across the periplasm to the outer membrane. The jellyfish-like architecture of Skp is similar to the eukaryotic and archeal prefoldins and the mitochondrial Tim chaperones, that is α-helical ‘tentacles’ extend from a β-strand ‘body’ to create an internal cavity. Contrast variation small-angle neutron scattering (SANS) experiments on Skp alone in solution and bound in two different complexes to unfolded outer membrane proteins (uOMPs), OmpA and OmpW, demonstrate that the helical tentacles of Skp bind their substrate in a clamp-like mechanism in a conformation similar to that previously observed in the apo crystal structure of Skp. Deuteration of the uOMP component combined with contrast variation analysis allowed the shapes of Skp and uOMP as well as the location of uOMP with respect to Skp to be determined in both complexes. This represents unique information that could not be obtained without deuterium labeling of the uOMPs. The data yield the first direct structural evidence that the α-helical Skp tentacles move closer together on binding its substrate and that the structure of Skp is different when binding different uOMPs. This work presents, by example, a tutorial on performing SANS experiments using both deuterium labeling and contrast variation, including SANS theory, sample preparation, data collection, sample quality validation, data analysis and structure modeling. PMID:26791979

Deuterium Labeling Together with Contrast Variation Small-Angle Neutron Scattering Suggests How Skp Captures and Releases Unfolded Outer Membrane Proteins.

PubMed

Zaccai, Nathan R; Sandlin, Clifford W; Hoopes, James T; Curtis, Joseph E; Fleming, Patrick J; Fleming, Karen G; Krueger, Susan

2016-01-01

In Gram-negative bacteria, the chaperone protein Skp forms specific and stable complexes with membrane proteins while they are transported across the periplasm to the outer membrane. The jellyfish-like architecture of Skp is similar to the eukaryotic and archaeal prefoldins and the mitochondrial Tim chaperones, that is the α-helical "tentacles" extend from a β-strand "body" to create an internal cavity. Contrast variation small-angle neutron scattering (SANS) experiments on Skp alone in solution and bound in two different complexes to unfolded outer membrane proteins (uOMPs), OmpA and OmpW, demonstrate that the helical tentacles of Skp bind their substrate in a clamp-like mechanism in a conformation similar to that previously observed in the apo crystal structure of Skp. Deuteration of the uOMP component combined with contrast variation analysis allowed the shapes of Skp and uOMP as well as the location of uOMP with respect to Skp to be determined in both complexes. This represents unique information that could not be obtained without deuterium labeling of the uOMPs. The data yield the first direct structural evidence that the α-helical Skp tentacles move closer together on binding its substrate and that the structure of Skp is different when binding different uOMPs. This work presents, by example, a tutorial on performing SANS experiments using both deuterium labeling and contrast variation, including SANS theory, sample preparation, data collection, sample quality validation, data analysis, and structure modeling. © 2016 Elsevier Inc. All rights reserved.

Yeast pro- and paraprobiotics have the capability to bind pathogenic bacteria associated with animal disease

USDA-ARS?s Scientific Manuscript database

Live yeast probiotics and yeast cell wall components (paraprobiotics) may serve as an alternative to the use of antibiotics in prevention and treatment of infections caused by pathogenic bacteria. Probiotics and paraprobiotics can bind directly to pathogens, which limits binding of the pathogens to ...

Crossmodal Statistical Binding of Temporal Information and Stimuli Properties Recalibrates Perception of Visual Apparent Motion

PubMed Central

Zhang, Yi; Chen, Lihan

2016-01-01

Recent studies of brain plasticity that pertain to time perception have shown that fast training of temporal discrimination in one modality, for example, the auditory modality, can improve performance of temporal discrimination in another modality, such as the visual modality. We here examined whether the perception of visual Ternus motion could be recalibrated through fast crossmodal statistical binding of temporal information and stimuli properties binding. We conducted two experiments, composed of three sessions each: pre-test, learning, and post-test. In both the pre-test and the post-test, participants classified the Ternus display as either “element motion” or “group motion.” For the training session in Experiment 1, we constructed two types of temporal structures, in which two consecutively presented sound beeps were dominantly (80%) flanked by one leading visual Ternus frame and by one lagging visual Ternus frame (VAAV) or dominantly inserted by two Ternus visual frames (AVVA). Participants were required to respond which interval (auditory vs. visual) was longer. In Experiment 2, we presented only a single auditory–visual pair but with similar temporal configurations as in Experiment 1, and asked participants to perform an audio–visual temporal order judgment. The results of these two experiments support that statistical binding of temporal information and stimuli properties can quickly and selectively recalibrate the sensitivity of perceiving visual motion, according to the protocols of the specific bindings. PMID:27065910

KU675, a Concomitant Heat-Shock Protein Inhibitor of Hsp90 and Hsc70 that Manifests Isoform Selectivity for Hsp90α in Prostate Cancer Cells.

PubMed

Liu, Weiya; Vielhauer, George A; Holzbeierlein, Jeffrey M; Zhao, Huiping; Ghosh, Suman; Brown, Douglas; Lee, Eugene; Blagg, Brian S J

2015-07-01

The 90-kDa heat-shock protein (Hsp90) assists in the proper folding of numerous mutated or overexpressed signal transduction proteins that are involved in cancer. Inhibiting Hsp90 consequently is an attractive strategy for cancer therapy as the concomitant degradation of multiple oncoproteins may lead to effective antineoplastic agents. Here we report a novel C-terminal Hsp90 inhibitor, designated KU675, that exhibits potent antiproliferative and cytotoxic activity along with client protein degradation without induction of the heat-shock response in both androgen-dependent and -independent prostate cancer cell lines. In addition, KU675 demonstrates direct inhibition of Hsp90 complexes as measured by the inhibition of luciferase refolding in prostate cancer cells. In direct binding studies, the internal fluorescence signal of KU675 was used to determine the binding affinity of KU675 to recombinant Hsp90α, Hsp90β, and Hsc70 proteins. The binding affinity (Kd) for Hsp90α was determined to be 191 μM, whereas the Kd for Hsp90β was 726 μM, demonstrating a preference for Hsp90α. Western blot experiments with four different prostate cancer cell lines treated with KU675 supported this selectivity by inducing the degradation of Hsp90α -: dependent client proteins. KU675 also displayed binding to Hsc70 with a Kd value at 76.3 μM, which was supported in cellular by lower levels of Hsc70-specific client proteins on Western blot analyses. Overall, these findings suggest that KU675 is an Hsp90 C-terminal inhibitor, as well as a dual inhibitor of Hsc70, and may have potential use for the treatment of cancer. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Scanpath memory binding: multiple read-out experiments

NASA Astrophysics Data System (ADS)

Stark, Lawrence W.; Privitera, Claudio M.; Yang, Huiyang; Azzariti, Michela; Ho, Yeuk F.; Chan, Angie; Krischer, Christof; Weinberger, Adam

1999-05-01

The scanpath theory proposed that an internal spatial- cognitive model controls perception and the active looking eye movements, EMs, of the scanpath sequence. Evidence for this came from new quantitative methods, experiments with ambiguous figures and visual imagery and from MRI studies, all on cooperating human subjects. Besides recording EMs, we introduce other experimental techniques wherein the subject must depend upon memory bindings as in visual imagery, but may call upon other motor behaviors than EMs to read-out the remembered patterns. How is the internal model distributed and operationally assembled. The concept of binding speaks to the assigning of values for the model and its execution in various parts of the brain. Current neurological information helps to localize different aspects of the spatial-cognitive model in the brain. We suppose that there are several levels of 'binding' -- semantic or symbolic binding, structural binding for the spatial locations of the regions-of-interest and sequential binding for the dynamic execution program that yields the sequence of EMs. Our aim is to dissect out respective contributions of these different forms of binding.

The Solution Structure, Binding Properties, and Dynamics of the Bacterial Siderophore-binding Protein FepB*

PubMed Central

Chu, Byron C. H.; Otten, Renee; Krewulak, Karla D.; Mulder, Frans A. A.; Vogel, Hans J.

2014-01-01

The periplasmic binding protein (PBP) FepB plays a key role in transporting the catecholate siderophore ferric enterobactin from the outer to the inner membrane in Gram-negative bacteria. The solution structures of the 34-kDa apo- and holo-FepB from Escherichia coli, solved by NMR, represent the first solution structures determined for the type III class of PBPs. Unlike type I and II PBPs, which undergo large “Venus flytrap” conformational changes upon ligand binding, both forms of FepB maintain similar overall folds; however, binding of the ligand is accompanied by significant loop movements. Reverse methyl cross-saturation experiments corroborated chemical shift perturbation results and uniquely defined the binding pocket for gallium enterobactin (GaEnt). NMR relaxation experiments indicated that a flexible loop (residues 225–250) adopted a more rigid and extended conformation upon ligand binding, which positioned residues for optimal interactions with the ligand and the cytoplasmic membrane ABC transporter (FepCD), respectively. In conclusion, this work highlights the pivotal role that structural dynamics plays in ligand binding and transporter interactions in type III PBPs. PMID:25173704

Identification of new ligands for the methionine biosynthesis transcriptional regulator (MetJ) by FAC-MS.

PubMed

Martí-Arbona, Ricardo; Teshima, Munehiro; Anderson, Penelope S; Nowak-Lovato, Kristy L; Hong-Geller, Elizabeth; Unkefer, Clifford J; Unkefer, Pat J

2012-01-01

We have developed a high-throughput approach using frontal affinity chromatography coupled to mass spectrometry (FAC-MS) for the identification and characterization of the small molecules that modulate transcriptional regulator (TR) binding to TR targets. We tested this approach using the methionine biosynthesis regulator (MetJ). We used effector mixtures containing S-adenosyl-L-methionine (SAM) and S-adenosyl derivatives as potential ligands for MetJ binding. The differences in the elution time of different compounds allowed us to rank the binding affinity of each compound. Consistent with previous results, FAC-MS showed that SAM binds to MetJ with the highest affinity. In addition, adenine and 5'-deoxy-5'-(methylthio)adenosine bind to the effector binding site on MetJ. Our experiments with MetJ demonstrate that FAC-MS is capable of screening complex mixtures of molecules and identifying high-affinity binders to TRs. In addition, FAC-MS experiments can be used to discriminate between specific and nonspecific binding of the effectors as well as to estimate the dissociation constant (K(d)) for effector-TR binding. Copyright © 2012 S. Karger AG, Basel.

