Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Electrostatically Biased Binding of Kinesin to Microtubules

PubMed Central

Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

2011-01-01

The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

PubMed Central

Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

2012-01-01

F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

Structural basis for collagen recognition by the immune receptor OSCAR.

PubMed

Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

2016-02-04

The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

Multitargeting by curcumin as revealed by molecular interaction studies

PubMed Central

Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

2012-01-01

Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

2016-03-24

The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

2011-07-29

Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou,Z.; Zhen, J.; Karpowich, N.

2007-01-01

Tricyclic antidepressants exert their pharmacological effect -- inhibiting the reuptake of serotonin, norepinephrine, and dopamine -- by directly blocking neurotransmitter transporters (SERT, NET, and DAT, respectively) in the presynaptic membrane. The drug-binding site and the mechanism of this inhibition are poorly understood. We determined the crystal structure at 2.9 angstroms of the bacterial leucine transporter (LeuT), a homolog of SERT, NET, and DAT, in complex with leucine and the antidepressant desipramine. Desipramine binds at the inner end of the extracellular cavity of the transporter and is held in place by a hairpin loop and by a salt bridge. This bindingmore » site is separated from the leucine-binding site by the extracellular gate of the transporter. By directly locking the gate, desipramine prevents conformational changes and blocks substrate transport. Mutagenesis experiments on human SERT and DAT indicate that both the desipramine-binding site and its inhibition mechanism are probably conserved in the human neurotransmitter transporters.« less

In situ detection of warfarin using time-correlated single-photon counting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosengren, Annika M.; Karlsson, Bjoern C.G.; Naeslund, Inga

Highlights: {yields} Direct in situ measurement of specific isomeric forms of the anticoagulant warfarin. {yields} TCSPC spectroscopy in conjunction with synthetic Sudlow I binding site receptors. {yields} Development of sensor principle for use in clinical and environmental monitoring. -- Abstract: Here we report on a novel method for the direct in situ measurement of specific isomeric forms of the anticoagulant warfarin using time correlated single-photon counting (TCSPC) spectroscopy in conjunction with synthetic Sudlow I binding site receptors. The method is highly robust over the clinically significant concentration range, and demonstrates the potential of the binding site mimics in conjunction withmore » the spectroscopic strategy employed here for the determination of this important pharmaceutical in clinical or even environmental samples.« less

Stoichiometry of maltodextrin-binding sites in LamB, an outer membrane protein from Escherichia coli.

PubMed Central

Gehring, K; Cheng, C H; Nikaido, H; Jap, B K

1991-01-01

We have directly measured the stoichiometry of maltodextrin-binding sites in LamB. Scatchard plots and computer fitting of flow dialysis (rate-of-dialysis) experiments clearly establish three independent binding sites per LamB trimer, with a dissociation constant of approximately 60 microM for maltoheptaose. The current model for LamB's function as a specific pore is discussed with respect to the symmetry in LamB's kinetic properties and the implications of our results. Images PMID:2001992

Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

PubMed Central

Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

1989-01-01

Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

[Propranolol beta-blocker decrease in the concentration of high-affinity binding sites for calcium ions by sarcolemma membranes of the rat heart].

PubMed

Seleznev, Iu M; Martynov, A V; Smirnov, V N

1982-05-01

In vivo administration of propranolol considerably inhibits the isoproterenol-stimulated increase in 45Ca accumulation by the myocardium and completely eliminates the potentiation of isoproterenol effect by hydrocortisone. A significant lowering of the concentration of high affinity binding sites for calcium in the sarcolemmal membranes can be produced by propranolol in vitro. Under these conditions, the glucocorticoids do not change the sarcolemmal Ca2+-binding parameters or modulate the propranolol effect. Therefore, for the manifestation of glucocorticoid action to be brought about, the integrity of the cells is apparently required, while propranolol seems to change calcium binding by direct interaction with the sarcolemmal membranes. It is suggested that in vivo propranolol inhibition of catecholamine effect on calcium ion accumulation by the myocardium depends on the interaction with the beta-receptors and direct modulation of the concentration of high affinity binding sites for calcium ions on the surface of the sarcolemma.

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Biological role and structural mechanism of twinfilin–capping protein interaction

PubMed Central

Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

2004-01-01

Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

PubMed

DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

2003-07-08

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

PubMed

Leonard, D A; Rajaram, N; Kerppola, T K

1997-05-13

Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Direct Binding of the Corrector VX-809 to Human CFTR NBD1: Evidence of an Allosteric Coupling between the Binding Site and the NBD1:CL4 Interface.

PubMed

Hudson, Rhea P; Dawson, Jennifer E; Chong, P Andrew; Yang, Zhengrong; Millen, Linda; Thomas, Philip J; Brouillette, Christie G; Forman-Kay, Julie D

2017-08-01

Understanding the mechanism of action of modulator compounds for the cystic fibrosis transmembrane conductance regulator (CFTR) is key for the optimization of therapeutics as well as obtaining insights into the molecular mechanisms of CFTR function. We demonstrate the direct binding of VX-809 to the first nucleotide-binding domain (NBD1) of human CFTR. Disruption of the interaction between C-terminal helices and the NBD1 core upon VX-809 binding is observed from chemical shift changes in the NMR spectra of residues in the helices and on the surface of β -strands S3, S9, and S10. Binding to VX-809 leads to a significant negative shift in NBD1 thermal melting temperature (T m ), pointing to direct VX-809 interaction shifting the NBD1 conformational equilibrium. An inter-residue correlation analysis of the chemical shift changes provides evidence of allosteric coupling between the direct binding site and the NBD1:CL4 interface, thus enabling effects on the interface in the absence of direct binding in that location. These NMR binding data and the negative T m shifts are very similar to those previously reported by us for binding of the dual corrector-potentiator CFFT-001 to NBD1 (Hudson et al., 2012), suggesting that the two compounds may share some aspects of their mechanisms of action. Although previous studies have shown an important role for VX-809 in modulating the conformation of the first membrane spanning domain (Aleksandrov et al., 2012; Ren et al., 2013), this additional mode of VX-809 binding provides insight into conformational dynamics and allostery within CFTR. Copyright © 2017 by The Author(s).

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Electrostatic control of DNA intersegmental translocation by the ETS transcription factor ETV6.

PubMed

Vo, Tam; Wang, Shuo; Poon, Gregory M K; Wilson, W David

2017-08-11

To find their DNA target sites in complex solution environments containing excess heterogeneous DNA, sequence-specific DNA-binding proteins execute various translocation mechanisms known collectively as facilitated diffusion. For proteins harboring a single DNA contact surface, long-range translocation occurs by jumping between widely spaced DNA segments. We have configured biosensor-based surface plasmon resonance to directly measure the affinity and kinetics of this intersegmental jumping by the ETS-family transcription factor ETS variant 6 (ETV6). To isolate intersegmental target binding in a functionally defined manner, we pre-equilibrated ETV6 with excess salmon sperm DNA, a heterogeneous polymer, before exposing the nonspecifically bound protein to immobilized oligomeric DNA harboring a high-affinity ETV6 site. In this way, the mechanism of ETV6-target association could be toggled electrostatically through varying NaCl concentration in the bulk solution. Direct measurements of association and dissociation kinetics of the site-specific complex indicated that 1) freely diffusive binding by ETV6 proceeds through a nonspecific-like intermediate, 2) intersegmental jumping is rate-limited by dissociation from the nonspecific polymer, and 3) dissociation of the specific complex is independent of the history of complex formation. These results show that target searches by proteins with an ETS domain, such as ETV6, whose single DNA-binding domain cannot contact both source and destination sites simultaneously, are nonetheless strongly modulated by intersegmental jumping in heterogeneous site environments. Our findings establish biosensors as a general technique for directly and specifically measuring target site search by DNA-binding proteins via intersegmental translocation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Mapping the signal peptide binding and oligomer contact sites of the core subunit of the pea twin arginine protein translocase.

PubMed

Ma, Xianyue; Cline, Kenneth

2013-03-01

Twin arginine translocation (Tat) systems of thylakoid and bacterial membranes transport folded proteins using the proton gradient as the sole energy source. Tat substrates have hydrophobic signal peptides with an essential twin arginine (RR) recognition motif. The multispanning cpTatC plays a central role in Tat operation: It binds the signal peptide, directs translocase assembly, and may facilitate translocation. An in vitro assay with pea (Pisum sativum) chloroplasts was developed to conduct mutagenesis and analysis of cpTatC functions. Ala scanning mutagenesis identified mutants defective in substrate binding and receptor complex assembly. Mutations in the N terminus (S1) and first stromal loop (S2) caused specific defects in signal peptide recognition. Cys matching between substrate and imported cpTatC confirmed that S1 and S2 directly and specifically bind the RR proximal region of the signal peptide. Mutations in four lumen-proximal regions of cpTatC were defective in receptor complex assembly. Copurification and Cys matching analyses suggest that several of the lumen proximal regions may be important for cpTatC-cpTatC interactions. Surprisingly, RR binding domains of adjacent cpTatCs directed strong cpTatC-cpTatC cross-linking. This suggests clustering of binding sites on the multivalent receptor complex and explains the ability of Tat to transport cross-linked multimers. Transport of substrate proteins cross-linked to the signal peptide binding site tentatively identified mutants impaired in the translocation step.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

PubMed Central

Sun, W; O'Connell, M; Speck, N A

1993-01-01

Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA. Images PMID:8445719

Chloride sensing by WNK1 kinase involves inhibition of autophosphorylation

PubMed Central

Piala, Alexander T.; Moon, Thomas M.; Akella, Radha; He, Haixia; Cobb, Melanie H.; Goldsmith, Elizabeth J.

2014-01-01

WNK1 [with no lysine (K)] is a serine-threonine kinase associated with a form of familial hypertension. WNK1 is at the top of a kinase cascade leading to phosphorylation of several cotransporters, in particular those transporting sodium, potassium, and chloride (NKCC), sodium and chloride (NCC), and potassium and chloride (KCC). The responsiveness of NKCC, NCC, and KCC to changes in extracellular chloride parallels their phosphorylation state, provoking the proposal that these transporters are controlled by a chloride-sensitive protein kinase. Here, we found that chloride stabilizes the inactive conformation of WNK1, preventing kinase autophosphorylation and activation. Crystallographic studies of inactive WNK1 in the presence of chloride revealed that chloride binds directly to the catalytic site, providing a basis for the unique position of the catalytic lysine. Mutagenesis of the chloride binding site rendered the kinase less sensitive to inhibition of autophosphorylation by chloride, validating the binding site. Thus, these data suggest that WNK1 functions as a chloride sensor through direct binding of a regulatory chloride ion to the active site, which inhibits autophosphorylation. PMID:24803536

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

C2 Domain of Protein Kinase Cα: Elucidation of the Membrane Docking Surface by Site-Directed Fluorescence and Spin Labeling†

PubMed Central

Kohout, Susy C.; Corbalán-García, Senena; Gómez-Fernández, Juan C.; Falke, Joseph J.

2013-01-01

The C2 domain is a conserved signaling motif that triggers membrane docking in a Ca2+-dependent manner, but the membrane docking surfaces of many C2 domains have not yet been identified. Two extreme models can be proposed for the docking of the protein kinase Cα (PKCα) C2 domain to membranes. In the parallel model, the membrane-docking surface includes the Ca2+ binding loops and an anion binding site on β-strands 3–4, such that the β-strands are oriented parallel to the membrane. In the perpendicular model, the docking surface is localized to the Ca2+ binding loops and the β-strands are oriented perpendicular to the membrane surface. The present study utilizes site-directed fluorescence and spin-labeling to map out the membrane docking surface of the PKCα C2 domain. Single cysteine residues were engineered into 18 locations scattered over all regions of the protein surface, and were used as attachment sites for spectroscopic probes. The environmentally sensitive fluorescein probe identified positions where Ca2+ activation or membrane docking trigger measurable fluorescence changes. Ca2+ binding was found to initiate a global conformational change, while membrane docking triggered the largest fluorescein environmental changes at labeling positions on the three Ca2+ binding loops (CBL), thereby localizing these loops to the membrane docking surface. Complementary EPR power saturation measurements were carried out using a nitroxide spin probe to determine a membrane depth parameter, Φ, for each spin-labeled mutant. Positive membrane depth parameters indicative of membrane insertion were found for three positions, all located on the Ca2+ binding loops: N189 on CBL 1, and both R249 and R252 on CBL 3. In addition, EPR power saturation revealed that five positions near the anion binding site are partially protected from collisions with an aqueous paramagnetic probe, indicating that the anion binding site lies at or near the surface of the headgroup layer. Together, the fluorescence and EPR results indicate that the Ca2+ first and third Ca2+ binding loops insert directly into the lipid headgroup region of the membrane, and that the anion binding site on β-strands 3–4 lies near the headgroups. The data support a model in which the β-strands are tilted toward the parallel orientation relative to the membrane surface. PMID:12564928

Involvement of the N-terminal part of cyclophilin B in the interaction with specific Jurkat T-cell binding sites.

PubMed

Mariller, C; Haendler, B; Allain, F; Denys, A; Spik, G

1996-07-15

Cyclophilin B (CyPB) is secreted in biological fluids such as blood or milk and binds to a specific receptor present on the human lymphoblastic cell line Jurkat and on human peripheral blood lymphocytes. This study was intended to specify the areas of CyPB that are involved in the interaction with the receptor. A synthetic peptide corresponding to the first 24 N-terminal amino acid residues of CyPB was shown to specifically recognize the receptor. Moreover, modification of Arg18 of CyPB by p-hydroxyphenlglyoxal led to a dramatic loss of affinity for the receptor. However, when this residue was replaced by an alanine residue using site-directed mutagenesis, no modification of the binding properties was found, suggesting that Arg18 is not directly involved but is sufficiently close to the interaction site to interfere with the binding when modified. Competitive binding experiments using a chimaeric protein made up of the 24 N-terminal amino acid residues of CyPB fused to the cyclophilin A core sequence confirmed the involvement of this region of CyPB in receptor binding.

Elucidation of the Hsp90 C-terminal Inhibitor Binding Site

PubMed Central

Matts, Robert L.; Dixit, Anshuman; Peterson, Laura B.; Sun, Liang; Voruganti, Sudhakar; Kalyanaraman, Palgunan; Hartson, Steve D.; Verkhivker, Gennady M.; Blagg, Brian S. J.

2011-01-01

The Hsp90 chaperone machine is required for the folding, activation and/or stabilization of more than 50 proteins directly related to malignant progression. Hsp90 contains small molecule binding sites at both its N- and C-terminal domains, however, limited structural and biochemical data regarding the C-terminal binding site is available. In this report, the small molecule binding site in the Hsp90 C-terminal domain was revealed by protease fingerprinting and photoaffinity labeling utilizing LC-MS/MS. The identified site was characterized by generation of a homology model for hHsp90α using the SAXS open structure of HtpG and docking the bioactive conformation of NB into the generated model. The resulting model for the bioactive conformation of NB bound to Hsp90α is presented herein. PMID:21548602

Site-directed antibody immobilization using a protein A-gold binding domain fusion protein for enhanced SPR immunosensing.

PubMed

de Juan-Franco, Elena; Caruz, Antonio; Pedrajas, J R; Lechuga, Laura M

2013-04-07

We have implemented a novel strategy for the oriented immobilization of antibodies onto a gold surface based on the use of a fusion protein, the protein A-gold binding domain (PAG). PAG consists of a gold binding peptide (GBP) coupled to the immunoglobulin-binding domains of staphylococcal protein A. This fusion protein provides an easy and fast oriented immobilization of antibodies preserving its native structure, while leaving the antigen binding sites (Fab) freely exposed. Using this immobilization strategy, we have demonstrated the performance of the immunosensing of the human Growth Hormone by SPR. A limit of detection of 90 ng mL(-1) was obtained with an inter-chip variability lower than 7%. The comparison of this method with other strategies for the direct immobilization of antibodies over gold surfaces has showed the enhanced sensitivity provided by the PAG approach.

Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, Nicole R.; Hecht, Karen A.; Hu, Dehong

2016-01-08

The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins incorporating a tetracysteine tag for site-directed labeling with biarsenical affinity probes and either EGFP or single chain antibody to test colocalization of probes with the EGFP-tagged recombinant protein or binding of biosilica-immobilized antibodies to large and small molecule antigens, respectively. Site-directed labeling with the biarsenical probes demonstrated colocalization with EGFP-encoded proteins in nascent and mature biosilica, supporting their use in studying biosilica maturation. Isolated biosilica transformed with a single chain antibody against either the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT) effectively boundmore » the respective antigens. A marked increase in fluorescence lifetime of the TNT surrogate Alexa Fluor 555-trinitrobenzene reflected the high binding specificity of the transformed isolated biosilica. These results demonstrated the potential use of biosilica-immobilized single chain antibodies as binders for large and small molecule antigens in sensing and therapeutics.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

The Receptor-Binding Site of the Measles Virus Hemagglutinin Protein Itself Constitutes a Conserved Neutralizing Epitope

PubMed Central

Ohno, Shinji; Sakai, Kouji; Ito, Yuri; Fukuhara, Hideo; Komase, Katsuhiro; Brindley, Melinda A.; Rota, Paul A.; Plemper, Richard K.; Maenaka, Katsumi; Takeda, Makoto

2013-01-01

Here, we provide direct evidence that the receptor-binding site of measles virus (MV) hemagglutinin protein itself forms an effective conserved neutralizing epitope (CNE). Several receptor-interacting residues constitute the CNE. Thus, viral escape from neutralization has to be associated with loss of receptor-binding activity. Since interactions with both the signaling lymphocyte activation molecule (SLAM) and nectin4 are critical for MV pathogenesis, its escape, which results from loss of receptor-binding activity, should not occur in nature. PMID:23283964

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCann, D.J.; Su, T.P.

1991-05-01

The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

Specific phospholipid binding to Na,K-ATPase at two distinct sites.

PubMed

Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

2017-03-14

Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

A Conserved Surface Loop in Type I Dehydroquinate Dehydratases Positions an Active Site Arginine and Functions in Substrate Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Light, Samuel H.; Minasov, George; Shuvalova, Ludmilla

2012-04-18

Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. We present three crystal structures of the Salmonella enterica type I DHQD that address the functionality of a surface loop that is observed to close over the active site following substrate binding. Two wild-type structures with differing loop conformations and kinetic and structural studies of a mutant provide evidence of both direct and indirect mechanisms of involvement of the loop in substrate binding. In addition to allowing amino acid side chains to establish a direct interaction with the substrate, closure of the loop necessitates a conformational change ofmore » a key active site arginine, which in turn positions the substrate productively. The absence of DHQD in humans and its essentiality in many pathogenic bacteria make the enzyme a target for the development of nontoxic antimicrobials. The structures and ligand binding insights presented here may inform the design of novel type I DHQD inhibiting molecules.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Differential Binding Models for Direct and Reverse Isothermal Titration Calorimetry.

PubMed

Herrera, Isaac; Winnik, Mitchell A

2016-03-10

Isothermal titration calorimetry (ITC) is a technique to measure the stoichiometry and thermodynamics from binding experiments. Identifying an appropriate mathematical model to evaluate titration curves of receptors with multiple sites is challenging, particularly when the stoichiometry or binding mechanism is not available. In a recent theoretical study, we presented a differential binding model (DBM) to study calorimetry titrations independently of the interaction among the binding sites (Herrera, I.; Winnik, M. A. J. Phys. Chem. B 2013, 117, 8659-8672). Here, we build upon our DBM and show its practical application to evaluate calorimetry titrations of receptors with multiple sites independently of the titration direction. Specifically, we present a set of ordinary differential equations (ODEs) with the general form d[S]/dV that can be integrated numerically to calculate the equilibrium concentrations of free and bound species S at every injection step and, subsequently, to evaluate the volume-normalized heat signal (δQ(V) = δq/dV) of direct and reverse calorimetry titrations. Additionally, we identify factors that influence the shape of the titration curve and can be used to optimize the initial concentrations of titrant and analyte. We demonstrate the flexibility of our updated DBM by applying these differentials and a global regression analysis to direct and reverse calorimetric titrations of gadolinium ions with multidentate ligands of increasing denticity, namely, diglycolic acid (DGA), citric acid (CIT), and nitrilotriacetic acid (NTA), and use statistical tests to validate the stoichiometries for the metal-ligand pairs studied.

Replication of damaged DNA in vitro is blocked by p53

PubMed Central

Zhou, Jianmin; Prives, Carol

2003-01-01

The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

PubMed Central

Keck, P C; Huston, J S

1996-01-01

Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

Photoactivable antibody binding protein: site-selective and covalent coupling of antibody.

PubMed

Jung, Yongwon; Lee, Jeong Min; Kim, Jung-won; Yoon, Jeongwon; Cho, Hyunmin; Chung, Bong Hyun

2009-02-01

Here we report new photoactivable antibody binding proteins, which site-selectively capture antibodies and form covalent conjugates with captured antibodies upon irradiation. The proteins allow the site-selective tagging and/or immobilization of antibodies with a highly preferred orientation and omit the need for prior antibody modifications. The minimal Fc-binding domain of protein G, a widely used antibody binding protein, was genetically and chemically engineered to contain a site-specific photo cross-linker, benzophenone. In addition, the domain was further mutated to have an enhanced Fc-targeting ability. This small engineered protein was successfully cross-linked only to the Fc region of the antibody without any nonspecific reactivity. SPR analysis indicated that antibodies can be site-selectively biotinylated through the present photoactivable protein. Furthermore, the system enabled light-induced covalent immobilization of antibodies directly on various solid surfaces, such as those of glass slides, gold chips, and small particles. Antibody coupling via photoactivable antibody binding proteins overcomes several limitations of conventional approaches, such as random chemical reactions or reversible protein binding, and offers a versatile tool for the field of immunosensors.

1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

2005-08-22

Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

PubMed Central

Fox, K R; Waring, M J

1986-01-01

The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

Structural Basis for Certain Naturally Occurring Bioflavonoids to Function as Reducing Co-Substrates of Cyclooxygenase I and II

PubMed Central

Zhu, Bao Ting

2010-01-01

Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785

DNA-Templated Introduction of an Aldehyde Handle in Proteins.

PubMed

Kodal, Anne Louise B; Rosen, Christian B; Mortensen, Michael R; Tørring, Thomas; Gothelf, Kurt V

2016-07-15

Many medical and biotechnological applications rely on protein labeling, but a key challenge is the production of homogeneous and site-specific conjugates. This can rarely be achieved by simple residue-specific random labeling, but generally requires genetic engineering. Using site-selective DNA-templated reductive amination, we created DNA-protein conjugates with control over labeling stoichiometry and without genetic engineering. A guiding DNA strand with a metal-binding functionality facilitates site-selectivity by directing the coupling of a second reactive DNA strand in the vicinity of a protein metal-binding site. We demonstrate DNA-templated reductive amination for His6 -tagged proteins and metal-binding proteins, including IgG1 antibodies. We also used a cleavable linker between the DNA and the protein to remove the DNA and introduce a single aldehyde on the protein. This functions as a handle for further modifications with desired labels. In addition to directing the aldehyde positioning, the DNA provides a straightforward route for purification between reaction steps. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

PubMed Central

Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

2011-01-01

The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

Non-competitive inhibition by active site binders.

PubMed

Blat, Yuval

2010-06-01

Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Asymmetry of the three catalytic sites on beta subunits of TF1 from a thermophilic Bacillus strain PS3.

PubMed

Hisabori, T; Kobayashi, H; Kaibara, C; Yoshida, M

1994-03-01

F1-ATPase isolated from plasma membrane of a thermophilic Bacillus strain PS3 (TF1) has very little or no endogenously bound adenine nucleotides. However, it can bind one ADP per mol of the enzyme on one of three beta subunits to form a stable TF1.ADP complex when incubated with a high concentration of ADP [Yoshida, M. & Allison, W.S. (1986) J. Biol. Chem. 261, 5714-5721]. The same TF1.ADP complex was recovered after filling all ADP binding sites with [3H]ADP and repeated gel filtration. Direct binding assay revealed that the TF1.ADP complex had lost the highest affinity site for TNP-ADP. When a substoichiometric amount of TNP-ATP was added, the complex hydrolyzed TNP-ATP slowly (single site hydrolysis), like native TF1. However, this hydrolysis was not promoted by chase-addition of excess ATP. The optimal pH of the ATPase activity of TF1 or the TF1.ADP complex measured with a short reaction period, 6.5, was lower than the reported value, 9.0, under the steady-state condition. Although the bound ADP was released from the complex only when the enzyme underwent multiple catalytic turnover, the rate of this release was much slower than the turnover. These results suggest that when one ADP binds to a site on one of the beta subunits and stays there for a long time, the enzyme will change form and the bound ADP will become a special species which is not able to be directly involved in the enzyme catalysis. This binding site for ADP appears to be the first site responsible for the single-site catalysis reaction observed for native TF1.

Identification of the residues involved in stabilization of the semiquinone radical in the high-affinity ubiquinone binding site in cytochrome bo(3) from Escherichia coli by site-directed mutagenesis and EPR spectroscopy.

PubMed

Hellwig, Petra; Yano, Takahiro; Ohnishi, Tomoko; Gennis, Robert B

2002-08-27

During turnover of cytochrome bo(3) from Escherichia coli, a semiquinone radical is stabilized in a high-affinity binding site. To identify binding partners of this radical, site-directed mutants have been designed on the basis of a recently modeled quinone binding site (Abramson et al., 2000). The R71H, H98F, D75H, and I102W mutant enzymes were found to show very little or no quinol oxidase activity. The thermodynamic and EPR spectroscopic properties of semiquinone radicals in these mutants were characterized. For the H98F and the R71H mutants, no EPR signal of the semiquinone radical was observed in the redox potential range from -100 to 250 mV. During potentiometric titration of the D75H mutant enzyme, a semiquinone signal was detected in the same potential range as that of the wild-type enzyme. However, the EPR spectrum of the D75H mutant lacks the characteristic hyperfine structure of the semiquinone radical signal observed in the wild-type oxidase, indicating that D75 or the introduced His, interacts with the semiquinone radical. For the I102W mutant, a free radical signal was observed with a redox midpoint potential downshifted by about 200 mV. On the basis of these observations, it is suggested that R71, D75, and H98 residues are involved in the stabilization of the semiquinone state in the high-affinity binding site. Details of the possible binding motif and mechanistic implications are discussed.

Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†

PubMed Central

Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald

2009-01-01

A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

PubMed

Schlaepfer, D D; Hunter, T

1996-10-01

Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Structure of the transcriptional regulator LmrR and its mechanism of multidrug recognition.

PubMed

Madoori, Pramod Kumar; Agustiandari, Herfita; Driessen, Arnold J M; Thunnissen, Andy-Mark W H

2009-01-21

LmrR is a PadR-related transcriptional repressor that regulates the production of LmrCD, a major multidrug ABC transporter in Lactococcus lactis. Transcriptional regulation is presumed to follow a drug-sensitive induction mechanism involving the direct binding of transporter ligands to LmrR. Here, we present crystal structures of LmrR in an apo state and in two drug-bound states complexed with Hoechst 33342 and daunomycin. LmrR shows a common topology containing a typical beta-winged helix-turn-helix domain with an additional C-terminal helix involved in dimerization. Its dimeric organization is highly unusual with a flat-shaped hydrophobic pore at the dimer centre serving as a multidrug-binding site. The drugs bind in a similar manner with their aromatic rings sandwiched in between the indole groups of two dimer-related tryptophan residues. Multidrug recognition is facilitated by conformational plasticity and the absence of drug-specific hydrogen bonds. Combined analyses using site-directed mutagenesis, fluorescence-based drug binding and protein-DNA gel shift assays reveal an allosteric coupling between the multidrug- and DNA-binding sites of LmrR that most likely has a function in the induction mechanism.

Combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis reveal the cognitive characteristics of honey bee chemosensory protein to plant semiochemical.

PubMed

Tan, Jing; Song, Xinmi; Fu, Xiaobin; Wu, Fan; Hu, Fuliang; Li, Hongliang

2018-08-05

In the chemoreceptive system of insects, there are always some soluble binding proteins, such as some antennal-specific chemosensory proteins (CSPs), which are abundantly distributed in the chemosensory sensillar lymph. The antennal-specific CSPs usually have strong capability to bind diverse semiochemicals, while the detailed interaction between CSPs and the semiochemicals remain unclear. Here, by means of the combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis, we detailedly interpreted a binding interaction between a plant semiochemical β-ionone and antennal-specific CSP1 from the worker honey bee. Thermodynamic parameters (ΔH < 0, ΔS > 0) indicate that the interaction is mainly driven by hydrophobic forces and electrostatic interactions. Docking prediction results showed that there are two key amino acids, Phe44 and Gln63, may be involved in the interacting process of CSP1 to β-ionone. In order to confirm the two key amino acids, site-directed mutagenesis were performed and the binding constant (K A ) for two CSP1 mutant proteins was reduced by 60.82% and 46.80% compared to wild-type CSP1. The thermodynamic analysis of mutant proteins furtherly verified that Phe44 maintained an electrostatic interaction and Gln63 contributes hydrophobic and electrostatic forces. Our investigation initially elucidates the physicochemical mechanism of the interaction between antennal-special CSPs in insects including bees to plant semiochemicals, as well as the development of twice thermodynamic analysis (wild type and mutant proteins) combined with multispectral and site-directed mutagenesis methods. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

Control of Recombination Directionality by the Listeria Phage A118 Protein Gp44 and the Coiled-Coil Motif of Its Serine Integrase.

PubMed

Mandali, Sridhar; Gupta, Kushol; Dawson, Anthony R; Van Duyne, Gregory D; Johnson, Reid C

2017-06-01

The serine integrase of phage A118 catalyzes integrative recombination between attP on the phage and a specific attB locus on the chromosome of Listeria monocytogenes , but it is unable to promote excisive recombination between the hybrid attL and attR sites found on the integrated prophage without assistance by a recombination directionality factor (RDF). We have identified and characterized the phage-encoded RDF Gp44, which activates the A118 integrase for excision and inhibits integration. Gp44 binds to the C-terminal DNA binding domain of integrase, and we have localized the primary binding site to be within the mobile coiled-coil (CC) motif but distinct from the distal tip of the CC that is required for recombination. This interaction is sufficient to inhibit integration, but a second interaction involving the N-terminal end of Gp44 is also required to activate excision. We provide evidence that these two contacts modulate the trajectory of the CC motifs as they extend out from the integrase core in a manner dependent upon the identities of the four att sites. Our results support a model whereby Gp44 shapes the Int-bound complexes to control which att sites can synapse and recombine. IMPORTANCE Serine integrases mediate directional recombination between bacteriophage and bacterial chromosomes. These highly regulated site-specific recombination reactions are integral to the life cycle of temperate phage and, in the case of Listeria monocytogenes lysogenized by A118 family phage, are an essential virulence determinant. Serine integrases are also utilized as tools for genetic engineering and synthetic biology because of their exquisite unidirectional control of the DNA exchange reaction. Here, we identify and characterize the recombination directionality factor (RDF) that activates excision and inhibits integration reactions by the phage A118 integrase. We provide evidence that the A118 RDF binds to and modulates the trajectory of the long coiled-coil motif that extends from the large carboxyl-terminal DNA binding domain and is postulated to control the early steps of recombination site synapsis. Copyright © 2017 American Society for Microbiology.

Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae)

PubMed Central

Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

2016-01-01

Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

PubMed

Hagemann, H; Marcillat, O; Buchet, R; Vial, C

2000-08-08

Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Activation of the edema factor of Bacillus anthracis by calmodulin: evidence of an interplay between the EF-calmodulin interaction and calcium binding.

PubMed

Laine, Elodie; Martínez, Leandro; Blondel, Arnaud; Malliavin, Thérèse E

2010-10-06

Calmodulin (CaM) is a remarkably flexible protein which can bind multiple targets in response to changes in intracellular calcium concentration. It contains four calcium-binding sites, arranged in two globular domains. The calcium affinity of CaM N-terminal domain (N-CaM) is dramatically reduced when the complex with the edema factor (EF) of Bacillus anthracis is formed. Here, an atomic explanation for this reduced affinity is proposed through molecular dynamics simulations and free energy perturbation calculations of the EF-CaM complex starting from different crystallographic models. The simulations show that electrostatic interactions between CaM and EF disfavor the opening of N-CaM domains usually induced by calcium binding. Relative calcium affinities of the N-CaM binding sites are probed by free energy perturbation, and dissociation probabilities are evaluated with locally enhanced sampling simulations. We show that EF impairs calcium binding on N-CaM through a direct conformational restraint on Site 1, by an indirect destabilization of Site 2, and by reducing the cooperativity between the two sites. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

PubMed Central

Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

2014-01-01

Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

Molecular Characterization of Monoclonal Antibodies that Inhibit Acetylcholinesterase by Targeting the Peripheral Site and Backdoor Region

PubMed Central

Essono, Sosthène; Mondielli, Grégoire; Lamourette, Patricia; Boquet, Didier; Grassi, Jacques; Marchot, Pascale

2013-01-01

The inhibition properties and target sites of monoclonal antibodies (mAbs) Elec403, Elec408 and Elec410, generated against Electrophorus electricus acetylcholinesterase (AChE), have been defined previously using biochemical and mutagenesis approaches. Elec403 and Elec410, which bind competitively with each other and with the peptidic toxin inhibitor fasciculin, are directed toward distinctive albeit overlapping epitopes located at the AChE peripheral anionic site, which surrounds the entrance of the active site gorge. Elec408, which is not competitive with the other two mAbs nor fasciculin, targets a second epitope located in the backdoor region, distant from the gorge entrance. To characterize the molecular determinants dictating their binding site specificity, we cloned and sequenced the mAbs; generated antigen-binding fragments (Fab) retaining the parental inhibition properties; and explored their structure-function relationships using complementary x-ray crystallography, homology modeling and flexible docking approaches. Hypermutation of one Elec403 complementarity-determining region suggests occurrence of antigen-driven selection towards recognition of the AChE peripheral site. Comparative analysis of the 1.9Å-resolution structure of Fab408 and of theoretical models of its Fab403 and Fab410 congeners evidences distinctive surface topographies and anisotropic repartitions of charges, consistent with their respective target sites and inhibition properties. Finally, a validated, data-driven docking model of the Fab403-AChE complex suggests a mode of binding at the PAS that fully correlates with the functional data. This comprehensive study documents the molecular peculiarities of Fab403 and Fab410, as the largest peptidic inhibitors directed towards the peripheral site, and those of Fab408, as the first inhibitor directed toward the backdoor region of an AChE and a unique template for the design of new, specific modulators of AChE catalysis. PMID:24146971

Nickel binding to NikA: an additional binding site reconciles spectroscopy, calorimetry and crystallography.

PubMed

Addy, Christine; Ohara, Masato; Kawai, Fumihiro; Kidera, Akinori; Ikeguchi, Mitsunori; Fuchigami, Sotaro; Osawa, Masanori; Shimada, Ichio; Park, Sam-Yong; Tame, Jeremy R H; Heddle, Jonathan G

2007-02-01

Intracellular nickel is required by Escherichia coli as a cofactor for a number of enzymes and is necessary for anaerobic respiration. However, high concentrations of nickel are toxic, so both import and export systems have evolved to control the cellular level of the metal. The nik operon in E. coli encodes a nickel-uptake system that includes the periplasmic nickel-binding protein NikA. The crystal structures of wild-type NikA both bound to nickel and in the apo form have been solved previously. The liganded structure appeared to show an unusual interaction between the nickel and the protein in which no direct bonds are formed. The highly unusual nickel coordination suggested by the crystal structure contrasted strongly with earlier X-ray spectroscopic studies. The known nickel-binding site has been probed by extensive mutagenesis and isothermal titration calorimetry and it has been found that even large numbers of disruptive mutations appear to have little effect on the nickel affinity. The crystal structure of a binding-site mutant with nickel bound has been solved and it is found that nickel is bound to two histidine residues at a position distant from the previously characterized binding site. This novel site immediately resolves the conflict between the crystal structures and other biophysical analyses. The physiological relevance of the two binding sites is discussed.

A Smad action turnover switch operated by WW domain readers of a phosphoserine code

PubMed Central

Aragón, Eric; Goerner, Nina; Zaromytidou, Alexia-Ileana; Xi, Qiaoran; Escobedo, Albert; Massagué, Joan; Macias, Maria J.