Arabidopsis CaM1 and CaM4 Promote Nitric Oxide Production and Salt Resistance by Inhibiting S-Nitrosoglutathione Reductase via Direct Binding

PubMed Central

Wu, Dan; Peng, Xuan; Liu, Xu; Zhang, Jiaojiao; Zhao, Junfeng; Chen, Kunming; Zhao, Liqun

2016-01-01

Salt is a major threat to plant growth and crop productivity. Calmodulin (CaM), the most important multifunctional Ca2+ sensor protein in plants, mediates reactions against environmental stresses through target proteins; however, direct proof of the participation of CaM in salt tolerance and its corresponding signaling pathway in vivo is lacking. In this study, we found that AtCaM1 and AtCaM4 produced salt-responsive CaM isoforms according to real-time reverse transcription-polymerase chain reaction analyses; this result was verified based on a phenotypic analysis of salt-treated loss-of-function mutant and transgenic plants. We also found that the level of nitric oxide (NO), an important salt-responsive signaling molecule, varied in response to salt treatment depending on AtCaM1 and AtCaM4 expression. GSNOR is considered as an important and widely utilized regulatory component of NO homeostasis in plant resistance protein signaling networks. In vivo and in vitro protein-protein interaction assays revealed direct binding between AtCaM4 and S-nitrosoglutathione reductase (GSNOR), leading to reduced GSNOR activity and an increased NO level. Overexpression of GSNOR intensified the salt sensitivity of cam4 mutant plants accompanied by a reduced internal NO level, whereas a gsnor deficiency increased the salt tolerance of cam4 plants accompanied by an increased internal NO level. Physiological experiments showed that CaM4-GSNOR, acting through NO, reestablished the ion balance to increase plant resistance to salt stress. Together, these data suggest that AtCaM1 and AtCaM4 serve as signals in plant salt resistance by promoting NO accumulation through the binding and inhibition of GSNOR. This could be a conserved defensive signaling pathway in plants and animals. PMID:27684709

Wnt/β-catenin signaling stimulates the expression and synaptic clustering of the autism-associated Neuroligin 3 gene.

PubMed

Medina, Matías A; Andrade, Víctor M; Caracci, Mario O; Avila, Miguel E; Verdugo, Daniela A; Vargas, Macarena F; Ugarte, Giorgia D; Reyes, Ariel E; Opazo, Carlos; De Ferrari, Giancarlo V

2018-03-05

Synaptic abnormalities have been described in individuals with autism spectrum disorders (ASD). The cell-adhesion molecule Neuroligin-3 (Nlgn3) has an essential role in the function and maturation of synapses and NLGN3 ASD-associated mutations disrupt hippocampal and cortical function. Here we show that Wnt/β-catenin signaling increases Nlgn3 mRNA and protein levels in HT22 mouse hippocampal cells and primary cultures of rat hippocampal neurons. We characterized the activity of mouse and rat Nlgn3 promoter constructs containing conserved putative T-cell factor/lymphoid enhancing factor (TCF/LEF)-binding elements (TBE) and found that their activity is significantly augmented in Wnt/β-catenin cell reporter assays. Chromatin immunoprecipitation (ChIP) assays and site-directed mutagenesis experiments revealed that endogenous β-catenin binds to novel TBE consensus sequences in the Nlgn3 promoter. Moreover, activation of the signaling cascade increased Nlgn3 clustering and co- localization with the scaffold PSD-95 protein in dendritic processes of primary neurons. Our results directly link Wnt/β-catenin signaling to the transcription of the Nlgn3 gene and support a functional role for the signaling pathway in the dysregulation of excitatory/inhibitory neuronal activity, as is observed in animal models of ASD.

Blood-brain barrier shuttle peptides enhance AAV transduction in the brain after systemic administration.

PubMed

Zhang, Xintao; He, Ting; Chai, Zheng; Samulski, R Jude; Li, Chengwen

2018-09-01

The adeno-associated virus (AAV) vector has been used in preclinical and clinical trials of gene therapy for central nervous system (CNS) diseases. One of the biggest challenges of effectively delivering AAV to the brain is to surmount the blood-brain barrier (BBB). Herein, we identified several potential BBB shuttle peptides that significantly enhanced AAV8 transduction in the brain after a systemic administration, the best of which was the THR peptide. The enhancement of AAV8 brain transduction by THR is dose-dependent, and neurons are the primary THR targets. Mechanism studies revealed that THR directly bound to the AAV8 virion, increasing its ability to cross the endothelial cell barrier. Further experiments showed that binding of THR to the AAV virion did not interfere with AAV8 infection biology, and that THR competitively blocked transferrin from binding to AAV8. Taken together, our results demonstrate, for the first time, that BBB shuttle peptides are able to directly interact with AAV and increase the ability of the AAV vectors to cross the BBB for transduction enhancement in the brain. These results will shed important light on the potential applications of BBB shuttle peptides for enhancing brain transduction with systemic administration of AAV vectors. Copyright © 2018 Elsevier Ltd. All rights reserved.

High-Throughput Method for Ranking the Affinity of Peptide Ligands Selected from Phage Display Libraries

PubMed Central

González-Techera, A.; Umpiérrez-Failache, M.; Cardozo, S.; Obal, G.; Pritsch, O.; Last, J. A.; Gee, S. J.; Hammock, B. D.; González-Sapienza, G.

2010-01-01

The use of phage display peptide libraries allows rapid isolation of peptide ligands for any target selector molecule. However, due to differences in peptide expression and the heterogeneity of the phage preparations, there is no easy way to compare the binding properties of the selected clones, which operates as a major “bottleneck” of the technology. Here, we present the development of a new type of library that allows rapid comparison of the relative affinity of the selected peptides in a high-throughput screening format. As a model system, a phage display peptide library constructed on a phagemid vector that contains the bacterial alkaline phosphatase gene (BAP) was selected with an antiherbicide antibody. Due to the intrinsic switching capacity of the library, the selected peptides were transferred “en masse” from the phage coat protein to BAP. This was coupled to an optimized affinity ELISA where normalized amounts of the peptide–BAP fusion allow direct comparison of the binding properties of hundreds of peptide ligands. The system was validated by plasmon surface resonance experiments using synthetic peptides, showing that the method discriminates among the affinities of the peptides within 3 orders of magnitude. In addition, the peptide–BAP protein can find direct application as a tracer reagent. PMID:18393454

Characterization of C-ring component assembly in flagellar motors from amino acid coevolution

PubMed Central

dos Santos, Ricardo Nascimento; Khan, Shahid

2018-01-01

Bacterial flagellar motility, an important virulence factor, is energized by a rotary motor localized within the flagellar basal body. The rotor module consists of a large framework (the C-ring), composed of the FliG, FliM and FliN proteins. FliN and FliM contacts the FliG torque ring to control the direction of flagellar rotation. We report that structure-based models constrained only by residue coevolution can recover the binding interface of atomic X-ray dimer complexes with remarkable accuracy (approx. 1 Å RMSD). We propose a model for FliM–FliN heterodimerization, which agrees accurately with homologous interfaces as well as in situ cross-linking experiments, and hence supports a proposed architecture for the lower portion of the C-ring. Furthermore, this approach allowed the identification of two discrete and interchangeable homodimerization interfaces between FliM middle domains that agree with experimental measurements and might be associated with C-ring directional switching dynamics triggered upon binding of CheY signal protein. Our findings provide structural details of complex formation at the C-ring that have been difficult to obtain with previous methodologies and clarify the architectural principle that underpins the ultra-sensitive allostery exhibited by this ring assembly that controls the clockwise or counterclockwise rotation of flagella. PMID:29892378

Color-motion feature-binding errors are mediated by a higher-order chromatic representation.

PubMed

Shevell, Steven K; Wang, Wei

2016-03-01

Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature429, 262 (2004)10.1038/429262a]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A31, A60 (2014)JOAOD60740-323210.1364/JOSAA.31.000A60]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at everyslevel. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higher-order chromatic mechanism.

The Determination of Vitamin D-Dependent Calcium Binding Protein in Chick Intesting: An Undergraduate Biochemistry Laboratory Experiment.

ERIC Educational Resources Information Center

Lessard, George M.

1980-01-01

Described is an experiment used in an undergraduate biochemistry laboratory involving inducing rickets in chicks and correlating the disease to a reduction in vitamin D-dependent calcium binding protein. Techniques involved are hormone induction, protein isolation, and radioisotope methodology. (Author/DS)

Direct observation of a single nanoparticle-ubiquitin corona formation

NASA Astrophysics Data System (ADS)

Ding, Feng; Radic, Slaven; Chen, Ran; Chen, Pengyu; Geitner, Nicholas K.; Brown, Jared M.; Ke, Pu Chun

2013-09-01

The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate, transport, and toxicity of nanomaterials in living systems and for enabling the vast applications of nanomedicine. Here we combined multiscale molecular dynamics simulations and complementary experiments to characterize the silver nanoparticle-ubiquitin corona formation. Notably, ubiquitins competed with citrates for the nanoparticle surface, governed by specific electrostatic interactions. Under a high protein/nanoparticle stoichiometry, ubiquitins formed a multi-layer corona on the particle surface. The binding exhibited an unusual stretched-exponential behavior, suggesting a rich binding kinetics. Furthermore, the binding destabilized the α-helices while increasing the β-sheet content of the proteins. This study revealed the atomic and molecular details of the structural and dynamic characteristics of nanoparticle-protein corona formation.The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate, transport, and toxicity of nanomaterials in living systems and for enabling the vast applications of nanomedicine. Here we combined multiscale molecular dynamics simulations and complementary experiments to characterize the silver nanoparticle-ubiquitin corona formation. Notably, ubiquitins competed with citrates for the nanoparticle surface, governed by specific electrostatic interactions. Under a high protein/nanoparticle stoichiometry, ubiquitins formed a multi-layer corona on the particle surface. The binding exhibited an unusual stretched-exponential behavior, suggesting a rich binding kinetics. Furthermore, the binding destabilized the α-helices while increasing the β-sheet content of the proteins. This study revealed the atomic and molecular details of the structural and dynamic characteristics of nanoparticle-protein corona formation. Electronic supplementary information (ESI) available: Experimental and computational methods as well as supporting figures. See DOI: 10.1039/c3nr02147e

Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

PubMed

Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

2017-07-18

Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

Biogenesis of influenza a virus hemagglutinin cross-protective stem epitopes.