2011-01-01

When directed to the nucleus by TGF-β or BMP signals, Smad proteins undergo cyclin-dependent kinase 8/9 (CDK8/9) and glycogen synthase kinase-3 (GSK3) phosphorylations that mediate the binding of YAP and Pin1 for transcriptional action, and of ubiquitin ligases Smurf1 and Nedd4L for Smad destruction. Here we demonstrate that there is an order of events—Smad activation first and destruction later—and that it is controlled by a switch in the recognition of Smad phosphoserines by WW domains in their binding partners. In the BMP pathway, Smad1 phosphorylation by CDK8/9 creates binding sites for the WW domains of YAP, and subsequent phosphorylation by GSK3 switches off YAP binding and adds binding sites for Smurf1 WW domains. Similarly, in the TGF-β pathway, Smad3 phosphorylation by CDK8/9 creates binding sites for Pin1 and GSK3, then adds sites to enhance Nedd4L binding. Thus, a Smad phosphoserine code and a set of WW domain code readers provide an efficient solution to the problem of coupling TGF-β signal delivery to turnover of the Smad signal transducers. PMID:21685363

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

Interactions of the GM2 activator protein with phosphatidylcholine bilayers: a site-directed spin-labeling power saturation study.

PubMed

Mathias, Jordan D; Ran, Yong; Carter, Jeffery D; Fanucci, Gail E

2009-09-02

The GM2 activator protein (GM2AP) is an accessory protein that is an essential component in the catabolism of the ganglioside GM2. A function of GM2AP is to bind and extract GM2 from intralysosomal vesicles, forming a soluble protein-lipid complex, which interacts with the hydrolase Hexosaminidase A, the enzyme that cleaves the terminal sugar group of GM2. Here, we used site-directed spin labeling with power saturation electron paramagnetic resonance to determine the surface-bound orientation of GM2AP upon phosphatidylcholine vesicles. Because GM2AP extracts lipid ligands from the vesicle and is undergoing exchange on and off the vesicle surface, we utilized a nickel-chelating lipid to localize the paramagnetic metal collider to the lipid bilayer-aqueous interface. Spin-labeled sites that collide with the lipid-bound metal relaxing agent provide a means for mapping sites of the protein that interact with the lipid bilayer interface. Results show that GM2AP binds to lipid bilayers such that the residues lining the lipid-binding cavity lie on the vesicle surface. This orientation creates a favorable microenvironment that can allow for the lipid tails to flip out of the bilayer directly into the hydrophobic pocket of GM2AP.

Structural evolution of luciferase activity in Zophobas mealworm AMP/CoA-ligase (protoluciferase) through site-directed mutagenesis of the luciferin binding site.

PubMed

Prado, R A; Barbosa, J A; Ohmiya, Y; Viviani, V R

2011-07-01

The structural origin and evolution of bioluminescent activity of beetle luciferases from AMP/CoA ligases remains a mystery. Previously we cloned the luciferase-like enzyme from Zophobas morio mealworm, a reasonable protoluciferase model that could shine light on this mystery. Kinetic characterization and studies with D- and L-luciferin and their adenylates showed that stereoselectivity constitutes a critical feature for the origin of luciferase activity in AMP/CoA ligases. Comparison of the primary structures and modeling studies of this protoluciferase and the three main families of beetle luciferases showed that the carboxylic acid substrate binding site of this enzyme is smaller and more hydrophobic than the luciferin binding site of beetle luciferases, showing several substitutions of otherwise conserved residues. Thus, here we performed a site-directed mutagenesis survey of the carboxylic binding site motifs of the protoluciferase by replacing their residues by the respective conserved ones found in beetle luciferases in order to identify the structural determinants of luciferase/oxygenase activity. Although most of the substitutions had negative impact on the luminescence activity of the protoluciferase, only the substitution I327T improved the luminescence activity, resulting in a broad and 15 nm blue-shifted luminescence spectrum. Such substitution indicates the importance of the loop motif 322YGMSEI327 (341YGLTETT347 in Photinus pyralis luciferase) for luciferase activity, and indicates a possible route for the evolution of bioluminescence function of beetle luciferases.

Analysis of the Binding Moiety Mediating the Interaction between Monocarboxylate Transporters and Carbonic Anhydrase II*

PubMed Central

Noor, Sina Ibne; Dietz, Steffen; Heidtmann, Hella; Boone, Christopher D.; McKenna, Robert; Deitmer, Joachim W.; Becker, Holger M.

2015-01-01

Proton-coupled monocarboxylate transporters (MCTs) mediate the exchange of high energy metabolites like lactate between different cells and tissues. We have reported previously that carbonic anhydrase II augments transport activity of MCT1 and MCT4 by a noncatalytic mechanism, while leaving transport activity of MCT2 unaltered. In the present study, we combined electrophysiological measurements in Xenopus oocytes and pulldown experiments to analyze the direct interaction between carbonic anhydrase II (CAII) and MCT1, MCT2, and MCT4, respectively. Transport activity of MCT2-WT, which lacks a putative CAII-binding site, is not augmented by CAII. However, introduction of a CAII-binding site into the C terminus of MCT2 resulted in CAII-mediated facilitation of MCT2 transport activity. Interestingly, introduction of three glutamic acid residues alone was not sufficient to establish a direct interaction between MCT2 and CAII, but the cluster had to be arranged in a fashion that allowed access to the binding moiety in CAII. We further demonstrate that functional interaction between MCT4 and CAII requires direct binding of the enzyme to the acidic cluster 431EEE in the C terminus of MCT4 in a similar fashion as previously shown for binding of CAII to the cluster 489EEE in the C terminus of MCT1. In CAII, binding to MCT1 and MCT4 is mediated by a histidine residue at position 64. Taken together, our results suggest that facilitation of MCT transport activity by CAII requires direct binding between histidine 64 in CAII and a cluster of glutamic acid residues in the C terminus of the transporter that has to be positioned in surroundings that allow access to CAII. PMID:25561737

Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

PubMed

Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

2016-05-12

Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

PubMed Central

Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

2015-01-01

Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

Frataxin Directly Stimulates Mitochondrial Cysteine Desulfurase by Exposing Substrate-binding Sites, and a Mutant Fe-S Cluster Scaffold Protein with Frataxin-bypassing Ability Acts Similarly*♦

PubMed Central

Pandey, Alok; Gordon, Donna M.; Pain, Jayashree; Stemmler, Timothy L.; Dancis, Andrew; Pain, Debkumar

2013-01-01

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the “buried” substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation. PMID:24217246

Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

PubMed

Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

2009-11-01

The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

Frataxin directly stimulates mitochondrial cysteine desulfurase by exposing substrate-binding sites, and a mutant Fe-S cluster scaffold protein with frataxin-bypassing ability acts similarly.

PubMed

Pandey, Alok; Gordon, Donna M; Pain, Jayashree; Stemmler, Timothy L; Dancis, Andrew; Pain, Debkumar

2013-12-27

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the "buried" substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation.

Control of Ion Selectivity in LeuT: Two Na+ Binding Sites with two different mechanisms

PubMed Central

Noskov, Sergei Y.; Roux, Benoît

2016-01-01

The x-ray structure of LeuT, a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporter, provides a great opportunity to better understand the molecular basis of monovalent cation selectivity in ion-coupled transporters. LeuT possesses two ion-binding sites, NA1 and NA2, which are highly selective for Na+. Extensive all-atom free energy molecular dynamics simulations of LeuT embedded in an explicit membrane are performed at different temperatures and various occupancy states of the binding sites to dissect the molecular mechanism of ion selectivity. The results show that the two binding sites display robust selectivity for Na+ over K+ or Li+, the competing ions of most similar radii. Of particular interest, the mechanism primarily responsible for selectivity for each of the two binding sites appears to be different. In site NA1, selectivity for Na+ over K+ arises predominantly from the strong electrostatic field arising from the negatively charged carboxylate group of the leucine substrate coordinating the ion directly. In site NA2, which comprises only neutral ligands, selectivity for Na+ is enforced by the local structural restraints arising from the hydrogen-bonding network and the covalent connectivity of the poly-peptide chain surrounding the ion according to a snug-fit mechanism. PMID:18280500

Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

PubMed

Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

2018-03-21

Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

The role of monovalent cations in the ATPase reaction of DNA gyrase.

PubMed

Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

2015-04-01

Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K(+), is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K(+) ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na(+) ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites.

How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

PubMed

Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

2003-09-17

The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

Predicting Displaceable Water Sites Using Mixed-Solvent Molecular Dynamics.

PubMed

Graham, Sarah E; Smith, Richard D; Carlson, Heather A

2018-02-26

Water molecules are an important factor in protein-ligand binding. Upon binding of a ligand with a protein's surface, waters can either be displaced by the ligand or may be conserved and possibly bridge interactions between the protein and ligand. Depending on the specific interactions made by the ligand, displacing waters can yield a gain in binding affinity. The extent to which binding affinity may increase is difficult to predict, as the favorable displacement of a water molecule is dependent on the site-specific interactions made by the water and the potential ligand. Several methods have been developed to predict the location of water sites on a protein's surface, but the majority of methods are not able to take into account both protein dynamics and the interactions made by specific functional groups. Mixed-solvent molecular dynamics (MixMD) is a cosolvent simulation technique that explicitly accounts for the interaction of both water and small molecule probes with a protein's surface, allowing for their direct competition. This method has previously been shown to identify both active and allosteric sites on a protein's surface. Using a test set of eight systems, we have developed a method using MixMD to identify conserved and displaceable water sites. Conserved sites can be determined by an occupancy-based metric to identify sites which are consistently occupied by water even in the presence of probe molecules. Conversely, displaceable water sites can be found by considering the sites which preferentially bind probe molecules. Furthermore, the inclusion of six probe types allows the MixMD method to predict which functional groups are capable of displacing which water sites. The MixMD method consistently identifies sites which are likely to be nondisplaceable and predicts the favorable displacement of water sites that are known to be displaced upon ligand binding.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like.

Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway

PubMed Central

Reizis, Boris; Leder, Philip

2002-01-01

The Notch signaling pathway regulates the commitment and early development of T lymphocytes. We studied Notch-mediated induction of the pre-T cell receptor α (pTa) gene, a T-cell-specific transcriptional target of Notch. The pTa enhancer was activated by Notch signaling and contained binding sites for its nuclear effector, CSL. Mutation of the CSL-binding sites abolished enhancer induction by Notch and delayed the up-regulation of pTa transgene expression during T cell lineage commitment. These results show a direct mechanism of stage- and tissue-specific gene induction by the mammalian Notch/CSL signaling pathway. PMID:11825871

The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse

PubMed Central

Jacobsen, Jacob P.R.; Plenge, Per; Sachs, Benjamin D.; Pehrson, Alan L.; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L.; Dalvi, Prachiti; Robinson, Taylor J.; O’Neill, Sharon P.; Khoo, King S.; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G.

2015-01-01

Rationale Escitalopram is a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and antidepressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram’s inhibition hereof. Objectives Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Methods Recombinant technology; in vivo microdialysis; receptor binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). Results We generated mice expressing either the wild-type human SERT (hSERTWT) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERTALI/VFL+SI/TT). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. Importantly, escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment. Further, escitalopram-induced 5-HTExt elevation was not affected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small, tending to be enhanced by R-citalopram co-administration. Conclusions We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram. Our findings points to mechanisms for R-citalopram antagonism of escitalopram’s antidepressant action other than direct antagonistic binding interactions at the hSERT. PMID:24810106

Structural basis for cargo binding and autoinhibition of Bicaudal-D1 by a parallel coiled-coil with homotypic registry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Terawaki, Shin-ichi, E-mail: terawaki@gunma-u.ac.jp; SPring-8 Center, RIKEN, 1-1-1 Koto, Sayo-cho, Sayo-gun, Hyogo 679-5148; Yoshikane, Asuka

Bicaudal-D1 (BICD1) is an α-helical coiled-coil protein mediating the attachment of specific cargo to cytoplasmic dynein. It plays an essential role in minus end-directed intracellular transport along microtubules. The third C-terminal coiled-coil region of BICD1 (BICD1 CC3) has an important role in cargo sorting, including intracellular vesicles associating with the small GTPase Rab6 and the nuclear pore complex Ran binding protein 2 (RanBP2), and inhibiting the association with cytoplasmic dynein by binding to the first N-terminal coiled-coil region (CC1). The crystal structure of BICD1 CC3 revealed a parallel homodimeric coiled-coil with asymmetry and complementary knobs-into-holes interactions, differing from Drosophila BicDmore » CC3. Furthermore, our binding study indicated that BICD1 CC3 possesses a binding surface for two distinct cargos, Rab6 and RanBP2, and that the CC1-binding site overlaps with the Rab6-binding site. These findings suggest a molecular basis for cargo recognition and autoinhibition of BICD proteins during dynein-dependent intracellular retrograde transport. - Highlights: • BICD1 CC3 is a parallel homodimeric coiled-coil with axial asymmetry. • The coiled-coil packing of BICD1 CC3 is adapted to the equivalent heptad position. • BICD1 CC3 has distinct binding sites for two classes of cargo, Rab6 and RanBP2. • The CC1-binding site of BICD1 CC3 overlaps with the Rab6-binding site.« less

Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

PubMed

Pessler, F; Pendergrast, P S; Hernandez, N

1997-07-01

The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes.

Glucocorticoids suppress tumor necrosis factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in the promoter.

PubMed

Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A

2000-06-16

Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.

Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

PubMed

Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

2011-01-30

During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

Cholesterol-Binding Sites in GIRK Channels: The Devil is in the Details.

PubMed

Rosenhouse-Dantsker, Avia

2018-01-01

In recent years, it has become evident that cholesterol plays a direct role in the modulation of a variety of ion channels. In most cases, cholesterol downregulates channel activity. In contrast, our earlier studies have demonstrated that atrial G protein inwardly rectifying potassium (GIRK) channels are upregulated by cholesterol. Recently, we have shown that hippocampal GIRK currents are also upregulated by cholesterol. A combined computational-experimental approach pointed to putative cholesterol-binding sites in the transmembrane domain of the GIRK2 channel, the primary subunit in hippocampal GIRK channels. In particular, the principal cholesterol-binding site was located in the center of the transmembrane domain in between the inner and outer α-helices of 2 adjacent subunits. Further studies pointed to a similar cholesterol-binding site in GIRK4, a major subunit in atrial GIRK channels. However, a close look at a sequence alignment of the transmembrane helices of the 2 channels reveals surprising differences among the residues that interact with the cholesterol molecule in these 2 channels. Here, we compare the residues that form putative cholesterol-binding sites in GIRK2 and GIRK4 and discuss the similarities and differences among them.

Quantitative in vivo receptor binding. I. Theory and application to the muscarinic cholinergic receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frey, K.A.; Ehrenkaufer, R.L.; Beaucage, S.

1985-02-01

A novel approach to in vivo receptor binding experiments is presented which allows direct quantitation of binding site densities. The method is based on an equilibrium model of tracer uptake and is designed to produce a static distribution proportional to receptor density and to minimize possible confounding influences of regional blood flow, blood-brain barrier permeability, and nonspecific binding. This technique was applied to the measurement of regional muscarinic cholinergic receptor densities in rat brain using (/sup 3/H)scopolamine. Specific in vivo binding of scopolamine demonstrated saturability, a pharmacologic profile, and regional densities which are consistent with interaction of the tracer withmore » the muscarinic receptor. Estimates of receptor density obtained with the in vivo method and in vitro measurements in homogenates were highly correlated. Furthermore, reduction in striatal muscarinic receptors following ibotenic acid lesions resulted in a significant decrease in tracer uptake in vivo, indicating that the correlation between scopolamine distribution and receptor density may be used to demonstrate pathologic conditions. We propose that the general method presented here is directly applicable to investigation of high affinity binding sites for a variety of radioligands.« less

Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

PubMed

Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

2016-12-13

Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

Phosphorylated nitrate reductase and 14-3-3 proteins. Site of interaction, effects of ions, and evidence for an amp-binding site on 14-3-3 proteins.

PubMed

Athwal, G S; Huber, J L; Huber, S C

1998-11-01

The inactivation of phosphorylated nitrate reductase (NR) by the binding of 14-3-3 proteins is one of a very few unambiguous biological functions for 14-3-3 proteins. We report here that serine and threonine residues at the +6 to +8 positions, relative to the known regulatory binding site involving serine-543, are important in the interaction with GF14omega, a recombinant plant 14-3-3. Also shown is that an increase in ionic strength with KCl or inorganic phosphate, known physical effectors of NR activity, directly disrupts the binding of protein and peptide ligands to 14-3-3 proteins. Increased ionic strength attributable to KCl caused a change in conformation of GF14omega, resulting in reduced surface hydrophobicity, as visualized with a fluorescent probe. Similarly, it is shown that the 5' isomer of AMP was specifically able to disrupt the inactive phosphorylated NR:14-3-3 complex. Using the 5'-AMP fluorescent analog trinitrophenyl-AMP, we show that there is a probable AMP-binding site on GF14omega.

NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

2010-12-03

Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

Viral receptor-binding site antibodies with diverse germline origins.

PubMed

Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C

2015-05-21

Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. Copyright © 2015 Elsevier Inc. All rights reserved.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

SPM for functional identification of individual biomolecules

NASA Astrophysics Data System (ADS)

Ros, Robert; Schwesinger, Falk; Padeste, Celestino; Plueckthun, Andreas; Anselmetti, Dario; Guentherodt, Hans-Joachim; Tiefenauer, Louis

1999-06-01

The identification of specific binding molecules is of increasing interest in the context of drug development based on combinatorial libraries. Scanning Probe Microscopy (SPM) is the method of choice to image and probe individual biomolecules on a surface. Functional identification of biomolecules is a first step towards screening on a single molecule level. As a model system we use recombinant single- chain Fv fragment (scFv) antibody molecules directed against the antigen fluorescein. The scFv's are covalently immobilized on a flat gold surface via the C-terminal cysteine, resulting in a high accessibility of the binding site. The antigen is immobilized covalently via a long hydrophilic spacer to the silicon nitride SPM-tip. This arrangement allows a direct measurement of binding forces. Thus, closely related antibody molecules differing in only one amino acid at their binding site could be distinguished. A novel SPM-software has been developed which combines imaging, force spectroscopic modes, and online analysis. This is a major prerequisite for future screening methods.

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

PubMed

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-07-01

The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Structural Comparison of Different Antibodies Interacting with Parvovirus Capsids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hafenstein, Susan; Bowman, Valorie D.; Sun, Tao

2009-05-13

The structures of canine parvovirus (CPV) and feline parvovirus (FPV) complexed with antibody fragments from eight different neutralizing monoclonal antibodies were determined by cryo-electron microscopy (cryoEM) reconstruction to resolutions varying from 8.5 to 18 {angstrom}. The crystal structure of one of the Fab molecules and the sequence of the variable domain for each of the Fab molecules have been determined. The structures of Fab fragments not determined crystallographically were predicted by homology modeling according to the amino acid sequence. Fitting of the Fab and virus structures into the cryoEM densities identified the footprints of each antibody on the viral surface.more » As anticipated from earlier analyses, the Fab binding sites are directed to two epitopes, A and B. The A site is on an exposed part of the surface near an icosahedral threefold axis, whereas the B site is about equidistant from the surrounding five-, three-, and twofold axes. One antibody directed to the A site binds CPV but not FPV. Two of the antibodies directed to the B site neutralize the virus as Fab fragments. The differences in antibody properties have been linked to the amino acids within the antibody footprints, the position of the binding site relative to the icosahedral symmetry elements, and the orientation of the Fab structure relative to the surface of the virus. Most of the exposed surface area was antigenic, although each of the antibodies had a common area of overlap that coincided with the positions of the previously mapped escape mutations.« less

The role of monovalent cations in the ATPase reaction of DNA gyrase

PubMed Central

Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

2015-01-01

Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K+, is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K+ ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na+ ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites. PMID:25849408

Mechanism of reactant and product dissociation from the anthrax edema factor: a locally enhanced sampling and steered molecular dynamics study.

PubMed

Martínez, Leandro; Malliavin, Thérèse E; Blondel, Arnaud

2011-05-01

The anthrax edema factor is a toxin overproducing damaging levels of cyclic adenosine monophosphate (cAMP) and pyrophosphate (PPi) from ATP. Here, mechanisms of dissociation of ATP and products (cAMP, PPi) from the active site are studied using locally enhanced sampling (LES) and steered molecular dynamics simulations. Various substrate conformations and ionic binding modes found in crystallographic structures are considered. LES simulations show that PPi and cAMP dissociate through different solvent accessible channels, while ATP dissociation requires significant active site exposure to solvent. The ionic content of the active site directly affects the dissociation of ATP and products. Only one ion dissociates along with ATP in the two-Mg(2+) binding site, suggesting that the other ion binds EF prior to ATP association. Dissociation of reaction products cAMP and PPi is impaired by direct electrostatic interactions between products and Mg(2+) ions. This provides an explanation for the inhibitory effect of high Mg(2+) concentrations on EF enzymatic activity. Breaking of electrostatic interactions is dependent on a competitive binding of water molecules to the ions, and thus on the solvent accessibility of the active site. Consequently, product dissociation seems to be a two-step process. First, ligands are progressively solvated while preserving the most important electrostatic interactions, in a process that is dependent on the flexibility of the active site. Second, breakage of the electrostatic bonds follows, and ligands diffuse into solvent. In agreement with this mechanism, product protonation facilitates dissociation.

Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity.

PubMed

Nancolas, Bethany; Sessions, Richard B; Halestrap, Andrew P

2015-02-15

The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523-530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7-10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278.

Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity

PubMed Central

Nancolas, Bethany; Sessions, Richard B.; Halestrap, Andrew P.

2014-01-01

The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523–530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7–10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278. PMID:25437897

Inactivation of phosphorylase b by potassium ferrate, a new reactive analogue of the phosphate group.

PubMed

Lee, Y M; Benisek, W F

1976-03-25

Rabbit muscle phosphorylase b reacts with the phosphate-like reagent potassium ferrate, K2FeO4, a potent oxidizing agent. The reaction results in inactivation of the enzyme and abolition of the ability of the enzyme to bind 5'-AMP. Activating and nonactivating nucleotides which bind at the 5'-AMP binding site such as 5'-AMP, 2'-AMP, 3'-AMP, and 5'-IMP substantially protect the enzyme from inactivation by ferrate. One to two residues of tyrosine and approximately 1 residue of cysteine are modified by ferrate under the conditions employed. Tyrosine is protected by 5-AMP, whereas cysteine is not. The tyrosine modification is suggested as the inactivating chemical reaction. The location of the inactivating reaction is suggested to be in or near the 5'-AMP binding site. The structural and chemical properties of ferrate ion are discussed and compared to those of phosphate. Ferrate ion may be a reagent useful for phosphate group binding site-directed modification of proteins.

Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor*

PubMed Central

Lawrence, Callum F.; Margetts, Mai B.; Menting, John G.; Smith, Nicholas A.; Smith, Brian J.; Ward, Colin W.; Lawrence, Michael C.

2016-01-01

Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe701 and Phe705. The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

Cloning of an SNF2/SWI2-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter.

PubMed

Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A

1995-03-03

We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.

A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

NASA Technical Reports Server (NTRS)

Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

2001-01-01

The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

PubMed

Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

2003-08-01

Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

PubMed Central

Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

2013-01-01

NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

Wnt-Mediated Repression via Bipartite DNA Recognition by TCF in the Drosophila Hematopoietic System

PubMed Central

Zhang, Chen U.; Blauwkamp, Timothy A.; Burby, Peter E.; Cadigan, Ken M.

2014-01-01

The Wnt/β-catenin signaling pathway plays many important roles in animal development, tissue homeostasis and human disease. Transcription factors of the TCF family mediate many Wnt transcriptional responses, promoting signal-dependent activation or repression of target gene expression. The mechanism of this specificity is poorly understood. Previously, we demonstrated that for activated targets in Drosophila, TCF/Pangolin (the fly TCF) recognizes regulatory DNA through two DNA binding domains, with the High Mobility Group (HMG) domain binding HMG sites and the adjacent C-clamp domain binding Helper sites. Here, we report that TCF/Pangolin utilizes a similar bipartite mechanism to recognize and regulate several Wnt-repressed targets, but through HMG and Helper sites whose sequences are distinct from those found in activated targets. The type of HMG and Helper sites is sufficient to direct activation or repression of Wnt regulated cis-regulatory modules, and protease digestion studies suggest that TCF/Pangolin adopts distinct conformations when bound to either HMG-Helper site pair. This repressive mechanism occurs in the fly lymph gland, the larval hematopoietic organ, where Wnt/β-catenin signaling controls prohemocytic differentiation. Our study provides a paradigm for direct repression of target gene expression by Wnt/β-catenin signaling and allosteric regulation of a transcription factor by DNA. PMID:25144371

Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

PubMed

Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

2017-10-15

In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

PubMed Central

Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

2017-01-01

Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

Characterization of BreR Interaction with the Bile Response Promoters breAB and breR in Vibrio cholerae

PubMed Central

Cerda-Maira, Francisca A.; Kovacikova, Gabriela; Jude, Brooke A.; Skorupski, Karen

2013-01-01

The Vibrio cholerae BreR protein is a transcriptional repressor of the breAB efflux system operon, which encodes proteins involved in bile resistance. In a previous study (F. A. Cerda-Maira, C. S. Ringelberg, and R. K. Taylor, J. Bacteriol. 190:7441–7452, 2008), we used gel mobility shift assays to determine that BreR binds at two independent binding sites at the breAB promoter and a single site at its own promoter. Here it is shown, by DNase I footprinting and site-directed mutagenesis, that BreR is able to bind at a distal and a proximal site in the breAB promoter. However, only one of these sites, the proximal 29-bp site, is necessary for BreR-mediated transcriptional repression of breAB expression. In addition, it was determined that BreR represses its own expression by recognizing a 28-bp site at the breR promoter. These sites comprise regions of dyad symmetry within which residues critical for BreR function could be identified. The BreR consensus sequence AANGTANAC-N6-GTNTACNTT overlaps the −35 region at both promoters, implying that the repression of gene expression is achieved by interfering with RNA polymerase binding at these promoters. PMID:23144245

Re-engineering the zinc fingers of PRDM9 reverses hybrid sterility in mice.

PubMed

Davies, Benjamin; Hatton, Edouard; Altemose, Nicolas; Hussin, Julie G; Pratto, Florencia; Zhang, Gang; Hinch, Anjali Gupta; Moralli, Daniela; Biggs, Daniel; Diaz, Rebeca; Preece, Chris; Li, Ran; Bitoun, Emmanuelle; Brick, Kevin; Green, Catherine M; Camerini-Otero, R Daniel; Myers, Simon R; Donnelly, Peter

2016-02-11

The DNA-binding protein PRDM9 directs positioning of the double-strand breaks (DSBs) that initiate meiotic recombination in mice and humans. Prdm9 is the only mammalian speciation gene yet identified and is responsible for sterility phenotypes in male hybrids of certain mouse subspecies. To investigate PRDM9 binding and its role in fertility and meiotic recombination, we humanized the DNA-binding domain of PRDM9 in C57BL/6 mice. This change repositions DSB hotspots and completely restores fertility in male hybrids. Here we show that alteration of one Prdm9 allele impacts the behaviour of DSBs controlled by the other allele at chromosome-wide scales. These effects correlate strongly with the degree to which each PRDM9 variant binds both homologues at the DSB sites it controls. Furthermore, higher genome-wide levels of such 'symmetric' PRDM9 binding associate with increasing fertility measures, and comparisons of individual hotspots suggest binding symmetry plays a downstream role in the recombination process. These findings reveal that subspecies-specific degradation of PRDM9 binding sites by meiotic drive, which steadily increases asymmetric PRDM9 binding, has impacts beyond simply changing hotspot positions, and strongly support a direct involvement in hybrid infertility. Because such meiotic drive occurs across mammals, PRDM9 may play a wider, yet transient, role in the early stages of speciation.

Sequence-Based Prediction of RNA-Binding Residues in Proteins.

PubMed

Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

2017-01-01

Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

Sequence-Based Prediction of RNA-Binding Residues in Proteins

PubMed Central

Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

2017-01-01

Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

PubMed

Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

2017-07-18

Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

PubMed

Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

1999-01-01

Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

Positive selection moments identify potential functional residues in human olfactory receptors

NASA Technical Reports Server (NTRS)

Singer, M. S.; Weisinger-Lewin, Y.; Lancet, D.; Shepherd, G. M.

1996-01-01

Correlated mutation analysis and molecular models of olfactory receptors have provided evidence that residues in the transmembrane domains form a binding pocket for odor ligands. As an independent test of these results, we have calculated positive selection moments for the alpha-helical sixth transmembrane domain (TM6) of human olfactory receptors. The moments can be used to identify residues that have been preferentially affected by positive selection and are thus likely to interact with odor ligands. The results suggest that residue 622, which is commonly a serine or threonine, could form critical H-bonds. In some receptors a dual-serine subsite, formed by residues 622 and 625, could bind hydroxyl determinants on odor ligands. The potential importance of these residues is further supported by site-directed mutagenesis in the beta-adrenergic receptor. The findings should be of practical value for future physiological studies, binding assays, and site-directed mutagenesis.

In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

PubMed

Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

2016-11-01

Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

Direct Activation of Epac by Sulfonylurea is Isoform Selective

PubMed Central

Herbst, Katie J.; Coltharp, Carla; Amzel, L. Mario; Zhang, Jin

2011-01-01

Summary Commonly used as a treatment for Type II diabetes, sulfonylureas (SUs) stimulate insulin secretion from pancreatic β cells by binding to sulfonylurea receptors. Recently, SUs have been shown to also activate exchange protein directly activated by cAMP 2 (Epac2), however little is known about this molecular action. Using biosensor imaging and biochemical analysis, we show that SUs activate Epac2 and the downstream signaling via direct binding to Epac2. We further identify R447 of Epac2 to be critically involved in SU binding. This distinct binding site from cAMP points to a new mode of allosteric activation of Epac2. We also show that SUs selectively activate Epac2 isoform, but not the closely related Epac1, further establishing SUs as a new class of isoform-selective enzyme activators. PMID:21338921

SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

PubMed

Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

2017-06-15

RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

PubMed

Jacobs, Y; Schnabel, C A; Cleary, M L

1999-07-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kato, K.; Fukuda, H.

1985-07-22

When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

Generalized theory on the mechanism of site-specific DNA-protein interactions

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-05-01

We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR

PubMed Central

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2012-01-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the 2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury, et. al. 2011). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. PMID:23000369

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR.

PubMed

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2013-02-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the β2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury et al., [32]). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. Copyright © 2012 Elsevier B.V. All rights reserved.

Distinct Involvement of the Gab1 and Grb2 Adaptor Proteins in Signal Transduction by the Related Receptor Tyrosine Kinases RON and MET

PubMed Central

Chaudhuri, Amitabha; Xie, Ming-Hong; Yang, Becky; Mahapatra, Kaushiki; Liu, Jinfeng; Marsters, Scot; Bodepudi, Sweta; Ashkenazi, Avi

2011-01-01

Although the signal transduction mechanisms of the receptor tyrosine kinase MET are well defined, less is known about its close relative RON. MET initiates intracellular signaling by autophosphorylation on specific cytoplasmic tyrosines that form docking sites for the adaptor proteins Grb2 and Gab1. Grb2 binds directly and is essential for all of the biological activities of MET. Gab1 docks either directly or indirectly via Grb2 and controls only a subset of MET functions. Because MET and RON possess similar adaptor binding sites, it was anticipated that their adaptor interactions would be conserved. Here we show that in contrast to MET, RON relies primarily on Gab1 for signal transmission. Surprisingly, disruption of the Grb2 docking site of RON or Grb2 depletion augments activity, whereas enhancement of Grb2 binding attenuates Gab1 recruitment and signaling. Hence, RON and MET differ in their adaptor interactions; furthermore, Grb2 performs a novel antagonistic role in the context of RON signaling. PMID:21784853

Epigallocatechin-3-gallate preferentially induces aggregation of amyloidogenic immunoglobulin light chains

PubMed Central

Hora, Manuel; Carballo-Pacheco, Martin; Weber, Benedikt; Morris, Vanessa K.; Wittkopf, Antje; Buchner, Johannes; Strodel, Birgit; Reif, Bernd

2017-01-01

Antibody light chain amyloidosis is a rare disease caused by fibril formation of secreted immunoglobulin light chains (LCs). The huge variety of antibody sequences puts a serious challenge to drug discovery. The green tea polyphenol epigallocatechin-3-gallate (EGCG) is known to interfere with fibril formation in general. Here we present solution- and solid-state NMR studies as well as MD simulations to characterise the interaction of EGCG with LC variable domains. We identified two distinct EGCG binding sites, both of which include a proline as an important recognition element. The binding sites were confirmed by site-directed mutagenesis and solid-state NMR analysis. The EGCG-induced protein complexes are unstructured. We propose a general mechanistic model for EGCG binding to a conserved site in LCs. We find that EGCG reacts selectively with amyloidogenic mutants. This makes this compound a promising lead structure, that can handle the immense sequence variability of antibody LCs. PMID:28128355

Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

PubMed Central

Pessler, F; Pendergrast, P S; Hernandez, N

1997-01-01

The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes. PMID:9199312

Exploring the binding pathways of the 14-3-3ζ protein: Structural and free-energy profiles revealed by Hamiltonian replica exchange molecular dynamics with distancefield distance restraints

PubMed Central

Nagy, Gabor; Oostenbrink, Chris; Hritz, Jozef

2017-01-01

The 14-3-3 protein family performs regulatory functions in eukaryotic organisms by binding to a large number of phosphorylated protein partners. Whilst the binding mode of the phosphopeptides within the primary 14-3-3 binding site is well established based on the crystal structures of their complexes, little is known about the binding process itself. We present a computational study of the process by which phosphopeptides bind to the 14-3-3ζ protein. Applying a novel scheme combining Hamiltonian replica exchange molecular dynamics and distancefield restraints allowed us to map and compare the most likely phosphopeptide-binding pathways to the 14-3-3ζ protein. The most important structural changes to the protein and peptides involved in the binding process were identified. In order to bind phosphopeptides to the primary interaction site, the 14-3-3ζ adopted a newly found wide-opened conformation. Based on our findings we additionally propose a secondary interaction site on the inner surface of the 14-3-3ζ dimer, and a direct interference on the binding process by the flexible C-terminal tail. A minimalistic model was designed to allow for the efficient calculation of absolute binding affinities. Binding affinities calculated from the potential of mean force along the binding pathway are in line with the available experimental estimates for two of the studied systems. PMID:28727767

Structure of a retro-binding peptide inhibitor complexed with human alpha-thrombin.

PubMed

Tabernero, L; Chang, C Y; Ohringer, S L; Lau, W F; Iwanowicz, E J; Han, W C; Wang, T C; Seiler, S M; Roberts, D G; Sack, J S

1995-02-10

The crystallographic structure of the ternary complex between human alpha-thrombin, hirugen and the peptidyl inhibitor Phe-alloThr-Phe-O-CH3, which is acylated at its N terminus with 4-guanidino butanoic acid (BMS-183507), has been determined at 2.6 A resolution. The structure reveals a unique "retro-binding" mode for this tripeptide active site inhibitor. The inhibitor binds with its alkyl-guanidine moiety in the primary specificity pocket and its two phenyl rings occupying the hydrophobic proximal and distal pockets of the thrombin active site. In this arrangement the backbone of the tripeptide forms a parallel beta-strand to the thrombin main-chain at the binding site. This is opposite to the orientation of the natural substrate, fibrinogen, and all the small active site-directed thrombin inhibitors whose bound structures have been previously reported. BMS-183507 is the first synthetic inhibitor proved to bind in a retro-binding fashion to thrombin, in a fashion similar to that of the N-terminal residues of the natural inhibitor hirudin. Furthermore, this new potent thrombin inhibitor (Ki = 17.2 nM) is selective for thrombin over other serine proteases tested and may be a template to be considered in designing hirudin-based thrombin inhibitors with interactions at the specificity pocket.

Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

Metal Binding Properties of Escherichia coli YjiA, a Member of the Metal Homeostasis-Associated COG0523 Family of GTPases

PubMed Central

2013-01-01

GTPases are critical molecular switches involved in a wide range of biological functions. Recent phylogenetic and genomic analyses of the large, mostly uncharacterized COG0523 subfamily of GTPases revealed a link between some COG0523 proteins and metal homeostasis pathways. In this report, we detail the bioinorganic characterization of YjiA, a representative member of COG0523 subgroup 9 and the only COG0523 protein to date with high-resolution structural information. We find that YjiA is capable of binding several types of transition metals with dissociation constants in the low micromolar range and that metal binding affects both the oligomeric structure and GTPase activity of the enzyme. Using a combination of X-ray crystallography and site-directed mutagenesis, we identify, among others, a metal-binding site adjacent to the nucleotide-binding site in the GTPase domain that involves a conserved cysteine and several glutamate residues. Mutations of the coordinating residues decrease the impact of metal, suggesting that metal binding to this site is responsible for modulating the GTPase activity of the protein. These findings point toward a regulatory function for these COG0523 GTPases that is responsive to their metal-bound state. PMID:24449932

Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

PubMed

Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

2005-02-28

Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the cognate elements.

Modeling the Interaction between Quinolinate and the Receptor for Advanced Glycation End Products (RAGE): Relevance for Early Neuropathological Processes

PubMed Central

Serratos, Iris N.; Castellanos, Pilar; Pastor, Nina; Millán-Pacheco, César; Rembao, Daniel; Pérez-Montfort, Ruy; Cabrera, Nallely; Reyes-Espinosa, Francisco; Díaz-Garrido, Paulina; López-Macay, Ambar; Martínez-Flores, Karina; López-Reyes, Alberto; Sánchez-García, Aurora; Cuevas, Elvis; Santamaria, Abel

2015-01-01

The receptor for advanced glycation end products (RAGE) is a pattern-recognition receptor involved in neurodegenerative and inflammatory disorders. RAGE induces cellular signaling upon binding to a variety of ligands. Evidence suggests that RAGE up-regulation is involved in quinolinate (QUIN)-induced toxicity. We investigated the QUIN-induced toxic events associated with early noxious responses, which might be linked to signaling cascades leading to cell death. The extent of early cellular damage caused by this receptor in the rat striatum was characterized by image processing methods. To document the direct interaction between QUIN and RAGE, we determined the binding constant (Kb) of RAGE (VC1 domain) with QUIN through a fluorescence assay. We modeled possible binding sites of QUIN to the VC1 domain for both rat and human RAGE. QUIN was found to bind at multiple sites to the VC1 dimer, each leading to particular mechanistic scenarios for the signaling evoked by QUIN binding, some of which directly alter RAGE oligomerization. This work contributes to the understanding of the phenomenon of RAGE-QUIN recognition, leading to the modulation of RAGE function. PMID:25757085

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

PubMed Central

2016-01-01

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843

Site-directed Mutagenesis Shows the Significance of Interactions with Phospholipids and the G-protein OsYchF1 for the Physiological Functions of the Rice GTPase-activating Protein 1 (OsGAP1).

PubMed

Yung, Yuk-Lin; Cheung, Ming-Yan; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yu, Mei-Hui; Chye, Mee-Len; Wong, Kam-Bo; Lam, Hon-Ming

2015-09-25

The C2 domain is one of the most diverse phospholipid-binding domains mediating cellular signaling. One group of C2-domain proteins are plant-specific and are characterized by their small sizes and simple structures. We have previously reported that a member of this group, OsGAP1, is able to alleviate salt stress and stimulate defense responses, and bind to both phospholipids and an unconventional G-protein, OsYchF1. Here we solved the crystal structure of OsGAP1 to a resolution of 1.63 Å. Using site-directed mutagenesis, we successfully differentiated between the clusters of surface residues that are required for binding to phospholipids versus OsYchF1, which, in turn, is critical for its role in stimulating defense responses. On the other hand, the ability to alleviate salt stress by OsGAP1 is dependent only on its ability to bind OsYchF1 and is independent of its phospholipid-binding activity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

PubMed

Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

2017-01-26

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.

The pathogen-related yeast protein Pry1, a member of the CAP protein superfamily, is a fatty acid-binding protein

PubMed Central

Darwiche, Rabih; Mène-Saffrané, Laurent; Gfeller, David; Asojo, Oluwatoyin A.; Schneiter, Roger

2017-01-01

Members of the CAP superfamily (cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins), also known as SCP superfamily (sperm-coating proteins), have been implicated in many physiological processes, including immune defenses, venom toxicity, and sperm maturation. Their mode of action, however, remains poorly understood. Three proteins of the CAP superfamily, Pry1, -2, and -3 (pathogen related in yeast), are encoded in the Saccharomyces cerevisiae genome. We have shown previously that Pry1 binds cholesterol in vitro and that Pry function is required for sterol secretion in yeast cells, indicating that members of this superfamily may generally bind sterols or related small hydrophobic compounds. On the other hand, tablysin-15, a CAP protein from the horsefly Tabanus yao, has been shown to bind leukotrienes and free fatty acids in vitro. Therefore, here we assessed whether the yeast Pry1 protein binds fatty acids. Computational modeling and site-directed mutagenesis indicated that the mode of fatty acid binding is conserved between tablysin-15 and Pry1. Pry1 bound fatty acids with micromolar affinity in vitro, and its function was essential for fatty acid export in cells lacking the acyl-CoA synthetases Faa1 and Faa4. Fatty acid binding of Pry1 is independent of its capacity to bind sterols, and the two sterol- and fatty acid-binding sites are nonoverlapping. These results indicate that some CAP family members, such as Pry1, can bind different lipids, particularly sterols and fatty acids, at distinct binding sites, suggesting that the CAP domain may serve as a stable, secreted protein domain that can accommodate multiple ligand-binding sites. PMID:28365570

Fast pressure jumps can perturb calcium and magnesium binding to troponin C F29W.

PubMed

Pearson, David S; Swartz, Darl R; Geeves, Michael A

2008-11-18

We have used rapid pressure jump and stopped-flow fluorometry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL/mol). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000/s and 100/s. Between pCa 8-5.4 and at troponin C concentrations of 8-28 muM, the slow relaxation times were invariant, indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps, respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium-sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200-300 muM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo.

Fast Pressure Jumps Can Perturb Calcium and Magnesium Binding to Troponin C F29W

PubMed Central

Pearson, David S.; Swartz, Darl R.; Geeves, Michael A.

2009-01-01

We have used rapid pressure jump and stopped-flow fluorimetry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL.mol-1). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000 s-1 and 100 s-1. Between pCa 8-5.4 and at troponin C concentrations of 8-28 μM, the slow relaxation times were invariant indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200 - 300 μM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo. PMID:18942859

Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

PubMed

Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

2008-05-15

Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Competitive Inhibition Mechanism of Acetylcholinesterase without Catalytic Active Site Interaction: Study on Functionalized C60 Nanoparticles via in Vitro and in Silico Assays.

PubMed

Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian

2017-06-07

Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.

Understanding the interaction between human serum albumin and anti-bacterial/ anti-cancer compounds.

PubMed

Rehman, Md Tabish; Khan, Asad U

2015-01-01

Human serum albumin (HSA) is the most important carrier of exogenous and endogenous molecules in human plasma. Understanding and characterizing the interaction of drugs with HSA has attracted enormous research interests from decades. The nature and magnitude of these bindings have direct consequence on drug delivery, pharmacokinetics, pharmacodynamics, therapeutic efficacy and drug designing. An overview of HSA and antibacterial/ anti-cancer ligands interaction is the need of the hour as these drugs together constitute more than half of the total drug consumption in the world. In this review, the information on the number of binding sites, binding strength, the nature of binding interactions and the location of binding sites of such drugs on the HSA are summarised. The effect of such drugs on the overall conformation, stability and function of HSA is also reviewed. This review will help to gain useful insights into the significance of the binding of anti-bacterial and anti-cancer drugs with plasma protein and the effect of binding on its overall distribution and pharmacological activities.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.

PubMed

Subramanian, Nandhitha; Scopelitti, Amanda J; Carland, Jane E; Ryan, Renae M; O'Mara, Megan L; Vandenberg, Robert J

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2

PubMed Central

Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045

Solution NMR studies provide structural basis for endotoxin pattern recognition by the innate immune receptor CD14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albright, Seth; Chen Bin; Holbrook, Kristen

CD14 functions as a key pattern recognition receptor for a diverse array of Gram-negative and Gram-positive cell-wall components in the host innate immune response by binding to pathogen-associated molecular patterns (PAMPs) at partially overlapping binding site(s). To determine the potential contribution of CD14 residues in this pattern recognition, we have examined using solution NMR spectroscopy, the binding of three different endotoxin ligands, lipopolysaccharide, lipoteichoic acid, and a PGN-derived compound, muramyl dipeptide to a {sup 15}N isotopically labeled 152-residue N-terminal fragment of sCD14 expressed in Pichia pastoris. Mapping of NMR spectral changes upon addition of ligands revealed that the pattern ofmore » residues affected by binding of each ligand is partially similar and partially different. This first direct structural observation of the ability of specific residue combinations of CD14 to differentially affect endotoxin binding may help explain the broad specificity of CD14 in ligand recognition and provide a structural basis for pattern recognition. Another interesting finding from the observed spectral changes is that the mode of binding may be dynamically modulated and could provide a mechanism for binding endotoxins with structural diversity through a common binding site.« less

Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter.

PubMed

Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A

2014-07-29

ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.

B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

PubMed

Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

2008-10-03

The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

Stereoselective hydrogenation of olefins using rhodium-substituted carbonic anhydrase--a new reductase.

PubMed

Jing, Qing; Okrasa, Krzysztof; Kazlauskas, Romas J

2009-01-01

One useful synthetic reaction missing from nature's toolbox is the direct hydrogenation of substrates using hydrogen. Instead nature uses cofactors like NADH to reduce organic substrates, which adds complexity and cost to these reductions. To create an enzyme that can directly reduce organic substrates with hydrogen, researchers have combined metal hydrogenation catalysts with proteins. One approach is an indirect link where a ligand is linked to a protein and the metal binds to the ligand. Another approach is direct linking of the metal to protein, but nonspecific binding of the metal limits this approach. Herein, we report a direct hydrogenation of olefins catalyzed by rhodium(I) bound to carbonic anhydrase (CA-[Rh]). We minimized nonspecific binding of rhodium by replacing histidine residues on the protein surface using site-directed mutagenesis or by chemically modifying the histidine residues. Hydrogenation catalyzed by CA-[Rh] is slightly slower than for uncomplexed rhodium(I), but the protein environment induces stereoselectivity favoring cis- over trans-stilbene by about 20:1. This enzyme is the first cofactor-independent reductase that reduces organic molecules using hydrogen. This catalyst is a good starting point to create variants with tailored reactivity and selectivity. This strategy to insert transition metals in the active site of metalloenzymes opens opportunities to a wider range of enzyme-catalyzed reactions.

The PBX1 lupus susceptibility gene regulates CD44 expression

PubMed Central

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

2017-01-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

PubMed Central

McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

2013-01-01

Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. PMID:24068937

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

PubMed Central

Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

2015-01-01

Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.

PubMed

Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C

2015-07-05

Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.

Radioligand Recognition of Insecticide Targets.

PubMed

Casida, John E

2018-04-04

Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

Recombination directionality factor gp3 binds ϕC31 integrase via the zinc domain, potentially affecting the trajectory of the coiled-coil motif

PubMed Central

Younger, Ellen; Fernando, Booshini D; Khaleel, Thanafez; Stark, W Marshall; Smith, Margaret C M

2018-01-01

Abstract To establish a prophage state, the genomic DNA of temperate bacteriophages normally becomes integrated into the genome of their host bacterium by integrase-mediated, site-specific DNA recombination. Serine integrases catalyse a single crossover between an attachment site in the host (attB) and a phage attachment site (attP) on the circularized phage genome to generate the integrated prophage DNA flanked by recombinant attachment sites, attL and attR. Exiting the prophage state and entry into the lytic growth cycle requires an additional phage-encoded protein, the recombination directionality factor or RDF, to mediate recombination between attL and attR and excision of the phage genome. The RDF is known to bind integrase and switch its activity from integration (attP x attB) to excision (attL x attR) but its precise mechanism is unclear. Here, we identify amino acid residues in the RDF, gp3, encoded by the Streptomyces phage ϕC31 and within the ϕC31 integrase itself that affect the gp3:Int interaction. We show that residue substitutions in integrase that reduce gp3 binding adversely affect both excision and integration reactions. The mutant integrase phenotypes are consistent with a model in which the RDF binds to a hinge region at the base of the coiled-coil motif in ϕC31 integrase. PMID:29228292

ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

DOE PAGES

Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...

2015-09-21

The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jie; Overall, Christopher C.; Johnson, Rudd C.

The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

Thiol Versus Hydroxamate as Zinc Binding Group In HDAC Inhibition: An Ab Initio QM/MM Molecular Dynamics Study

PubMed Central

Gong, Wenjing; Wu, Ruibo; Zhang, Yingkai

2015-01-01

Zinc-dependent histone deacetylases (HDACs) play a critical role in transcriptional repression and gene silencing, and are among the most attractive targets for the development of new therapeutics against cancer and various other diseases. Two HDAC inhibitors have been approved by FDA as anti-cancer drugs: one is SAHA whose hydroxamate is directly bound to zinc, the other is FK228 whose active form may use thiol as the zinc binding group. In spite of extensive studies, it remains to be ambiguous regarding how thiol and hydroxamate are bound to the zinc active site of HDACs. In this work, our computational approaches center on Born-Oppenheimer ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics with umbrella sampling, which allow for modeling of the zinc active site with reasonable accuracy while properly including dynamics and effects of protein environment. Meanwhile, an improved short-long effective function (SLEF2) to describe non-bonded interactions between zinc and other atoms has been employed in initial MM equilibrations. Our ab initio QM/MM MD simulations have confirmed that hydroxamate is neutral when it is bound to HDAC8, and found that thiol is deprotonated when directly bound to zinc in the HDAC active site. By comparing thiol and hydroxamate, our results elucidated the differences in their binding environment in the HDAC active sites, and emphasized the importance of the linker design to achieve more specific binding towards class IIa HDACs. PMID:26452222

Thiol versus hydroxamate as zinc binding group in HDAC inhibition: An ab initio QM/MM molecular dynamics study.

PubMed

Gong, Wenjing; Wu, Ruibo; Zhang, Yingkai

2015-11-15

Zinc-dependent histone deacetylases (HDACs) play a critical role in transcriptional repression and gene silencing, and are among the most attractive targets for the development of new therapeutics against cancer and various other diseases. Two HDAC inhibitors have been approved by FDA as anti-cancer drugs: one is SAHA whose hydroxamate is directly bound to zinc, the other is FK228 whose active form may use thiol as the zinc binding group. In spite of extensive studies, it remains to be ambiguous regarding how thiol and hydroxamate are bound to the zinc active site of HDACs. In this work, our computational approaches center on Born-Oppenheimer ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics with umbrella sampling, which allow for modeling of the zinc active site with reasonable accuracy while properly including dynamics and effects of protein environment. Meanwhile, an improved short-long effective function (SLEF2) to describe non-bonded interactions between zinc and other atoms has been employed in initial MM equilibrations. Our ab initio QM/MM MD simulations have confirmed that hydroxamate is neutral when it is bound to HDAC8, and found that thiol is deprotonated when directly bound to zinc in the HDAC active site. By comparing thiol and hydroxamate, our results elucidated the differences in their binding environment in the HDAC active sites, and emphasized the importance of the linker design to achieve more specific binding toward class IIa HDACs. © 2015 Wiley Periodicals, Inc.

The epitope of monoclonal antibodies blocking erythrocyte invasion by Plasmodium falciparum map to the dimerization and receptor glycan binding sites of EBA-175.

PubMed

Ambroggio, Xavier; Jiang, Lubin; Aebig, Joan; Obiakor, Harold; Lukszo, Jan; Narum, David L

2013-01-01

The malaria parasite, Plasmodium falciparum, and related parasites use a variety of proteins with Duffy-Binding Like (DBL) domains to bind glycoproteins on the surface of host cells. Among these proteins, the 175 kDa erythrocyte binding antigen, EBA-175, specifically binds to glycophorin A on the surface of human erythrocytes during the process of merozoite invasion. The domain responsible for glycophorin A binding was identified as region II (RII) which contains two DBL domains, F1 and F2. The crystal structure of this region revealed a dimer that is presumed to represent the glycophorin A binding conformation as sialic acid binding sites and large cavities are observed at the dimer interface. The dimer interface is largely composed of two loops from within each monomer, identified as the F1 and F2 β-fingers that contact depressions in the opposing monomers in a similar manner. Previous studies have identified a panel of five monoclonal antibodies (mAbs) termed R215 to R218 and R256 that bind to RII and inhibit invasion of erythrocytes to varying extents. In this study, we predict the F2 β-finger region as the conformational epitope for mAbs, R215, R217, and R256, and confirm binding for the most effective blocking mAb R217 and R215 to a synthetic peptide mimic of the F2 β-finger. Localization of the epitope to the dimerization and glycan binding sites of EBA-175 RII and site-directed mutagenesis within the predicted epitope are consistent with R215 and R217 blocking erythrocyte invasion by Plasmodium falciparum by preventing formation of the EBA-175- glycophorin A complex.

Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.

PubMed

Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F

2005-11-01

Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.

Inducible model for β-six-mediated site-specific recombination in mammalian cells

PubMed Central

Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

2006-01-01

The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

Analysis of flavin oxidation and electron-transfer inhibition in Plasmodium falciparum dihydroorotate dehydrogenase.

PubMed

Malmquist, Nicholas A; Gujjar, Ramesh; Rathod, Pradipsinh K; Phillips, Margaret A

2008-02-26

Plasmodium falciparum dihydroorotate dehydrogenase (pfDHODH) is a flavin-dependent mitochondrial enzyme that provides the only route to pyrimidine biosynthesis in the parasite. Clinically significant inhibitors of human DHODH (e.g., A77 1726) bind to a pocket on the opposite face of the flavin cofactor from dihydroorotate (DHO). This pocket demonstrates considerable sequence variability, which has allowed species-specific inhibitors of the malarial enzyme to be identified. Ubiquinone (CoQ), the physiological oxidant in the reaction, has been postulated to bind this site despite a lack of structural evidence. To more clearly define the residues involved in CoQ binding and catalysis, we undertook site-directed mutagenesis of seven residues in the structurally defined A77 1726 binding site, which we term the species-selective inhibitor site. Mutation of several of these residues (H185, F188, and F227) to Ala substantially decreased the affinity of pfDHODH-specific inhibitors (40-240-fold). In contrast, only a modest increase in the Kmapp for CoQ was observed, although mutation of Y528 in particular caused a substantial reduction in kcat (40-100-fold decrease). Pre-steady-state kinetic analysis by single wavelength stopped-flow spectroscopy showed that the mutations had no effect on the rate of the DHO-dependent reductive half-reaction, but most reduced the rate of the CoQ-dependent flavin oxidation step (3-20-fold decrease), while not significantly altering the Kdox for CoQ. As with the mutants, inhibitors that bind this site block the CoQ-dependent oxidative half-reaction without affecting the DHO-dependent step. These results identify residues involved in inhibitor binding and electron transfer to CoQ. Importantly, the data provide compelling evidence that the binding sites for CoQ and species-selective site inhibitors do not overlap, and they suggest instead that inhibitors act either by blocking the electron path between flavin and CoQ or by stabilizing a conformation that excludes CoQ binding.

Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

PubMed Central

Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

2012-01-01

The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

NASA Astrophysics Data System (ADS)

Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

2018-03-01

Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

Selective Photoaffinity Labeling Identifies the Signal Peptide Binding Domain on SecA

PubMed Central

Musial-Siwek, Monika; Rusch, Sharyn L.; Kendall, Debra A.

2007-01-01

SecA, an ATPase crucial to the Sec-dependent translocation machinery in Escherichia coli, recognizes and directly binds the N-terminal signal peptide of an exported preprotein. This interaction plays a central role in the targeting and transport of preproteins via the SecYEG channel. Here we identify the Signal Peptide Binding Groove (SPBG) on SecA addressing a key issue regarding the SecA-preprotein interaction. We employ a synthetic signal peptide containing the photoreactive benzoylphenylalanine to efficiently and specifically label SecA containing a unique Factor Xa site. Comparison of the photolabeled fragment from the subsequent proteolysis of several SecAs, which vary only in the location of the Factor Xa site, reveals one 53-residue segment in common with the entire series. The covalently modified SecA segment produced is the same in aqueous solution and in lipid vesicles. This spans amino acids 269 to 322 of the E. coli protein, which is distinct from a previously proposed signal peptide binding site, and contributes to a hydrophobic peptide binding groove evident in molecular models of SecA. PMID:17084862

Functional Roles of the Non-Catalytic Calcium-Binding Sites in the N-Terminal Domain of Human Peptidylarginine Deiminase 4

PubMed Central

Liu, Yi-Liang; Tsai, I-Chen; Chang, Chia-Wei; Liao, Ya-Fan; Liu, Guang-Yaw; Hung, Hui-Chih

2013-01-01

This study investigated the functional roles of the N-terminal Ca2+ ion-binding sites, in terms of enzyme catalysis and stability, of peptidylarginine deiminase 4 (PAD4). Amino acid residues located in the N-terminal Ca2+-binding site of PAD4 were mutated to disrupt the binding of Ca2+ ions. Kinetic data suggest that Asp155, Asp157 and Asp179, which directly coordinate Ca3 and Ca4, are essential for catalysis in PAD4. For D155A, D157A and D179A, the k cat/K m,BAEE values were 0.02, 0.63 and 0.01 s−1mM−1 (20.8 s−1mM−1 for WT), respectively. Asn153 and Asp176 are directly coordinated with Ca3 and indirectly coordinated with Ca5 via a water molecule. However, N153A displayed low enzymatic activity with a k cat value of 0.3 s−1 (13.3 s−1 for wild-type), whereas D176A retained some catalytic power with a k cat of 9.7 s−1. Asp168 is the direct ligand for Ca5, and Ca5 coordination by Glu252 is mediated by two water molecules. However, mutation of these two residues to Ala did not cause a reduction in the k cat/K m,BAEE values, which indicates that the binding of Ca5 may not be required for PAD4 enzymatic activity. The possible conformational changes of these PAD4 mutants were examined. Thermal stability analysis of the PAD4 mutants in the absence or presence of Ca2+ indicated that the conformational stability of the enzyme is highly dependent on Ca2+ ions. In addition, the results of urea-induced denaturation for the N153, D155, D157 and D179 series mutants further suggest that the binding of Ca2+ ions in the N-terminal Ca2+-binding site stabilizes the overall conformational stability of PAD4. Therefore, our data strongly suggest that the N-terminal Ca2+ ions play critical roles in the full activation of the PAD4 enzyme. PMID:23382808

A gratuitous β-Lactamase inducer uncovers hidden active site dynamics of the Staphylococcus aureus BlaR1 sensor domain.

PubMed

Frederick, Thomas E; Peng, Jeffrey W

2018-01-01

Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.

Binding patterns of vanadium ions with different valence states to human serum transferrin studied by HPLC/high-resolution ICP-MS.

PubMed

Nagaoka, Megumi Hamano; Yamazaki, Takeshi; Maitani, Tamio

2002-09-06

Vanadium (V) is an essential metal for mammals and has different valence states. In blood, V is bound to serum transferrin (Tf), a glycoprotein which has two metal-binding sites, and carbonate is generally required for the binding. In this study, the binding patterns of V(III), V(IV), and V(V) to human serum Tf (hTf) were analyzed using an HPLC system equipped with an anion-exchange column and directly connected to a high-resolution inductively coupled plasma-mass spectrometer for metal detection (51V). In affinity to hTf, the three ions were ranked V(III)>V(IV)>V(V) in the presence of bicarbonate and V(III) reverse congruent V(IV)>V(V) in the absence. Intermediates in the "open forms" binding to the respective sites were detected at the initial stage. V(IV) and V(V) were bound to the N-lobe site in the "closed form" and "open form," respectively. In the absence of bicarbonate, V ions with respective valence states were bound to hTf in the "open form." In terms of binding to hTf, tri-valent V was most favorable in the presence of bicarbonate.

Escitalopram, an antidepressant with an allosteric effect at the serotonin transporter--a review of current understanding of its mechanism of action.

PubMed

Zhong, Huailing; Haddjeri, Nasser; Sánchez, Connie

2012-01-01

Escitalopram is a widely used antidepressant for the treatment of patients with major depression. It is the pure S-enantiomer of racemic citalopram. Several clinical trials and meta-analyses indicate that escitalopram is quantitatively more efficacious than many other antidepressants with a faster onset of action. This paper reviews current knowledge about the mechanism of action of escitalopram. The primary target for escitalopram is the serotonin transporter (SERT), which is responsible for serotonin (or 5-hydroxytryptamine [5-HT]) reuptake at the terminals and cell bodies of serotonergic neurons. Escitalopram and selective serotonin reuptake inhibitors bind with high affinity to the 5-HT binding site (orthosteric site) on the transporter. This leads to antidepressant effects by increasing extracellular 5-HT levels which enhance 5-HT neurotransmission. SERT also has one or more allosteric sites, binding to which modulates activity at the orthosteric binding site but does not directly affect 5-HT reuptake by the transporter. In vitro studies have shown that through allosteric binding, escitalopram decreases its own dissociation rate from the orthosteric site on the SERT. R-citalopram, the nontherapeutic enantiomer in citalopram, is also an allosteric modulator of SERT but can inhibit the actions of escitalopram by interfering negatively with its binding. Both nonclinical studies and some clinical investigations have demonstrated the cellular, neurochemical, neuroadaptive, and neuroplastic changes induced by escitalopram with acute and chronic administration. The findings from binding, neurochemical, and neurophysiological studies may provide a mechanistic rationale for the clinical difference observed with escitalopram compared to other antidepressant therapies.

Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

PubMed Central

Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

2015-01-01

In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

NASA Astrophysics Data System (ADS)

Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

2016-04-01

Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

Mannose-recognition mutant of the galactose/N-acetylgalactosamine-specific C-type lectin CEL-I engineered by site-directed mutagenesis.

PubMed

Moriuchi, Hiromi; Unno, Hideaki; Goda, Shuichiro; Tateno, Hiroaki; Hirabayashi, Jun; Hatakeyama, Tomomitsu

2015-07-01

CEL-I is a galactose/N-acetylgalactosamine-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. Its carbohydrate-binding site contains a QPD (Gln-Pro-Asp) motif, which is generally recognized as the galactose specificity-determining motif in the C-type lectins. In our previous study, replacement of the QPD motif by an EPN (Glu-Pro-Asn) motif led to a weak binding affinity for mannose. Therefore, we examined the effects of an additional mutation in the carbohydrate-binding site on the specificity of the lectin. Trp105 of EPN-CEL-I was replaced by a histidine residue using site-directed mutagenesis, and the binding affinity of the resulting mutant, EPNH-CEL-I, was examined by sugar-polyamidoamine dendrimer assay, isothermal titration calorimetry, and glycoconjugate microarray analysis. Tertiary structure of the EPNH-CEL-I/mannose complex was determined by X-ray crystallographic analysis. Sugar-polyamidoamine dendrimer assay and glycoconjugate microarray analysis revealed a drastic change in the specificity of EPNH-CEL-I from galactose/N-acetylgalactosamine to mannose. The association constant of EPNH-CEL-I for mannose was determined to be 3.17×10(3) M(-1) at 25°C. Mannose specificity of EPNH-CEL-I was achieved by stabilization of the binding of mannose in a correct orientation, in which the EPN motif can form proper hydrogen bonds with 3- and 4-hydroxy groups of the bound mannose. Specificity of CEL-I can be engineered by mutating a limited number of amino acid residues in addition to the QPD/EPN motifs. Versatility of the C-type carbohydrate-recognition domain structure in the recognition of various carbohydrate chains could become a promising platform to develop novel molecular recognition proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

Single-molecule Imaging Analysis of Binding, Processive Movement, and Dissociation of Cellobiohydrolase Trichoderma reesei Cel6A and Its Domains on Crystalline Cellulose*

PubMed Central

Nakamura, Akihiko; Tasaki, Tomoyuki; Ishiwata, Daiki; Yamamoto, Mayuko; Okuni, Yasuko; Visootsat, Akasit; Maximilien, Morice; Noji, Hiroyuki; Uchiyama, Taku; Samejima, Masahiro; Igarashi, Kiyohiko; Iino, Ryota

2016-01-01

Trichoderma reesei Cel6A (TrCel6A) is a cellobiohydrolase that hydrolyzes crystalline cellulose into cellobiose. Here we directly observed the reaction cycle (binding, surface movement, and dissociation) of single-molecule intact TrCel6A, isolated catalytic domain (CD), cellulose-binding module (CBM), and CBM and linker (CBM-linker) on crystalline cellulose Iα. The CBM-linker showed a binding rate constant almost half that of intact TrCel6A, whereas those of the CD and CBM were only one-tenth of intact TrCel6A. These results indicate that the glycosylated linker region largely contributes to initial binding on crystalline cellulose. After binding, all samples showed slow and fast dissociations, likely caused by the two different bound states due to the heterogeneity of cellulose surface. The CBM showed much higher specificity to the high affinity site than to the low affinity site, whereas the CD did not, suggesting that the CBM leads the CD to the hydrophobic surface of crystalline cellulose. On the cellulose surface, intact molecules showed slow processive movements (8.8 ± 5.5 nm/s) and fast diffusional movements (30–40 nm/s), whereas the CBM-Linker, CD, and a catalytically inactive full-length mutant showed only fast diffusional movements. These results suggest that both direct binding and surface diffusion contribute to searching of the hydrolysable point of cellulose chains. The duration time constant for the processive movement was 7.7 s, and processivity was estimated as 68 ± 42. Our results reveal the role of each domain in the elementary steps of the reaction cycle and provide the first direct evidence of the processive movement of TrCel6A on crystalline cellulose. PMID:27609516

DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

PubMed Central

Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

2009-01-01

GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

mTOR kinase structure, mechanism and regulation by the rapamycin-binding domain

PubMed Central

Yang, Haijuan; Rudge, Derek G.; Koos, Joseph D.; Vaidialingam, Bhamini; Yang, Hyo J.; Pavletich, Nikola P.

2015-01-01

The mammalian target of rapamycin (mTOR), a phosphoinositide 3-kinase related protein kinase, controls cell growth in response to nutrients and growth factors and is frequently deregulated in cancer. Here we report co-crystal structures of a truncated mTOR-mLST8 complex with an ATP transition state mimic and with ATP-site inhibitors. The structures reveal an intrinsically active kinase conformation, with catalytic residues and mechanism remarkably similar to canonical protein kinases. The active site is highly recessed due to the FKBP12-Rapamycin binding (FRB) domain and an inhibitory helix protruding from the catalytic cleft. mTOR activating mutations map to the structural framework that holds these elements in place, indicating the kinase is controlled by restricted access. In vitro biochemistry indicates that the FRB domain acts as a gatekeeper, with its rapamycin-binding site interacting with substrates to grant them access to the restricted active site. FKBP12-rapamycin inhibits by directly blocking substrate recruitment and by further restricting active site access. The structures also reveal active site residues and conformational changes that underlie inhibitor potency and specificity. PMID:23636326

Superposition-free comparison and clustering of antibody binding sites: implications for the prediction of the nature of their antigen

PubMed Central

Di Rienzo, Lorenzo; Milanetti, Edoardo; Lepore, Rosalba; Olimpieri, Pier Paolo; Tramontano, Anna

2017-01-01

We describe here a superposition free method for comparing the surfaces of antibody binding sites based on the Zernike moments and show that they can be used to quickly compare and cluster sets of antibodies. The clusters provide information about the nature of the bound antigen that, when combined with a method for predicting the number of direct antibody antigen contacts, allows the discrimination between protein and non-protein binding antibodies with an accuracy of 76%. This is of relevance in several aspects of antibody science, for example to select the framework to be used for a combinatorial antibody library. PMID:28338016

Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

PubMed Central

Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

2012-01-01

Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

The binding sites for benztropines and dopamine in the dopamine transporter overlap

PubMed Central

Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

2013-01-01

Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

Mefloquine inhibits voltage dependent Nav1.4 channel by overlapping the local anaesthetic binding site.

PubMed

Paiz-Candia, Bertin; Islas, Angel A; Sánchez-Solano, Alfredo; Mancilla-Simbro, Claudia; Scior, Thomas; Millan-PerezPeña, Lourdes; Salinas-Stefanon, Eduardo M

2017-02-05

Mefloquine constitutes a multitarget antimalaric that inhibits cation currents. However, the effect and the binding site of this compound on Na + channels is unknown. To address the mechanism of action of mefloquine, we employed two-electrode voltage clamp recordings on Xenopus laevis oocytes, site-directed mutagenesis of the rat Na + channel, and a combined in silico approach using Molecular Dynamics and docking protocols. We found that mefloquine: i) inhibited Na v 1.4 currents (IC 50 =60μM), ii) significantly delayed fast inactivation but did not affect recovery from inactivation, iii) markedly the shifted steady-state inactivation curve to more hyperpolarized potentials. The presence of the β1 subunit significantly reduced mefloquine potency, but the drug induced a significant frequency-independent rundown upon repetitive depolarisations. Computational and experimental results indicate that mefloquine overlaps the local anaesthetic binding site by docking at a hydrophobic cavity between domains DIII and DIV that communicates the local anaesthetic binding site with the selectivity filter. This is supported by the fact that mefloquine potency significantly decreased on mutant Na v 1.4 channel F1579A and significantly increased on K1237S channels. In silico this compound docked above F1579 forming stable π-π interactions with this residue. We provide structure-activity insights into how cationic amphiphilic compounds may exert inhibitory effects by docking between the local anaesthetic binding site and the selectivity filter of a mammalian Na + channel. Our proposed synergistic cycle of experimental and computational studies may be useful for elucidating binding sites of other drugs, thereby saving in vitro and in silico resources. Copyright © 2016 Elsevier B.V. All rights reserved.

Conformational Ensembles of Calmodulin Revealed by Nonperturbing Site-Specific Vibrational Probe Groups.

PubMed

Kelly, Kristen L; Dalton, Shannon R; Wai, Rebecca B; Ramchandani, Kanika; Xu, Rosalind J; Linse, Sara; Londergan, Casey H

2018-03-22

Seven native residues on the regulatory protein calmodulin, including three key methionine residues, were replaced (one by one) by the vibrational probe amino acid cyanylated cysteine, which has a unique CN stretching vibration that reports on its local environment. Almost no perturbation was caused by this probe at any of the seven sites, as reported by CD spectra of calcium-bound and apo calmodulin and binding thermodynamics for the formation of a complex between calmodulin and a canonical target peptide from skeletal muscle myosin light chain kinase measured by isothermal titration. The surprising lack of perturbation suggests that this probe group could be applied directly in many protein-protein binding interfaces. The infrared absorption bands for the probe groups reported many dramatic changes in the probes' local environments as CaM went from apo- to calcium-saturated to target peptide-bound conditions, including large frequency shifts and a variety of line shapes from narrow (interpreted as a rigid and invariant local environment) to symmetric to broad and asymmetric (likely from multiple coexisting and dynamically exchanging structures). The fast intrinsic time scale of infrared spectroscopy means that the line shapes report directly on site-specific details of calmodulin's variable structural distribution. Though quantitative interpretation of the probe line shapes depends on a direct connection between simulated ensembles and experimental data that does not yet exist, formation of such a connection to data such as that reported here would provide a new way to evaluate conformational ensembles from data that directly contains the structural distribution. The calmodulin probe sites developed here will also be useful in evaluating the binding mode of calmodulin with many uncharacterized regulatory targets.

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed Central

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-01-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

2010-10-28

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; G Buchko; L Qin

2011-12-31

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

The juxtamembrane domain of the E-cadherin cytoplasmic tail contributes to its interaction with Myosin VI

PubMed Central

Mangold, Sabine; Norwood, Suzanne J.; Yap, Alpha S.; Collins, Brett M.