PubMed

Magadán, Javier G; Altman, Meghan O; Ince, William L; Hickman, Heather D; Stevens, James; Chevalier, Aaron; Baker, David; Wilson, Patrick C; Ahmed, Rafi; Bennink, Jack R; Yewdell, Jonathan W

2014-06-01

Antigenic variation in the globular domain of influenza A virus (IAV) hemagglutinin (HA) precludes effective immunity to this major human pathogen. Although the HA stem is highly conserved between influenza virus strains, HA stem-reactive antibodies (StRAbs) were long considered biologically inert. It is now clear, however, that StRAbs reduce viral replication in animal models and protect against pathogenicity and death, supporting the potential of HA stem-based immunogens as drift-resistant vaccines. Optimally designing StRAb-inducing immunogens and understanding StRAb effector functions require thorough comprehension of HA stem structure and antigenicity. Here, we study the biogenesis of HA stem epitopes recognized in cells infected with various drifted IAV H1N1 strains using mouse and human StRAbs. Using a novel immunofluorescence (IF)-based assay, we find that human StRAbs bind monomeric HA in the endoplasmic reticulum (ER) and trimerized HA in the Golgi complex (GC) with similar high avidity, potentially good news for producing effective monomeric HA stem immunogens. Though HA stem epitopes are nestled among several N-linked oligosaccharides, glycosylation is not required for full antigenicity. Rather, as N-linked glycans increase in size during intracellular transport of HA through the GC, StRAb binding becomes temperature-sensitive, binding poorly to HA at 4°C and well at 37°C. A de novo designed, 65-residue protein binds the mature HA stem independently of temperature, consistent with a lack of N-linked oligosaccharide steric hindrance due to its small size. Likewise, StRAbs bind recombinant HA carrying simple N-linked glycans in a temperature-independent manner. Chemical cross-linking experiments show that N-linked oligosaccharides likely influence StRAb binding by direct local effects rather than by globally modifying the conformational flexibility of HA. Our findings indicate that StRAb binding to HA is precarious, raising the possibility that sufficient immune pressure on the HA stem region could select for viral escape mutants with increased steric hindrance from N-linked glycans.

Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.

PubMed

Du, W; Aloyo, V J; Harvey, J A

1997-10-03

Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.

The role of source memory in older adults' recollective experience.

PubMed

Boywitt, C Dennis; Kuhlmann, Beatrice G; Meiser, Thorsten

2012-06-01

Younger adults' "remember" judgments are accompanied by better memory for the source of an item than "know" judgments. Furthermore, remember judgments are not merely associated with better memory for individual source features but also with bound memory for multiple source features. However, older adults, independent of their subjective memory experience, are generally less likely to "bind" source features to an item and to each other in memory (i.e., the associative deficit). In two experiments, we tested whether memory for perceptual source features, independently or bound, is also the basis for older adults' remember responses or if their associative deficit leads them to base their responses on other types of information. The results suggest that retrieval of perceptual source features, individually or bound, forms the basis for younger but not for older adults' remember judgments even when the overall level of memory for perceptual sources is closely equated (Experiment 1) and when attention is explicitly directed to the source information at encoding (Experiment 2). PsycINFO Database Record (c) 2012 APA, all rights reserved

Energy profile of nanobody-GFP complex under force.

PubMed

Klamecka, Kamila; Severin, Philip M; Milles, Lukas F; Gaub, Hermann E; Leonhardt, Heinrich

2015-09-10

Nanobodies (Nbs)-the smallest known fully functional and naturally occuring antigen-binding fragments-have attracted a lot of attention throughout the last two decades. Exploring their potential beyond the current use requires more detailed characterization of their binding forces as those cannot be directly derived from the binding affinities. Here we used atomic force microscope to measure rupture force of the Nb-green fluorescent protein (GFP) complex in various pulling geometries and derived the energy profile characterizing the interaction along the direction of the pulling force. We found that-despite identical epitopes-the Nb binds stronger (41-56 pN) to enhanced GFP than to wild-type GFP (28-45 pN). Measured forces make the Nb-GFP pair a potent reference for investigating molecular forces in living systems both in and ex vivo.

Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells.

PubMed

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-12-14

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations.

Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells

PubMed Central

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-01-01

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations. PMID:28846104

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

PubMed

Schumann, Marcel; Armen, Roger S

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

PubMed Central

Schumann, Marcel; Armen, Roger S.

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

Structural basis for collagen recognition by the immune receptor OSCAR.

PubMed

Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

2016-02-04

The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Quartz crystal microbalance (QCM) with immobilized protein receptors: comparison of response to ligand binding for direct protein immobilization and protein attachment via disulfide linker.

PubMed

Baltus, Ruth E; Carmon, Kendra S; Luck, Linda A

2007-03-27

Results from an investigation of the frequency response resulting from ligand binding for a genetically engineered hormone-binding domain of the alpha-estrogen receptor immobilized to a piezoelectric quartz crystal are reported. Two different approaches were used to attach a genetically altered receptor to the gold electrode on the quartz surface: (1) the mutant receptor containing a single solvent-exposed cysteine was directly attached to the crystal via a sulfur to gold covalent bond, forming a self-assembled protein monolayer, and (2) the N-terminal histidine-tagged end was utilized to attach the receptor via a 3,3-dithiobis[N-(5-amino-5-carboxypentyl)propionamide-N',N'-diacetic acid] linker complexed with nickel. Previous studies have shown that these engineered constructs bind 17beta-estradiol and are fully functional. Exposure of the receptor directly attached to the piezoelectric crystal to the known ligand 17beta-estradiol resulted in a measurable frequency response, consistent with a change in conformation of the receptor with ligand binding. However, no response was observed when the receptor immobilized via the linker was exposed to the same ligand. The presence of the linker between the quartz surface and the protein receptor does not allow the crystal to sense the conformational change in the receptor that occurs with ligand binding. These results illustrate that the immobilization strategy used to bind the receptor to the sensor platform is key to eliciting an appropriate response from this biosensor. This study has important implications for the development of QCM-based sensors using protein receptors.

Adenosine triphosphate regulates the activity of guinea pig Cav1.2 channel by direct binding to the channel in a dose-dependent manner.

PubMed

Feng, Rui; Xu, Jianjun; Minobe, Etsuko; Kameyama, Asako; Yang, Lei; Yu, Lifeng; Hao, Liying; Kameyama, Masaki

2014-05-01

The present study is to investigate the mechanism by which ATP regulates Cav1.2 channel activity. Ventricular tissue was obtained from adult guinea pig hearts using collagenase. Ca(2+) channel activity was monitored using the patch-clamp technique. Proteins were purified using wheat germ agglutinin-Sepharose, and the concentration was determined using the Coomassie brilliant blue technique. ATP binding to the Cav1.2 channel was examined using the photoaffinity method. EDA-ATP-biotin maintains Ca(2+) channel activity in inside-out membrane patches. ATP directly bound to the Cav1.2 channel in a dose-dependent manner, and at least two molecules of ATP bound to one molecule of the Cav1.2 channel. Low levels of calmodulin (CaM) increased ATP binding to the Cav1.2 channel, but higher levels of CaM decreased ATP binding to the Cav1.2 channel. In addition, Ca(2+) was another regulator for ATP binding to the Cav1.2 channel. Furthermore, ATP bound to GST-fusion peptides of NH2-terminal region (amino acids 6-140) and proximal COOH-terminal region (amino acids 1,509-1,789) of the main subunit (α1C) of the Cav1.2 channel. Our data suggest that ATP might regulate Cav1.2 channel activity by directly binding to the Cav1.2 channel in a dose-dependent manner. In addition, the ATP-binding effect to the Cav1.2 channel was both CaM- and Ca(2+) dependent.

Application of plug-plug technique to ACE experiments for discovery of peptides binding to a larger target protein: a model study of calmodulin-binding fragments selected from a digested mixture of reduced BSA.

PubMed

Saito, Kazuki; Nakato, Mamiko; Mizuguchi, Takaaki; Wada, Shinji; Uchimura, Hiromasa; Kataoka, Hiroshi; Yokoyama, Shigeyuki; Hirota, Hiroshi; Kiso, Yoshiaki

2014-03-01

To discover peptide ligands that bind to a target protein with a higher molecular mass, a concise screening methodology has been established, by applying a "plug-plug" technique to ACE experiments. Exploratory experiments using three mixed peptides, mastoparan-X, β-endorphin, and oxytocin, as candidates for calmodulin-binding ligands, revealed that the technique not only reduces the consumption of the protein sample, but also increases the flexibility of the experimental conditions, by allowing the use of MS detection in the ACE experiments. With the plug-plug technique, the ACE-MS screening methodology successfully selected calmodulin-binding peptides from a random library with diverse constituents, such as protease digests of BSA. Three peptides with Kd values between 8-147 μM for calmodulin were obtained from a Glu-C endoprotease digest of reduced BSA, although the digest showed more than 70 peaks in its ACE-MS electropherogram. The method established here will be quite useful for the screening of peptide ligands, which have only low affinities due to their flexible chain structures but could potentially provide primary information for designing inhibitors against the target protein. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments

PubMed Central

Chèneby, Jeanne; Gheorghe, Marius; Artufel, Marie

2018-01-01

Abstract With this latest release of ReMap (http://remap.cisreg.eu), we present a unique collection of regulatory regions in human, as a result of a large-scale integrative analysis of ChIP-seq experiments for hundreds of transcriptional regulators (TRs) such as transcription factors, transcriptional co-activators and chromatin regulators. In 2015, we introduced the ReMap database to capture the genome regulatory space by integrating public ChIP-seq datasets, covering 237 TRs across 13 million (M) peaks. In this release, we have extended this catalog to constitute a unique collection of regulatory regions. Specifically, we have collected, analyzed and retained after quality control a total of 2829 ChIP-seq datasets available from public sources, covering a total of 485 TRs with a catalog of 80M peaks. Additionally, the updated database includes new search features for TR names as well as aliases, including cell line names and the ability to navigate the data directly within genome browsers via public track hubs. Finally, full access to this catalog is available online together with a TR binding enrichment analysis tool. ReMap 2018 provides a significant update of the ReMap database, providing an in depth view of the complexity of the regulatory landscape in human. PMID:29126285

Eyes that bind us: Gaze leading induces an implicit sense of agency.

PubMed

Stephenson, Lisa J; Edwards, S Gareth; Howard, Emma E; Bayliss, Andrew P

2018-03-01

Humans feel a sense of agency over the effects their motor system causes. This is the case for manual actions such as pushing buttons, kicking footballs, and all acts that affect the physical environment. We ask whether initiating joint attention - causing another person to follow our eye movement - can elicit an implicit sense of agency over this congruent gaze response. Eye movements themselves cannot directly affect the physical environment, but joint attention is an example of how eye movements can indirectly cause social outcomes. Here we show that leading the gaze of an on-screen face induces an underestimation of the temporal gap between action and consequence (Experiments 1 and 2). This underestimation effect, named 'temporal binding,' is thought to be a measure of an implicit sense of agency. Experiment 3 asked whether merely making an eye movement in a non-agentic, non-social context might also affect temporal estimation, and no reliable effects were detected, implying that inconsequential oculomotor acts do not reliably affect temporal estimations under these conditions. Together, these findings suggest that an implicit sense of agency is generated when initiating joint attention interactions. This is important for understanding how humans can efficiently detect and understand the social consequences of their actions. Copyright © 2017 Elsevier B.V. All rights reserved.

Direct replacement of antibodies with molecularly imprinted polymer nanoparticles in ELISA--development of a novel assay for vancomycin.

PubMed

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J Sarah; Piletska, Elena V; De Vargas Sansalvador, Isabel M Perez; Whitcombe, Michael J; Piletsky, Sergey A

2013-09-03

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop assays similar to the enzyme-linked immunosorbent assay (ELISA) is presented here for the first time. NanoMIPs were synthesized by a solid-phase approach with an immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering, and electron microscopy. Immobilization, blocking, and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a horseradish peroxidase-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range of 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was 3 orders of magnitude better than a previously described ELISA based on antibodies. In these experiments, nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA.

Load-dependent ADP binding to myosins V and VI: Implications for subunit coordination and function

PubMed Central

Oguchi, Yusuke; Mikhailenko, Sergey V.; Ohki, Takashi; Olivares, Adrian O.; De La Cruz, Enrique M.; Ishiwata, Shin'ichi

2008-01-01

Dimeric myosins V and VI travel long distances in opposite directions along actin filaments in cells, taking multiple steps in a “hand-over-hand” fashion. The catalytic cycles of both myosins are limited by ADP dissociation, which is considered a key step in the walking mechanism of these motors. Here, we demonstrate that external loads applied to individual actomyosin V or VI bonds asymmetrically affect ADP affinity, such that ADP binds weaker under loads assisting motility. Model-based analysis reveals that forward and backward loads modulate the kinetics of ADP binding to both myosins, although the effect is less pronounced for myosin VI. ADP dissociation is modestly accelerated by forward loads and inhibited by backward loads. Loads applied in either direction slow ADP binding to myosin V but accelerate binding to myosin VI. We calculate that the intramolecular load generated during processive stepping is ≈2 pN for both myosin V and myosin VI. The distinct load dependence of ADP binding allows these motors to perform different cellular functions. PMID:18509050

Specific binding of a Pop6/Pop7 heterodimer to the P3 stem of the yeast RNase MRP and RNase P RNAs.

PubMed

Perederina, Anna; Esakova, Olga; Koc, Hasan; Schmitt, Mark E; Krasilnikov, Andrey S

2007-10-01

Pop6 and Pop7 are protein subunits of Saccharomyces cerevisiae RNase MRP and RNase P. Here we show that bacterially expressed Pop6 and Pop7 form a soluble heterodimer that binds the RNA components of both RNase MRP and RNase P. Footprint analysis of the interaction between the Pop6/7 heterodimer and the RNase MRP RNA, combined with gel mobility assays, demonstrates that the Pop6/7 complex binds to a conserved region of the P3 domain. Binding of these proteins to the MRP RNA leads to local rearrangement in the structure of the P3 loop and suggests that direct interaction of the Pop6/7 complex with the P3 domain of the RNA components of RNases MRP and P may mediate binding of other protein components. These results suggest a role for a key element in the RNase MRP and RNase P RNAs in protein binding, and demonstrate the feasibility of directly studying RNA-protein interactions in the eukaryotic RNases MRP and P complexes.

Synergy of cAMP and calcium signaling pathways in CFTR regulation

PubMed Central

Bozoky, Zoltan; Ahmadi, Saumel; Milman, Tal; Kim, Tae Hun; Du, Kai; Di Paola, Michelle; Pasyk, Stan; Pekhletski, Roman; Keller, Jacob P.; Bear, Christine E.; Forman-Kay, Julie D.

2017-01-01

Cystic fibrosis results from mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, leading to defective apical chloride transport. Patients also experience overactivation of inflammatory processes, including increased calcium signaling. Many investigations have described indirect effects of calcium signaling on CFTR or other calcium-activated chloride channels; here, we investigate the direct response of CFTR to calmodulin-mediated calcium signaling. We characterize an interaction between the regulatory region of CFTR and calmodulin, the major calcium signaling molecule, and report protein kinase A (PKA)-independent CFTR activation by calmodulin. We describe the competition between calmodulin binding and PKA phosphorylation and the differential effects of this competition for wild-type CFTR and the major F508del mutant, hinting at potential therapeutic strategies. Evidence of CFTR binding to isolated calmodulin domains/lobes suggests a mechanism for the role of CFTR as a molecular hub. Together, these data provide insights into how loss of active CFTR at the membrane can have additional consequences besides impaired chloride transport. PMID:28242698

From intermolecular interactions to structures and properties of a novel cocrystal explosive: a first-principles study.

PubMed

Zhang, Lei; Wu, Ji-Zhou; Jiang, Sheng-Li; Yu, Yi; Chen, Jun

2016-09-29

By employing a first-principles method, we conducted a thorough study on a novel cocrystal explosive 1 : 1 NTO : TZTN and gained insight into the interaction-structure-property interrelationship. Mulliken bond orders, Hirshfeld surfaces, intermolecular binding energies, packing coefficients, and oxygen balance were calculated to analyze the intermolecular interactions and structures of the cocrystal explosive. The cocrystallization of NTO and TZTN molecules enhances the intermolecular binding force, which drives the synthesis of the cocrystal. However, the cocrystallization decreases the molecular packing density along the closest packed directions, which reduces the density by 10.5% and deteriorates the oxygen balance. All of these lead to a reduction in the detonation performance compared to NTO explosives. We have also proposed a new method to evaluate the impact sensitivity according to the lattice dynamics calculation. The cocrystal explosive has a lower impact sensitivity than TZTN but higher than NTO, which agrees well with experiments.

Serum Amyloid P Component (SAP) Interactome in Human Plasma Containing Physiological Calcium Levels.

PubMed

Poulsen, Ebbe Toftgaard; Pedersen, Kata Wolff; Marzeda, Anna Maria; Enghild, Jan J

2017-02-14

The pentraxin serum amyloid P component (SAP) is secreted by the liver and found in plasma at a concentration of approximately 30 mg/L. SAP is a 25 kDa homopentamer known to bind both protein and nonprotein ligands, all in a calcium-dependent manner. The function of SAP is unclear but likely involves the humoral innate immune system spanning the complement system, inflammation, and coagulation. Also, SAP is known to bind to the generic structure of amyloid deposits and possibly to protect them against proteolysis. In this study, we have characterized the SAP interactome in human plasma containing the physiological Ca 2+ concentration using SAP affinity pull-down and co-immunoprecipitation experiments followed by mass spectrometry analyses. The analyses resulted in the identification of 33 proteins, of which 24 were direct or indirect interaction partners not previously reported. The SAP interactome can be divided into categories that include apolipoproteins, the complement system, coagulation, and proteolytic regulation.

Formation and organization of protein domains in the immunological synapse

NASA Astrophysics Data System (ADS)

Carlson, Andreas; Mahadevan, L.

2014-11-01

The cellular basis for the adaptive immune response during antigen recognition relies on a specialized protein interface known as the immunological synapse. Here, we propose a minimal mathematical model for the dynamics of the IS that encompass membrane mechanics, hydrodynamics and protein kinetics. Simple scaling laws describe the dynamics of protein clusters as a function of membrane stiffness, rigidity of the adhesive proteins, and fluid flow in the synaptic cleft. Numerical simulations complement the scaling laws by quantifying the nucleation, growth and stabilization of proteins domains on the size of the cell. Direct comparison with experiment suggests that passive dynamics suffices to describe the short-time formation and organization of protein clusters, while the stabilization and long time dynamics of the synapse is likely determined by active cytoskeleton processes triggered by receptor binding. Our study reveals that the fluid flow generated by the interplay between membrane deformation and protein binding kinetics can assist immune cells in regulating protein sorting.