2012-01-01

We recently identified the atypical myosin, Myosin VI, as a component of epithelial cell-cell junctions that interacts with E-cadherin. Recombinant proteins bearing the cargo-binding domain of Myosin VI (Myo VI-CBD) or the cytoplasmic tail of E-cadherin can interact directly with one another. In this report we further investigate the molecular requirements of the interaction between Myo VI-CBD and E-cadherin combining truncation mutation analysis with in vitro binding assays. We report that a short (28 amino acid) juxtamembrane region of the cadherin cytoplasmic tail is sufficient to bind Myo VI-CBD. However, central regions of the cadherin tail adjacent to the juxtamembrane sequence also display binding activity for Myo VI-CBD. It is therefore possible that the cadherin tail bears two binding sites for Myosin VI, or an extended binding site that includes the juxtamembrane region. Nevertheless, our biochemical data highlight the capacity for the juxtamembrane region to interact with functionally-significant cytoplasmic proteins. PMID:23007415

The Antibiotic Novobiocin Binds and Activates the ATPase That Powers Lipopolysaccharide Transport.

PubMed

May, Janine M; Owens, Tristan W; Mandler, Michael D; Simpson, Brent W; Lazarus, Michael B; Sherman, David J; Davis, Rebecca M; Okuda, Suguru; Massefski, Walter; Ruiz, Natividad; Kahne, Daniel

2017-12-06

Novobiocin is an orally active antibiotic that inhibits DNA gyrase by binding the ATP-binding site in the ATPase subunit. Although effective against Gram-positive pathogens, novobiocin has limited activity against Gram-negative organisms due to the presence of the lipopolysaccharide-containing outer membrane, which acts as a permeability barrier. Using a novobiocin-sensitive Escherichia coli strain with a leaky outer membrane, we identified a mutant with increased resistance to novobiocin. Unexpectedly, the mutation that increases novobiocin resistance was not found to alter gyrase, but the ATPase that powers lipopolysaccharide (LPS) transport. Co-crystal structures, biochemical, and genetic evidence show novobiocin directly binds this ATPase. Novobiocin does not bind the ATP binding site but rather the interface between the ATPase subunits and the transmembrane subunits of the LPS transporter. This interaction increases the activity of the LPS transporter, which in turn alters the permeability of the outer membrane. We propose that novobiocin will be a useful tool for understanding how ATP hydrolysis is coupled to LPS transport.

Rapid characterization of a novel taspine derivative-HMQ1611 binding to EGFR by a cell membrane chromatography method.

PubMed

Du, Hui; Lv, Nan; Wang, Sicen; He, Langchong

2013-05-01

A new high-expression endothelial growth factor receptor (EGFR) cell membrane chromatography (CMC) method was applied to recognize the ligands acting on EGFR specifically, and investigate the affinity of gefitinib/HMQ1611 to EGFR. In the self and direct competitive assay, gefitinib/HMQ1611 was used as a competitor in the mobile phase to evaluate the effect of the competitor's concentrations on the retention of the ligands, respectively, and the competition between gefitinib and HMQ1611 binding to EGFR was also been examined. The retention behavior indicated that gefitinib had one type of binding sites on the EGFR, and the equilibrium dissociation constant (K(D)) was (9.11 ± 1.89) × 10(-6) M; HMQ1611 had two major binding regions on the EGFR, and the K(D) values obtained from the model were (2.39 ± 0.33) × 10(-7) and (3.87 ± 0.93) × 10(-5) M for HMQ1611 at the high- and low-affinity sites, respectively. The competition between gefitinib and HMQ1611 occurred at the low-affinity sites on the EGFR. The low-affinity sites were of higher concentrations and contributed to a much larger part of retention of HMQ1611. The results suggested that gefitinib and HMQ1611 competed for the common binding sites on the EGFR, no matter the ligand was used as an analyte or a competitor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zukin, R.S.; Eghbali, M.; Olive, D.

{kappa} opioid receptors ({kappa} receptors) have been characterized in homogenates of guinea pig and rat brain under in vitro binding conditions. {kappa} receptors were labeled by using the tritiated prototypic {kappa} opioid ethylketocyclazocine under conditions in which {mu} and {delta} opioid binding was suppressed. In the case of guinea pig brain membranes, a single population of high-affinity {kappa} opioid receptor sites was observed. In contrast, in the case of rat brain, two populations of {kappa} sites were observed. To test the hypothesis that the high- and low-affinity {kappa} sites represent two distinct {kappa} receptor subtypes, a series of opioids weremore » tested for their abilities to compete for binding to the two sites. U-69,593 and Cambridge 20 selectively displaced the high-affinity {kappa} site in both guinea pig and rat tissue, but were inactive at the rat-brain low-affinity site. Other {kappa} opioid drugs competed for binding to both sites, but with different rank orders of potency. Quantitative light microscopy in vitro autoradiography was used to visualize the neuroanatomical pattern of {kappa} receptors in rat and guinea pig brain. The distribution patterns of the two {kappa} receptor subtypes of rat brain were clearly different. Collectively, these data provide direct evidence for the presence of two {kappa} receptor subtypes; the U-69,593-sensitive, high-affinity {kappa}{sub 1} site predominates in guinea pig brain, and the U-69,593-insensitive, low-affinity {kappa}{sub 2} site predominates in rat brain.« less

Substance P analogs displace sigma binding differentially in the brain and spinal cord of the adult mouse.

PubMed

Mousseau, D D; Larson, A A

1994-09-01

We have previously observed similarities in the behavioral effects produced by the NH2-terminus of the undecapeptide substance P (SP) and by 1,3-di(2-tolyl)-guanidine (DTG) in the adult mouse. The present series of experiments indicate differences in the rank-order of potency of sigma ligands [DTG; haloperidol (HAL)], SP analogs [SP; SP(1-7); SP(5-11); [D-Pro2, D-Phe7]-SP(1-7) (D-SP(1-7))] and miscellaneous compounds [morphine (MOR), naloxone (NAL)] at competing for [3H]-DTG binding sites in the mouse brain and spinal cord in vitro: Brain; DTG = HAL > SP = MOR = NAL > SP(1-7) > D-SP(1-7) > SP(5-11): Spinal cord; DTG = HAL > SP(1-7) = MOR = NAL > SP > D-SP(1-7) = SP(5-11). The observed difference in the rank-order potencies of the displacing ligands at these same binding sites supports the notion of two distinct populations of sigma binding sites in these tissues in the adult mouse. Given the low (micromolar) potency of SP analogs at displacing [3H]-DTG binding in the present series of experiments, it is unlikely that the similar behavioral effects we have previously observed elicited by SP(1-7) and DTG in the adult mouse are a result of a direct action of SP(1-7) at the sigma binding site.

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

PubMed

Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

2002-09-01

Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Mechanistic Insights into Elastin Degradation by Pseudolysin, the Major Virulence Factor of the Opportunistic Pathogen Pseudomonas aeruginosa

PubMed Central

Yang, Jie; Zhao, Hui-Lin; Ran, Li-Yuan; Li, Chun-Yang; Zhang, Xi-Ying; Su, Hai-Nan; Shi, Mei; Zhou, Bai-Cheng; Chen, Xiu-Lan; Zhang, Yu-Zhong

2015-01-01

Pseudolysin is the most abundant protease secreted by Pseudomonas aeruginosa and is the major extracellular virulence factor of this opportunistic human pathogen. Pseudolysin destroys human tissues by solubilizing elastin. However, the mechanisms by which pseudolysin binds to and degrades elastin remain elusive. In this study, we investigated the mechanism of action of pseudolysin on elastin binding and degradation by biochemical assay, microscopy and site-directed mutagenesis. Pseudolysin bound to bovine elastin fibers and preferred to attack peptide bonds with hydrophobic residues at the P1 and P1’ positions in the hydrophobic domains of elastin. The time-course degradation processes of both bovine elastin fibers and cross-linked human tropoelastin by pseudolysin were further investigated by microscopy. Altogether, the results indicate that elastin degradation by pseudolysin began with the hydrophobic domains on the fiber surface, followed by the progressive disassembly of macroscopic elastin fibers into primary structural elements. Moreover, our site-directed mutational results indicate that five hydrophobic residues in the S1-S1’ sub-sites played key roles in the binding of pseudolysin to elastin. This study sheds lights on the pathogenesis of P. aeruginosa infection. PMID:25905792

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

PubMed Central

Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

1977-01-01

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

Integration of Inhibition Kinetics and Molecular Dynamics Simulations: A Urea-Mediated Folding Study on Acetaldehyde Dehydrogenase 1.

PubMed

Xu, Yingying; Lee, Jinhyuk; Lü, Zhi-Rong; Mu, Hang; Zhang, Qian; Park, Yong-Doo

2016-07-01

Understanding the mechanism of acetaldehyde dehydrogenase 1 (ALDH1) folding is important because this enzyme is directly involved in several types of cancers and other diseases. We investigated the urea-mediated unfolding of ALDH1 by integrating kinetic inhibition studies with computational molecular dynamics (MD) simulations. Conformational changes in the enzyme structure were also analyzed using intrinsic and 1-anilinonaphthalene-8-sulfonate (ANS)-binding fluorescence measurements. Kinetic studies revealed that the direct binding of urea to ALDH1 induces inactivation of ALDH1 in a manner of mixed-type inhibition. Tertiary structural changes associated with regional hydrophobic exposure of the active site were observed. The urea binding regions on ALDH1 were predicted by docking simulations and were partly shared with active site residues of ALDH1 and with interface residues of the oligomerization domain for tetramer formation. The docking results suggest that urea prevents formation of the ALDH1 normal shape for the tetramer state as well as entrance of the substrate into the active site. Our study provides insight into the structural changes that accompany urea-mediated unfolding of ALDH1 and the catalytic role associated with conformational changes.

Transport direction determines the kinetics of substrate transport by the glutamate transporter EAAC1

PubMed Central

Zhang, Zhou; Tao, Zhen; Gameiro, Armanda; Barcelona, Stephanie; Braams, Simona; Rauen, Thomas; Grewer, Christof

2007-01-01

Glutamate transport by the excitatory amino acid carrier EAAC1 is known to be reversible. Thus, glutamate can either be taken up into cells, or it can be released from cells through reverse transport, depending on the electrochemical gradient of the co- and countertransported ions. However, it is unknown how fast and by which reverse transport mechanism glutamate can be released from cells. Here, we determined the steady- and pre-steady-state kinetics of reverse glutamate transport with submillisecond time resolution. First, our results suggest that glutamate and Na+ dissociate from their cytoplasmic binding sites sequentially, with glutamate dissociating first, followed by the three cotransported Na+ ions. Second, the kinetics of glutamate transport depend strongly on transport direction, with reverse transport being faster but less voltage-dependent than forward transport. Third, electrogenicity is distributed over several reverse transport steps, including intracellular Na+ binding, reverse translocation, and reverse relocation of the K+-bound EAAC1. We propose a kinetic model, which is based on a “first-in-first-out” mechanism, suggesting that glutamate association, with its extracellular binding site as well as dissociation from its intracellular binding site, precedes association and dissociation of at least one Na+ ion. Our model can be used to predict rates of glutamate release from neurons under physiological and pathophysiological conditions. PMID:17991780

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

Novel interactions of CAPS (Ca2+-dependent activator protein for secretion) with the three neuronal SNARE proteins required for vesicle fusion.

PubMed

Daily, Neil J; Boswell, Kristin L; James, Declan J; Martin, Thomas F J

2010-11-12

CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca(2+)-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis.

Novel Interactions of CAPS (Ca2+-dependent Activator Protein for Secretion) with the Three Neuronal SNARE Proteins Required for Vesicle Fusion*

PubMed Central

Daily, Neil J.; Boswell, Kristin L.; James, Declan J.; Martin, Thomas F. J.

2010-01-01

CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca2+-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis. PMID:20826818

Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Y.; Li, H.; Li, Hua

2009-04-28

Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings,more » we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.« less

Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

PubMed Central

Harada, Yoichiro; Li, Hua; Li, Huilin; Lennarz, William J.

2009-01-01

Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of ≈1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes. PMID:19365066

Ion Selectivity in the KcsA Potassium Channel from the Perspective of the Ion Binding Site

PubMed Central

Dixit, Purushottam D.; Merchant, Safir; Asthagiri, D.

2009-01-01

To understand the thermodynamic exclusion of Na+ relative to K+ from the S2 site of the selectivity filter, the distribution PX(ɛ) (X = K+ or Na+) of the binding energy (ɛ) of the ion with the channel is analyzed using the potential distribution theorem. By expressing the excess chemical potential of the ion as a sum of mean-field 〈ɛ〉 and fluctuation μexflux,X contributions, we find that selectivity arises from a higher value of μflux,Na+ex relative to μflux,K+ex. To understand the role of site-site interactions on μexflux,X, we decompose PX(ɛ) into n-dependent distributions, where n is the number of ion-coordinating ligands within a distance λ from the ion. For λ comparable to typical ion-oxygen bond distances, investigations building on this multistate model reveal an inverse correlation between favorable ion-site and site-site interactions: the ion-coordination states that most influence the thermodynamics of the ion are also those for which the binding site is energetically less strained and vice versa. This correlation motivates understanding entropic effects in ion binding to the site and leads to the finding that μexflux,X is directly proportional to the average site-site interaction energy, a quantity that is sensitive to the chemical type of the ligand coordinating the ion. Increasing the coordination number around Na+ only partially accounts for the observed magnitude of selectivity; acknowledging the chemical type of the ion-coordinating ligand is essential. PMID:19289040

PI(4,5)P2-binding effector proteins for vesicle exocytosis

PubMed Central

Martin, Thomas F. J.

2014-01-01

PI(4,5)P2 participates directly in priming and possibly fusion steps of Ca2+-triggered vesicle exocytosis. High concentration nanodomains of PI(4,5)P2 reside on the plasma membrane of neuroendocrine cells. A subset of vesicles that co-localize with PI(4,5)P2 domains appear to undergo preferential exocytosis in stimulated cells. PI(4,5)P2 directly regulates vesicle exocytosis by recruiting and activating PI(4,5)P2-binding proteins that regulate SNARE protein function including CAPS, Munc13-1/2, synaptotagmin-1, and other C2 domain-containing proteins. These PI(4,5)P2 effector proteins are coincidence detectors that engage in multiple interactions at vesicle exocytic sites. The SNARE protein syntaxin-1 also binds to PI(4,5)P2, which promotes clustering, but an activating role for PI(4,5)P2 in syntaxin-1 function remains to be fully characterized. Similar principles underlie polarized constitutive vesicle fusion mediated in part by the PI(4,5)P2-binding subunits of the exocyst complex (Sec3, Exo70). Overall, focal vesicle exocytosis occurs at sites landmarked by PI(4,5)P2, which serves to recruit and/or activate multifunctional PI(4,5)P2-binding proteins. PMID:25280637

Terminating DNA Tile Assembly with Nanostructured Caps.

PubMed

Agrawal, Deepak K; Jiang, Ruoyu; Reinhart, Seth; Mohammed, Abdul M; Jorgenson, Tyler D; Schulman, Rebecca

2017-10-24

Precise control over the nucleation, growth, and termination of self-assembly processes is a fundamental tool for controlling product yield and assembly dynamics. Mechanisms for altering these processes programmatically could allow the use of simple components to self-assemble complex final products or to design processes allowing for dynamic assembly or reconfiguration. Here we use DNA tile self-assembly to develop general design principles for building complexes that can bind to a growing biomolecular assembly and terminate its growth by systematically characterizing how different DNA origami nanostructures interact with the growing ends of DNA tile nanotubes. We find that nanostructures that present binding interfaces for all of the binding sites on a growing facet can bind selectively to growing ends and stop growth when these interfaces are presented on either a rigid or floppy scaffold. In contrast, nucleation of nanotubes requires the presentation of binding sites in an arrangement that matches the shape of the structure's facet. As a result, it is possible to build nanostructures that can terminate the growth of existing nanotubes but cannot nucleate a new structure. The resulting design principles for constructing structures that direct nucleation and termination of the growth of one-dimensional nanostructures can also serve as a starting point for programmatically directing two- and three-dimensional crystallization processes using nanostructure design.

Screening of a library of T7 phage-displayed peptides identifies alphaC helix in 14-3-3 protein as a CBP501-binding site.

PubMed

Matsumoto, Yuki; Shindo, Yosuke; Takakusagi, Yoichi; Takakusagi, Kaori; Tsukuda, Senko; Kusayanagi, Tomoe; Sato, Hitoshi; Kawabe, Takumi; Sugawara, Fumio; Sakaguchi, Kengo

2011-12-01

CBP501 is a chemically modified peptide composed of twelve unnatural d-amino acids, which inhibits Chk kinase and abrogates G2 arrest induced by DNA-damaging agents. Here we identified an alphaC helix in 14-3-3 protein as a CBP501-binding site using T7 phage display technology. An affinity selection of T7 phage-displayed peptide using biotinylated CBP501 identified a 14-mer peptide NSDCIISRKIEQKE. This peptide sequence showed similarity to a portion of the alphaC helix of human 14-3-3ε, suggesting that CBP501 may bind to this region. Surface plasmon resonance (SPR) and ELISA demonstrated that CBP501 interacts with 14-3-3ε specifically at the screen-guided region. An avidin-agarose bead pull-down assay showed that CBP501 also binds to other 14-3-3 isoforms in Jurkat cells. Among the other known Chk kinase inhibitors tested, CBP501 showed the strongest affinity for 14-3-3ε. Thus, we conclude that in addition to the direct inhibition of Chk kinase activity, CBP501 directly binds to cellular 14-3-3 proteins through alphaC helix. Copyright © 2011 Elsevier Ltd. All rights reserved.

Antibody humanization by molecular dynamics simulations-in-silico guided selection of critical backmutations.

PubMed

Margreitter, Christian; Mayrhofer, Patrick; Kunert, Renate; Oostenbrink, Chris

2016-06-01

Monoclonal antibodies represent the fastest growing class of biotherapeutic proteins. However, as they are often initially derived from rodent organisms, there is a severe risk of immunogenic reactions, hampering their applicability. The humanization of these antibodies remains a challenging task in the context of rational drug design. "Superhumanization" describes the direct transfer of the complementarity determining regions to a human germline framework, but this humanization approach often results in loss of binding affinity. In this study, we present a new approach for predicting promising backmutation sites using molecular dynamics simulations of the model antibody Ab2/3H6. The simulation method was developed in close conjunction with novel specificity experiments. Binding properties of mAb variants were evaluated directly from crude supernatants and confirmed using established binding affinity assays for purified antibodies. Our approach provides access to the dynamical features of the actual binding sites of an antibody, based solely on the antibody sequence. Thus we do not need structural data on the antibody-antigen complex and circumvent cumbersome methods to assess binding affinities. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

PubMed Central

Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

1999-01-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase.

PubMed

Levin, Mikhail K; Gurjar, Madhura; Patel, Smita S

2005-05-01

Helicases translocate along their nucleic acid substrates using the energy of ATP hydrolysis and by changing conformations of their nucleic acid-binding sites. Our goal is to characterize the conformational changes of hepatitis C virus (HCV) helicase at different stages of ATPase cycle and to determine how they lead to translocation. We have reported that ATP binding reduces HCV helicase affinity for nucleic acid. Now we identify the stage of the ATPase cycle responsible for translocation and unwinding. We show that a rapid directional movement occurs upon helicase binding to DNA in the absence of ATP, resulting in opening of several base pairs. We propose that HCV helicase translocates as a Brownian motor with a simple two-stroke cycle. The directional movement step is fueled by single-stranded DNA binding energy while ATP binding allows for a brief period of random movement that prepares the helicase for the next cycle.

Site-specific effects of the nonsteroidal anti-inflammatory drug lysine clonixinate on rat brain opioid receptors.

PubMed

Ortí, E; Coirini, H; Pico, J C

1999-04-01

In addition to effects in the periphery through inhibition of prostaglandin synthesis, several lines of evidence suggest that nonsteroidal anti-inflammatory drugs (NSAIDs) act in the central nervous system. The possibility that the central action of NSAIDs involves regulation of opioid receptors was investigated by quantitative autoradiography of mu, delta, and kappa sites in rat brain slices. Increased (p < 0.05) labeling of mu receptors was observed in thalamic nuclei, gyrus dentate, and layers of the parietal cortex of rats treated for 10 days with lysine clonixinate. Labeling of delta receptors was lower in the lateral septum, and kappa sites decreased in thalamic nuclei. These effects were not mediated through direct interaction with opioid-binding sites, since receptor-binding assays using rat brain membranes confirmed that clonixinate up to 1 x 10(-4) mol/l does not inhibit mu, delta, and kappa receptor specific binding. Central effects of NSAIDs might, therefore, involve interaction with the opioid receptor system through indirect mechanisms.

Identifying Ca2+-Binding Sites in Proteins by Liquid Chromatography-Mass Spectrometry Using Ca2+-Directed Dissociations

PubMed Central

Jamalian, Azadeh; Sneekes, Evert-Jan; Wienk, Hans; Dekker, Lennard J. M.; Ruttink, Paul J. A.; Ursem, Mario; Luider, Theo M.; Burgers, Peter C.

2014-01-01

Here we describe a new method to identify calcium-binding sites in proteins using high-resolution liquid chromatography-mass spectrometry in concert with calcium-directed collision-induced dissociations. Our method does not require any modifications to the liquid chromatography-mass spectrometry apparatus, uses standard digestion protocols, and can be applied to existing high-resolution MS data files. In contrast to NMR, our method is applicable to very small amounts of complex protein mixtures (femtomole level). Calcium-bound peptides can be identified using three criteria: (1) the calculated exact mass of the calcium containing peptide; (2) specific dissociations of the calcium-containing peptide from threonine and serine residues; and (3) the very similar retention times of the calcium-containing peptide and the free peptide. PMID:25023127

Molecular Control of Polyene Macrolide Biosynthesis

PubMed Central

Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

2011-01-01

Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

Molecular Dynamics Simulations of Family 7 Cellobiohydrolase Mutants Aimed at Reducing Product Inhibition.

PubMed

Silveira, Rodrigo L; Skaf, Munir S

2015-07-23

Enzymatic conversion of lignocellulosic biomass into biofuels and chemicals constitutes a potential route for sustainable development. Cellobiohydrolases are key enzymes used in industrial cocktails for depolymerization of crystalline cellulose, and their mechanism of action has been intensely studied in the past several years. Provided with a tunnel-like substrate-binding cavity, cellobiohydrolases possess the ability to processively hydrolyze glycosidic bonds of crystalline cellulose, yielding one molecule of cellobiose per catalytic cycle. As such, cellobiose expulsion from the product binding site is a necessary step in order to allow for the processive hydrolysis mechanism. However, the high-affinity binding of cellobiose to the enzyme impairs the process and causes activity inhibition due to reaction products. Here, we use molecular dynamics simulations to study the binding of cellobiose to the Trichoderma reesei Cel7A (TrCel7A) cellobiohydrolase and the effects of mutations that reduce cellobiose binding, without affecting the structural and dynamical integrities of the enzyme. We observe that the product binding site exhibits an intrinsic flexibility that can sterically hinder cellobiose release. Several point mutations in the product binding site reduce cellobiose-enzyme interactions, but not all modifications are able to maintain the structural integrity of the enzyme. In particular, mutation of charged residues in the TrCel7A product binding site causes perturbations that affect the structure of the loops that form the substrate-binding tunnel of the enzyme and, hence, may affect TrCel7A function in other steps of the hydrolysis mechanism. Our results suggest there is a trade-off between product inhibition and catalytic efficiency, and they provide directions for cellulases engineering.

LTRs of endogenous retroviruses as a source of Tbx6 binding sites

NASA Astrophysics Data System (ADS)

Yasuhiko, Yukuto; Hirabayashi, Yoko; Ono, Ryuichi

2017-06-01

Retrotransposons are abundant in mammalian genomes and can modulate the gene expression of surrounding genes by disrupting endogenous binding sites for transcription factors (TFs) or providing novel TFs binding sites within retrotransposon sequences. Here, we show that a (C/T)CACACCT sequence motif in ORR1A, ORR1B, ORR1C and ORR1D, Long Terminal Repeats (LTRs) of MaLR endogenous retrovirus (ERV), is the direct target of Tbx6, an evolutionary conserved family of T-box transcription factors. Moreover, by comparing gene expression between control mice (Tbx6 +/-) and Tbx6-deficient mice (Tbx6 -/-), we demonstrate that at least four genes, Twist2, Pitx2, Oscp1, and Nfxl1, are down-regulated with Tbx6 deficiency. These results suggest that ORR1A, ORR1B, ORR1C and ORR1D may contribute to the evolution of mammalian embryogenesis.

LTRs of Endogenous Retroviruses as a Source of Tbx6 Binding Sites

PubMed Central

Yasuhiko, Yukuto; Hirabayashi, Yoko; Ono, Ryuichi

2017-01-01

Retrotransposons are abundant in mammalian genomes and can modulate the gene expression of surrounding genes by disrupting endogenous binding sites for transcription factors (TFs) or providing novel TFs binding sites within retrotransposon sequences. Here, we show that a (C/T)CACACCT sequence motif in ORR1A, ORR1B, ORR1C, and ORR1D, Long Terminal Repeats (LTRs) of MaLR endogenous retrovirus (ERV), is the direct target of Tbx6, an evolutionary conserved family of T-box TFs. Moreover, by comparing gene expression between control mice (Tbx6 +/−) and Tbx6-deficient mice (Tbx6 −/−), we demonstrate that at least four genes, Twist2, Pitx2, Oscp1, and Nfxl1, are down-regulated with Tbx6 deficiency. These results suggest that ORR1A, ORR1B, ORR1C and ORR1D may contribute to the evolution of mammalian embryogenesis. PMID:28664156

LTRs of Endogenous Retroviruses as a Source of Tbx6 Binding Sites.

PubMed

Yasuhiko, Yukuto; Hirabayashi, Yoko; Ono, Ryuichi

2017-01-01

Retrotransposons are abundant in mammalian genomes and can modulate the gene expression of surrounding genes by disrupting endogenous binding sites for transcription factors (TFs) or providing novel TFs binding sites within retrotransposon sequences. Here, we show that a (C/T)CACACCT sequence motif in ORR1A, ORR1B, ORR1C, and ORR1D, Long Terminal Repeats (LTRs) of MaLR endogenous retrovirus (ERV), is the direct target of Tbx6, an evolutionary conserved family of T-box TFs. Moreover, by comparing gene expression between control mice (Tbx6 +/-) and Tbx6-deficient mice (Tbx6 -/-), we demonstrate that at least four genes, Twist2, Pitx2, Oscp1 , and Nfxl1 , are down-regulated with Tbx6 deficiency. These results suggest that ORR1A, ORR1B, ORR1C and ORR1D may contribute to the evolution of mammalian embryogenesis.

Mutants of Cre recombinase with improved accuracy

PubMed Central

Eroshenko, Nikolai; Church, George M.

2013-01-01

Despite rapid advances in genome engineering technologies, inserting genes into precise locations in the human genome remains an outstanding problem. It has been suggested that site-specific recombinases can be adapted towards use as transgene delivery vectors. The specificity of recombinases can be altered either with directed evolution or via fusions to modular DNA-binding domains. Unfortunately, both wildtype and altered variants often have detectable activities at off-target sites. Here we use bacterial selections to identify mutations in the dimerization surface of Cre recombinase (R32V, R32M, and 303GVSdup) that improve the accuracy of recombination. The mutants are functional in bacteria, in human cells, and in vitro (except for 303GVSdup, which we did not purify), and have improved selectivity against both model off-target sites and the entire E. coli genome. We propose that destabilizing binding cooperativity may be a general strategy for improving the accuracy of dimeric DNA-binding proteins. PMID:24056590

Relative binding affinities of monolignols to horseradish peroxidase

DOE PAGES

Sangha, Amandeep K.; Petridis, Loukas; Cheng, Xiaolin; ...

2016-07-22

Monolignol binding to the peroxidase active site is the first step in lignin polymerization in plant cell walls. Using molecular dynamics, docking, and free energy perturbation calculations, we investigate the binding of monolignols to horseradish peroxidase C. Our results suggest that p-coumaryl alcohol has the strongest binding affinity followed by sinapyl and coniferyl alcohol. Stacking interactions between the monolignol aromatic rings and nearby phenylalanine residues play an important role in determining the calculated relative binding affinities. p-Coumaryl and coniferyl alcohols bind in a pose productive for reaction in which a direct H-bond is formed between the phenolic –OH group andmore » a water molecule (W2) that may facilitate proton transfer during oxidation. In contrast, in the case of sinapyl alcohol there is no such direct interaction, the phenolic –OH group instead interacting with Pro139. Furthermore, since proton and electron transfer is the rate-limiting step in monolignol oxidation by peroxidase, the binding pose (and thus the formation of near attack conformation) appears to play a more important role than the overall binding affinity in determining the oxidation rate.« less

Identification of cisplatin-binding sites on the large cytoplasmic loop of the Na+/K+-ATPase.

PubMed

Šeflová, Jaroslava; Čechová, Petra; Štenclová, Tereza; Šebela, Marek; Kubala, Martin

2018-12-01

Cisplatin is the most widely used chemotherapeutic drug for the treatment of various types of cancer; however, its administration brings also numerous side effects. It was demonstrated that cisplatin can inhibit the Na + /K + -ATPase (NKA), which can explain a large part of the adverse effects. In this study, we have identified five cysteinyl residues (C452, C456, C457, C577, and C656) as the cisplatin binding sites on the cytoplasmic loop connecting transmembrane helices 4 and 5 (C45), using site-directed mutagenesis and mass spectrometry experiments. The identified residues are known to be susceptible to glutathionylation indicating their involvement in a common regulatory mechanism.

Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

NASA Astrophysics Data System (ADS)

Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

2017-03-01

Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

An NMR-Based Structural Rationale for Contrasting Stoichiometry and Ligand Binding Site(s) in Fatty Acid-binding Proteins†

PubMed Central

He, Yan; Estephan, Rima; Yang, Xiaomin; Vela, Adriana; Wang, Hsin; Bernard, Cédric; Stark, Ruth E.

2011-01-01

Liver fatty acid-binding protein (LFABP) is a 14-kDa cytosolic polypeptide, differing from other family members in number of ligand binding sites, diversity of bound ligands, and transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional 1H-15N NMR signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without solving the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and a R122L/S124A mutant in which electrostatic interactions viewed as essential to fatty acid binding were removed. For wild-type LFABP the results compared favorably with previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, 1H/15N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. PMID:21226535

Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV

PubMed Central

Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun

2013-01-01

Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868

Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

PubMed Central

Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

2017-01-01

Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

Reversible binding kinetics of a cytoskeletal protein at the erythrocyte submembrane.

PubMed Central

Stout, A. L.; Axelrod, D.

1994-01-01

Reversible binding among components of the cellular submembrane cytoskeleton and reversible binding of some of these components with the plasma membrane likely play a role in nonelastic morphological changes and mechanoplastic properties of cells. However, relatively few studies have been devoted to investigating directly the kinetic aspects of the interactions of individual components of the membrane skeleton with the membrane. The experiments described here investigated whether one component of the erythrocyte membrane cytoskeleton, protein 4.1, binds to its sites on the membrane reversibly and if so, whether the different 4.1-binding sites display distinct kinetic behavior. Protein 4.1 is known to stabilize the membrane and to mediate the attachment of spectrin filaments to the membrane. Protein 4.1 previously has been shown to bind to integral membrane proteins band 3, glycophorin C, and to negatively charged phospholipids. To examine the kinetic rates of dissociation of carboxymethyl fluorescein-labeled 4.1 (CF-4.1) to the cytofacial surface of erythrocyte membrane, a special preparation of hemolyzed erythrocyte ghosts was used, in which the ghosts became flattened on a glass surface and exposed their cytofacial surfaces to the solution through a membrane rip in a distinctive characteristic pattern. This preparation was examined by the microscopy technique of total internal reflection/fluorescence recovery after photobleaching (TIR/FRAP). Four different treatments were employed to help identify which membrane binding sites gave rise to the multiplicity of observed kinetic rates. The first treatment, the control, stripped off the native spectrin, actin, 4.1, and ankyrin. About 60% of the CF-4.1 bound to this control binded irreversibly (dissociation time > 20 min), but the remaining approximately 40% binded reversibly with a range of residency times averaging approximately 3 s. The second treatment subjected these stripped membranes to trypsin, which presumably removed most of the band 3. CF-4.1 binded significantly less to these trypsinized membranes and most of the decrease was a loss of the irreversibly binding sites. The third treatment simply preserved the native 4.1 and ankyrin. CF-4.1 binded less to this sample too, and the loss involved both the irreversible and reversible sites. The fourth treatment blocked the gycophorin C sites on the native 4.1-stripped membranes with an antibody. CF-4.1 again binded less to this sample than to a nonimmune serum control, and almost all of the decrease is a loss of irreversible sites. These rest suggest that 1) protein 4.1 binds to membrane or submembrane sites at least in part reversibly ; 2) the most reversible sites are probably not proteinaceous and not glycophorin C, but possibly are phospholipids (especially phosphatidylserine); and 3) TIWRFRAP can successfully examine the fast reversible dynamics of cytoskeletal components binding to biological membranes. Images FIGURE 2 FIGURE 3 FIGURE 4 PMID:7811947

PRISM offers a comprehensive genomic approach to transcription factor function prediction

PubMed Central

Wenger, Aaron M.; Clarke, Shoa L.; Guturu, Harendra; Chen, Jenny; Schaar, Bruce T.; McLean, Cory Y.; Bejerano, Gill

2013-01-01

The human genome encodes 1500–2000 different transcription factors (TFs). ChIP-seq is revealing the global binding profiles of a fraction of TFs in a fraction of their biological contexts. These data show that the majority of TFs bind directly next to a large number of context-relevant target genes, that most binding is distal, and that binding is context specific. Because of the effort and cost involved, ChIP-seq is seldom used in search of novel TF function. Such exploration is instead done using expression perturbation and genetic screens. Here we propose a comprehensive computational framework for transcription factor function prediction. We curate 332 high-quality nonredundant TF binding motifs that represent all major DNA binding domains, and improve cross-species conserved binding site prediction to obtain 3.3 million conserved, mostly distal, binding site predictions. We combine these with 2.4 million facts about all human and mouse gene functions, in a novel statistical framework, in search of enrichments of particular motifs next to groups of target genes of particular functions. Rigorous parameter tuning and a harsh null are used to minimize false positives. Our novel PRISM (predicting regulatory information from single motifs) approach obtains 2543 TF function predictions in a large variety of contexts, at a false discovery rate of 16%. The predictions are highly enriched for validated TF roles, and 45 of 67 (67%) tested binding site regions in five different contexts act as enhancers in functionally matched cells. PMID:23382538

High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors.

PubMed Central

Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G

1993-01-01

The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090

Molecular flip–flops formed by overlapping Fis sites

PubMed Central

Hengen, Paul N.; Lyakhov, Ilya G.; Stewart, Lisa E.; Schneider, Thomas D.

2003-01-01

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip–flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip–flop could represent part of an on–off switch for replication. Because they can be used to create precise switched states, molecular flip–flops could be used as the basis of a novel molecular computer. PMID:14602927

Molecular flip-flops formed by overlapping Fis sites.

PubMed

Hengen, Paul N; Lyakhov, Ilya G; Stewart, Lisa E; Schneider, Thomas D

2003-11-15

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip-flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip-flop could represent part of an on-off switch for replication. Because they can be used to create precise switched states, molecular flip-flops could be used as the basis of a novel molecular computer.

The antigenic surface of staphylococcal nuclease. II. Analysis of the N-1 epitope by site-directed mutagenesis.

PubMed

Smith, A M; Benjamin, D C

1991-02-15

Previous studies in our laboratory on the production and isolation of a panel of mAb to staphylococcal nuclease allowed us to define a series of eight overlapping epitopes. Using site-directed mutagenesis of the nuclease coding sequences we were able to map the nonoverlapping epitopes recognized by two members of this panel. In the study reported here, we report the generation and analysis of a number of single amino acid substitutions for seven surface residues predicted to lie within one of these two epitopes. Immunochemical analysis showed that one or more substitutions at each of these seven positions had a major effect on mAb binding, whereas other substitutions had none. Based on the nature of these substitutions and the chemical and physical properties of the variant molecules, we believe that any structural effects induced by these substitutions are local and do not result in long-range structural alterations that indirectly influence antibody reactivity. Therefore, we conclude that disruption of mAb binding can be directly attributed to changes in amino acid side chains and that not only are all seven of the residues studied part of the epitope but all seven make contact with the antibody combining site. These studies demonstrate the advantages of using site-directed mutagenesis to study antigen structure and emphasize the importance of constructing the examining multiple substitutions for any given amino acid.