Multiplexed biomimetic lipid membranes on graphene by dip-pen nanolithography

PubMed Central

Hirtz, Michael; Oikonomou, Antonios; Georgiou, Thanasis; Fuchs, Harald; Vijayaraghavan, Aravind

2013-01-01

The application of graphene in sensor devices depends on the ability to appropriately functionalize the pristine graphene. Here we show the direct writing of tailored phospholipid membranes on graphene using dip-pen nanolithography. Phospholipids exhibit higher mobility on graphene compared with the commonly used silicon dioxide substrate, leading to well-spread uniform membranes. Dip-pen nanolithography allows for multiplexed assembly of phospholipid membranes of different functionalities in close proximity to each other. The membranes are stable in aqueous environments and we observe electronic doping of graphene by charged phospholipids. On the basis of these results, we propose phospholipid membranes as a route for non-covalent immobilization of various functional groups on graphene for applications in biosensing and biocatalysis. As a proof of principle, we demonstrate the specific binding of streptavidin to biotin-functionalized membranes. The combination of atomic force microscopy and binding experiments yields a consistent model for the layer organization within phospholipid stacks on graphene. PMID:24107937

Trigger loop folding determines transcription rate of Escherichia coli’s RNA polymerase

DOE PAGES

Mejia, Yara X.; Nudler, Evgeny; Bustamante, Carlos

2014-12-31

Two components of the RNA polymerase (RNAP) catalytic center, the bridge helix and the trigger loop (TL), have been linked with changes in elongation rate and pausing. Here, single molecule experiments with the WT and two TL-tip mutants of the Escherichia coli enzyme reveal that tip mutations modulate RNAP’s pause-free velocity, identifying TL conformational changes as one of two rate-determining steps in elongation. Consistent with this observation, we find a direct correlation between helix propensity of the modified amino acid and pause-free velocity. Moreover, nucleotide analogs affect transcription rate, suggesting that their binding energy also influences TL folding. A kineticmore » model in which elongation occurs in two steps, TL folding on nucleoside triphosphate (NTP) binding followed by NTP incorporation/pyrophosphate release, quantitatively accounts for these results. The TL plays no role in pause recovery remaining unfolded during a pause. The model suggests a finely tuned mechanism that balances transcription speed and fidelity.« less

Computational Calorimetry: High-Precision Calculation of Host–Guest Binding Thermodynamics

PubMed Central

2015-01-01

We present a strategy for carrying out high-precision calculations of binding free energy and binding enthalpy values from molecular dynamics simulations with explicit solvent. The approach is used to calculate the thermodynamic profiles for binding of nine small molecule guests to either the cucurbit[7]uril (CB7) or β-cyclodextrin (βCD) host. For these systems, calculations using commodity hardware can yield binding free energy and binding enthalpy values with a precision of ∼0.5 kcal/mol (95% CI) in a matter of days. Crucially, the self-consistency of the approach is established by calculating the binding enthalpy directly, via end point potential energy calculations, and indirectly, via the temperature dependence of the binding free energy, i.e., by the van’t Hoff equation. Excellent agreement between the direct and van’t Hoff methods is demonstrated for both host–guest systems and an ion-pair model system for which particularly well-converged results are attainable. Additionally, we find that hydrogen mass repartitioning allows marked acceleration of the calculations with no discernible cost in precision or accuracy. Finally, we provide guidance for accurately assessing numerical uncertainty of the results in settings where complex correlations in the time series can pose challenges to statistical analysis. The routine nature and high precision of these binding calculations opens the possibility of including measured binding thermodynamics as target data in force field optimization so that simulations may be used to reliably interpret experimental data and guide molecular design. PMID:26523125

A role for carbohydrate recognition in mammalian sperm-egg binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, Gary F., E-mail: clarkgf@health.missouri.edu

Highlights: • Mammalian sperm-egg binding as a carbohydrate dependent species recognition event. • The role of carbohydrate recognition in human, mouse and pig sperm-egg binding. • Historical perspective and future directions for research focused on gamete binding. - Abstract: Mammalian fertilization usually requires three sequential cell–cell interactions: (i) initial binding of sperm to the specialized extracellular matrix coating the egg known as the zona pellucida (ZP); (ii) binding of sperm to the ZP via the inner acrosomal membrane that is exposed following the induction of acrosomal exocytosis; and (iii) adhesion of acrosome-reacted sperm to the plasma membrane of the eggmore » cell, enabling subsequent fusion of these gametes. The focus of this review is on the initial binding of intact sperm to the mammalian ZP. Evidence collected over the past fifty years has confirmed that this interaction relies primarily on the recognition of carbohydrate sequences presented on the ZP by lectin-like egg binding proteins located on the plasma membrane of sperm. There is also evidence that the same carbohydrate sequences that mediate binding also function as ligands for lectins on lymphocytes that can inactivate immune responses, likely protecting the egg and the developing embryo up to the stage of blastocyst hatching. The literature related to initial sperm-ZP binding in the three major mammalian models (human, mouse and pig) is discussed. Historical perspectives and future directions for research related to this aspect of gamete adhesion are also presented.« less

The basic leucine zipper domain of c-Jun functions in transcriptional activation through interaction with the N terminus of human TATA-binding protein-associated factor-1 (human TAF(II)250).

PubMed

Lively, Tricia N; Nguyen, Tuan N; Galasinski, Shelly K; Goodrich, James A

2004-06-18

We previously reported that c-Jun binds directly to the N-terminal 163 amino acids of Homo sapiens TATA-binding protein-associated factor-1 (hsTAF1), causing a derepression of transcription factor IID (TFIID)-driven transcription (Lively, T. N., Ferguson, H. A., Galasinski, S. K., Seto, A. G., and Goodrich, J. A. (2001) J. Biol. Chem. 276, 25582-25588). This region of hsTAF1 binds TATA-binding protein to repress TFIID DNA binding and transcription. Here we show that the basic leucine zipper domain of c-Jun, which allows for DNA binding and homodimerization, is necessary and sufficient for interaction with hsTAF1. Interestingly, the isolated basic leucine zipper domain of c-Jun was able to derepress TFIID-directed basal transcription in vitro. Moreover, when the N-terminal region of hsTAF1 was added to in vitro transcription reactions and overexpressed in cells, it blocked c-Jun activation. c-Fos, another basic leucine zipper protein, did not interact with hsTAF1, but c-Fos/c-Jun heterodimers did bind the N terminus of hsTAF1. Our studies show that, in addition to dimerization and DNA binding, the well characterized basic leucine zipper domain of c-Jun functions in transcriptional activation by binding to the N terminus of hsTAF1 to derepress transcription.

A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment.

PubMed

Farajpour, Zahra; Rahbarizadeh, Fatemeh; Kazemi, Bahram; Ahmadvand, Davoud

2014-03-28

Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate. Copyright © 2014 Elsevier Inc. All rights reserved.

The PBX1 lupus susceptibility gene regulates CD44 expression

PubMed Central

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

2017-01-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

Myosin binding protein C positioned to play a key role in regulation of muscle contraction: structure and interactions of domain C1.

PubMed

Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Le Masurier, Clare; Gautel, Mathias; Pfuhl, Mark

2008-12-19

Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1-S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (K(d) of approximately 10-20 microM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1-S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1-C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation.

Myosin Binding Protein C Positioned to Play a Key Role in Regulation of Muscle Contraction: Structure and Interactions of Domain C1

PubMed Central

Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Masurier, Clare Le; Gautel, Mathias; Pfuhl, Mark

2008-01-01

Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1–S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (Kd of approximately 10–20 μM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1–S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1–C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation. PMID:18926831

Native ESI Mass Spectrometry Can Help to Avoid Wrong Interpretations from Isothermal Titration Calorimetry in Difficult Situations

NASA Astrophysics Data System (ADS)

Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe

2017-02-01

We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate Kd values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to Kd(ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (Kd, ΔH) pairs greatly improved the fits and yielded a second Kd(ITC) close to Kd(ESI-MS). The striking features are: (1) ITC detected a minor binding mode ( 20%) of `low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (Kd, ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments.

Native ESI Mass Spectrometry Can Help to Avoid Wrong Interpretations from Isothermal Titration Calorimetry in Difficult Situations.

PubMed

Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe

2017-02-01

We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate K d values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to K d (ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (K d , ΔH) pairs greatly improved the fits and yielded a second K d (ITC) close to K d (ESI-MS). The striking features are: (1) ITC detected a minor binding mode (~20%) of 'low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (K d , ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments. Graphical Abstract ᅟ.

Effects of chronic delta-9-tetrahydrocannabinol (THC) administration on neurotransmitter concentrations and receptor binding in the rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, S.F.; Newport, G.D.; Scallet, A.C.

THC is the major psychoactive constituent of marijuana and is also known as an hallucinogenic compound. Numerous reports have shown that large doses of THC produce significant alterations in various neurotransmitter systems. The present study was designed to determine whether chronic exposure to THC produces significant alterations in selected neurotransmitter systems (dopamine, serotonin, acetylcholine, GABAergic, benzodiazepine, and opiate) in the rat brain. In Experiment 1, male Sprague-Dawley rats were gavaged with vehicle, 10 or 20 mg THC/kg body weight daily, 5 days/week for 90 days. Animals were killed either 24 hours or two months after the last dose. Brains weremore » dissected into different regions for neurochemical analyses. Two months after the cessation of chronic administration, there was a significant decrease in GABA receptor binding in the hippocampus of animals in the high dose group. However, no other significant changes were found in neurotransmitter receptor binding characteristics in the hippocampus or in neurotransmitter concentrations in the caudate nucleus, hypothalamus or septum after chronic THC administration. In an attempt to replicate the GABA receptor binding changes and also to determine the (35S)TBPS binding in hippocampus, we designed Experiment 2. In this experiment, we dosed the animals by gavage with 0, 5, 10 or 20 mg THC/kg daily, 5 days/week or with 20 mg THC/kg Monday through Thursday and 60 mg/kg on Friday for 90 days. Results from this experiment failed to replicate the dose-dependent effect of THC on GABA receptor binding in hippocampus. Modulation of (35S)TBPS binding by GABA or 3 alpha-OH-DHP or inhibition by cold TBPS in frontal cortex did not show any significant dose-related effects.« less

How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.

PubMed

Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit

2017-07-25

Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright © 2017. Published by Elsevier Inc.

Dimerization Domain of Retinal Membrane Guanylyl Cyclase 1 (RetGC1) Is an Essential Part of Guanylyl Cyclase-activating Protein (GCAP) Binding Interface.

PubMed

Peshenko, Igor V; Olshevskaya, Elena V; Dizhoor, Alexander M

2015-08-07

The photoreceptor-specific proteins guanylyl cyclase-activating proteins (GCAPs) bind and regulate retinal membrane guanylyl cyclase 1 (RetGC1) but not natriuretic peptide receptor A (NPRA). Study of RetGC1 regulation in vitro and its association with fluorescently tagged GCAP in transfected cells showed that R822P substitution in the cyclase dimerization domain causing congenital early onset blindness disrupted RetGC1 ability to bind GCAP but did not eliminate its affinity for another photoreceptor-specific protein, retinal degeneration 3 (RD3). Likewise, the presence of the NPRA dimerization domain in RetGC1/NPRA chimera specifically disabled binding of GCAPs but not of RD3. In subsequent mapping using hybrid dimerization domains in RetGC1/NPRA chimera, multiple RetGC1-specific residues contributed to GCAP binding by the cyclase, but the region around Met(823) was the most crucial. Either positively or negatively charged residues in that position completely blocked GCAP1 and GCAP2 but not RD3 binding similarly to the disease-causing mutation in the neighboring Arg(822). The specificity of GCAP binding imparted by RetGC1 dimerization domain was not directly related to promoting dimerization of the cyclase. The probability of coiled coil dimer formation computed for RetGC1/NPRA chimeras, even those incapable of binding GCAP, remained high, and functional complementation tests showed that the RetGC1 active site, which requires dimerization of the cyclase, was formed even when Met(823) or Arg(822) was mutated. These results directly demonstrate that the interface for GCAP binding on RetGC1 requires not only the kinase homology region but also directly involves the dimerization domain and especially its portion containing Arg(822) and Met(823). © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Steady-State Fluorescence Anisotropy to Investigate Flavonoids Binding to Proteins

ERIC Educational Resources Information Center

Ingersoll, Christine M.; Strollo, Christen M.

2007-01-01

The steady-state fluorescence anisotropy is employed to study the binding of protein of a model protein, human serum albumin, to a commonly used flavonoid, quercetin. The experiment describes the thermodynamics, as well as the biochemical interactions of such binding effectively.

Single molecule junction conductance and binding geometry

NASA Astrophysics Data System (ADS)

Kamenetska, Maria

This Thesis addresses the fundamental problem of controlling transport through a metal-organic interface by studying electronic and mechanical properties of single organic molecule-metal junctions. Using a Scanning Tunneling Microscope (STM) we image, probe energy-level alignment and perform STM-based break junction (BJ) measurements on molecules bound to a gold surface. Using Scanning Tunneling Microscope-based break-junction (STM-BJ) techniques, we explore the effect of binding geometry on single-molecule conductance by varying the structure of the molecules, metal-molecule binding chemistry and by applying sub-nanometer manipulation control to the junction. These experiments are performed both in ambient conditions and in ultra high vacuum (UHV) at cryogenic temperatures. First, using STM imaging and scanning tunneling spectroscopy (STS) measurements we explore binding configurations and electronic properties of an amine-terminated benzene derivative on gold. We find that details of metal-molecule binding affect energy-level alignment at the interface. Next, using the STM-BJ technique, we form and rupture metal-molecule-metal junctions ˜104 times to obtain conductance-vs-extension curves and extract most likely conductance values for each molecule. With these measurements, we demonstrated that the control of junction conductance is possible through a choice of metal-molecule binding chemistry and sub-nanometer positioning. First, we show that molecules terminated with amines, sulfides and phosphines bind selectively on gold and therefore demonstrate constant conductance levels even as the junction is elongated and the metal-molecule attachment point is modified. Such well-defined conductance is also obtained with paracyclophane molecules which bind to gold directly through the pi system. Next, we are able to create metal-molecule-metal junctions with more than one reproducible conductance signatures that can be accessed by changing junction geometry. In the case of pyridine-linked molecules, conductance can be reliably switched between two distinct conductance states using sub-nanometer mechanical manipulation. Using a methyl sulfide linker attached to an oligoene backbone, we are able to create a 3-nm-long molecular potentiometer, whose resistance can be tuned exponentially with Angstom-scale modulations in metal-molecule configuration. These experiments points to a new paradigm for attaining reproducible electrical characteristics of metal-organic devices which involves controlling linker-metal chemistry rather than fabricating identically structured metal-molecule interfaces. By choosing a linker group which is either insensitive to or responds reproducibly to changes in metal-molecule configuration, one can design single molecule devices with functionality more complex than a simple resistor. These ambient temperature experiments were combined with UHV conductance measurements performed in a commercial STM on amine-terminated benzene derivatives which conduct through a non-resonant tunneling mechanism, at temperatures varying from 5 to 300 Kelvin. Our results indicate that while amine-gold binding remains selective irrespective of environment, conductance is not temperature independent, in contrast to what is expected for a tunneling mechanism. Furthermore, using temperature-dependent measurements in ambient conditions we find that HOMO-conducting amines and LUMO-conducting pyridines show opposite dependence of conductance on temperature. These results indicate that energy-level alignment between the molecule and the electrodes changes as a result of varying electrode structure at different temperatures. We find that temperature can serve as a knob with which to tune transport properties of single molecule-metal junctions.

PDK1-mediated activation of MRCKα regulates directional cell migration and lamellipodia retraction

PubMed Central

Gagliardi, Paolo Armando; di Blasio, Laura; Puliafito, Alberto; Seano, Giorgio; Sessa, Roberto; Chianale, Federica; Leung, Thomas; Bussolino, Federico

2014-01-01

Directional cell migration is of paramount importance in both physiological and pathological processes, such as development, wound healing, immune response, and cancer invasion. Here, we report that 3-phosphoinositide-dependent kinase 1 (PDK1) regulates epithelial directional migration and invasion by binding and activating myotonic dystrophy kinase–related CDC42-binding kinase α (MRCKα). We show that the effect of PDK1 on cell migration does not involve its kinase activity but instead relies on its ability to bind membrane phosphatidylinositol (3,4,5)-trisphosphate. Upon epidermal growth factor (EGF) stimulation, PDK1 and MRCKα colocalize at the cell membrane in lamellipodia. We demonstrate that PDK1 positively modulates MRCKα activity and drives its localization within lamellipodia. Likewise, the retraction phase of lamellipodia is controlled by PDK1 through an MRCKα-dependent mechanism. In summary, we discovered a functional pathway involving PDK1-mediated activation of MRCKα, which links EGF signaling to myosin contraction and directional migration. PMID:25092657

The Flavonoid Apigenin Downregulates CDK1 by Directly Targeting Ribosomal Protein S9

PubMed Central

Iizumi, Yosuke; Oishi, Masakatsu; Taniguchi, Tomoyuki; Goi, Wakana; Sowa, Yoshihiro; Sakai, Toshiyuki

2013-01-01

Flavonoids have been reported to inhibit tumor growth by causing cell cycle arrest. However, little is known about the direct targets of flavonoids in tumor growth inhibition. In the present study, we developed a novel method using magnetic FG beads to purify flavonoid-binding proteins, and identified ribosomal protein S9 (RPS9) as a binding partner of the flavonoid apigenin. Similar to treatment with apigenin, knockdown of RPS9 inhibited the growth of human colon cancer cells at the G2/M phase by downregulating cyclin-dependent kinase 1 (CDK1) expression at the promoter level. Furthermore, knockdown of RPS9 suppressed G2/M arrest caused by apigenin. These results suggest that apigenin induces G2/M arrest at least partially by directly binding and inhibiting RPS9 which enhances CDK1 expression. We therefore raise the possibility that identification of the direct targets of flavonoids may contribute to the discovery of novel molecular mechanisms governing tumor growth. PMID:24009741

Allosteric conformational barcodes direct signaling in the cell.

PubMed

Nussinov, Ruth; Ma, Buyong; Tsai, Chung-Jung; Csermely, Peter

2013-09-03

The cellular network is highly interconnected. Pathways merge and diverge. They proceed through shared proteins and may change directions. How are cellular pathways controlled and their directions decided, coded, and read? These questions become particularly acute when we consider that a small number of pathways, such as signaling pathways that regulate cell fates, cell proliferation, and cell death in development, are extensively exploited. This review focuses on these signaling questions from the structural standpoint and discusses the literature in this light. All co-occurring allosteric events (including posttranslational modifications, pathogen binding, and gain-of-function mutations) collectively tag the protein functional site with a unique barcode. The barcode shape is read by an interacting molecule, which transmits the signal. A conformational barcode provides an intracellular address label, which selectively favors binding to one partner and quenches binding to others, and, in this way, determines the pathway direction, and, eventually, the cell's response and fate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

PubMed

Pessler, F; Pendergrast, P S; Hernandez, N

1997-07-01

The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes.

Efavirenz directly modulates the oestrogen receptor and induces breast cancer cell growth.

PubMed

Sikora, M J; Rae, J M; Johnson, M D; Desta, Z

2010-10-01

Efavirenz-based HIV therapy is associated with breast hypertrophy and gynaecomastia. Here, we tested the hypothesis that efavirenz induces gynaecomastia through direct binding and modulation of the oestrogen receptor (ER). To determine the effect of efavirenz on growth, the oestrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under oestrogen-free conditions in the presence or absence of the anti-oestrogen ICI 182,780. Cells treated with 17β-oestradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure the ER binding affinity of efavirenz. Efavirenz induced growth in MCF-7 cells with an estimated effective concentration for half-maximal growth (EC(50)) of 15.7 μM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to the ER [inhibitory concentration for half maximal binding (IC(50)) of ∼52 μM] at a roughly 1000-fold higher concentration than observed with 17β-oestradiol. Our data suggest that efavirenz-induced gynaecomastia may be caused, at least in part, by drug-induced ER activation in breast tissues.

Direct observation of a surface resonance state and surface band inversion control in black phosphorus

NASA Astrophysics Data System (ADS)

Ehlen, N.; Sanna, A.; Senkovskiy, B. V.; Petaccia, L.; Fedorov, A. V.; Profeta, G.; Grüneis, A.

2018-01-01

We report a Cs-doping-induced band inversion and the direct observation of a surface resonance state with an elliptical Fermi surface in black phosphorus (BP) using angle-resolved photoemission spectroscopy. By selectively inducing a higher electron concentration (1.7 ×1014cm-2 ) in the topmost layer, the changes in the Coulomb potential are sufficiently large to cause surface band inversion between the parabolic valence band of BP and a parabolic surface state around the Γ point of the BP Brillouin zone. Tight-binding calculations reveal that band gap openings at the crossing points in the two high-symmetry directions of the Brillouin zone require out-of-plane hopping and breaking of the glide mirror symmetry. Ab initio calculations are in very good agreement with the experiment if a stacking fault on the BP surface is taken into account. The demonstrated level of control over the band structure suggests the potential application of few-layer phosphorene in topological field-effect transistors.

The Antitumor Effect of Single-domain Antibodies Directed Towards Membrane-associated Catalase and Superoxide Dismutase.