Myosin binding protein C positioned to play a key role in regulation of muscle contraction: structure and interactions of domain C1.

PubMed

Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Le Masurier, Clare; Gautel, Mathias; Pfuhl, Mark

2008-12-19

Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1-S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (K(d) of approximately 10-20 microM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1-S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1-C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation.

Myosin Binding Protein C Positioned to Play a Key Role in Regulation of Muscle Contraction: Structure and Interactions of Domain C1

PubMed Central

Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Masurier, Clare Le; Gautel, Mathias; Pfuhl, Mark

2008-01-01

Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1–S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (Kd of approximately 10–20 μM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1–S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1–C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation. PMID:18926831

Water channel in the binding site of a high affinity anti-methotrexate antibody.

PubMed

Gayda, Susan; Longenecker, Kenton L; Manoj, Sharmila; Judge, Russell A; Saldana, Sylvia C; Ruan, Qiaoqiao; Swift, Kerry M; Tetin, Sergey Y

2014-06-17

In the present study, we report the structure of the free and drug-bound Fab fragment of a high affinity anti-methotrexate antibody and perform a thermodynamic analysis of the binding process. The anti-methotrexate Fab fragment features a remarkably rigid tunnel-like binding site that extends into a water channel serving as a specialized route to move solvent out and into the site upon ligand binding and dissociation. This new finding in antibody structure-function relationships directly relates to the fast association (1 × 10⁷ M⁻¹ s⁻¹) and slow dissociation (4 × 10⁻⁵ s⁻¹) rates determined for mAb ADD056, resulting in a very strong binding with a K(D) ~ 3.6 pM at 20 °C. As follows from the X-ray data analysis, the methotrexate-antibody complex is stabilized by an extended network of hydrogen bonds and stacking interactions. The analysis also shows structural involvement of the CDR H3 in formation of the water channel revealing another important role of this hypervariable region. This suggests a new direction in natural affinity maturation and opens a new possibility in antibody engineering. Methotrexate is a widely used therapeutic agent for many malignant diseases and inflammatory disorders. Unfortunately, it may also interfere with central aspects of metabolism and thereby cause inevitable side effects. Therefore, methotrexate therapy requires careful monitoring of drug blood levels, which is traditionally done by immunoassays. An understanding of the structure-function properties of antibodies selected for drug monitoring substantiates the performance and robustness of such tests.

Direct interaction of the inhibitory gamma-subunit of Rod cGMP phosphodiesterase (PDE6) with the PDE6 GAFa domains.

PubMed

Muradov, Khakim G; Granovsky, Alexey E; Schey, Kevin L; Artemyev, Nikolai O

2002-03-26

Retinal rod and cone cGMP phosphodiesterases (PDE6 family) function as the effector enzyme in the vertebrate visual transduction cascade. The activity of PDE6 catalytic subunits is controlled by the Pgamma-subunits. In addition to the inhibition of cGMP hydrolysis at the catalytic sites, Pgamma is known to stimulate a noncatalytic binding of cGMP to the regulatory GAFa-GAFb domains of PDE6. The latter role of Pgamma has been attributed to its polycationic region. To elucidate the structural basis for the regulation of cGMP binding to the GAF domains of PDE6, a photoexcitable peptide probe corresponding to the polycationic region of Pgamma, Pgamma-21-45, was specifically cross-linked to rod PDE6alphabeta. The site of Pgamma-21-45 cross-linking was localized to Met138Gly139 within the PDE6alpha GAFa domain using mass spectrometric analysis. Chimeras between PDE5 and cone PDE6alpha', containing GAFa and/or GAFb domains of PDE6alpha' have been generated to probe a potential role of the GAFb domains in binding to Pgamma. Analysis of the inhibition of the PDE5/PDE6alpha' chimeras by Pgamma supported the role of PDE6 GAFa but not GAFb domains in the interaction with Pgamma. Our results suggest that a direct binding of the polycationic region of Pgamma to the GAFa domains of PDE6 may lead to a stabilization of the noncatalytic cGMP-binding sites.

Computer-aided active-site-directed modeling of the Herpes Simplex Virus 1 and human thymidine kinase

NASA Astrophysics Data System (ADS)

Folkers, Gerd; Trumpp-Kallmeyer, Susanne; Gutbrod, Oliver; Krickl, Sabine; Fetzer, Jürgen; Keil, Günther M.

1991-10-01

Thymidine kinase (TK), which is induced by Herpes Simplex Virus 1 (HSV1), plays a key role in the antiviral activity of guanine derivatives such as aciclovir (ACV). In contrast, ACV shows only low affinity to the corresponding host cell enzyme. In order to define the differences in substrate binding of the two enzymes on molecular level, models for the three-dimensional (3-D) structures of the active sites of HSV1-TK and human TK were developed. The reconstruction of the active sites started from primary and secondary structure analysis of various kinases. The results were validated to homologous enzymes with known 3-D structures. The models predict that both enzymes consist of a central core β-sheet structure, connected by loops and α-helices very similar to the overall structure of other nucleotide binding enzymes. The phosphate binding is made up of a highly conserved glycine-rich loop at the N-terminus of the proteins and a conserved region at the C-terminus. The thymidine recognition site was found about 100 amino acids downstream from the phosphate binding loop. The differing substrate specificity of human and HSV1-TK can be explained by amino-acid substitutions in the homologous regions. To achieve a better understanding of the structure of the active site and how the thymidine kinase proteins interact with their substrates, the corresponding complexes of thymidine and dihydroxypropoxyguanine (DHPG) with HSV1 and human TK were built. For the docking of the guanine derivative, the X-ray structure of Elongation Factor Tu (EF-Tu), co-crystallized with guanosine diphosphate, was taken as reference. Fitting of thymidine into the active sites was done with respect to similar interactions found in thymidylate kinase. To complement the analysis of the 3-D structures of the two kinases and the substrate enzyme interactions, site-directed mutagenesis of the thymidine recognition site of HSV1-TK has been undertaken, changing Asp162 in the thymidine recognition site into Asn. First investigations reveal that the enzymatic activity of the mutant protein is destroyed.

Carbohydrate binding specificity of pea lectin studied by NMR spectroscopy and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Cheong, Youngjoo; Shim, Gyuchang; Kang, Dongil; Kim, Yangmee

1999-02-01

The conformational details of Man( α1,6)Man( α)OMe are investigated through NMR spectroscopy in conjunction with molecular modeling. The lowest energy structure (M1) in the adiabatic energy map calculated with a dielectric constant of 50 has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=180°. The other low energy structure (M2) has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=-60°. Molecular dynamics simulations and NMR experiments prove that Man( α1,6)Man( α)OMe in the free form exists with conformational averaging of M1 and M2 conformers predominantly. Molecular dynamics simulations of the pea lectin-carbohydrate complex with explicit water molecules starting from the X-ray crystallographic structure of pea lectin show that the protein-carbohydrate interaction centers mainly on the hydrogen bonds and van der Waals interactions between protein and carbohydrate. From the molecular dynamics simulation, it is found that the M1 structure can bind to pea lectin better than the M2 structure. The origin of this selectivity is the water- mediated hydrogen bond interactions between the remote mannose and the binding site of pea lectin as well as the direct hydrogen bond interaction between the terminal mannose and pea lectin. Extensive networks of interactions in the carbohydrate binding site and the metal binding site are important in maintaining the carbohydrate binding properties of pea lectin. Especially, the predominant factors of mannose binding specificity of pea lectin are the hydrogen bond interactions between the 4th hydroxyl groups of the terminal sugar ring and the side chains of Asp-81 and Asn-125 in the carbohydrate binding site, and the additional interactions between these side chains of Asp-81 and Asn-125 and the calcium ion in the metal binding site of pea lectin.

Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

PubMed

Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

2018-04-06

Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

The binding of human and guinea-pig IgG subclasses to homologous macrophage and monocyte Fc receptors.

PubMed Central

Alexander, M D; Andrews, J A; Leslie, R G; Wood, N J

1978-01-01

Guinea-pig IgG2 and IgT1 bind to contiguous Fc receptors on homologous peritoneal macrophages. Equilibrium association constants determined for the binding of human IgG subclasses to homologous peripheral blood monocytes show that the order of binding is IgG1 greater than IgG3 greater than IgG4 greater than IgG2. Direct binding and rosette assay techniques independently established that both guinea-pig IgG2 and human IgG bind to homologous macrophage-monocyte Fc receptors through a site present in whole Fc (CH2. CH3)2, but absent in pFc' subfragments (CH3)2. PMID:680795

The ebolavirus VP24 interferon antagonist

PubMed Central

Zhang, Adrianna P.P.; Abelson, Dafna M.; Bornholdt, Zachary A.; Liu, Tong; Woods, Jr, Virgil L.; Saphire, Erica Ollmann

2012-01-01

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways.1,2 The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation.3 A more recent discovery is that VP24 also binds STAT1 directly,4 suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses. PMID:23076242

The ebolavirus VP24 interferon antagonist: know your enemy.

PubMed

Zhang, Adrianna P P; Abelson, Dafna M; Bornholdt, Zachary A; Liu, Tong; Woods, Virgil L; Saphire, Erica Ollmann

2012-08-15

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways. The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation. A more recent discovery is that VP24 also binds STAT1 directly, suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses.

The Platelet Function Defect of Cardiopulmonary Bypass.

DTIC Science & Technology

1992-11-24

K complex, not to uncomplexed GPIb or GPDC.31 FMC25 (provided by Dr. Berndt) is directed against GPK .32-33 A panel of platelet GPIIb-IIIa-specific...on GPIb (Fig 2, panel B), GPK (Fig 2, panel C), or the GPIb-K complex (Fig 2, panel D). 14 In addition, we examined the ristocetin-induced binding...on GPIb (6D1), the thrombin binding site on GPIb (TM60), GPK (FMC25), and the GPIb-K complex (AK1). Panel E: ristocetin-induced binding of exogenous

Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

PubMed Central

Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

2009-01-01

Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

PubMed Central

Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

2013-01-01

IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

The investigation of the binding of 6-mercaptopurine to site I on human serum albumin.

PubMed

Sochacka, Jolanta; Baran, Wojciech

2012-12-01

6-Mercaptopurine (6-MP) is one of a large series of purine analogues which has been found active against human leukemias. The equilibrium dialysis, circular dichroism (CD) and molecular docking were employed to study the binding of 6-MP to human serum albumin (HSA). The binding of 6-MP to HSA in the equilibrium dialysis experiment was detected by measuring the displacement of 6-MP by specific markers for site I on HSA, warfarin (RWF), phenylbutazone (PhB) and n-butyl p-aminobenzoate (ABE). It was shown, according to CD data, that binding of 6-MP to HSA leads to alteration of HSA secondary structure. Based on the findings from displacement experiment and molecular docking simulation it was found that 6-MP was located within binding cavity of subdomain IIA and the space occupied by site markers overlapped with that of 6-MP. Displacement of 6-MP by the RWF or PhB was not up the level expected for a competitive mechanism, therefore displacement of 6-MP was rather by non-cooperative than that the direct competition. Instead, in case of the interaction between ABE and 6-MP, when the little enhancement of the binding of ABE by 6-MP was found, the interaction could be via a positively cooperative mechanism.

Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

PubMed

Pessler, Frank; Hernandez, Nouria

2003-08-01

POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

Structural Basis for High Affinity Volatile Anesthetic Binding in a Natural 4-helix Bundle Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu,R.; Loll, P.; Eckenhoff, R.

2005-01-01

Physiologic sites for inhaled anesthetics are presumed to be cavities within transmembrane 4-{alpha}-helix bundles of neurotransmitter receptors, but confirmation of binding and structural detail of such sites remains elusive. To provide such detail, we screened soluble proteins containing this structural motif, and found only one that exhibited evidence of strong anesthetic binding. Ferritin is a 24-mer of 4-{alpha}-helix bundles; both halothane and isoflurane bind with K{sub A} values of {approx}10{sup 5} M{sup -1, } higher than any previously reported inhaled anesthetic-protein interaction. The crystal structures of the halothane/apoferritin and isoflurane/apoferritin complexes were determined at 1.75 Angstroms resolution, revealing a commonmore » anesthetic binding pocket within an interhelical dimerization interface. The high affinity is explained by several weak polar contacts and an optimal host/guest packing relationship. Neither the acidic protons nor ether oxygen of the anesthetics contribute to the binding interaction. Compared with unliganded apoferritin, the anesthetic produced no detectable alteration of structure or B factors. The remarkably high affinity of the anesthetic/apoferritin complex implies greater selectivity of protein sites than previously thought, and suggests that direct protein actions may underlie effects at lower than surgical levels of anesthetic, including loss of awareness.« less

Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

PubMed

DasGupta, G; White, J; Cheung, P; Reisler, E

1990-09-11

The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

Structural Characterization of the E2 Domain of APL-1, a C. Elegans Homolog of Human Amyloid Precursor Protein, and its Heparin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoopes, J.; Liu, X; Xu, X

2010-01-01

The amyloid {beta}-peptide deposit found in the brain tissue of patients with Alzheimer disease is derived from a large heparin-binding protein precursor APP. The biological function of APP and its homologs is not precisely known. Here we report the x-ray structure of the E2 domain of APL-1, an APP homolog in Caenorhabditis elegans, and compare it to the human APP structure. We also describe the structure of APL-1 E2 in complex with sucrose octasulfate, a highly negatively charged disaccharide, which reveals an unexpected binding pocket between the two halves of E2. Based on the crystal structure, we are able tomore » map, using site-directed mutagenesis, a surface groove on E2 to which heparin may bind. Our biochemical data also indicate that the affinity of E2 for heparin is influenced by pH: at pH 5, the binding appears to be much stronger than that at neutral pH. This property is likely caused by histidine residues in the vicinity of the mapped heparin binding site and could be important for the proposed adhesive function of APL-1.« less

Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

PubMed

Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

2016-04-20

Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Direct measurement of torque and twist generated by a dye binding to DNA

NASA Astrophysics Data System (ADS)

Gore, Jeff; Bryant, Zev; Bustamante, Carlos

2004-03-01

Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

PubMed

Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

2017-02-01

We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

PubMed

Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

2017-02-01

Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

Direct interplay between two candidate genes in FSHD muscular dystrophy

PubMed Central

Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

2015-01-01

Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

Metallofullerenol Gd@C82(OH)22 distracts the proline-rich-motif from putative binding on the SH3 domain

NASA Astrophysics Data System (ADS)

Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong

2013-03-01

Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr33756a

Quantum Mechanics/Molecular Mechanics Modeling of Drug Metabolism: Mexiletine N-Hydroxylation by Cytochrome P450 1A2.

PubMed

Lonsdale, Richard; Fort, Rachel M; Rydberg, Patrik; Harvey, Jeremy N; Mulholland, Adrian J

2016-06-20

The mechanism of cytochrome P450(CYP)-catalyzed hydroxylation of primary amines is currently unclear and is relevant to drug metabolism; previous small model calculations have suggested two possible mechanisms: direct N-oxidation and H-abstraction/rebound. We have modeled the N-hydroxylation of (R)-mexiletine in CYP1A2 with hybrid quantum mechanics/molecular mechanics (QM/MM) methods, providing a more detailed and realistic model. Multiple reaction barriers have been calculated at the QM(B3LYP-D)/MM(CHARMM27) level for the direct N-oxidation and H-abstraction/rebound mechanisms. Our calculated barriers indicate that the direct N-oxidation mechanism is preferred and proceeds via the doublet spin state of Compound I. Molecular dynamics simulations indicate that the presence of an ordered water molecule in the active site assists in the binding of mexiletine in the active site, but this is not a prerequisite for reaction via either mechanism. Several active site residues play a role in the binding of mexiletine in the active site, including Thr124 and Phe226. This work reveals key details of the N-hydroxylation of mexiletine and further demonstrates that mechanistic studies using QM/MM methods are useful for understanding drug metabolism.

Crystal Structures of Yellowtail Ascites Virus VP4 Protease

PubMed Central

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-01-01

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

Binding modes of dihydroquinoxalinones in a homology model of bradykinin receptor 1.

PubMed

Ha, Sookhee N; Hey, Pat J; Ransom, Rick W; Harrell, C Meacham; Murphy, Kathryn L; Chang, Ray; Chen, Tsing-Bau; Su, Dai-Shi; Markowitz, M Kristine; Bock, Mark G; Freidinger, Roger M; Hess, Fred J

2005-05-27

We report the first homology model of human bradykinin receptor B1 generated from the crystal structure of bovine rhodopsin as a template. Using an automated docking procedure, two B1 receptor antagonists of the dihydroquinoxalinone structural class were docked into the receptor model. Site-directed mutagenesis data of the amino acid residues in TM1, TM3, TM6, and TM7 were incorporated to place the compounds in the binding site of the homology model of the human B1 bradykinin receptor. The best pose in agreement with the mutation data was selected for detailed study of the receptor-antagonist interaction. To test the model, the calculated antagonist-receptor binding energy was correlated with the experimentally measured binding affinity (K(i)) for nine dihydroquinoxalinone analogs. The model was used to gain insight into the molecular mechanism for receptor function and to optimize the dihydroquinoxalinone analogs.

Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

PubMed Central

Baptista, A M; Martel, P J; Soares, C M

1999-01-01

A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

Novel bis-(−)-nor-meptazinol derivatives act as dual binding site AChE inhibitors with metal-complexing property

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Wei; NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032; Li, Juan

The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC{sub 50} values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC{sub 50} values of 49.1 μM (for ZLA) and 55.3more » μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.« less

[Studying specific effects of nootropic drugs on glutamate receptors in the rat brain].

PubMed

Firstova, Iu Iu; Vasil'eva, E V; Kovalev, G I

2011-01-01

The influence of nootropic drugs of different groups (piracetam, phenotropil, nooglutil, noopept, semax, meclofenoxate, pantocalcine, and dimebon) on the binding of the corresponding ligands to AMPA, NMDA, and mGlu receptors of rat brain has been studied by the method of radio-ligand binding in vitro. It is established that nooglutil exhibits pharmacologically significant competition with a selective agonist of AMPA receptors ([G-3H]Ro 48-8587) for the receptor binding sites (with IC50 = 6.4 +/- 0.2 microM), while the competition of noopept for these receptor binding sites was lower by an order of magnitude (IC50 = 80 +/- 5.6 microM). The heptapeptide drug semax was moderately competitive with [G-3H]LY 354740 for mGlu receptor sites (IC50 = 33 +/- 2.4 microM). Dimebon moderately influenced the specific binding of the ligand of NMDA receptor channel ([G-3H]MK-801) at IC50 = 59 +/- 3.6 microM. Nootropic drugs of the pyrrolidone group (piracetam, phenotropil) as well as meclofenoxate, pantocalcine (pantogam) in a broad rage of concentrations (10(-4)-10(-10) M) did not affect the binding of the corresponding ligands to glutamate receptors (IC50 100 pM). Thus, the direct neurochemical investigation was used for the first time to qualitatively characterize the specific binding sites for nooglutil and (to a lower extent) noopept on AMPA receptors, for semax on metabotropic glutamate receptors, and for dimebon on the channel region of NMDA receptors. The results are indicative of a selective action of some nootropes on the glutamate family.

Alcohol-Binding Sites in Distinct Brain Proteins: The Quest for Atomic Level Resolution

PubMed Central

Howard, Rebecca J.; Slesinger, Paul A.; Davies, Daryl L.; Das, Joydip; Trudell, James R.; Harris, R. Adron

2011-01-01

Defining the sites of action of ethanol on brain proteins is a major prerequisite to understanding the molecular pharmacology of this drug. The main barrier to reaching an atomic-level understanding of alcohol action is the low potency of alcohols, ethanol in particular, which is a reflection of transient, low-affinity interactions with their targets. These mechanisms are difficult or impossible to study with traditional techniques such as radioligand binding or spectroscopy. However, there has been considerable recent progress in combining X-ray crystallography, structural modeling, and site-directed mutagenesis to define the sites and mechanisms of action of ethanol and related alcohols on key brain proteins. We review such insights for several diverse classes of proteins including inwardly rectifying potassium, transient receptor potential, and neurotransmit-ter-gated ion channels, as well as protein kinase C epsilon. Some common themes are beginning to emerge from these proteins, including hydrogen bonding of the hydroxyl group and van der Waals interactions of the methylene groups of ethanol with specific amino acid residues. The resulting binding energy is proposed to facilitate or stabilize low-energy state transitions in the bound proteins, allowing ethanol to act as a “molecular lubricant” for protein function. We discuss evidence for characteristic, discrete alcohol-binding sites on protein targets, as well as evidence that binding to some proteins is better characterized by an interaction region that can accommodate multiple molecules of ethanol. PMID:21676006

The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

PubMed Central

Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

2013-01-01

Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

Active site-directed double mutants of dihydrofolate reductase.

PubMed

Ercikan-Abali, E A; Mineishi, S; Tong, Y; Nakahara, S; Waltham, M C; Banerjee, D; Chen, W; Sadelain, M; Bertino, J R

1996-09-15

Variants of dihydrofolate reductase (DHFR), which confer resistance to antifolates, are used as dominant selectable markers in vitro and in vivo and may be useful in the context of gene therapy. To identify improved mutant human DHFRs with increased catalytic efficiency and decreased binding to methotrexate, we constructed by site-directed mutagenesis four variants with substitutions at both Leu22 and Phe31 (i.e., Phe22-Ser31, Tyr22-Ser31, Phe22-Gly31, and Tyr22-Gly31). Antifolate resistance has been observed previously when individual changes are made at these active-site residues. Substrate and antifolate binding properties of these "double" mutants revealed that each have greatly diminished affinity for antifolates (> 10,000-fold) yet only slightly reduced substrate affinity. Comparison of in vitro measured properties with those of single-residue variants indicates that double mutants are indeed significantly superior. This was verified for one of the double mutants that provided high-level methotrexate resistance following retrovirus-mediated gene transfer in NIH3T3 cells.

The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

PubMed Central

Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

2014-01-01

Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

Distribution of sup 125 I-neurotensin binding sites in human forebrain: Comparison with the localization of acetylcholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szigethy, E.; Quirion, R.; Beaudet, A.

1990-07-22

The distribution of 125I-neurotensin binding sites was compared with that of acetylcholinesterase reactivity in the human basal forebrain by using combined light microscopic radioautography/histochemistry. High 125I-neurotensin binding densities were observed in the bed nucleus of the stria terminalis, islands of Calleja, claustrum, olfactory tubercle, and central nucleus of the amygdala; lower levels were seen in the caudate, putamen, medial septum, diagonal band nucleus, and nucleus basalis of Meynert. Adjacent sections processed for cholinesterase histochemistry demonstrated a regional overlap between the distribution of labeled neurotensin binding sites and that of intense acetylcholinesterase staining in all of the above regions, except inmore » the bed nucleus of the stria terminalis, claustrum, and central amygdaloid nucleus, where dense 125I-neurotensin labeling was detected over areas containing only weak to moderate cholinesterase staining. At higher magnification, 125I-neurotensin-labeled binding sites in the islands of Calleja, supraoptic nucleus of the hypothalamus, medial septum, diagonal band nucleus, and nucleus basalis of Meynert were selectively associated with neuronal perikarya found to be cholinesterase-positive in adjacent sections. Moderate 125I-neurotensin binding was also apparent over the cholinesterase-reactive neuropil of these latter three regions. These data suggest that neurotensin (NT) may directly influence the activity of magnocellular cholinergic neurons in the human basal forebrain, and may be involved in the physiopathology of dementing disorders such as Alzheimer's disease, in which these neurons have been shown to be affected.« less

The PBX1 lupus susceptibility gene regulates CD44 expression.

PubMed

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A; Choi, Seung-Chul; Morel, Laurence

2017-05-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4 + T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and shows that the lupus-associated isoform PBX1-d has unique molecular functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

PubMed Central

Fiorucci, Sébastien; Zacharias, Martin

2010-01-01

Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

A Graphical Modelling Approach to the Dissection of Highly Correlated Transcription Factor Binding Site Profiles

PubMed Central

Stojnic, Robert; Fu, Audrey Qiuyan; Adryan, Boris

2012-01-01

Inferring the combinatorial regulatory code of transcription factors (TFs) from genome-wide TF binding profiles is challenging. A major reason is that TF binding profiles significantly overlap and are therefore highly correlated. Clustered occurrence of multiple TFs at genomic sites may arise from chromatin accessibility and local cooperation between TFs, or binding sites may simply appear clustered if the profiles are generated from diverse cell populations. Overlaps in TF binding profiles may also result from measurements taken at closely related time intervals. It is thus of great interest to distinguish TFs that directly regulate gene expression from those that are indirectly associated with gene expression. Graphical models, in particular Bayesian networks, provide a powerful mathematical framework to infer different types of dependencies. However, existing methods do not perform well when the features (here: TF binding profiles) are highly correlated, when their association with the biological outcome is weak, and when the sample size is small. Here, we develop a novel computational method, the Neighbourhood Consistent PC (NCPC) algorithms, which deal with these scenarios much more effectively than existing methods do. We further present a novel graphical representation, the Direct Dependence Graph (DDGraph), to better display the complex interactions among variables. NCPC and DDGraph can also be applied to other problems involving highly correlated biological features. Both methods are implemented in the R package ddgraph, available as part of Bioconductor (http://bioconductor.org/packages/2.11/bioc/html/ddgraph.html). Applied to real data, our method identified TFs that specify different classes of cis-regulatory modules (CRMs) in Drosophila mesoderm differentiation. Our analysis also found depletion of the early transcription factor Twist binding at the CRMs regulating expression in visceral and somatic muscle cells at later stages, which suggests a CRM-specific repression mechanism that so far has not been characterised for this class of mesodermal CRMs. PMID:23144600

The Sequence-specific Peptide-binding Activity of the Protein Sulfide Isomerase AGR2 Directs Its Stable Binding to the Oncogenic Receptor EpCAM.

PubMed

Mohtar, M Aiman; Hernychova, Lenka; O'Neill, J Robert; Lawrence, Melanie L; Murray, Euan; Vojtesek, Borek; Hupp, Ted R

2018-04-01

AGR2 is an oncogenic endoplasmic reticulum (ER)-resident protein disulfide isomerase. AGR2 protein has a relatively unique property for a chaperone in that it can bind sequence-specifically to a specific peptide motif (TTIYY). A synthetic TTIYY-containing peptide column was used to affinity-purify AGR2 from crude lysates highlighting peptide selectivity in complex mixtures. Hydrogen-deuterium exchange mass spectrometry localized the dominant region in AGR2 that interacts with the TTIYY peptide to within a structural loop from amino acids 131-135 (VDPSL). A peptide binding site consensus of Tx[IL][YF][YF] was developed for AGR2 by measuring its activity against a mutant peptide library. Screening the human proteome for proteins harboring this motif revealed an enrichment in transmembrane proteins and we focused on validating EpCAM as a potential AGR2-interacting protein. AGR2 and EpCAM proteins formed a dose-dependent protein-protein interaction in vitro Proximity ligation assays demonstrated that endogenous AGR2 and EpCAM protein associate in cells. Introducing a single alanine mutation in EpCAM at Tyr251 attenuated its binding to AGR2 in vitro and in cells. Hydrogen-deuterium exchange mass spectrometry was used to identify a stable binding site for AGR2 on EpCAM, adjacent to the TLIYY motif and surrounding EpCAM's detergent binding site. These data define a dominant site on AGR2 that mediates its specific peptide-binding function. EpCAM forms a model client protein for AGR2 to study how an ER-resident chaperone can dock specifically to a peptide motif and regulate the trafficking a protein destined for the secretory pathway. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Comparative studies on the human serum albumin binding of the clinically approved EGFR inhibitors gefitinib, erlotinib, afatinib, osimertinib and the investigational inhibitor KP2187.

PubMed

Dömötör, Orsolya; Pelivan, Karla; Borics, Attila; Keppler, Bernhard K; Kowol, Christian R; Enyedy, Éva A

2018-05-30

Binding interactions between human serum albumin (HSA) and four approved epidermal growth factor receptor (EGFR) inhibitors gefitinib (GEF), erlotinib (ERL), afatinib (AFA), osimertinib (OSI), as well as the experimental drug KP2187, were investigated by means of spectrofluorometric and molecular modelling methods. Steady-state and time resolved spectrofluorometric techniques were carried out, including direct quenching of protein fluorescence and site marker displacement measurements. Proton dissociation processes and solvent dependent fluorescence properties were investigated as well. The EGFR inhibitors were predominantly presented in their single protonated form (HL + ) at physiological pH except ERL, which is charge-neutral. Significant solvent dependent fluorescence properties were found for GEF, ERL and KP2187, namely their emission spectra show strong dependence on the polarity and the hydrogen bonding ability of the solvents. The inhibitors proved to be bound at site I of HSA (in subdomain IIA) in a weak-to-moderate fashion (logK' 3.9-4.9) using spectrofluorometry. OSI (logK' 4.3) and KP2187 can additionally bind in site II (in subdomain IIIA), while GEF, ERL and AFA clearly show no interaction here. Docking methods qualitatively confirmed binding site preferences of compounds GEF and KP2187, and indicated that they probably bind to HSA in their neutral forms. Binding constants calculated on the basis of the various experimental data indicate a weak-to-moderate binding on HSA, only OSI exhibits somewhat higher affinity towards this protein. However, model calculations performed at physiological blood concentrations of HSA resulted in high (ca. 90%) bound fractions for the inhibitors, highlighting the importance of plasma protein binding. Copyright © 2018 Elsevier B.V. All rights reserved.

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

Clathrin- and AP-2-binding sites in HIP1 uncover a general assembly role for endocytic accessory proteins.

PubMed

Mishra, S K; Agostinelli, N R; Brett, T J; Mizukami, I; Ross, T S; Traub, L M

2001-12-07

Clathrin-mediated endocytosis is a major pathway for the internalization of macromolecules into the cytoplasm of eukaryotic cells. The principle coat components, clathrin and the AP-2 adaptor complex, assemble a polyhedral lattice at plasma membrane bud sites with the aid of several endocytic accessory proteins. Here, we show that huntingtin-interacting protein 1 (HIP1), a binding partner of huntingtin, copurifies with brain clathrin-coated vesicles and associates directly with both AP-2 and clathrin. The discrete interaction sequences within HIP1 that facilitate binding are analogous to motifs present in other accessory proteins, including AP180, amphiphysin, and epsin. Bound to a phosphoinositide-containing membrane surface via an epsin N-terminal homology (ENTH) domain, HIP1 associates with AP-2 to provide coincident clathrin-binding sites that together efficiently recruit clathrin to the bilayer. Our data implicate HIP1 in endocytosis, and the similar modular architecture and function of HIP1, epsin, and AP180 suggest a common role in lipid-regulated clathrin lattice biogenesis.

A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

PubMed Central

2004-01-01

Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele

Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less

Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

PubMed

Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

2016-02-23

The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

Calcitonin: regional distribution of the hormone and its binding sites in the human brain and pituitary.

PubMed

Fischer, J A; Tobler, P H; Kaufmann, M; Born, W; Henke, H; Cooper, P E; Sagar, S M; Martin, J B

1981-12-01

Immunoreactive calcitonin (CT), indistinguishable from human CT-(1-32) and its sulfoxide, has been identified in extracts of the hypothalamus, the pituitary, and the thyroid obtained from human subjects at autopsy. DCT concentrations were highest in a region encompassing the posterior hypothalamus, the median eminence, and the pituitary; intermediate in the substantia nigra, the anterior hypothalamus, the globus pallidus, and the inferior colliculus; and low in the caudate nucleus, the hippocampus, the amygdala, and the cerebral and cerebellar cortices. Specific CT binding measured with 125I-labeled salmon CT was highest in homogenates of the posterior hypothalamus and the median eminence, shown to contain the highest concentrations of endogenous CT in the brain; CT binding was less than 12% of hypothalamic binding in all of the other regions of the brain examined and was negligible in the pituitary. Half-maximal binding was achieved with 0.1 nM nonradioactive salmon CT-(1-32), and the binding was directed to structural or conformational sites, or both, in the COOH-terminal half of salmon CT. The rank order of the inhibition of the binding by CT from different species and analogues of the human hormone was the same as in receptors on a human lymphoid cell line (Moran, J., Hunziker, W. & Fischer, J. A. (1978) Proc. Natl. Acad. Sci. USA 75, 3984-3988). The functional role of CT and of its binding sites in the brain remains to be elucidated.

Cooperative DNA binding of heterologous proteins: Evidence for contact between the cyclic AMP receptor protein and RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Y.L.; Garges, S.; Adhya, S.

1988-06-01

Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 canmore » activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.« less

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

Direct identification of the site of binding on the chaperone SecB for the amino terminus of the translocon motor SecA.

PubMed

Randall, Linda L; Henzl, Michael T

2010-06-01

Protein export mediated by the general secretory Sec system in Escherichia coli proceeds by a dynamic transfer of a precursor polypeptide from the chaperone SecB to the SecA ATPase motor of the translocon and subsequently into and through the channel of the membrane-embedded SecYEG heterotrimer. The complex between SecA and SecB is stabilized by several separate sites of contact. Here we have demonstrated directly an interaction between the N-terminal residues 2 through 11 of SecA and the C-terminal 13 residues of SecB by isothermal titration calorimetry and analytical sedimentation velocity centrifugation. We discuss the unusual binding properties of SecA and SecB in context of a model for transfer of the precursor along the pathway of export.

Bioinformatic prediction of gene functions regulated by quorum sensing in the bioleaching bacterium Acidithiobacillus ferrooxidans.

PubMed

Banderas, Alvaro; Guiliani, Nicolas

2013-08-16

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

PubMed Central

Banderas, Alvaro; Guiliani, Nicolas

2013-01-01

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process. PMID:23959118

Examining the critical roles of human CB2 receptor residues Valine 3.32 (113) and Leucine 5.41 (192) in ligand recognition and downstream signaling activities.

PubMed

Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun

2014-09-26

We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

Docking modes of BB-3497 into the PDF active site--a comparison of the pure MM and QM/MM based docking strategies.

PubMed

Kumari, Tripti; Issar, Upasana; Kakkar, Rita

2014-01-01

Peptide deformylase (PDF) has emerged as an important antibacterial drug target. Considerable effort is being directed toward developing peptidic and non-peptidic inhibitors for this metalloprotein. In this work, the known peptidic inhibitor BB-3497 and its various ionization and tautomeric states are evaluated for their inhibition efficiency against PDF using a molecular mechanics (MM) approach as well as a mixed quantum mechanics/molecular mechanics (QM/MM) approach, with an aim to understand the interactions in the binding site. The evaluated Gibbs energies of binding with the mixed QM/MM approach are shown to have the best predictive power. The experimental pose is found to have the most negative Gibbs energy of binding, and also the smallest strain energy. A quantum mechanical evaluation of the active site reveals the requirement of strong chelation by the ligand with the metal ion. The investigated ligand chelates the metal ion through the two oxygens of its reverse hydroxamate moiety, particularly the N-O(-) oxygen, forming strong covalent bonds with the metal ion, which is penta-coordinated. In the uninhibited state, the metal ion is tetrahedrally coordinated, and hence chelation with the inhibitor is associated with an increase of the metal ion coordination. Thus, the strong binding of the ligand at the binding site is accounted for.

Analysis of hydrogen adsorption and surface binding configuration on tungsten using direct recoil spectrometry

DOE PAGES

Kolasinski, R. D.; Hammond, K. D.; Whaley, J. A.; ...

2014-12-03

In our work, we apply low energy ion beam analysis to examine directly how the adsorbed hydrogen concentration and binding configuration on W(1 0 0) depend on temperature. We exposed the tungsten surface to fluxes of both atomic and molecular H and D. We then probed the H isotopes adsorbed along different crystal directions using 1–2 keV Ne + ions. At saturation coverage, H occupies two-fold bridge sites on W(1 0 0) at 25 °C. Moreover, the H coverage dramatically changes the behavior of channeled ions, as does reconstruction of the surface W atoms. For the exposure conditions examined here,more » we find that surface sites remain populated with H until the surface temperature reaches 200 °C. Then, we observe H rapidly desorbing until only a residual concentration remains at 450 °C. Development of an efficient atomistic model that accurately reproduces the experimental ion energy spectra and azimuthal variation of recoiled H is underway.« less

Ligand accessibility to the HIV-1 Env co-receptor binding site can occur prior to CD4 engagement and is independent of viral tier category.