PubMed

Bauer, Georg; Motz, Manfred

2016-11-01

Neutralizing single-domain antibodies directed towards catalase or superoxide dismutase (SOD) caused efficient reactivation of intercellular reactive oxygen species/reactive nitrogen species (ROS/RNS)-dependent apoptosis-inducing signaling specifically in human tumor cells. Single-domain antibodies targeted tumor cell-specific membrane-associated SOD and catalase, but not the corresponding intracellular enzymes. They were shown to be about 200-fold more effective than corresponding classical recombinant antigen-binding fragments and more than four log steps more efficient than monoclonal antibodies. Combined addition of single-domain antibodies against catalase and SOD caused a remarkable synergistic effect. Proof-of-concept experiments in immunocompromised mice using human tumor xenografts and single-domain antibodies directed towards SOD showed an inhibition of tumor growth. Neutralizing single-domain antibodies directed to catalase and SOD also caused a very strong synergistic effect with the established chemotherapeutic agent taxol, indicating an overlap of signaling pathways. This effect might also be useful in order to avoid unwanted side-effects and to drastically lower the costs for taxol-based therapy. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE PAGES

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.; ...

2017-08-30

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

[Propranolol beta-blocker decrease in the concentration of high-affinity binding sites for calcium ions by sarcolemma membranes of the rat heart].

PubMed

Seleznev, Iu M; Martynov, A V; Smirnov, V N

1982-05-01

In vivo administration of propranolol considerably inhibits the isoproterenol-stimulated increase in 45Ca accumulation by the myocardium and completely eliminates the potentiation of isoproterenol effect by hydrocortisone. A significant lowering of the concentration of high affinity binding sites for calcium in the sarcolemmal membranes can be produced by propranolol in vitro. Under these conditions, the glucocorticoids do not change the sarcolemmal Ca2+-binding parameters or modulate the propranolol effect. Therefore, for the manifestation of glucocorticoid action to be brought about, the integrity of the cells is apparently required, while propranolol seems to change calcium binding by direct interaction with the sarcolemmal membranes. It is suggested that in vivo propranolol inhibition of catecholamine effect on calcium ion accumulation by the myocardium depends on the interaction with the beta-receptors and direct modulation of the concentration of high affinity binding sites for calcium ions on the surface of the sarcolemma.

Targeting the FANCJ–BRCA1 interaction promotes a switch from recombination to polη-dependent bypass

PubMed Central

Xie, J; Litman, R; Wang, S; Peng, M; Guillemette, S; Rooney, T; Cantor, SB

2010-01-01

BRCA1 and the DNA helicase FANCJ (also known as BACH1 or BRIP1) have common functions in breast cancer suppression and DNA repair. However, the functional significance of the direct interaction between BRCA1 and FANCJ remains unclear. Here, we have discovered that BRCA1 binding to FANCJ regulates DNA damage repair choice. Thus, when FANCJ binding to BRCA1 is ablated, the molecular mechanism chosen for the repair of damaged DNA is dramatically altered. Specifically, a FANCJ protein that cannot be phosphorylated at serine 990 or bind BRCA1 inhibits DNA repair via homologous recombination and promotes polη-dependent bypass. Furthermore, the polη-dependent bypass promoted by FANCJ requires the direct binding to the mismatch repair (MMR) protein, MLH1. Together, our findings implicate that in human cells BRCA1 binding to FANCJ is critical to regulate DNA repair choice and promote genomic stability. Moreover, unregulated FANCJ function could be associated with cancer and/or chemoresistance. PMID:20173781

Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC.

PubMed

Chen, Qiang; Kinde, Monica N; Arjunan, Palaniappa; Wells, Marta M; Cohen, Aina E; Xu, Yan; Tang, Pei

2015-09-08

Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6') and A244(13'). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6' or 13' support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs.

Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC

PubMed Central

Chen, Qiang; Kinde, Monica N.; Arjunan, Palaniappa; Wells, Marta M.; Cohen, Aina E.; Xu, Yan; Tang, Pei

2015-01-01

Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6′) and A244(13′). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6′ or 13′ support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs. PMID:26346220

A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions.

PubMed

Tian, Qingyun; Zhao, Shuai; Liu, Chuanju

2014-01-01

The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.

Collective Dynamics of Periplasmic Glutamine Binding Protein upon Domain Closure

PubMed Central

Loeffler, Hannes H.; Kitao, Akio

2009-01-01

The glutamine binding protein is a vital component of the associated ATP binding cassette transport systems responsible for the uptake of glutamine into the cell. We have investigated the global movements of this protein by molecular dynamics simulations and principal component analysis (PCA). We confirm that the most dominant mode corresponds to the biological function of the protein, i.e., a hinge-type motion upon ligand binding. The closure itself was directly observed from two independent trajectories whereby PCA was used to elucidate the nature of this closing reaction. Two intermediary states are identified and described in detail. The ligand binding induces the structural change of the hinge regions from a discontinuous β-sheet to a continuous one, which also enhances softness of the hinge and modifies the direction of hinge motion to enable closing. We also investigated the convergence behavior of PCA modes, which were found to converge rather quickly when the associated magnitudes of the eigenvalues are well separated. PMID:19883597

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

PML/RARA oxidation and arsenic binding initiate the antileukemia response of As2O3.

PubMed

Jeanne, Marion; Lallemand-Breitenbach, Valérie; Ferhi, Omar; Koken, Marcel; Le Bras, Morgane; Duffort, Stéphanie; Peres, Laurent; Berthier, Caroline; Soilihi, Hassane; Raught, Brian; de Thé, Hugues

2010-07-13

As(2)O(3) cures acute promyelocytic leukemia (APL) by initiating PML/RARA oncoprotein degradation, through sumoylation of its PML moiety. However, how As(2)O(3) initiates PML sumoylation has remained largely unexplained. As(2)O(3) binds vicinal cysteines and increases reactive oxygen species (ROS) production. We demonstrate that upon As(2)O(3) exposure, PML undergoes ROS-initiated intermolecular disulfide formation and binds arsenic directly. Disulfide-linked PML or PML/RARA multimers form nuclear matrix-associated nuclear bodies (NBs), become sumoylated and are degraded. Hematopoietic progenitors transformed by an As(2)O(3)-binding PML/RARA mutant exhibit defective As(2)O(3) response. Conversely, nonarsenical oxidants elicit PML/RARA multimerization, NB-association, degradation, and leukemia response in vivo, but do not affect PLZF/RARA-driven APLs. Thus, PML oxidation regulates NB-biogenesis, while oxidation-enforced PML/RARA multimerization and direct arsenic-binding cooperate to enforce APL's exquisite As(2)O(3) sensitivity. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Mycoplasma infection of cell lines can simulate the expression of Fc receptors by binding of the carbohydrate moiety of antibodies.

PubMed

Lemke, H; Krausse, R; Lorenzen, J; Havsteen, B

1985-05-01

During the production of Fc receptor (FcR)-bearing hybridomas it was observed with a particular monoclonal anti-sheep red blood cell antibody (anti-SRBC 1/5, IgG1) that the contamination with Mycoplasma arginini of in vitro cultured cell lines leads to an apparent FcR activity. This property did not correspond with the serological typing since other antibodies of the same isotype could not support FcR rosette formation. Another mycoplasma strain M. orale lacked this property. Analysis of the binding reaction revealed that M. arginini contains a lectin which binds the carbohydrate moiety of the anti-SRBC 1/5 antibody, i.e. anti-SRBC 1/5 synthesized under the influence of tunicamycin or deglycosylated by NaIO4 oxidation did not support rosette formation. These data suggest that binding of antibodies to certain mycoplasma strains may be a pathogenic factor during mycoplasma infections by masking the microorganisms with the host's own defense molecules. The experiments with M. arginini-infected cell lines gain immunological importance since we obtained identical results with staphylococcal protein A, as another bacteriological FcR, and cell lines expressing intrinsic membrane FcR. Although it is an open question whether the glycoconjugates are directly bound by the FcR or else by influencing the three-dimensional structure of the antibodies, it seems possible that FcR in general may be lectins.

GIGANTEA directly activates Flowering Locus T in Arabidopsis thaliana.

PubMed

Sawa, Mariko; Kay, Steve A

2011-07-12

Plants perceive environmental signals such as day length and temperature to determine optimal timing for the transition from vegetative to floral stages. Arabidopsis flowers under long-day conditions through the CONSTANS (CO)-FLOWERING LOCUS T (FT) regulatory module. It is thought that the environmental cues for photoperiodic control of flowering are initially perceived in the leaves. We have previously shown that GIGANTEA (GI) regulates the timing of CO expression, together with FLAVIN-BINDING, KELCH REPEAT, F BOX protein 1. Normally, CO and FT are expressed exclusively in vascular bundles, whereas GI is expressed in various tissues. To better elucidate the role of tissue-specific expression of GI in the flowering pathway, we established transgenic lines in which GI is expressed exclusively in mesophyll, vascular bundles, epidermis, shoot apical meristem, or root. We found that GI expressed in either mesophyll or vascular bundles rescues the late-flowering phenotype of the gi-2 loss-of-function mutant under both short-day and long-day conditions. Interestingly, GI expressed in mesophyll or vascular tissues increases FT expression without up-regulating CO expression under short-day conditions. Furthermore, we examined the interaction between GI and FT repressors in mesophyll. We found that GI can bind to three FT repressors: SHORT VEGETATIVE PHASE (SVP), TEMPRANILLO (TEM)1, and TEM2. Finally, our chromatin immunoprecipitation experiments showed that GI binds to FT promoter regions that are near the SVP binding sites. Taken together, our data further elucidate the multiple roles of GI in the regulation of flowering time.

Direct detection of methicillin resistance in Staphylococcus aureus in blood culture broth by use of a penicillin binding protein 2a latex agglutination test.

PubMed

Qian, Qinfang; Venkataraman, Lata; Kirby, James E; Gold, Howard S; Yamazumi, Toshiaki

2010-04-01

We studied the utility of performing a penicillin binding protein 2a latex agglutination (PBP-LA) assay directly on Bactec blood culture broth samples containing Staphylococcus aureus to rapidly detect methicillin resistance. The sensitivity, specificity, positive predictive value, and negative predictive value of this method were 94.1%, 97.5%, 98%, and 92.9%, respectively.