PubMed

Boliar, Saikat; Patil, Shilpa; Shukla, Brihaspati N; Ghobbeh, Ali; Deshpande, Suprit; Chen, Weizao; Guenaga, Javier; Dimitrov, Dimiter S; Wyatt, Richard T; Chakrabarti, Bimal K

2018-06-01

HIV-1 virus entry into target cells requires the envelope glycoprotein (Env) to first bind the primary receptor, CD4 and subsequently the co-receptor. Antibody access to the co-receptor binding site (CoRbs) in the pre-receptor-engaged state, prior to cell attachment, remains poorly understood. Here, we have demonstrated that for tier-1 Envs, the CoRbs is directly accessible to full-length CD4-induced (CD4i) antibodies even before primary receptor engagement, indicating that on these Envs the CoRbs site is either preformed or can conformationally sample post-CD4-bound state. Tier-2 and tier-3 Envs, which are resistant to full-length CD4i antibody, are neutralized by m36.4, a lower molecular mass of CD4i-directed domain antibody. In some tier-2 and tier-3 Envs, CoRbs is accessible to m36.4 even prior to cellular attachment in an Env-specific manner independent of their tier category. These data suggest differential structural arrangements of CoRbs and varied masking of ligand access to the CoRbs in different Env isolates. Copyright © 2018 Elsevier Inc. All rights reserved.

X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz

2009-11-18

For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In themore » present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.« less

Molecular Basis for Modulation of Metabotropic Glutamate Receptors and Their Drug Actions by Extracellular Ca2+

PubMed Central

Zou, Juan; Jiang, Jason Y.; Yang, Jenny J.

2017-01-01

Metabotropic glutamate receptors (mGluRs) associated with the slow phase of the glutamatergic signaling pathway in neurons of the central nervous system have gained importance as drug targets for chronic neurodegenerative diseases. While extracellular Ca2+ was reported to exhibit direct activation and modulation via an allosteric site, the identification of those binding sites was challenged by weak binding. Herein, we review the discovery of extracellular Ca2+ in regulation of mGluRs, summarize the recent developments in probing Ca2+ binding and its co-regulation of the receptor based on structural and biochemical analysis, and discuss the molecular basis for Ca2+ to regulate various classes of drug action as well as its importance as an allosteric modulator in mGluRs. PMID:28335551

Motors and Their Tethers: The Role of Secondary Binding Sites in Processive Motility

PubMed Central

Kincaid, Margaret M.; King, Stephen J.

2007-01-01

Cytoskeletal motors convert the energy from binding and hydrolyzing ATP into conformational changes that direct movement along a cytoskeletal polymer substrate. These enzymes utilize different mechanisms to generate long-range motion on the order of a micron or more that is required for functions ranging from muscle contraction to transport of growth factors along a nerve axon. Several of the individual cytoskeletal motors are processive, meaning that they have the ability to take sequential steps along their polymer substrate without dissociating from the polymer. This ability to maintain contact with the polymer allows individual motors to move cargos quickly from one cellular location to another. Many of the processive motors have now been found to utilize secondary binding sites that aid in motor processivity. PMID:17172850

Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.

PubMed

Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R

1982-02-01

Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (<0.4 pmol/10(7) cells per min) and NBMPR binding (<3,000 sites/cell) for the treated group. In summary, myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10-fold between leukemic blasts and normal leukocytes, but transport capacity related directly to the number of nucleoside transport sites on the cell. Finally, low araC transport rates or few NBMPR binding sites on blasts were observed in a subset of patients with acute leukemia who failed to achieve remission with drug combinations containing araC.

Biochemical and biophysical characterization of the selenium-binding and reducing site in Arabidopsis thaliana homologue to mammals selenium-binding protein 1.

PubMed

Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

2014-11-14

The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO3(2-)) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys(21) and Cys(22) as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO3(2-) to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Biochemical and Biophysical Characterization of the Selenium-binding and Reducing Site in Arabidopsis thaliana Homologue to Mammals Selenium-binding Protein 1*

PubMed Central

Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

2014-01-01

The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO32−) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys21 and Cys22 as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO32− to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. PMID:25274629

Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

PubMed

Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

2001-07-01

The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding.

PubMed

Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

2007-05-01

The P2X(7) receptor exhibits complex pharmacological properties. In this study, binding of a [(3)H]-labelled P2X(7) receptor antagonist to human P2X(7) receptors has been examined to further understand ligand interactions with this receptor. The P2X(7) receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.1(3,7)]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X(7) receptors. Binding of [(3)H]-compound-17 was higher in membranes prepared from cells expressing P2X(7) receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X(7) receptors. Binding was reversible, saturable and modulated by P2X(7) receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. These data demonstrate that human P2X(7) receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X(7) receptor complex enhances subsequent binding to other P2X(7) subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X(7) receptor.

Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding

PubMed Central

Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

2007-01-01

Background and Purpose: The P2X7 receptor exhibits complex pharmacological properties. In this study, binding of a [3H]-labelled P2X7 receptor antagonist to human P2X7 receptors has been examined to further understand ligand interactions with this receptor. Experimental Approach: The P2X7 receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.13,7]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X7 receptors. Key Results: Binding of [3H]-compound-17 was higher in membranes prepared from cells expressing P2X7 receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X7 receptors. Binding was reversible, saturable and modulated by P2X7 receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. Conclusions: These data demonstrate that human P2X7 receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X7 receptor complex enhances subsequent binding to other P2X7 subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X7 receptor. PMID:17339830

IspE Inhibitors Identified by a Combination of In Silico and In Vitro High-Throughput Screening

PubMed Central

Tidten-Luksch, Naomi; Grimaldi, Raffaella; Torrie, Leah S.; Frearson, Julie A.; Hunter, William N.; Brenk, Ruth

2012-01-01

CDP-ME kinase (IspE) contributes to the non-mevalonate or deoxy-xylulose phosphate (DOXP) pathway for isoprenoid precursor biosynthesis found in many species of bacteria and apicomplexan parasites. IspE has been shown to be essential by genetic methods and since it is absent from humans it constitutes a promising target for antimicrobial drug development. Using in silico screening directed against the substrate binding site and in vitro high-throughput screening directed against both, the substrate and co-factor binding sites, non-substrate-like IspE inhibitors have been discovered and structure-activity relationships were derived. The best inhibitors in each series have high ligand efficiencies and favourable physico-chemical properties rendering them promising starting points for drug discovery. Putative binding modes of the ligands were suggested which are consistent with established structure-activity relationships. The applied screening methods were complementary in discovering hit compounds, and a comparison of both approaches highlights their strengths and weaknesses. It is noteworthy that compounds identified by virtual screening methods provided the controls for the biochemical screens. PMID:22563402

Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

NASA Astrophysics Data System (ADS)

Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

2016-06-01

Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

Identification of sucrose synthase as an actin-binding protein

NASA Technical Reports Server (NTRS)

Winter, H.; Huber, J. L.; Huber, S. C.; Davies, E. (Principal Investigator)

1998-01-01

Several lines of evidence indicate that sucrose synthase (SuSy) binds both G- and F-actin: (i) presence of SuSy in the Triton X-100-insoluble fraction of microsomal membranes (i.e. crude cytoskeleton fraction); (ii) co-immunoprecipitation of actin with anti-SuSy monoclonal antibodies; (iii) association of SuSy with in situ phalloidin-stabilized F-actin filaments; and (iv) direct binding to F-actin, polymerized in vitro. Aldolase, well known to interact with F-actin, interfered with binding of SuSy, suggesting that a common or overlapping binding site may be involved. We postulate that some of the soluble SuSy in the cytosol may be associated with the actin cytoskeleton in vivo.

Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms.

PubMed

Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno

2016-03-18

The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.

Crystal structure and structure-based mutagenesis of actin-specific ADP-ribosylating toxin CPILE-a as novel enterotoxin

PubMed Central

Toniti, Waraphan; Yoshida, Toru; Tsurumura, Toshiharu; Irikura, Daisuke; Monma, Chie; Kamata, Yoichi

2017-01-01

Unusual outbreaks of food poisoning in Japan were reported in which Clostridium perfringens was strongly suspected to be the cause based on epidemiological information and fingerprinting of isolates. The isolated strains lack the typical C. perfringens enterotoxin (CPE) but secrete a new enterotoxin consisting of two components: C. perfringens iota-like enterotoxin-a (CPILE-a), which acts as an enzymatic ADP-ribosyltransferase, and CPILE-b, a membrane binding component. Here we present the crystal structures of apo-CPILE-a, NAD+-CPILE-a and NADH-CPILE-a. Though CPILE-a structure has high similarity with known iota toxin-a (Ia) with NAD+, it possesses two extra-long protruding loops from G262-S269 and E402-K408 that are distinct from Ia. Based on the Ia–actin complex structure, we focused on actin-binding interface regions (I-V) including two protruding loops (PT) and examined how mutations in these regions affect the ADP-ribosylation activity of CPILE-a. Though some site-directed mutagenesis studies have already been conducted on the actin binding site of Ia, in the present study, mutagenesis studies were conducted against both α- and β/γ-actin in CPILE-a and Ia. Interestingly, CPILE-a ADP-ribosylates both α- and β/γ-actin, but its sensitivity towards β/γ-actin is 36% compared with α-actin. Our results contrast to that only C2-I ADP-ribosylates β/γ-actin. We also showed that PT-I and two convex-concave interactions in CPILE-a are important for actin binding. The current study is the first detailed analysis of site-directed mutagenesis in the actin binding region of Ia and CPILE-a against both α- and β/γ-actin. PMID:28199340

Multiple Mechanisms of Zinc-Mediated Inhibition for the Apoptotic Caspases-3, -6, -7, and -8.

PubMed

Eron, Scott J; MacPherson, Derek J; Dagbay, Kevin B; Hardy, Jeanne A

2018-05-18

Zinc is emerging as a widely used and important biological regulatory signal. Cellular zinc levels are tightly regulated by a complex array of zinc importers and exporters to control processes such as apoptotic cell death. While caspase inhibition by zinc has been reported previously, the reported inhibition constants were too weak to suggest a critical biological role for zinc-mediated inhibition. In this work, we have adopted a method of assessing available zinc. This allowed assessment of accurate inhibition constants for apoptotic caspases, caspase-3, -6, -7, and -8. Each of these caspases are inhibited by zinc at intracellular levels but with widely differing inhibition constants and different zinc binding stoichiometries. Caspase-3, -6, and -8 appear to be constitutively inhibited by typical zinc levels, and this inhibition must be lifted to allow activation. The inhibition constant for caspase-7 (76 nM) is much weaker than for the other apoptotic caspases (2.6-6.9 nM) suggesting that caspase-7 is not inactivated by normal zinc concentrations but can be inhibited under conditions of zinc stress. Caspase-3, -7, and -8 were found to bind three, one, and two zincs, respectively. In each of these caspases, zinc was present in the active site, in contrast to caspase-6, which binds one zinc allosterically. The most notable new mechanism to emerge from this work is for zinc-mediated inhibition of caspase-8. Zinc binds caspase-8 directly at the active site and at a second site. Zinc binding inhibits formation of the caspase-8 dimer, the activated form of the enzyme. Together these findings suggest that zinc plays a critical role in regulation of apoptosis by direct inactivation of caspases, in a manner that is unique for each caspase.

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

PubMed

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

Allosteric conformational barcodes direct signaling in the cell.

PubMed

Nussinov, Ruth; Ma, Buyong; Tsai, Chung-Jung; Csermely, Peter

2013-09-03

The cellular network is highly interconnected. Pathways merge and diverge. They proceed through shared proteins and may change directions. How are cellular pathways controlled and their directions decided, coded, and read? These questions become particularly acute when we consider that a small number of pathways, such as signaling pathways that regulate cell fates, cell proliferation, and cell death in development, are extensively exploited. This review focuses on these signaling questions from the structural standpoint and discusses the literature in this light. All co-occurring allosteric events (including posttranslational modifications, pathogen binding, and gain-of-function mutations) collectively tag the protein functional site with a unique barcode. The barcode shape is read by an interacting molecule, which transmits the signal. A conformational barcode provides an intracellular address label, which selectively favors binding to one partner and quenches binding to others, and, in this way, determines the pathway direction, and, eventually, the cell's response and fate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

The λ Integrase Site-specific Recombination Pathway

PubMed Central

LANDY, ARTHUR

2017-01-01

The site-specific recombinase encoded by bacteriophage λ (Int) is responsible for integrating and excising the viral chromosome into and out of the chromosome of its Escherichia coli host. Int carries out a reaction that is highly directional, tightly regulated, and depends upon an ensemble of accessory DNA bending proteins acting on 240 bp of DNA encoding 16 protein binding sites. This additional complexity enables two pathways, integrative and excisive recombination, whose opposite, and effectively irreversible, directions are dictated by different physiological and environmental signals. Int recombinase is a heterobivalent DNA binding protein and each of the four Int protomers, within a multiprotein 400 kDa recombinogenic complex, is thought to bind and, with the aid of DNA bending proteins, bridge one arm- and one core-type DNA site. In the 12 years since the publication of the last review focused solely on the λ site-specific recombination pathway in Mobile DNA II, there has been a great deal of progress in elucidating the molecular details of this pathway. The most dramatic advances in our understanding of the reaction have been in the area of X-ray crystallography where protein-DNA structures have now been determined for of all of the DNA-protein interfaces driving the Int pathway. Building on this foundation of structures, it has been possible to derive models for the assembly of components that determine the regulatory apparatus in the P-arm, and for the overall architectures that define excisive and integrative recombinogenic complexes. The most fundamental additional mechanistic insights derive from the application of hexapeptide inhibitors and single molecule kinetics. PMID:26104711

Characterization of a conformationally sensitive murine monoclonal antibody directed to the metal ion-dependent adhesion site face of integrin CD11b.

PubMed

Li, Rui; Haruta, Ikuko; Rieu, Philippe; Sugimori, Takashi; Xiong, Jian-Ping; Arnaout, M Amin

2002-02-01

Integrin binding to physiologic ligands requires divalent cations and an inside-out-driven switch of the integrin to a high-affinity state. Divalent cations at the metal ion-dependent adhesion site (MIDAS) face of the alpha subunit-derived A domain provide a direct bridge between ligands and the integrin, and it has been proposed that activation dependency is caused by reorientation of the surrounding residues relative to the metal ion, forming an optimal binding interface. To gain more insight into the functional significance of the protein movements on the MIDAS face, we raised and characterized a murine mAb 107 directed against the MIDAS face of the A domain from integrin CD11b. We find that mAb 107 behaves as a ligand mimic. It binds in a divalent-cation-dependent manner to solvent-exposed residues on the MIDAS face of CD11b, blocks interaction of 11bA or the holoreceptor with ligands, and inhibits spreading and phagocytosis by human neutrophils. However, in contrast to physiologic ligands, mAb 107 preferentially binds to the inactive low-affinity form of the integrin, suggesting that its antagonistic effects are exerted in part by stabilizing the receptor in the low-affinity state. These data support a functional relevance of the protein movements on the MIDAS face and suggest that stabilizing the A domain in the low-affinity state may have therapeutic benefit.

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE PAGES

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.; ...

2017-08-30

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC.

PubMed

Chen, Qiang; Kinde, Monica N; Arjunan, Palaniappa; Wells, Marta M; Cohen, Aina E; Xu, Yan; Tang, Pei

2015-09-08

Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6') and A244(13'). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6' or 13' support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs.

Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC

PubMed Central

Chen, Qiang; Kinde, Monica N.; Arjunan, Palaniappa; Wells, Marta M.; Cohen, Aina E.; Xu, Yan; Tang, Pei

2015-01-01

Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6′) and A244(13′). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6′ or 13′ support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs. PMID:26346220

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

PubMed

Fukuzawa, M; Williams, J G

2000-06-01

The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

Differential 3-bromopyruvate inhibition of cytosolic and mitochondrial human serine hydroxymethyltransferase isoforms, key enzymes in cancer metabolic reprogramming.

PubMed

Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto

2016-11-01

The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.

The co-crystal structure of ubiquitin carboxy-terminal hydrolase L1 (UCHL1) with a tripeptide fluoromethyl ketone (Z-VAE(OMe)-FMK)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, Christopher W.; Chaney, Joseph; Korbel, Gregory

2012-07-25

UCHL1 is a 223 amino acid member of the UCH family of deubiquitinating enzymes (DUBs), found abundantly and exclusively expressed in neurons and the testis in normal tissues. Two naturally occurring variants of UCHL1 are directly involved in Parkinson's disease (PD). Not only has UCHL1 been linked to PD, but it has oncogenic properties, having been found abnormally expressed in lung, pancreatic, and colorectal cancers. Although inhibitors of UCHL1 have been described previously the co-crystal structure of the enzyme bound to any inhibitor has not been reported. Herein, we report the X-ray structure of UCHL1 co-crystallized with a peptide-based fluoromethylketonemore » inhibitor, Z-VAE(OMe)-FMK (VAEFMK) at 2.35 {angstrom} resolution. The co-crystal structure reveals that the inhibitor binds in the active-site cleft, irreversibly modifying the active-site cysteine; however, the catalytic histidine is still misaligned as seen in the native structure, suggesting that the inhibitor binds to an inactive form of the enzyme. Our structure also reveals that the inhibitor approaches the active-site cleft from the opposite side of the crossover loop as compared to the direction of approach of ubiquitin's C-terminal tail, thereby occupying the P1{prime} (leaving group) site, a binding site perhaps used by the unknown C-terminal extension of ubiquitin in the actual in vivo substrate(s) of UCHL1. This structure provides a view of molecular contacts at the active-site cleft between the inhibitor and the enzyme as well as furnishing structural information needed to facilitate further design of inhibitors targeted to UCHL1 with high selectivity and potency.« less

High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

PubMed

Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

2007-05-22

Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

B Akabayov; C Richardson

Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less

Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

PubMed Central

Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

2013-01-01

The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

PubMed

Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

2015-06-01

IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

The RCAN carboxyl end mediates calcineurin docking-dependent inhibition via a site that dictates binding to substrates and regulators

PubMed Central

Martínez-Martínez, Sara; Genescà, Lali; Rodríguez, Antonio; Raya, Alicia; Salichs, Eulàlia; Were, Felipe; López-Maderuelo, María Dolores; Redondo, Juan Miguel; de la Luna, Susana

2009-01-01

Specificity of signaling kinases and phosphatases toward their targets is usually mediated by docking interactions with substrates and regulatory proteins. Here, we characterize the motifs involved in the physical and functional interaction of the phosphatase calcineurin with a group of modulators, the RCAN protein family. Mutation of key residues within the hydrophobic docking-cleft of the calcineurin catalytic domain impairs binding to all human RCAN proteins and to the calcineurin interacting proteins Cabin1 and AKAP79. A valine-rich region within the RCAN carboxyl region is essential for binding to the docking site in calcineurin. Although a peptide containing this sequence compromises NFAT signaling in living cells, it does not inhibit calcineurin catalytic activity directly. Instead, calcineurin catalytic activity is inhibited by a motif at the extreme C-terminal region of RCAN, which acts in cis with the docking motif. Our results therefore indicate that the inhibitory action of RCAN on calcineurin-NFAT signaling results not only from the inhibition of phosphatase activity but also from competition between NFAT and RCAN for binding to the same docking site in calcineurin. Thus, competition by substrates and modulators for a common docking site appears to be an essential mechanism in the regulation of Ca2+-calcineurin signaling. PMID:19332797

Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

PubMed Central

Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

2016-01-01

DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*

PubMed Central

Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun

2012-01-01

Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017

The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

PubMed Central

Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

2006-01-01

As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

Dancing the night away: Improving the persistence of locomotion on the micron scale

NASA Astrophysics Data System (ADS)

Gehrels, Emily W.; Rogers, W. Benjamin; Zeravcic, Zorana; Manoharan, Vinothan N.

In recent years a range of nano and microscale walkers (motors that are able to move along a preformed track) have been developed. Many of these walkers bind to their tracks using a single binding site at each station along the track. A disadvantage of these systems is that any failure involving a single site becoming unbound leads to the walker falling off of the track and locomotion being prematurely terminated. For this reason, it has been difficult to develop a motor that can reliably take more than a few sequential steps. We present an experimental system of DNA-functionalized colloidal particles which exhibit directed motion along patterned substrates in response to temperature cycling. Many DNA bridges form between each pair of interacting particles, adding redundancy to the binding at each station to realize a system that should be able to consistently take many steps. We take advantage of toehold exchange in the design of the DNA sequences that mediate the colloidal interactions to produce broadened, flat, or even re-entrant binding and unbinding transitions between the particles and substrate. Using this new freedom of design, we devise systems where, by thermal ratcheting, we can externally control the direction of motion and sequence of steps of the colloidal motor.

Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

PubMed

Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

2011-12-23

Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

PubMed

López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

2004-07-09

The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse.

PubMed

Jacobsen, Jacob P R; Plenge, Per; Sachs, Benjamin D; Pehrson, Alan L; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L; Dalvi, Prachiti; Robinson, Taylor J; O'Neill, Sharon P; Khoo, King S; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G

2014-12-01

Escitalopram appears to be a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, there by curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and hence anti-depressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram's inhibition here of. Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Recombinant generation of hSERT transgenic mice; in vivo microdialysis; SERT binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). We generated mice expressing either the wild-type human SERT (hSERT(WT)) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERT(ALI/VFL+SI/TT)). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. The hSERT mice showed normal basal 5-HTExt levels. Escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment and was unaffected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small and tended to be enhanced by R-citalopram co-administration. We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram.

Native Mass Spectrometry in Fragment-Based Drug Discovery.

PubMed

Pedro, Liliana; Quinn, Ronald J

2016-07-28

The advent of native mass spectrometry (MS) in 1990 led to the development of new mass spectrometry instrumentation and methodologies for the analysis of noncovalent protein-ligand complexes. Native MS has matured to become a fast, simple, highly sensitive and automatable technique with well-established utility for fragment-based drug discovery (FBDD). Native MS has the capability to directly detect weak ligand binding to proteins, to determine stoichiometry, relative or absolute binding affinities and specificities. Native MS can be used to delineate ligand-binding sites, to elucidate mechanisms of cooperativity and to study the thermodynamics of binding. This review highlights key attributes of native MS for FBDD campaigns.

Application of a continuous distribution model for proton binding by humic acids extracted from acidic lake sediments

NASA Astrophysics Data System (ADS)

Rhea, James R.; Young, Thomas C.

1987-10-01

The proton binding characteristics of humic acids extracted from the sediments of Cranberry Pond, an acidic water body located in the Adirondack Mountain region of New York State, were explored by the application of a multiligand distribution model. The model characterizes a class of proton binding sites by mean log K values and the standard deviations of log K values about the mean. Mean log K values and their relative abundances were determined directly from experimental titration data. The model accurately predicts the binding of protons by the humic acids for pH values in the range 3.5 to 10.0.

Application of a continuous distribution model for proton binding by humic acids extracted from acidic lake sediments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhea, J.R.; Young, T.C.

1987-01-01

The proton binding characteristics of humic acids extracted from the sediments of Cranberry Pond, an acidic water body located in the Adirondack Mountain region of New York State, were explored by the application of a nultiligand distribution model. The model characterizes a class of proton binding sites by mean log K values and the standard deviations of log K values and the mean. Mean log K values and their relative abundances were determined directly from experimental titration data. The model accurately predicts the binding of protons by the humic acids for pH values in the range 3.5 to 10.0.

Direct Measurement of Equilibrium Constants for High-Affinity Hemoglobins

PubMed Central

Kundu, Suman; Premer, Scott A.; Hoy, Julie A.; Trent, James T.; Hargrove, Mark S.

2003-01-01

The biological functions of heme proteins are linked to their rate and affinity constants for ligand binding. Kinetic experiments are commonly used to measure equilibrium constants for traditional hemoglobins comprised of pentacoordinate ligand binding sites and simple bimolecular reaction schemes. However, kinetic methods do not always yield reliable equilibrium constants with more complex hemoglobins for which reaction mechanisms are not clearly understood. Furthermore, even where reaction mechanisms are clearly understood, it is very difficult to directly measure equilibrium constants for oxygen and carbon monoxide binding to high-affinity (KD ≪ 1 μM) hemoglobins. This work presents a method for direct measurement of equilibrium constants for high-affinity hemoglobins that utilizes a competition for ligands between the "target" protein and an array of "scavenger" hemoglobins with known affinities. This method is described for oxygen and carbon monoxide binding to two hexacoordinate hemoglobins: rice nonsymbiotic hemoglobin and Synechocystis hemoglobin. Our results demonstrate that although these proteins have different mechanisms for ligand binding, their affinities for oxygen and carbon monoxide are similar. Their large affinity constants for oxygen, 285 and ∼100 μM−1 respectively, indicate that they are not capable of facilitating oxygen transport. PMID:12770899

Crystal Structure of the Neutralizing Llama VHH D7 and Its Mode of HIV-1 gp120 Interaction

PubMed Central

Hinz, Andreas; Lutje Hulsik, David; Forsman, Anna; Koh, Willie Wee-Lee; Belrhali, Hassan; Gorlani, Andrea; de Haard, Hans; Weiss, Robin A.; Verrips, Theo; Weissenhorn, Winfried

2010-01-01

HIV-1 entry into host cells is mediated by the sequential binding of the envelope glycoprotein gp120 to CD4 and a chemokine receptor. Antibodies binding to epitopes overlapping the CD4-binding site on gp120 are potent inhibitors of HIV entry, such as the llama heavy chain antibody fragment VHH D7, which has cross-clade neutralizing properties and competes with CD4 and mAb b12 for high affinity binding to gp120. We report the crystal structure of the D7 VHH at 1.5 Å resolution, which reveals the molecular details of the complementarity determining regions (CDR) and substantial flexibility of CDR3 that could facilitate an induced fit interaction with gp120. Structural comparison of CDRs from other CD4 binding site antibodies suggests diverse modes of interaction. Mutational analysis identified CDR3 as a key component of gp120 interaction as determined by surface plasmon resonance. A decrease in affinity is directly coupled to the neutralization efficiency since mutations that decrease gp120 interaction increase the IC50 required for HIV-1 IIIB neutralization. Thus the structural study identifies the long CDR3 of D7 as the key determinant of interaction and HIV-1 neutralization. Furthermore, our data confirm that the structural plasticity of gp120 can accommodate multiple modes of antibody binding within the CD4 binding site. PMID:20463957

Probing site-exclusive binding of aqueous QDs and their organelle-dependent dynamics in live cells by single molecule spectroscopy.

PubMed

Dong, Chaoqing; Chowdhury, Basudev; Irudayaraj, Joseph

2013-05-21

Understanding the biophysical and chemical interactions of nanoprobes and their fate upon entering live cells is critical for developing fundamental insights related to intracellular diagnostics, drug delivery and targeting. In this article we report herein a single molecule analysis procedure to quantitate site-specific exclusive membrane binding of N-acetyl-L-cysteine (NAC)-capped cadmium telluride (CdTe) quantum dots (QDs) in A-427 lung carcinoma cells (k(eq) = 0.075 ± 0.011 nM(-1)), its relative intracellular distribution and dynamics using fluorescence correlation spectroscopy (FCS) combined with scanning confocal fluorescence lifetime imaging (FLIM). In particular, we demonstrate that the binding efficacy of QDs to the cell membrane is directly related to their size and the targeting of QDs to specific membrane sites is exclusive. We also show that QDs are efficiently internalized by endocytosis and enclosed within the endosome and organelle-dependent diffusion dynamics can be monitored in live cells.

Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

PubMed Central

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

2014-01-01

Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

Crystallographic structure of a small molecule SIRT1 activator-enzyme complex

NASA Astrophysics Data System (ADS)

Dai, Han; Case, April W.; Riera, Thomas V.; Considine, Thomas; Lee, Jessica E.; Hamuro, Yoshitomo; Zhao, Huizhen; Jiang, Yong; Sweitzer, Sharon M.; Pietrak, Beth; Schwartz, Benjamin; Blum, Charles A.; Disch, Jeremy S.; Caldwell, Richard; Szczepankiewicz, Bruce; Oalmann, Christopher; Yee Ng, Pui; White, Brian H.; Casaubon, Rebecca; Narayan, Radha; Koppetsch, Karsten; Bourbonais, Francis; Wu, Bo; Wang, Junfeng; Qian, Dongming; Jiang, Fan; Mao, Cheney; Wang, Minghui; Hu, Erding; Wu, Joe C.; Perni, Robert B.; Vlasuk, George P.; Ellis, James L.

2015-07-01

SIRT1, the founding member of the mammalian family of seven NAD+-dependent sirtuins, is composed of 747 amino acids forming a catalytic domain and extended N- and C-terminal regions. We report the design and characterization of an engineered human SIRT1 construct (mini-hSIRT1) containing the minimal structural elements required for lysine deacetylation and catalytic activation by small molecule sirtuin-activating compounds (STACs). Using this construct, we solved the crystal structure of a mini-hSIRT1-STAC complex, which revealed the STAC-binding site within the N-terminal domain of hSIRT1. Together with hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis using full-length hSIRT1, these data establish a specific STAC-binding site and identify key intermolecular interactions with hSIRT1. The determination of the interface governing the binding of STACs with human SIRT1 facilitates greater understanding of STAC activation of this enzyme, which holds significant promise as a therapeutic target for multiple human diseases.

Time-resolved absorbance changes induced by fast acidification of bacteriorhodopsin in vesicle systems.

PubMed Central

Druckmann, S; Ottolenghi, M; Korenstein, R

1985-01-01

The direction of the accessibility to protons of the binding site in bacteriorhodopsin is of primary importance in elucidating the proton-pump mechanism. The problem is approached via the pH-dependent equilibrium bR560 in equilibrium bR605 in vesicles with preferentially oriented purple membranes. Fast acidification (stopped-flow) experiments with inside-out, monomeric, bR vesicles were carried out with and without a buffer enclosed in the vesicle interior. The results, showing a buffer-induced delay in the formation of bR605, indicate that the binding site is accessible to protons from the inside of the vesicles. We arrive at this conclusion also by working with inside-out trimeric vesicles in the presence and in the absence of H+ (and K+) ionophores. The results suggest that in Halobacterium halobium, the binding site and thus the retinal Schiff base are exposed to the outside of the cell. This conclusion is consistent with a pumping mechanism based on a light-induced pK change. PMID:3978185

The Interface between Catalytic and Hemopexin Domains in Matrix Metalloproteinase-1 Conceals a Collagen Binding Exosite*

PubMed Central

Arnold, Laurence H.; Butt, Louise E.; Prior, Stephen H.; Read, Christopher M.; Fields, Gregg B.; Pickford, Andrew R.

2011-01-01

Matrix metalloproteinase-1 (MMP-1) is an instigator of collagenolysis, the catabolism of triple helical collagen. Previous studies have implicated its hemopexin (HPX) domain in binding and possibly destabilizing the collagen substrate in preparation for hydrolysis of the polypeptide backbone by the catalytic (CAT) domain. Here, we use biophysical methods to study the complex formed between the MMP-1 HPX domain and a synthetic triple helical peptide (THP) that encompasses the MMP-1 cleavage site of the collagen α1(I) chain. The two components interact with 1:1 stoichiometry and micromolar affinity via a binding site within blades 1 and 2 of the four-bladed HPX domain propeller. Subsequent site-directed mutagenesis and assay implicates blade 1 residues Phe301, Val319, and Asp338 in collagen binding. Intriguingly, Phe301 is partially masked by the CAT domain in the crystal structure of full-length MMP-1 implying that transient separation of the domains is important in collagen recognition. However, mutation of this residue in the intact enzyme disrupts the CAT-HPX interface resulting in a drastic decrease in binding activity. Thus, a balanced equilibrium between these compact and dislocated states may be an essential feature of MMP-1 collagenase activity. PMID:22030392

Biochemistry of the tale transcription factors PREP, MEIS, and PBX in vertebrates.

PubMed

Longobardi, E; Penkov, D; Mateos, D; De Florian, G; Torres, M; Blasi, Francesco

2014-01-01

TALE (three amino acids loop extension) homeodomain transcription factors are required in various steps of embryo development, in many adult physiological functions, and are involved in important pathologies. This review focuses on the PREP, MEIS, and PBX sub-families of TALE factors and aims at giving information on their biochemical properties, i.e., structure, interactors, and interaction surfaces. Members of the three sets of protein form dimers in which the common partner is PBX but they can also directly interact with other proteins forming higher-order complexes, in particular HOX. Finally, recent advances in determining the genome-wide DNA-binding sites of PREP1, MEIS1, and PBX1, and their partial correspondence with the binding sites of some HOX proteins, are reviewed. These studies have generated a few general rules that can be applied to all members of the three gene families. PREP and MEIS recognize slightly different consensus sequences: PREP prefers to bind to promoters and to have PBX as a DNA-binding partner; MEIS prefers HOX as partner, and both PREP and MEIS drive PBX to their own binding sites. This outlines the clear individuality of the PREP and MEIS proteins, the former mostly devoted to basic cellular functions, the latter more to developmental functions. Copyright © 2013 Wiley Periodicals, Inc.

A gain-of-function mutation in the M-domain of cardiac myosin-binding protein-C increases binding to actin.

PubMed

Bezold, Kristina L; Shaffer, Justin F; Khosa, Jaskiran K; Hoye, Elaine R; Harris, Samantha P

2013-07-26

The M-domain is the major regulatory subunit of cardiac myosin-binding protein-C (cMyBP-C) that modulates actin and myosin interactions to influence muscle contraction. However, the precise mechanism(s) and the specific residues involved in mediating the functional effects of the M-domain are not fully understood. Positively charged residues adjacent to phosphorylation sites in the M-domain are thought to be critical for effects of cMyBP-C on cross-bridge interactions by mediating electrostatic binding with myosin S2 and/or actin. However, recent structural studies revealed that highly conserved sequences downstream of the phosphorylation sites form a compact tri-helix bundle. Here we used site-directed mutagenesis to probe the functional significance of charged residues adjacent to the phosphorylation sites and conserved residues within the tri-helix bundle. Results confirm that charged residues adjacent to phosphorylation sites and residues within the tri-helix bundle are important for mediating effects of the M-domain on contraction. In addition, four missense variants within the tri-helix bundle that are associated with human hypertrophic cardiomyopathy caused either loss-of-function or gain-of-function effects on force. Importantly, the effects of the gain-of-function variant, L348P, increased the affinity of the M-domain for actin. Together, results demonstrate that functional effects of the M-domain are not due solely to interactions with charged residues near phosphorylatable serines and provide the first demonstration that the tri-helix bundle contributes to the functional effects of the M-domain, most likely by binding to actin.

Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Hongyan, E-mail: hongyan_dong@hc-sc.gc.ca; Yauk, Carole L.; Wade, Michael G.

Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined withmore » chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism.« less

[The mechanism of the transport of organophosphorus compounds across the histo-hematic barriers].

PubMed

Miroshkina, V N; Kosmachev, A B; Salova, L S

1999-01-01

It was demonstrated in experiments on mice [correction of rats] that the transport of organophosphorus compounds (OPC) through membranes of the histohematic barriers (HHB) of the organism occurs by means of diffusion. The rate of this process depends on the interaction of OPC with the specific sites of binding with the tissues, among which the enzyme carboxylesterase plays an important part. It is suggested that both the rate and direction of OPC diffusion are determined by the relationship between the values of affinity of the ligands for the sites of their specific binding found on both sides of the HHB.

PDZ binding to the BAR domain of PICK1 is elucidated by coarse-grained molecular dynamics.

PubMed

He, Yi; Liwo, Adam; Weinstein, Harel; Scheraga, Harold A

2011-01-07

A key regulator of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor traffic, PICK1 is known to interact with over 40 other proteins, including receptors, transporters and ionic channels, and to be active mostly as a homodimer. The current lack of a complete PICK1 structure determined at atomic resolution hinders the elucidation of its functional mechanisms. Here, we identify interactions between the component PDZ and BAR domains of PICK1 by calculating possible binding sites for the PDZ domain of PICK1 (PICK1-PDZ) to the homology-modeled, crescent-shaped dimer of the PICK1-BAR domain using multiplexed replica-exchange molecular dynamics (MREMD) and canonical molecular dynamics simulations with the coarse-grained UNRES force field. The MREMD results show that the preferred binding site for the single PDZ domain is the concave cavity of the BAR dimer. A second possible binding site is near the N-terminus of the BAR domain that is linked directly to the PDZ domain. Subsequent short canonical molecular dynamics simulations used to determine how the PICK1-PDZ domain moves to the preferred binding site on the BAR domain of PICK1 revealed that initial hydrophobic interactions drive the progress of the simulated binding. Thus, the concave face of the BAR dimer accommodates the PDZ domain first by weak hydrophobic interactions and then the PDZ domain slides to the center of the concave face, where more favorable hydrophobic interactions take over. Copyright © 2010 Elsevier Ltd. All rights reserved.

Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

PubMed

Fiorucci, Sébastien; Zacharias, Martin

2010-05-19

Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Enhanced protective antibody to a mutant meningococcal factor H-binding protein with low-factor H binding

PubMed Central

Granoff, Dan M.; Giuntini, Serena; Gowans, Flor A.; Lujan, Eduardo; Sharkey, Kelsey; Beernink, Peter T.

2016-01-01

Meningococcal factor H-binding protein (FHbp) is an antigen in 2 serogroup B meningococcal vaccines. FHbp specifically binds human and some nonhuman primate complement FH. To investigate the effect of binding of FH to FHbp on protective antibody responses, we immunized infant rhesus macaques with either a control recombinant FHbp antigen that bound macaque FH or a mutant antigen with 2 amino acid substitutions and >250-fold lower affinity for FH. The mutant antigen elicited 3-fold higher serum IgG anti-FHbp titers and up to 15-fold higher serum bactericidal titers than the control FHbp vaccine. When comparing sera with similar IgG anti-FHbp titers, the antibodies elicited by the mutant antigen gave greater deposition of complement component C4b on live meningococci (classical complement pathway) and inhibited binding of FH, while the anti-FHbp antibodies elicited by the control vaccine enhanced FH binding. Thus, the mutant FHbp vaccine elicited an anti-FHbp antibody repertoire directed at FHbp epitopes within the FH binding site, which resulted in greater protective activity than the antibodies elicited by the control vaccine, which targeted FHbp epitopes outside of the FH combining site. Binding of a host protein to a vaccine antigen impairs protective antibody responses, which can be overcome with low-binding mutant antigens. PMID:27668287

Lactose-containing starburst dendrimers: influence of dendrimer generation and binding-site orientation of receptors (plant/animal lectins and immunoglobulins) on binding properties.

PubMed

André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J

1999-11-01

Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential of dendrimers for applications as lectin-targeting device, as attested by these observations.

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

PubMed Central

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.

2015-01-01

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.

The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeastSaccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)]in vitroandin vivoand that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8more » is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation.« less

Protein-directed self-assembly of a fullerene crystal.

PubMed

Kim, Kook-Han; Ko, Dong-Kyun; Kim, Yong-Tae; Kim, Nam Hyeong; Paul, Jaydeep; Zhang, Shao-Qing; Murray, Christopher B; Acharya, Rudresh; DeGrado, William F; Kim, Yong Ho; Grigoryan, Gevorg

2016-04-26

Learning to engineer self-assembly would enable the precise organization of molecules by design to create matter with tailored properties. Here we demonstrate that proteins can direct the self-assembly of buckminsterfullerene (C60) into ordered superstructures. A previously engineered tetrameric helical bundle binds C60 in solution, rendering it water soluble. Two tetramers associate with one C60, promoting further organization revealed in a 1.67-Å crystal structure. Fullerene groups occupy periodic lattice sites, sandwiched between two Tyr residues from adjacent tetramers. Strikingly, the assembly exhibits high charge conductance, whereas both the protein-alone crystal and amorphous C60 are electrically insulating. The affinity of C60 for its crystal-binding site is estimated to be in the nanomolar range, with lattices of known protein crystals geometrically compatible with incorporating the motif. Taken together, these findings suggest a new means of organizing fullerene molecules into a rich variety of lattices to generate new properties by design.

Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

PubMed

Broillet, M C; Firestein, S

1996-02-01

The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

A model for the solution structure of the rod arrestin tetramer.

PubMed

Hanson, Susan M; Dawson, Eric S; Francis, Derek J; Van Eps, Ned; Klug, Candice S; Hubbell, Wayne L; Meiler, Jens; Gurevich, Vsevolod V

2008-06-01

Visual rod arrestin has the ability to self-associate at physiological concentrations. We previously demonstrated that only monomeric arrestin can bind the receptor and that the arrestin tetramer in solution differs from that in the crystal. We employed the Rosetta docking software to generate molecular models of the physiologically relevant solution tetramer based on the monomeric arrestin crystal structure. The resulting models were filtered using the Rosetta energy function, experimental intersubunit distances measured with DEER spectroscopy, and intersubunit contact sites identified by mutagenesis and site-directed spin labeling. This resulted in a unique model for subsequent evaluation. The validity of the model is strongly supported by model-directed crosslinking and targeted mutagenesis that yields arrestin variants deficient in self-association. The structure of the solution tetramer explains its inability to bind rhodopsin and paves the way for experimental studies of the physiological role of rod arrestin self-association.

XIAP inhibits caspase-3 and -7 using two binding sites: evolutionarily conserved mechanism of IAPs

PubMed Central

Scott, Fiona L; Denault, Jean-Bernard; Riedl, Stefan J; Shin, Hwain; Renatus, Martin; Salvesen, Guy S

2005-01-01

The X-linked inhibitor of apoptosis protein (XIAP) uses its second baculovirus IAP repeat domain (BIR2) to inhibit the apoptotic executioner caspase-3 and -7. Structural studies have demonstrated that it is not the BIR2 domain itself but a segment N-terminal to it that directly targets the activity of these caspases. These studies failed to demonstrate a role of the BIR2 domain in inhibition. We used site-directed mutagenesis of BIR2 and its linker to determine the mechanism of executioner caspase inhibition by XIAP. We show that the BIR2 domain contributes substantially to inhibition of executioner caspases. A surface groove on BIR2, which also binds to Smac/DIABLO, interacts with a neoepitope generated at the N-terminus of the caspase small subunit following activation. Therefore, BIR2 uses a two-site interaction mechanism to achieve high specificity and potency for inhibition. Moreover, for caspase-7, the precise location of the activating cleavage is critical for subsequent inhibition. Since apical caspases utilize this cleavage site differently, we predict that the origin of the death stimulus should dictate the efficiency of inhibition by XIAP. PMID:15650747

New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

2013-11-01

Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

7-Methoxytacrine-adamantylamine heterodimers as cholinesterase inhibitors in Alzheimer's disease treatment--synthesis, biological evaluation and molecular modeling studies.

PubMed

Spilovska, Katarina; Korabecny, Jan; Kral, Jan; Horova, Anna; Musilek, Kamil; Soukup, Ondrej; Drtinova, Lucie; Gazova, Zuzana; Siposova, Katarina; Kuca, Kamil

2013-02-20

A structural series of 7-MEOTA-adamantylamine thioureas was designed, synthesized and evaluated as inhibitors of human acetylcholinesterase (hAChE) and human butyrylcholinesterase (hBChE). The compounds were prepared based on the multi-target-directed ligand strategy with different linker lengths (n = 2-8) joining the well-known NMDA antagonist adamantine and the hAChE inhibitor 7-methoxytacrine (7-MEOTA). Based on in silico studies, these inhibitors proved dual binding site character capable of simultaneous interaction with the peripheral anionic site (PAS) of hAChE and the catalytic active site (CAS). Clearly, these structural derivatives exhibited very good inhibitory activity towards hBChE resulting in more selective inhibitors of this enzyme. The most potent cholinesterase inhibitor was found to be thiourea analogue 14 (with an IC₅₀ value of 0.47 µM for hAChE and an IC₅₀ value of 0.11 µM for hBChE, respectively). Molecule 14 is a suitable novel lead compound for further evaluation proving that the strategy of dual binding site inhibitors might be a promising direction for development of novel AD drugs.

Anion Binding to Hydrophobic Concavity is Central to the Salting-in Effects of Hofmeister Chaotropes

PubMed Central

Gibb, Corinne L. D.; Gibb, Bruce C.

2011-01-01

For over 120 years it has been appreciated that certain salts (kosmotropes) cause the precipitation of proteins, whilst others (chaotropes) increase their solubility. The cause of this, “Hofmeister effect” is still unclear; especially with the original concept that kosmotropic anions “make” water structure and chaotropes “break” it being countered by recent studies suggesting otherwise. Here, we present the first direct evidence that chaotropic anions have an affinity for hydrophobic concavity, and that it is competition between a convex hydrophobe and the anion for a binding site that leads to the apparent weakening of the hydrophobic effect by chaotropes. In combination, these results suggest that chaotropes primarily induce protein solubilization by direct binding to concavity in the molten globule state of a protein. PMID:21524086

Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.

PubMed

Du, W; Aloyo, V J; Harvey, J A

1997-10-03

Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.

Dissecting the Catalytic Mechanism of Betaine-Homocysteine S-Methyltransferase Using Intrinsic Tryptophan Fluorescence and Site-Directed Mutagenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castro, C.; Gratson, A.A.; Evans, J.C.

2010-03-05

Betaine-homocysteine S-methyltransferase (BHMT) is a zinc-dependent enzyme that catalyzes the transfer of a methyl group from glycine betaine (Bet) to homocysteine (Hcy) to form dimethylglycine (DMG) and methionine (Met). Previous studies in other laboratories have indicated that catalysis proceeds through the formation of a ternary complex, with a transition state mimicked by the inhibitor S-({delta}-carboxybutyl)-l-homocysteine (CBHcy). Using changes in intrinsic tryptophan fluorescence to determine the affinity of human BHMT for substrates, products, or CBHcy, we now demonstrate that the enzyme-substrate complex reaches its transition state through an ordered bi-bi mechanism in which Hcy is the first substrate to bind andmore » Met is the last product released. Hcy, Met, and CBHcy bind to the enzyme to form binary complexes with K{sub d} values of 7.9, 6.9, and 0.28 {micro}M, respectively. Binary complexes with Bet and DMG cannot be detected with fluorescence as a probe, but Bet and DMG bind tightly to BHMT-Hcy to form ternary complexes with K{sub d} values of 1.1 and 0.73 {micro}M, respectively. Mutation of each of the seven tryptophan residues in human BHMT provides evidence that the enzyme undergoes two distinct conformational changes that are reflected in the fluorescence of the enzyme. The first is induced when Hcy binds, and the second, when Bet binds. As predicted by the crystal structure of BHMT, the amino acids Trp44 and Tyr160 are involved in binding Bet, and Glu159 in binding Hcy. Replacing these residues by site-directed mutagenesis significantly reduces the catalytic efficiency (V{sub max}/K{sub m}) of the enzyme. Replacing Tyr77 with Phe abolishes enzyme activity.« less

Locating the route of entry and binding sites of benzocaine and phenytoin in a bacterial voltage gated sodium channel.

PubMed

Martin, Lewis J; Corry, Ben

2014-07-01

Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites.

Locating the Route of Entry and Binding Sites of Benzocaine and Phenytoin in a Bacterial Voltage Gated Sodium Channel

PubMed Central

Martin, Lewis J.; Corry, Ben

2014-01-01

Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites. PMID:24992293

The HOPS/Class C Vps Complex Tethers High-Curvature Membranes via a Direct Protein-Membrane Interaction.

PubMed

Ho, Ruoya; Stroupe, Christopher

2016-10-01

Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

ITC-derived binding affinity may be biased due to titrant (nano)-aggregation. Binding of halogenated benzotriazoles to the catalytic domain of human protein kinase CK2

PubMed Central

Winiewska, Maria; Bugajska, Ewa

2017-01-01

The binding of four bromobenzotriazoles to the catalytic subunit of human protein kinase CK2 was assessed by two complementary methods: Microscale Thermophoresis (MST) and Isothermal Titration Calorimetry (ITC). New algorithm proposed for the global analysis of MST pseudo-titration data enabled reliable determination of binding affinities for two distinct sites, a relatively strong one with the Kd of the order of 100 nM and a substantially weaker one (Kd > 1 μM). The affinities for the strong binding site determined for the same protein-ligand systems using ITC were in most cases approximately 10-fold underestimated. The discrepancy was assigned directly to the kinetics of ligand nano-aggregates decay occurring upon injection of the concentrated ligand solution to the protein sample. The binding affinities determined in the reverse ITC experiment, in which ligands were titrated with a concentrated protein solution, agreed with the MST-derived data. Our analysis suggests that some ITC-derived Kd values, routinely reported together with PDB structures of protein-ligand complexes, may be biased due to the uncontrolled ligand (nano)-aggregation, which may occur even substantially below the solubility limit. PMID:28273138

The Apc5 Subunit of the Anaphase-Promoting Complex/Cyclosome Interacts with Poly(A) Binding Protein and Represses Internal Ribosome Entry Site-Mediated Translation

PubMed Central

Koloteva-Levine, Nadejda; Pinchasi, Dalia; Pereman, Idan; Zur, Amit; Brandeis, Michael; Elroy-Stein, Orna

2004-01-01

The anaphase-promoting complex/cyclosome (APC/C) is a multisubunit ubiquitin ligase that mediates the proteolysis of cell cycle proteins in mitosis and G1. We used a yeast three-hybrid screen to identify proteins that interact with the internal ribosome entry site (IRES) of platelet-derived growth factor 2 mRNA. Surprisingly, this screen identified Apc5, although it does not harbor a classical RNA binding domain. We found that Apc5 binds the poly(A) binding protein (PABP), which directly binds the IRES element. PABP was found to enhance IRES-mediated translation, whereas Apc5 overexpression counteracted this effect. In addition to its association with the APC/C complex, Apc5 binds much heavier complexes and cosediments with the ribosomal fraction. In contrast to Apc3, which is associated only with the APC/C and remains intact during differentiation, Apc5 is degraded upon megakaryocytic differentiation in correlation with IRES activation. Expression of Apc5 in differentiated cells abolished IRES activation. This is the first report implying an additional role for an APC/C subunit, apart from its being part of the APC/C complex. PMID:15082755

Drug Design Relating Amebicides to Inhibition of Protein Synthesis.

DTIC Science & Technology

1977-09-01

A study of the effect of emetine on protein synthesis in E. histolytica was made on log phase amebas as compared to stationary phase amebas ...Sensitivity to emetine was maintained independently of the rate of protein synthesis. Furthermore, both stages of amebas had the same capacity to bind emetine...elongation site. Finally, evidence was obtained that the capacity to bind emetine provides a basis for conferring drug resistance in amebas . A direct

Discovery of novel STAT3 small molecule inhibitors via in silico site-directed fragment-based drug design.

PubMed

Yu, Wenying; Xiao, Hui; Lin, Jiayuh; Li, Chenglong

2013-06-13

Constitutive activation of signal transducer and activator of transcription 3 (STAT3) has been validated as an attractive therapeutic target for cancer therapy. To stop both STAT3 activation and dimerization, a viable strategy is to design inhibitors blocking its SH2 domain phosphotyrosine binding site that is responsible for both actions. A new fragment-based drug design (FBDD) strategy, in silico site-directed FBDD, was applied in this study. A designed novel compound, 5,8-dioxo-6-(pyridin-3-ylamino)-5,8-dihydronaphthalene-1-sulfonamide (LY5), was confirmed to bind to STAT3 SH2 by fluorescence polarization assay. In addition, four out of the five chosen compounds have IC50 values lower than 5 μM for the U2OS cancer cells. 8 (LY5) has an IC50 range in 0.5-1.4 μM in various cancer cell lines. 8 also suppresses tumor growth in an in vivo mouse model. This study has demonstrated the utility of this approach and could be used to other drug targets in general.

Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

PubMed Central

Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

2016-01-01

A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed Central

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-01-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri*

PubMed Central

Nie, Laiyin; Grell, Ernst; Malviya, Viveka Nand; Xie, Hao; Wang, Jingkang; Michel, Hartmut

2016-01-01

Multidrug and toxic compound extrusion (MATE) transporters exist in all three domains of life. They confer multidrug resistance by utilizing H+ or Na+ electrochemical gradients to extrude various drugs across the cell membranes. The substrate binding and the transport mechanism of MATE transporters is a fundamental process but so far not fully understood. Here we report a detailed substrate binding study of NorM_PS, a representative MATE transporter from Pseudomonas stutzeri. Our results indicate that NorM_PS is a proton-dependent multidrug efflux transporter. Detailed binding studies between NorM_PS and 4′,6-diamidino-2-phenylindole (DAPI) were performed by isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectrofluorometry. Two exothermic binding events were observed from ITC data, and the high-affinity event was directly correlated with the extrusion of DAPI. The affinities are about 1 μm and 0.1 mm for the high and low affinity binding, respectively. Based on our homology model of NorM_PS, variants with mutations of amino acids that are potentially involved in substrate binding, were constructed. By carrying out the functional characterization of these variants, the critical amino acid residues (Glu-257 and Asp-373) for high-affinity DAPI binding were determined. Taken together, our results suggest a new substrate-binding site for MATE transporters. PMID:27235402

Elucidation of Lipid Binding Sites on Lung Surfactant Protein A Using X-ray Crystallography, Mutagenesis, and Molecular Dynamics Simulations.

PubMed

Goh, Boon Chong; Wu, Huixing; Rynkiewicz, Michael J; Schulten, Klaus; Seaton, Barbara A; McCormack, Francis X

2016-07-05

Surfactant protein A (SP-A) is a collagenous C-type lectin (collectin) that is critical for pulmonary defense against inhaled microorganisms. Bifunctional avidity of SP-A for pathogen-associated molecular patterns (PAMPs) such as lipid A and for dipalmitoylphosphatidylcholine (DPPC), the major component of surfactant membranes lining the air-liquid interface of the lung, ensures that the protein is poised for first-line interactions with inhaled pathogens. To improve our understanding of the motifs that are required for interactions with microbes and surfactant structures, we explored the role of the tyrosine-rich binding surface on the carbohydrate recognition domain of SP-A in the interaction with DPPC and lipid A using crystallography, site-directed mutagenesis, and molecular dynamics simulations. Critical binding features for DPPC binding include a three-walled tyrosine cage that binds the choline headgroup through cation-π interactions and a positively charged cluster that binds the phosphoryl group. This basic cluster is also critical for binding of lipid A, a bacterial PAMP and target for SP-A. Molecular dynamics simulations further predict that SP-A binds lipid A more tightly than DPPC. These results suggest that the differential binding properties of SP-A favor transfer of the protein from surfactant DPPC to pathogen membranes containing appropriate lipid PAMPs to effect key host defense functions.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The ligand-binding profile of HARE: hyaluronan and chondroitin sulfates A, C, and D bind to overlapping sites distinct from the sites for heparin, acetylated low-density lipoprotein, dermatan sulfate, and CS-E.

PubMed

Harris, Edward N; Weigel, Paul H

2008-08-01

The hyaluronic acid receptor for endocytosis (HARE)/ Stabilin-2 is the primary systemic scavenger receptor for hyaluronan (HA), the chondroitin sulfates (CS), dermatan sulfate (DS), and nonglycosaminoglycan (GAG) ligands such as acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides, and advanced glycation end products. We recently discovered that HARE is also a systemic scavenger receptor for heparin (Hep) (Harris EN, Weigel JA, Weigel PH. 2008. The human hyaluronan receptor for endocytosis [HARE/Stabilin-2] is a systemic clearance receptor for heparin. J Biol Chem. 283:17341-17350). Our goal was to map the binding sites of eight different ligands within HARE. We used biotinylated GAGs and radio-iodinated streptavidin or AcLDL to assess the binding activities of ligands directly or indirectly (by competition with unlabeled ligands) in endocytosis assays using stable cell lines expressing the 315 or 190 kDa HA receptor for endocytosis (315- or 190-HARE) isoforms, and ELISA-like assays, with purified recombinant soluble 190-HARE ecto-domain. For example, Hep binding to HARE was competed by DS, CS-E, AcLDL, and dextran sulfate, but not by other CS types, HA, dextran, or heparosan. (125)I-AcLDL binding to HARE was partially competed by Hep and dextran sulfate, but not competed by HA. Two ligands, DS and CS-E, competed with both Hep and HA to some degree. Hep and HA binding or endocytosis is mutually inclusive; binding of these two GAGs occurs with functionally separate, noncompetitive, and apparently noninteracting domains. Thus, HARE binds to HA and Hep simultaneously. Although the domain(s) responsible for Hep binding remains unknown, the Link domain was required for HARE binding to HA, CS-A, CS-C, and CS-D. These results enable us to outline, for the first time, a binding activity map for multiple ligands of HARE.

The ligand-binding profile of HARE: hyaluronan and chondroitin sulfates A, C, and D bind to overlapping sites distinct from the sites for heparin, acetylated low-density lipoprotein, dermatan sulfate, and CS-E

PubMed Central

Harris, Edward N.; Weigel, Paul H.

2008-01-01

The hyaluronic acid receptor for endocytosis (HARE)/ Stabilin-2 is the primary systemic scavenger receptor for hyaluronan (HA), the chondroitin sulfates (CS), dermatan sulfate (DS), and nonglycosaminoglycan (GAG) ligands such as acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides, and advanced glycation end products. We recently discovered that HARE is also a systemic scavenger receptor for heparin (Hep) (Harris EN, Weigel JA, Weigel PH. 2008. The human hyaluronan receptor for endocytosis [HARE/Stabilin-2] is a systemic clearance receptor for heparin. J Biol Chem. 283:17341–17350). Our goal was to map the binding sites of eight different ligands within HARE. We used biotinylated GAGs and radio-iodinated streptavidin or AcLDL to assess the binding activities of ligands directly or indirectly (by competition with unlabeled ligands) in endocytosis assays using stable cell lines expressing the 315 or 190 kDa HA receptor for endocytosis (315- or 190-HARE) isoforms, and ELISA-like assays, with purified recombinant soluble 190-HARE ecto-domain. For example, Hep binding to HARE was competed by DS, CS-E, AcLDL, and dextran sulfate, but not by other CS types, HA, dextran, or heparosan. 125I-AcLDL binding to HARE was partially competed by Hep and dextran sulfate, but not competed by HA. Two ligands, DS and CS-E, competed with both Hep and HA to some degree. Hep and HA binding or endocytosis is mutually inclusive; binding of these two GAGs occurs with functionally separate, noncompetitive, and apparently noninteracting domains. Thus, HARE binds to HA and Hep simultaneously. Although the domain(s) responsible for Hep binding remains unknown, the Link domain was required for HARE binding to HA, CS-A, CS-C, and CS-D. These results enable us to outline, for the first time, a binding activity map for multiple ligands of HARE. PMID:18499864

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

Characterization of the Interactions between Calmodulin and Death Receptor 5 in Triple-negative and Estrogen Receptor-positive Breast Cancer Cells

PubMed Central

Fancy, Romone M.; Wang, Lingyun; Zeng, Qinghua; Wang, Hong; Zhou, Tong; Buchsbaum, Donald J.; Song, Yuhua

2016-01-01

Activation of death receptor-5 (DR5) leads to the formation of death inducing signaling complex (DISC) for apoptotic signaling. Targeting DR5 to induce breast cancer apoptosis is a promising strategy to circumvent drug resistance and present a target for breast cancer treatment. Calmodulin (CaM) has been shown to regulate DR5-mediated apoptotic signaling, however, its mechanism remains unknown. In this study, we characterized CaM and DR5 interactions in breast cancer cells with integrated experimental and computational approaches. Results show that CaM directly binds to DR5 in a calcium dependent manner in breast cancer cells. The direct interaction of CaM with DR5 is localized at DR5 death domain. We have predicted and verified the CaM-binding site in DR5 being 354WEPLMRKLGL363 that is located at the α2 helix and the loop between α2 helix and α3 helix of DR5 DD. The residues of Trp-354, Arg-359, Glu-355, Leu-363, and Glu-367 in DR5 death domain that are important for DR5 recruitment of FADD and caspase-8 for DISC formation to signal apoptosis also play an important role for CaM-DR5 binding. The changed electrostatic potential distribution in the CaM-binding site in DR5 DD by the point mutations of W354A, E355K, R359A, L363N, or E367K in DR5 DD could directly contribute to the experimentally observed decreased CaM-DR5 binding by the point mutations of the key residues in DR5 DD. Results from this study provide a key step for the further investigation of the role of CaM-DR5 binding in DR5-mediated DISC formation for apoptosis in breast cancer cells. PMID:27129269

Synthesis of biotinylated glycoconjugates and their use in a novel ELISA for direct comparison of HIV-1 Gp120 recognition of GalCer and related carbohydrate analogues.

PubMed

McReynolds, K D; Hadd, M J; Gervay-Hague, J

1999-01-01

As part of our program directed toward the design and synthesis of high-affinity ligands for the GalCer-binding site on the HIV cell surface glycoprotein, gp120, we required a reliable method for qualitatively assessing relative binding affinities for related analogues. Due to the hydrophilic nature of these synthetic conjugates, difficulties were encountered with typical ELISA methods, which rely upon hydrophobic interactions to anchor the ligand to a microtiter plate. Other types of assays were also problematic due to nonspecific binding of gp120. Therefore, we developed a general method for plating water-soluble ligands on microtiter plates using biotin/NeutrAvidin recognition for adhesion. A water-soluble GalCer analogue was prepared by conjugating psychosine to biotin using a novel tetraethylene glycol linker. In a similar manner, LacCer and GlcCer analogues were prepared and these conjugates were plated into microtiter wells containing NeutrAvidin. Unoccupied sites were blocked using biotin functionalized as a primary amide. Gp120 binding to galactosyl sphingosine, GalSph (19), GlcSph (22), and LacSph (23) conjugates was assessed through incubation with recombinant HRP-gp120. It was determined that LacSph has the strongest interaction with gp120. The binding affinities of GalSph and GlcSph were similar to each other and less strong than LacSph. These data contradict earlier studies where HPTLC showed that LacCer and GlcCer do not significantly bind gp120. They also contradict liposome-based assays that reported psychosine is not recognized by gp120. The extent of plating for each biotinylated molecule was quantified using HRP-biotin, allowing direct comparison of ligand plating efficiencies for the first time. Several other synthetic biotin conjugates were prepared and tested, demonstrating the feasibility of performing ELISA on water-soluble ligands.

Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.

PubMed Central

Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C

1994-01-01

Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081

Computational and Biochemical Docking of the Irreversible Cocaine Analog RTI 82 Directly Demonstrates Ligand Positioning in the Dopamine Transporter Central Substrate-binding Site*

PubMed Central

Dahal, Rejwi Acharya; Pramod, Akula Bala; Sharma, Babita; Krout, Danielle; Foster, James D.; Cha, Joo Hwan; Cao, Jianjing; Newman, Amy Hauck; Lever, John R.; Vaughan, Roxanne A.; Henry, L. Keith

2014-01-01

The dopamine transporter (DAT) functions as a key regulator of dopaminergic neurotransmission via re-uptake of synaptic dopamine (DA). Cocaine binding to DAT blocks this activity and elevates extracellular DA, leading to psychomotor stimulation and addiction, but the mechanisms by which cocaine interacts with DAT and inhibits transport remain incompletely understood. Here, we addressed these questions using computational and biochemical methodologies to localize the binding and adduction sites of the photoactivatable irreversible cocaine analog 3β-(p-chlorophenyl)tropane-2β-carboxylic acid, 4′-azido-3′-iodophenylethyl ester ([125I]RTI 82). Comparative modeling and small molecule docking indicated that the tropane pharmacophore of RTI 82 was positioned in the central DA active site with an orientation that juxtaposed the aryliodoazide group for cross-linking to rat DAT Phe-319. This prediction was verified by focused methionine substitution of residues flanking this site followed by cyanogen bromide mapping of the [125I]RTI 82-labeled mutants and by the substituted cysteine accessibility method protection analyses. These findings provide positive functional evidence linking tropane pharmacophore interaction with the core substrate-binding site and support a competitive mechanism for transport inhibition. This synergistic application of computational and biochemical methodologies overcomes many uncertainties inherent in other approaches and furnishes a schematic framework for elucidating the ligand-protein interactions of other classes of DA transport inhibitors. PMID:25179220

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

HIP1 and HIP12 display differential binding to F-actin, AP2, and clathrin. Identification of a novel interaction with clathrin light chain.

PubMed

Legendre-Guillemin, Valerie; Metzler, Martina; Charbonneau, Martine; Gan, Lu; Chopra, Vikramjit; Philie, Jacynthe; Hayden, Michael R; McPherson, Peter S

2002-05-31

Huntingtin-interacting protein 1 (HIP1) and HIP12 are orthologues of Sla2p, a yeast protein with essential functions in endocytosis and regulation of the actin cytoskeleton. We now report that HIP1 and HIP12 are major components of the clathrin coat that interact but differ in their ability to bind clathrin and the clathrin adaptor AP2. HIP1 contains a clathrin-box and AP2 consensus-binding sites that display high affinity binding to the terminal domain of the clathrin heavy chain and the ear domain of the AP2 alpha subunit, respectively. These consensus sites are poorly conserved in HIP12 and correspondingly, HIP12 does not bind to AP2 nor does it demonstrate high affinity clathrin binding. Moreover, HIP12 co-sediments with F-actin in contrast to HIP1, which exhibits no interaction with actin in vitro. Despite these differences, both proteins efficiently stimulate clathrin assembly through their central helical domain. Interestingly, in both HIP1 and HIP12, this domain binds directly to the clathrin light chain. Our data suggest that HIP1 and HIP12 play related yet distinct functional roles in clathrin-mediated endocytosis.

Structural basis for the antibody neutralization of Herpes simplex virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan

2013-10-01

The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less

Structures of rat cytosolic PEPCK: insight into the mechanism of phosphorylation and decarboxylation of oxaloacetic acid.

PubMed

Sullivan, Sarah M; Holyoak, Todd

2007-09-04

The structures of the rat cytosolic isoform of phosphoenolpyruvate carboxykinase (PEPCK) reported in the PEPCK-Mn2+, -Mn2+-oxaloacetic acid (OAA), -Mn2+-OAA-Mn2+-guanosine-5'-diphosphate (GDP), and -Mn2+-Mn2+-guanosine-5'-tri-phosphate (GTP) complexes provide insight into the mechanism of phosphoryl transfer and decarboxylation mediated by this enzyme. OAA is observed to bind in a number of different orientations coordinating directly to the active site metal. The Mn2+-OAA and Mn2+-OAA-Mn2+GDP structures illustrate inner-sphere coordination of OAA to the manganese ion through the displacement of two of the three water molecules coordinated to the metal in the holo-enzyme by the C3 and C4 carbonyl oxygens. In the PEPCK-Mn2+-OAA complex, an alternate bound conformation of OAA is present. In this conformation, in addition to the previous interactions, the C1 carboxylate is directly coordinated to the active site Mn2+, displacing all of the waters coordinated to the metal in the holo-enzyme. In the PEPCK-Mn2+-GTP structure, the same water molecule displaced by the C1 carboxylate of OAA is displaced by one of the gamma-phosphate oxygens of the triphosphate nucleotide. The structures are consistent with a mechanism of direct in-line phosphoryl transfer, supported by the observed stereochemistry of the reaction. In the catalytically competent binding mode, the C1 carboxylate of OAA is sandwiched between R87 and R405 in an environment that would serve to facilitate decarboxylation. In the reverse reaction, these two arginines would form the CO2 binding site. Comparison of the Mn2+-OAA-Mn2+GDP and Mn2+-Mn2+GTP structures illustrates a marked difference in the bound conformations of the nucleotide substrates in which the GTP nucleotide is bound in a high-energy state resulting from the eclipsing of all three of the phosphoryl groups along the triphosphate chain. This contrasts a previously determined structure of PEPCK in complex with a triphosphate nucleotide analogue in which the analogue mirrors the conformation of GDP as opposed to GTP. Last, the structures illustrate a correlation between conformational changes in the P-loop, the nucleotide binding site, and the active site lid that are important for catalysis.

Oxysterol-binding protein-related protein (ORP) 9 is a PDK-2 substrate and regulates Akt phosphorylation.

PubMed

Lessmann, Eva; Ngo, Mike; Leitges, Michael; Minguet, Susana; Ridgway, Neale D; Huber, Michael

2007-02-01

The oxysterol-binding protein and oxysterol-binding protein-related protein family has been implicated in lipid transport and metabolism, vesicle trafficking and cell signaling. While investigating the phosphorylation of Akt/protein kinase B in stimulated bone marrow-derived mast cells, we observed that a monoclonal antibody directed against phospho-S473 Akt cross-reacted with oxysterol-binding protein-related protein 9 (ORP9). Further analysis revealed that mast cells exclusively express ORP9S, an N-terminal truncated version of full-length ORP9L. A PDK-2 consensus phosphorylation site in ORP9L and OPR9S at S287 (VPEFS(287)Y) was confirmed by site-directed mutagenesis. In contrast to Akt, increased phosphorylation of ORP9S S287 in stimulated mast cells was independent of phosphatidylinositol 3-kinase but sensitive to inhibition of conventional PKC isotypes. PKC-beta dependence was confirmed by lack of ORP9S phosphorylation at S287 in PKC-beta-deficient, but not PKC-alpha-deficient, mast cells. Moreover, co-immunoprecipitation of PKC-beta and ORP9S, and in vitro phosphorylation of ORP9S in this complex, argued for direct phosphorylation of ORP9S by PKC-beta, introducing ORP9S as a novel PKC-beta substrate. Akt was also detected in a PKC-beta/ORP9S immune complex and phosphorylation of Akt on S473 was delayed in PKC-deficient mast cells. In HEK293 cells, RNAi experiments showed that depletion of ORP9L increased Akt S473 phosphorylation 3-fold without affecting T308 phosphorylation in the activation loop. Furthermore, mammalian target of rapamycin was implicated in ORP9L phosphorylation in HEK293 cells. These studies identify ORP9 as a PDK-2 substrate and negative regulator of Akt phosphorylation at the PDK-2 site.

The BMP pathway acts to directly regulate Tbx20 in the developing heart

PubMed Central

Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.

2010-01-01

TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370

Communication between Thiamin Cofactors in the Escherichia coli Pyruvate Dehydrogenase Complex E1 Component Active Centers EVIDENCE FOR A DIRECT PATHWAY BETWEEN THE 4′-AMINOPYRIMIDINE N1′ ATOMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemeria, Natalia S; Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy

2010-11-03

Kinetic, spectroscopic, and structural analysis tested the hypothesis that a chain of residues connecting the 4{prime}-aminopyrimidine N1{prime} atoms of thiamin diphosphates (ThDPs) in the two active centers of the Escherichia coli pyruvate dehydrogenase complex E1 component provides a signal transduction pathway. Substitution of the three acidic residues (Glu{sup 571}, Glu{sup 235}, and Glu{sup 237}) and Arg{sup 606} resulted in impaired binding of the second ThDP, once the first active center was filled, suggesting a pathway for communication between the two ThDPs. (1) Steady-state kinetic and fluorescence quenching studies revealed that upon E571A, E235A, E237A, and R606A substitutions, ThDP binding inmore » the second active center was affected. (2) Analysis of the kinetics of thiazolium C2 hydrogen/deuterium exchange of enzyme-bound ThDP suggests half-of-the-sites reactivity for the E1 component, with fast (activated site) and slow exchanging sites (dormant site). The E235A and E571A variants gave no evidence for the slow exchanging site, indicating that only one of two active sites is filled with ThDP. (3) Titration of the E235A and E237A variants with methyl acetylphosphonate monitored by circular dichroism suggested that only half of the active sites were filled with a covalent predecarboxylation intermediate analog. (4) Crystal structures of E235A and E571A in complex with ThDP revealed the structural basis for the spectroscopic and kinetic observations and showed that either substitution affects cofactor binding, despite the fact that Glu{sup 235} makes no direct contact with the cofactor. The role of the conserved Glu{sup 571} residue in both catalysis and cofactor orientation is revealed by the combined results for the first time.« less

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Identification and clarification of the role of key active site residues in bacterial glutathione S-transferase zeta/maleylpyruvate isomerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Ti; Li, De-Feng; Zhou, Ning-Yi, E-mail: n.zhou@pentium.whiov.ac.cn

2011-07-08

Highlights: {yields} Application of site-directed mutagenesis to probe the active site residues of glutathione-dependent maleylpyruvate isomerase. {yields} Two conserved residues, Arg8 and Arg176, in zeta class glutathione S-transferases are critical for maleylpyruvate orientation and enolization. {yields} Arg109, found exclusively in NagL, participates in k{sub cat} regulation. {yields} The T11A mutant exhibited a significantly decreased K{sub m} value for glutathione with little impact on maleylpyruvate kinetics. {yields} The Thr11 residue appears to have significance in the evolution of glutathione S-transferase classes. -- Abstract: The maleylpyruvate isomerase NagL from Ralstonia sp. strain U2, which has been structurally characterized previously, catalyzes the isomerizationmore » of maleylpyruvate to fumarylpyruvate. It belongs to the class zeta glutathione S-transferases (GSTZs), part of the cytosolic GST family (cGSTs). In this study, site-directed mutagenesis was conducted to probe the functions of 13 putative active site residues. Steady-state kinetic information for mutants in the reduced glutathione (GSH) binding site, suggested that (a) Gln64 and Asp102 interact directly with the glutamyl moiety of glutathione, (b) Gln49 and Gln64 are involved in a potential electron-sharing network that influences the ionization of the GSH thiol. The information also suggests that (c) His38, Asn108 and Arg109 interact with the GSH glycine moiety, (d) His104 has a role in the ionization of the GSH sulfur and the stabilization of the maleyl terminal carboxyl group in the reaction intermediate and (e) Arg110 influences the electron distribution in the active site and therefore the ionization of the GSH thiolate. Kinetic data for mutants altered in the substrate-binding site imply that (a) Arg8 and Arg176 are critical for maleylpyruvate orientation and enolization, and (b) Arg109 (exclusive to NagL) participates in k{sub cat} regulation. Surprisingly, the T11A mutant had a decreased GSH K{sub m} value, whereas little impact on maleylpyruvate kinetics was observed, suggesting that this residue plays an important role in GSH binding. An evolutionary trend in this residue appears to have developed not only in prokaryotic and eukaryotic GSTZs, but also among the wider class of cGSTs.« less

Fluorescence Immunofiltration Assay of Brucella Melitensis.