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

On the interaction mechanisms of a p53 peptide and nutlin with the MDM2 and MDMX proteins: a Brownian dynamics study.

PubMed

ElSawy, Karim M; Verma, Chandra S; Joseph, Thomas L; Lane, David P; Twarock, Reidun; Caves, Leo S D

2013-02-01

The interaction of p53 with its regulators MDM2 and MDMX plays a major role in regulating the cell cycle. Inhibition of this interaction has become an important therapeutic strategy in oncology. Although MDM2 and MDMX share a very high degree of sequence/structural similarity, the small-molecule inhibitor nutlin appears to be an efficient inhibitor only of the p53-MDM2 interaction. Here, we investigate the mechanism of interaction of nutlin with these two proteins and contrast it with that of p53 using Brownian dynamics simulations. In contrast to earlier attempts to examine the bound states of the partners, here we locate initial reaction events in these interactions by identifying the regions of space around MDM2/MDMX, where p53/nutlin experience associative encounters with prolonged residence times relative to that in bulk solution. We find that the initial interaction of p53 with MDM2 is long-lived relative to nutlin, but, unlike nutlin, it takes place at the N- and C termini of the MDM2 protein, away from the binding site, suggestive of an allosteric mechanism of action. In contrast, nutlin initially interacts with MDM2 directly at the clefts of the binding site. The interaction of nutlin with MDMX, however, is very short-lived compared with MDM2 and does not show such direct initial interactions with the binding site. Comparison of the topology of the electrostatic potentials of MDM2 and MDMX and the locations of the initial encounters with p53/nutlin in tandem with structure-based sequence alignment revealed that the origin of the diminished activity of nutlin toward MDMX relative to MDM2 may stem partly from the differing topologies of the electrostatic potentials of the two proteins. Glu25 and Lys51 residues underpin these topological differences and appear to collectively play a key role in channelling nutlin directly toward the binding site on the MDM2 surface and are absent in MDMX. The results, therefore, provide new insight into the mechanism of p53/nutlin interactions with MDM2 and MDMX and could potentially have a broader impact on anticancer drug optimization strategies.

Differential 3-bromopyruvate inhibition of cytosolic and mitochondrial human serine hydroxymethyltransferase isoforms, key enzymes in cancer metabolic reprogramming.

PubMed

Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto

2016-11-01

The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

The FACT Complex Promotes Avian Leukosis Virus DNA Integration.

PubMed

Winans, Shelby; Larue, Ross C; Abraham, Carly M; Shkriabai, Nikolozi; Skopp, Amelie; Winkler, Duane; Kvaratskhelia, Mamuka; Beemon, Karen L

2017-04-01

All retroviruses need to integrate a DNA copy of their genome into the host chromatin. Cellular proteins regulating and targeting lentiviral and gammaretroviral integration in infected cells have been discovered, but the factors that mediate alpharetroviral avian leukosis virus (ALV) integration are unknown. In this study, we have identified the FACT protein complex, which consists of SSRP1 and Spt16, as a principal cellular binding partner of ALV integrase (IN). Biochemical experiments with purified recombinant proteins show that SSRP1 and Spt16 are able to individually bind ALV IN, but only the FACT complex effectively stimulates ALV integration activity in vitro Likewise, in infected cells, the FACT complex promotes ALV integration activity, with proviral integration frequency varying directly with cellular expression levels of the FACT complex. An increase in 2-long-terminal-repeat (2-LTR) circles in the depleted FACT complex cell line indicates that this complex regulates the ALV life cycle at the level of integration. This regulation is shown to be specific to ALV, as disruption of the FACT complex did not inhibit either lentiviral or gammaretroviral integration in infected cells. IMPORTANCE The majority of human gene therapy approaches utilize HIV-1- or murine leukemia virus (MLV)-based vectors, which preferentially integrate near genes and regulatory regions; thus, insertional mutagenesis is a substantial risk. In contrast, ALV integrates more randomly throughout the genome, which decreases the risks of deleterious integration. Understanding how ALV integration is regulated could facilitate the development of ALV-based vectors for use in human gene therapy. Here we show that the FACT complex directly binds and regulates ALV integration efficiency in vitro and in infected cells. Copyright © 2017 American Society for Microbiology.

Evaluation of 177Lu[Lu]-CHX-A″-DTPA-6A10 Fab as a radioimmunotherapy agent targeting carbonic anhydrase XII.

PubMed

Fiedler, L; Kellner, M; Gosewisch, A; Oos, R; Böning, G; Lindner, S; Albert, N; Bartenstein, P; Reulen, H-J; Zeidler, R; Gildehaus, F J

2018-05-01

Due to their infiltrative growth behavior, gliomas have, even after surgical resection, a high recurrence tendency. The approach of intracavitary radioimmunotherapy (RIT) is aimed at inhibiting tumor re-growth by directly administering drugs into the resection cavity (RC). Direct application of the radioconjugate into the RC has the advantage of bypassing the blood-brain barrier, which allows the administration of higher radiation doses than systemic application. Carbonic anhydrase XII (CA XII) is highly expressed on glioma cells while being absent from normal brain and thus an attractive target molecule for RIT. We evaluated a CA XII-specific 6A10 Fab (fragment antigen binding) labelled with 177 Lu as an agent for RIT. 6A10 Fab fragment was modified and radiolabelled with 177 Lu and characterized by MALDI-TOF, flow cytometry and radio-TLC. In vitro stability was determined under physiological conditions. Biodistribution studies, autoradiography tumor examinations and planar scintigraphy imaging were performed on SCID-mice bearing human glioma xenografts. The in vitro CA XII binding capacity of the modified Fab was confirmed. Radiochemical purity was determined to be >90% after 72 h of incubation under physiological conditions. Autoradiography experiments proved the specific binding of the Fab to CA XII on tumor cells. Biodistribution studies revealed a tumor uptake of 3.0%ID/g after 6 h and no detectable brain uptake. The tumor-to-contralateral ratio of 10/1 was confirmed by quantitative planar scintigraphy. The radiochemical stability in combination with a successful in vivo tumor uptake shows the potential suitability for future RIT applications with the 6A10 Fab. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification and Characterization of FAM124B as a Novel Component of a CHD7 and CHD8 Containing Complex

PubMed Central

Batsukh, Tserendulam; Schulz, Yvonne; Wolf, Stephan; Rabe, Tamara I.; Oellerich, Thomas; Urlaub, Henning; Schaefer, Inga-Marie; Pauli, Silke

2012-01-01

Background Mutations in the chromodomain helicase DNA binding protein 7 gene (CHD7) lead to CHARGE syndrome, an autosomal dominant multiple malformation disorder. Proteins involved in chromatin remodeling typically act in multiprotein complexes. We previously demonstrated that a part of human CHD7 interacts with a part of human CHD8, another chromodomain helicase DNA binding protein presumably being involved in the pathogenesis of neurodevelopmental (NDD) and autism spectrum disorders (ASD). Because identification of novel CHD7 and CHD8 interacting partners will provide further insights into the pathogenesis of CHARGE syndrome and ASD/NDD, we searched for additional associated polypeptides using the method of stable isotope labeling by amino acids in cell culture (SILAC) in combination with mass spectrometry. Principle findings The hitherto uncharacterized FAM124B (Family with sequence similarity 124B) was identified as a potential interaction partner of both CHD7 and CHD8. We confirmed the result by co-immunoprecipitation studies and showed a direct binding to the CHD8 part by direct yeast two hybrid experiments. Furthermore, we characterized FAM124B as a mainly nuclear localized protein with a widespread expression in embryonic and adult mouse tissues. Conclusion Our results demonstrate that FAM124B is a potential interacting partner of a CHD7 and CHD8 containing complex. From the overlapping expression pattern between Chd7 and Fam124B at murine embryonic day E12.5 and the high expression of Fam124B in the developing mouse brain, we conclude that Fam124B is a novel protein possibly involved in the pathogenesis of CHARGE syndrome and neurodevelopmental disorders. PMID:23285124

Protein-nucleotide contacts in motor proteins detected by DNP-enhanced solid-state NMR.

PubMed

Wiegand, Thomas; Liao, Wei-Chih; Ong, Ta Chung; Däpp, Alexander; Cadalbert, Riccardo; Copéret, Christophe; Böckmann, Anja; Meier, Beat H

2017-11-01

DNP (dynamic nuclear polarization)-enhanced solid-state NMR is employed to directly detect protein-DNA and protein-ATP interactions and identify the residue type establishing the intermolecular contacts. While conventional solid-state NMR can detect protein-DNA interactions in large oligomeric protein assemblies in favorable cases, it typically suffers from low signal-to-noise ratios. We show here, for the oligomeric DnaB helicase from Helicobacter pylori complexed with ADP and single-stranded DNA, that this limitation can be overcome by using DNP-enhanced spectroscopy. Interactions are established by DNP-enhanced 31 P- 13 C polarization-transfer experiments followed by the recording of a 2D 13 C- 13 C correlation experiment. The NMR spectra were obtained in less than 2 days and allowed the identification of residues of the motor protein involved in nucleotide binding.

Binding affinities of cationic dyes in the presence of activated charcoal and anionic surfactant in the premicellar region

NASA Astrophysics Data System (ADS)

Ali, Farman; Ibrahim, Muhammad; Khan, Fawad; Bibi, Iram; Shah, Syed W. H.

2018-03-01

Binding preferences of cationic dyes malachite green and methylene blue in a mixed charcoal-sodium dodecyl sulfate system have been investigated using UV-visible absorption spectroscopy. The dye adsorption shows surfactant-dependent patterns, indicating diverse modes of interactions. At low surfactant concentration, a direct binding to charcoal is preferred. Comparatively greater quantities of surfactant lead to attachment of dye-surfactant complex to charcoal through hydrophobic interactions. A simple model was employed for determination of equilibrium constant K eq and concentration of dye-surfactant ion pair N DS for both dyes. The values of binding parameters revealed that malachite green was directly adsorbed onto charcoal, whereas methylene blue was bound through surfactant monomers. The model is valid for low surfactant concentrations in the premicellar region. These findings have significance for material and environmental sciences.