DTIC Science & Technology

1995-01-01

second urease -labelled antibody directed against fluorescein. The assay system is useful for measuring protein, virus and bacteria in aqueous...binding site for the signal-generating urease -labelled antibody, it is a highly fluorescent molecule and has signal-generating capacity of its own

The mechanistic basis for noncompetitive ibogaine inhibition of serotonin and dopamine transporters.

PubMed

Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter

2012-05-25

Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study.

The Mechanistic Basis for Noncompetitive Ibogaine Inhibition of Serotonin and Dopamine Transporters*

PubMed Central

Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W.; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter

2012-01-01

Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study. PMID:22451652

Identification of the components of a glycolytic enzyme metabolon on the human red blood cell membrane.

PubMed

Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J; Galan, Jacob A; Tao, W Andy; Low, Philip S

2013-01-11

Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as "label transfer" that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction.

Identification of the Components of a Glycolytic Enzyme Metabolon on the Human Red Blood Cell Membrane*

PubMed Central

Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J.; Galan, Jacob A.; Tao, W. Andy; Low, Philip S.

2013-01-01

Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as “label transfer” that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction. PMID:23150667

Selective inhibition of CTCF binding by iAs directs TET-mediated reprogramming of 5-hydroxymethylation patterns in iAs-transformed cells

PubMed Central

Rea, Matthew; Gripshover, Tyler; Fondufe-Mittendorf, Yvonne

2017-01-01

Methylation at cytosine (5mC) is a fundamental epigenetic DNA modification recently associated with iAs-mediated carcinogenesis. In contrast, the role of 5-hydroxymethylcytosine (5hmC), the oxidation product of 5mC in iAs-mediated carcinogenesis is unknown. Here we assess the hydroxymethylome in iAs-transformed cells, showing that dynamic modulation of hydroxymethylated DNA is associated with specific transcriptional networks. Moreover, this pathologic iAs-mediated carcinogenesis is characterized by a shift toward a higher hydroxymethylation pattern genome-wide. At specific promoters, hydroxymethylation correlated with increased gene expression. Furthermore, this increase in hydroxymethylation occurs concurrently with an upregulation of ten-eleven translocation (TET) enzymes that oxidize 5-methylcytosine (5mC) in DNA. To gain an understanding into how iAs might impact TET expression, we found that iAs inhibits the binding of CTCF at the proximal, weak CTCF binding sites of the TET1 and TET2 gene promoters and enhances CTCF binding at the stronger distal binding site. Further analyses suggest that this distal site acts as an enhancer, thus high CTCF occupancy at the enhancer region of TET1 and TET2 possibly drives their high expression in iAs-transformed cells. These results have major implications in understanding the impact of differential CTCF binding, genome architecture and its consequences in iAs-mediated pathogenesis. PMID:29175454

Analysis of zinc binding sites in protein crystal structures.

PubMed

Alberts, I L; Nadassy, K; Wodak, S J

1998-08-01

The geometrical properties of zinc binding sites in a dataset of high quality protein crystal structures deposited in the Protein Data Bank have been examined to identify important differences between zinc sites that are directly involved in catalysis and those that play a structural role. Coordination angles in the zinc primary coordination sphere are compared with ideal values for each coordination geometry, and zinc coordination distances are compared with those in small zinc complexes from the Cambridge Structural Database as a guide of expected trends. We find that distances and angles in the primary coordination sphere are in general close to the expected (or ideal) values. Deviations occur primarily for oxygen coordinating atoms and are found to be mainly due to H-bonding of the oxygen coordinating ligand to protein residues, bidentate binding arrangements, and multi-zinc sites. We find that H-bonding of oxygen containing residues (or water) to zinc bound histidines is almost universal in our dataset and defines the elec-His-Zn motif. Analysis of the stereochemistry shows that carboxyl elec-His-Zn motifs are geometrically rigid, while water elec-His-Zn motifs show the most geometrical variation. As catalytic motifs have a higher proportion of carboxyl elec atoms than structural motifs, they provide a more rigid framework for zinc binding. This is understood biologically, as a small distortion in the zinc position in an enzyme can have serious consequences on the enzymatic reaction. We also analyze the sequence pattern of the zinc ligands and residues that provide elecs, and identify conserved hydrophobic residues in the endopeptidases that also appear to contribute to stabilizing the catalytic zinc site. A zinc binding template in protein crystal structures is derived from these observations.

Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

PubMed

Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

2014-01-01

Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

Linking CO 2 Sorption Performance to Polymer Morphology in Aminopolymer/Silica Composites through Neutron Scattering

DOE PAGES

Holewinski, Adam; Sakwa-Novak, Miles A.; Jones, Christopher W.

2015-08-26

Composites of poly(ethylenimine) (PEI) and mesoporous silica are effective, reversible adsorbents for CO 2, both from flue gas and in direct air-capture applications. The morphology of the PEI within the silica can strongly impact the overall carbon capture efficiency and rate of saturation. Here, we directly probe the spatial distribution of the supported polymer through small-angle neutron scattering (SANS). Combined with textural characterization from physisorption analysis, the data indicate that PEI first forms a thin conformal coating on the pore walls, but all additional polymer aggregates into plug(s) that grow along the pore axis. This model is consistent with observedmore » trends in amine-efficiency (CO 2/N binding ratio) and pore size distributions, and points to a trade-off between achieving high chemical accessibility of the amine binding sites, which are inaccessible when they strongly interact with the silica, and high accessibility for mass transport, which can be hampered by diffusion through PEI plugs. In conclusion, we illustrate this design principle by demonstrating higher CO 2 capacity and uptake rate for PEI supported in a hydrophobically modified silica, which exhibits repulsive interactions with the PEI, freeing up binding sites.« less

ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells

PubMed Central

Seitz, Patrick; Pezeshgi Modarres, Hassan; Borgeaud, Sandrine; Bulushev, Roman D.; Steinbock, Lorenz J.; Radenovic, Aleksandra; Dal Peraro, Matteo; Blokesch, Melanie

2014-01-01

The DNA uptake of naturally competent bacteria has been attributed to the action of DNA uptake machineries resembling type IV pilus complexes. However, the protein(s) for pulling the DNA across the outer membrane of Gram-negative bacteria remain speculative. Here we show that the competence protein ComEA binds incoming DNA in the periplasm of naturally competent Vibrio cholerae cells thereby promoting DNA uptake, possibly through ratcheting and entropic forces associated with ComEA binding. Using comparative modeling and molecular simulations, we projected the 3D structure and DNA-binding site of ComEA. These in silico predictions, combined with in vivo and in vitro validations of wild-type and site-directed modified variants of ComEA, suggested that ComEA is not solely a DNA receptor protein but plays a direct role in the DNA uptake process. Furthermore, we uncovered that ComEA homologs of other bacteria (both Gram-positive and Gram-negative) efficiently compensated for the absence of ComEA in V. cholerae, suggesting that the contribution of ComEA in the DNA uptake process might be conserved among naturally competent bacteria. PMID:24391524

Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface*

PubMed Central

Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

2016-01-01

Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. PMID:26912659

Structure of a Yeast Dyn2-Nup159 Complex and Molecular Basis for Dynein Light Chain-Nuclear Pore Interaction*

PubMed Central

Romes, Erin M.; Tripathy, Ashutosh; Slep, Kevin C.

2012-01-01

The nuclear pore complex gates nucleocytoplasmic transport through a massive, eight-fold symmetric channel capped by a nucleoplasmic basket and structurally unique, cytoplasmic fibrils whose tentacles bind and regulate asymmetric traffic. The conserved Nup82 complex, composed of Nsp1, Nup82, and Nup159, forms the unique cytoplasmic fibrils that regulate mRNA nuclear export. Although the nuclear pore complex plays a fundamental, conserved role in nuclear trafficking, structural information about the cytoplasmic fibrils is limited. Here, we investigate the structural and biochemical interactions between Saccharomyces cerevisiae Nup159 and the nucleoporin, Dyn2. We find that Dyn2 is predominantly a homodimer and binds arrayed sites on Nup159, promoting the Nup159 parallel homodimerization. We present the first structure of Dyn2, determined at 1.85 Å resolution, complexed with a Nup159 target peptide. Dyn2 resembles homologous metazoan dynein light chains, forming homodimeric composite substrate binding sites that engage two independent 10-residue target motifs, imparting a β-strand structure to each peptide via antiparallel extension of the Dyn2 core β-sandwich. Dyn2 recognizes a highly conserved QT motif while allowing sequence plasticity in the flanking residues of the peptide. Isothermal titration calorimetric analysis of the comparative binding of Dyn2 to two Nup159 target sites shows similar affinities (18 and 13 μm), but divergent thermal binding modes. Dyn2 homodimers are arrayed in the crystal lattice, likely mimicking the arrayed architecture of Dyn2 on the Nup159 multivalent binding sites. Crystallographic interdimer interactions potentially reflect a cooperative basis for Dyn2-Nup159 complex formation. Our data highlight the determinants that mediate oligomerization of the Nup82 complex and promote a directed, elongated cytoplasmic fibril architecture. PMID:22411995

Low-temperature binding of NO adsorbed on MIL-100(Al)-A case study for the application of high resolution pulsed EPR methods and DFT calculations.

PubMed

Mendt, Matthias; Barth, Benjamin; Hartmann, Martin; Pöppl, Andreas

2017-12-14

The low-temperature binding of nitric oxide (NO) in the metal-organic framework MIL-100(Al) has been investigated by pulsed electron nuclear double resonance and hyperfine sublevel correlation spectroscopy. Three NO adsorption species have been identified. Among them, one species has been verified experimentally to bind directly to an 27 Al atom and all its relevant 14 N and 27 Al hyperfine interaction parameters have been determined spectroscopically. Those parameters fit well to the calculated ones of a theoretical cluster model, which was derived by density functional theory (DFT) in the present work and describes the low temperature binding of NO to the regular coordinatively unsaturated Al 3+ site of the MIL-100(Al) structure. As a result, the Lewis acidity of that site has been characterized using the NO molecule as an electron paramagnetic resonance active probe. The DFT derived wave function analysis revealed a bent end-on coordination of the NO molecule adsorbed at that site which is almost purely ionic and has a weak binding energy. The calculated flat potential energy surface of this species indicates the ability of the NO molecule to freely rotate at intermediate temperatures while it is still binding to the Al 3+ site. For the other two NO adsorption species, no structural models could be derived, but one of them is indicated to be adsorbed at the organic part of the metal-organic framework. Hyperfine interactions with protons, weakly coupled to the observed NO adsorption species, have also been measured by pulsed electron paramagnetic resonance and found to be consistent with their attribution to protons of the MIL-100(Al) benzenetricarboxylate ligand molecules.

Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

PubMed Central

Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

2009-01-01

Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation.

PubMed

Chan, Siew Wee; Lim, Chun Jye; Guo, Fusheng; Tan, Ivan; Leung, Thomas; Hong, Wanjin

2013-12-27

Whether the Hippo pathway has downstream targets other than YAP and TAZ is unknown. In this report, we have identified angiomotin (Amot) family members as novel substrates of Hippo core kinases. The N-terminal regions of Amot proteins contain a conserved HXRXXS consensus site for LATS1/2-mediated phosphorylation. Phospho-specific antibodies showed that Hippo core kinases could mediate phosphorylation of endogenous as well as exogenous Amot family members. Knockdown of LATS1 and LATS2 endogenously reduced the phosphorylation of Amots detected by the phospho-specific antibodies. Mutation of the serine to alanine within this HXRXXS site in Amot and AmotL2 established that this site was essential for Hippo core kinase-mediated phosphorylation. Wild-type and non-phosphorylated Amot (Amot-S175A) were targeted to actin filaments, whereas phospho-mimic Amot (Amot-S175D) failed to be localized with actin. Overexpression of LATS2 caused dissociation of Amot from actin but not Amot-S175A. Mapping of the actin-binding site of Amot showed that serine 175 of Amot was important for the actin-binding activity. Amot-S175A promoted, whereas Amot and Amot-S175D inhibited, cell proliferation. These results collectively suggest that the Hippo pathway negatively regulates the actin-binding activity of Amot family members through direct phosphorylation.

Requirement for transient metal ions revealed through computational analysis for DNA polymerase going in reverse

PubMed Central

Perera, Lalith; Freudenthal, Bret D.; Beard, William A.; Shock, David D.; Pedersen, Lee G.; Wilson, Samuel H.

2015-01-01

DNA polymerases facilitate faithful insertion of nucleotides, a central reaction occurring during DNA replication and repair. DNA synthesis (forward reaction) is “balanced,” as dictated by the chemical equilibrium by the reverse reaction of pyrophosphorolysis. Two closely spaced divalent metal ions (catalytic and nucleotide-binding metals) provide the scaffold for these reactions. The catalytic metal lowers the pKa of O3′ of the growing primer terminus, and the nucleotide-binding metal facilitates substrate binding. Recent time-lapse crystallographic studies of DNA polymerases have identified an additional metal ion (product metal) associated with pyrophosphate formation, leading to the suggestion of its possible involvement in the reverse reaction. Here, we establish a rationale for a role of the product metal using quantum mechanical/molecular mechanical calculations of the reverse reaction in the confines of the DNA polymerase β active site. Additionally, site-directed mutagenesis identifies essential residues and metal-binding sites necessary for pyrophosphorolysis. The results indicate that the catalytic metal site must be occupied by a magnesium ion for pyrophosphorolysis to occur. Critically, the product metal site is occupied by a magnesium ion early in the pyrophosphorolysis reaction path but must be removed later. The proposed dynamic nature of the active site metal ions is consistent with crystallographic structures. The transition barrier for pyrophosphorolysis was estimated to be significantly higher than that for the forward reaction, consistent with kinetic activity measurements of the respective reactions. These observations provide a framework to understand how ions and active site changes could modulate the internal chemical equilibrium of a reaction that is central to genome stability. PMID:26351676

Using mass spectrometry to study the photo-affinity labeling of protein tyrosine phosphatase 1B

NASA Astrophysics Data System (ADS)

Leriche, Tammy; Skorey, Kathryn; Roy, Patrick; McKay, Dan; Bateman, Kevin P.

2004-11-01

Protein tyrosine phosphatase 1B (PTP1B) is a potential target for the treatment of Type II diabetes and several companies are developing small molecule inhibitors of this enzyme. Part of the characterization of these compounds as PTP1B inhibitors is the understanding of how they bind in the enzyme active site. The use of photo-activated inhibitors that target the active site can provide such insight. This paper describes the characterization of a photoprobe directed at the active site of PTP1B. Mass spectrometry revealed the specific binding of the probe to the intact protein. Digestion of the labeled protein followed by LC-MS and LC-MS/MS was used to show that the photoprobe binds to a specific active site amino acid. This was confirmed by comparison with the X-ray structure of PTP1B with a PTP1B inhibitor. The probe labels a conserved acidic residue (Asp) that is required for catalytic activity. This photoprobe may prove to be a useful tool for the development of a PTP1B inhibitor or for the study of PTPs in general.

Site-directed immobilization of a genetically engineered anti-methotrexate antibody via an enzymatically introduced biotin label significantly increases the binding capacity of immunoaffinity columns.

PubMed

Davenport, Kaitlynn R; Smith, Christopher A; Hofstetter, Heike; Horn, James R; Hofstetter, Oliver

2016-05-15

In this study, the effect of random vs. site-directed immobilization techniques on the performance of antibody-based HPLC columns was investigated using a single-domain camelid antibody (VHH) directed against methotrexate (MTX) as a model system. First, the high flow-through support material POROS-OH was activated with disuccinimidyl carbonate (DSC), and the VHH was bound in a random manner via amines located on the protein's surface. The resulting column was characterized by Frontal Affinity Chromatography (FAC). Then, two site-directed techniques were explored to increase column efficiency by immobilizing the antibody via its C-terminus, i.e., away from the antigen-binding site. In one approach, a tetra-lysine tail was added, and the antibody was immobilized onto DSC-activated POROS. In the second site-directed approach, the VHH was modified with the AviTag peptide, and a biotin-residue was enzymatically incorporated at the C-terminus using the biotin ligase BirA. The biotinylated antibody was subsequently immobilized onto NeutrAvidin-derivatized POROS. A comparison of the FAC analyses, which for all three columns showed excellent linearity (R(2)>0.999), revealed that both site-directed approaches yield better results than the random immobilization; the by far highest efficiency, however, was determined for the immunoaffinity column based on AviTag-biotinylated antibody. As proof of concept, all three columns were evaluated for quantification of MTX dissolved in phosphate buffered saline (PBS). Validation using UV-detection showed excellent linearity in the range of 0.04-12μM (R(2)>0.993). The lower limit of detection (LOD) and lower limit of quantification (LLOQ) were found to be independent of the immobilization strategy and were 40nM and 132nM, respectively. The intra- and inter-day precision was below 11.6%, and accuracy was between 90.7% and 112%. To the best of our knowledge, this is the first report of the AviTag-system in chromatography, and the first application of immunoaffinity chromatography for the analysis of MTX. Copyright © 2016 Elsevier B.V. All rights reserved.

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria

PubMed Central

Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej

2011-01-01

HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

The influence of repressor DNA binding site architecture on transcriptional control.

PubMed

Park, Dan M; Kiley, Patricia J

2014-08-26

How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

The T160A hemagglutinin substitution affects not only receptor binding property but also transmissibility of H5N1 clade 2.3.4 avian influenza virus in guinea pigs.

PubMed

Gu, Min; Li, Qunhui; Gao, Ruyi; He, Dongchang; Xu, Yunpeng; Xu, Haixu; Xu, Lijun; Wang, Xiaoquan; Hu, Jiao; Liu, Xiaowen; Hu, Shunlin; Peng, Daxin; Jiao, Xinan; Liu, Xiufan

2017-02-06

We generated and characterized site-directed HA mutants on the genetic backbone of H5N1 clade 2.3.4 virus preferentially binding to α-2,3 receptors in order to identify the key determinants in hemagglutinin rendering the dual affinity to both α-2,3 (avian-type) and α-2,6 (human-type) linked sialic acid receptors of the current clade 2.3.4.4 H5NX subtype avian influenza reassortants. The results show that the T160A substitution resulted in the loss of a glycosylation site at 158N and led not only to enhanced binding specificity for human-type receptors but also transmissibility among guinea pigs, which could be considered as an important molecular marker for assessing pandemic potential of H5 subtype avian influenza isolates.

Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

PubMed

Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

2007-11-02

The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

Interactions of a Pop5/Rpp1 heterodimer with the catalytic domain of RNase MRP.

PubMed

Perederina, Anna; Khanova, Elena; Quan, Chao; Berezin, Igor; Esakova, Olga; Krasilnikov, Andrey S

2011-10-01

Ribonuclease (RNase) MRP is a multicomponent ribonucleoprotein complex closely related to RNase P. RNase MRP and eukaryotic RNase P share most of their protein components, as well as multiple features of their catalytic RNA moieties, but have distinct substrate specificities. While RNase P is practically universally found in all three domains of life, RNase MRP is essential in eukaryotes. The structural organizations of eukaryotic RNase P and RNase MRP are poorly understood. Here, we show that Pop5 and Rpp1, protein components found in both RNase P and RNase MRP, form a heterodimer that binds directly to the conserved area of the putative catalytic domain of RNase MRP RNA. The Pop5/Rpp1 binding site corresponds to the protein binding site in bacterial RNase P RNA. Structural and evolutionary roles of the Pop5/Rpp1 heterodimer in RNases P and MRP are discussed.

Interactions of a Pop5/Rpp1 heterodimer with the catalytic domain of RNase MRP

PubMed Central

Perederina, Anna; Khanova, Elena; Quan, Chao; Berezin, Igor; Esakova, Olga; Krasilnikov, Andrey S.

2011-01-01

Ribonuclease (RNase) MRP is a multicomponent ribonucleoprotein complex closely related to RNase P. RNase MRP and eukaryotic RNase P share most of their protein components, as well as multiple features of their catalytic RNA moieties, but have distinct substrate specificities. While RNase P is practically universally found in all three domains of life, RNase MRP is essential in eukaryotes. The structural organizations of eukaryotic RNase P and RNase MRP are poorly understood. Here, we show that Pop5 and Rpp1, protein components found in both RNase P and RNase MRP, form a heterodimer that binds directly to the conserved area of the putative catalytic domain of RNase MRP RNA. The Pop5/Rpp1 binding site corresponds to the protein binding site in bacterial RNase P RNA. Structural and evolutionary roles of the Pop5/Rpp1 heterodimer in RNases P and MRP are discussed. PMID:21878546

The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

PubMed Central

Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

2015-01-01

Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Photoaffinity labelling and solubilization on the central 5-HT1A receptor binding site.

PubMed

Gozlan, H; Emerit, M B; el Mestikawy, S; Cossery, J M; Marquet, A; Besselievre, R; Hamon, M

1987-01-01

Two complementary approaches, covalent labelling and solubilization, have been used to study the biochemical properties of the central 5-HT1A receptor binding site. We have first designed a photoaffinity ligand containing the structure of 8-OH-DPAT, a potent and specific agonist of 5-HT1A sites. Thus, 8-methoxy-2[N-n-propyl,N-3-(2-nitro-4-azido-phenyl)- aminopropyl]aminotetralin or 8-methoxy-3'-NAP-amino-PAT, was found to displace, in the dark, [3H]8-OH-DPAT from 5-HT1A sites in rat hippocampal membranes with an IC50 of 6.6 nM. Under two cumulative UV irradiations (366 nm, for 20 min at 4 degrees C), 8-methoxy-3-'-NAP-amino-PAT (30 nM) blocked irreversibly 55-60% of 5-HT1A binding sites. This blockade was specific of 5-HT1A sites since the other serotoninergic sites, 5-HT1B, 5-HT2 and also the presynaptic 5-HT3 sites were not affected by the treatment. In addition, the binding of [3H]Spiperone and [3H]7-OH-DPAT to striatal dopamine sites remained unchanged under similar photolysis conditions. The tritiated derivative of the photoaffinity ligand (92 Ci/mmol) was then synthesized for the identification of the covalently bound protein(s). SDS-PAGE of solubilized membranes irradiated in the presence of 20 nM 3H-8-methoxy-3'-NAP-amino-PAT allowed the detection of a 63 kD protein whose labelling appeared specific. Thus, 3H-incorporation into the 63 kD band could be prevented by microM concentrations of 5-HT, 8-OH-DPAT and other selective 5-HT1A ligands such as isapirone. In contrast, the 5-HT2 antagonist ketanserin, norepinephrine and dopamine-related ligands (including 7-OH-DPAT) were ineffective. Direct solubilization of 5-HT1A receptor binding sites was also attempted from rat hippocampal membranes. The best results were obtained using CHAPS (10 mM) plus NaCl (0.2 M), which led to 50% recovery of 5-HT1A sites in the 100,000 g supernatant. The pharmacological properties and sensitivity to N-ethyl-maleimide and GppNHp of soluble sites appeared near identical to those of membrane-bound 5-HT1A sites.

In brain, Axl recruits Grb2 and the p85 regulatory subunit of Pl3 kinase; in vitro mutagenesis defines th requisite binding sites for downstream Akt activation

PubMed Central

Weinger, Jason G.; Gohari, Pouyan; Yan, Ying; Backer, Jonathan M.; Varnum, Brian; Shafit-Zagardo, Bridget

2010-01-01

Axl is a receptor tyrosine kinase implicated in cell survival following growth factor withdrawal and other stressors. The binding of Axl's ligand, growth arrest-specific protein 6 (Gas6), results in Axl autophosphorylation, recruitment of signaling molecules, and activation of downstream survival pathways. Pull-down assays and immunoprecipitations using wildtype and mutant Axl transfected cells determined that Axl directly binds growth factor receptor-bound protein 2 (Grb2) at pYVN and the p85 subunit of phosphatidylinositol-3 kinase (PI3 kinase) at two pYXXM sites (pY779 and pY821). Also, p85 can indirectly bind to Axl via an interaction between p85's second proline-rich region and the N-terminal SH3 domain of Grb2. Further, Grb2 and p85 can compete for binding at the pY821VNM site. Gas6-stimulation of Axl-transfected COS7 cells recruited activated PI3 kinase and phosphorylated Akt. An interaction between Axl, p85 and Grb2 was confirmed in brain homogenates, enriched populations of O4+ oligodendrocytes, and O4– flow-through prepared from day 10 mouse brain, indicating that cells with active Gas6/Axl signal through Grb2 and the PI3 kinase/Akt pathways. PMID:18346204

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Molecular Mechanism of Action for Allosteric Modulators and Agonists in CC-chemokine Receptor 5 (CCR5).

PubMed

Karlshøj, Stefanie; Amarandi, Roxana Maria; Larsen, Olav; Daugvilaite, Viktorija; Steen, Anne; Brvar, Matjaž; Pui, Aurel; Frimurer, Thomas Michael; Ulven, Trond; Rosenkilde, Mette Marie

2016-12-23

The small molecule metal ion chelators bipyridine and terpyridine complexed with Zn 2+ (ZnBip and ZnTerp) act as CCR5 agonists and strong positive allosteric modulators of CCL3 binding to CCR5, weak modulators of CCL4 binding, and competitors for CCL5 binding. Here we describe their binding site using computational modeling, binding, and functional studies on WT and mutated CCR5. The metal ion Zn 2+ is anchored to the chemokine receptor-conserved Glu-283 VII:06/7.39 Both chelators interact with aromatic residues in the transmembrane receptor domain. The additional pyridine ring of ZnTerp binds deeply in the major binding pocket and, in contrast to ZnBip, interacts directly with the Trp-248 VI:13/6.48 microswitch, contributing to its 8-fold higher potency. The impact of Trp-248 was further confirmed by ZnClTerp, a chloro-substituted version of ZnTerp that showed no inherent agonism but maintained positive allosteric modulation of CCL3 binding. Despite a similar overall binding mode of all three metal ion chelator complexes, the pyridine ring of ZnClTerp blocks the conformational switch of Trp-248 required for receptor activation, thereby explaining its lack of activity. Importantly, ZnClTerp becomes agonist to the same extent as ZnTerp upon Ala mutation of Ile-116 III:16/3.40 , a residue that constrains the Trp-248 microswitch in its inactive conformation. Binding studies with 125 I-CCL3 revealed an allosteric interface between the chemokine and the small molecule binding site, including residues Tyr-37 I:07/1.39 , Trp-86 II:20/2.60 , and Phe-109 III:09/3.33 The small molecules and CCL3 approach this interface from opposite directions, with some residues being mutually exploited. This study provides new insight into the molecular mechanism of CCR5 activation and paves the way for future allosteric drugs for chemokine receptors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Site-directed mutagenesis studies on the uridine monophosphate binding sites of feedback inhibition in carbamoyl phosphate synthetase and effects on cytidine production by Bacillus amyloliquefaciens.

PubMed

Fang, Haitian; Liu, Huiyan; Chen, Ning; Zhang, Chenglin; Xie, Xixian; Xu, Qingyang

2013-06-01

A major problem when pyrimidine de novo biosynthesis is used for cytidine production is the existence of many negative regulatory factors. Cytidine biosynthesis in Bacillus amyloliquefaciens proceeds via a pathway that is controlled by uridine monophosphate (UMP) through feedback inhibition of carbamoyl phosphate synthetase (CPS), the enzyme that converts CO2, NH3, and glutamine to carbamoyl phosphate. In this study, the gene carB encoding the large subunit of CPS from B. amyloliquefaciens CYT1 was site directed, and the UMP binding sites of feedback inhibition in Bam-CPS are described. The residues Thr-941, Thr-970, and Lys-986 in CPS from B. amyloliquefaciens were subjected to site-directed mutagenesis to alter UMP's feedback inhibition of CPS. To find feedback-resistant B. amyloliquefaciens, the influence of the T941F, T970A, K986I, T941F/K986I, and T941F/T970A/K986I mutations on CPS enzymatic properties was studied. The recombinant B. amyloliquefaciens with mutated T941F/K986I and T941F/T970A/K986I CPS showed a 3.7- and 5.7-fold increase, respectively, in cytidine production in comparison with the control expressing wild-type CPS, which was more suitable for further application of the cytidine synthesis. To a certain extent, the 5 mutations were found to release the enzyme from UMP inhibition and to improve B. amyloliquefaciens cytidine-producing strains.

The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.

PubMed

Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S

2000-07-01

OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like. This invention was made with Government support under Grant Contract No. AI-24695, awarded by the Department of health and Human Services, and under Grant Contract No. N 00014-87-K-0256, awarded by the Office of Naval Research. The Government has certain rights in this invention.

Discovering Small Molecule Inhibitors Targeted to Ligand-Stimulated RAGE-DIAPH1 Signaling Transduction

NASA Astrophysics Data System (ADS)

Pan, Jinhong

The receptor of advanced glycation end product (RAGE) is a multiligand receptor of the immunoglobulin superfamily of cell surface molecules, which plays an important role in immune responses. Full-length RAGE includes three extracellular immunoglobulin domains, a transmembrane domain and an intracellular domain. It is a pattern recognition receptor that can bind diverse ligands. NMR spectroscopy and x-ray crystallization studies of the extracellular domains of RAGE indicate that RAGE ligands bind by distinct charge- and hydrophobicity-dependent mechanisms. It is found that calgranulin binding to the C1C2 domain or AGEs binding to the V domain activates extracellular signaling, which triggers interactions of the RAGE cytoplasmic tail (ctRAGE) with intracellular effector, such as diaphanous 1 (DIAPH1), to initiate signal transduction cascades. ctRAGE is essential for RAGE-ligand-mediated signal transduction and consequent modulation of gene expression and cellular properties. RAGE is over-expressed in diseased tissues of most RAGE-associated pathogenic conditions, such as complications of Alzheimer's diseases, diabetes, vascular diseases, inflammation, cancers and neurodegeneration. They are the major diseases affecting a large population worldwide. RAGE can function as a biomarker or drug target for these diseases. The cytoplasmic tail of RAGE can be used as a drug target to inhibit RAGE-induced intracellular signaling by small molecule inhibitors to treat RAGE-associated diseases. We developed a high throughput screening assay with which we probed a small molecule library of 58,000 compounds to find that 777 small molecules displayed 50% inhibition and 97 compounds demonstrated dose-dependent inhibition of the binding of ctRAGE-DIAPH1. Eventually, there were 13 compounds which displayed dose-dependent inhibition of ctRAGE binding to DIAPH1 and direct binding to ctRAGE analyzed by 15N HSQC-NMR and native tryptophan fluorescence titration experiments; thus, they were identified as competitive inhibitors of ctRAGE interaction with DIAPH1. These compounds, which exhibit in vitro and in vivo inhibition of RAGE-dependent molecular processes, present attractive molecular scaffolds for the development of therapeutics against RAGE-induced diseases, and provide support for the feasibility of inhibition of protein-protein interaction (PPI). Among those 13 compounds, compounds 3, 4 and 11 with novel druggable structural features, strongly bound to ctRAGE with Kd values reaching to 18, 2 and 2 nM, respectively. There were 28 quinoline acetamide analogues of compound 11, and 20 carbazole/benzimidazole/indole 1,3-diamino-2-propanol analogues of compounds 3 and 4 were selected for SAR study by 15N-HSQC NMR. Native tryptophan fluorescence titration studies quantified the binding affinity and confirmed that tryptophan is involved in this interaction. The binding affinity tests found 19 compounds binding to ctRAGE with nanomolar binding affinities. They would be developed into lead compounds for in vitro and in vivo studies. The site directed mutagenesis was adopted to verify the interaction mode, in which the amino acid residues at the binding sites (Q3 and Q6) were knocked out individually and replaced with one alanine, resulting in weaker binding to the selective small molecule inhibitors across these knock-out sites. Therefore, it is confirmed that the amino acid residues of ctRAGE, Q3, and Q6, were involved in binding with R24, R102, R108, R 166, R167 and R208. Mutation modeling verified the established binding models for ctRAGE-R25 and ctRAGE-compound 3. Mapping the binding sites by NMR and CYANA calculation which established three-dimensional structure models of the ctRAGE-compound 3 complex and the ctRAGE-R25 complex, found the interactions between ctRAGE and compound 3 take place at W2, Q3 and Q6, while the interactions between ctRAGE and R25 take place W2, Q3, Q6 and E11. Their binding sites overlap the binding sites of ctRAGE-DIAPH1, which results that these two inhibitors bind to ctRAGE by replacing DIAPH1, and thus inhibit RAGE signaling.

An antibody reactive to the Gly63–Lys68 epitope of NT-proBNP exhibits O-glycosylation-independent binding

PubMed Central

Lee, Yujean; Kim, Hyori; Chung, Junho

2014-01-01

The N-terminal fragment of prohormone brain natriuretic peptide (NT-proBNP) is a commonly used biomarker for the diagnosis of congestive heart failure, although its biological function is not well known. NT-proBNP exhibits heavy O-linked glycosylation, and it is quite difficult to develop an antibody that exhibits glycosylation-independent binding. We developed an antibody that binds to the recombinant NT-proBNP protein and its deglycosylated form with similar affinities in an enzyme immunoassay. The epitope was defined as Gly63–Lys68 based on mimetic peptide screening, site-directed mutagenesis and a competition assay with a peptide mimotope. The nearest O-glycosylation residues are Thr58 and Thr71; therefore, four amino acid residues intervene between the epitope and those residues in both directions. In conclusion, we report that an antibody reactive to Gly63–Lys68 of NT-proBNP exhibits O-glycosylation-independent binding. PMID:25236766

Lis1 acts as a "clutch" between the ATPase and microtubule-binding domains of the dynein motor.

PubMed

Huang, Julie; Roberts, Anthony J; Leschziner, Andres E; Reck-Peterson, Samara L

2012-08-31

The lissencephaly protein Lis1 has been reported to regulate the mechanical behavior of cytoplasmic dynein, the primary minus-end-directed microtubule motor. However, the regulatory mechanism remains poorly understood. Here, we address this issue using purified proteins from Saccharomyces cerevisiae and a combination of techniques, including single-molecule imaging and single-particle electron microscopy. We show that rather than binding to the main ATPase site within dynein's AAA+ ring or its microtubule-binding stalk directly, Lis1 engages the interface between these elements. Lis1 causes individual dynein motors to remain attached to microtubules for extended periods, even during cycles of ATP hydrolysis that would canonically induce detachment. Thus, Lis1 operates like a "clutch" that prevents dynein's ATPase domain from transmitting a detachment signal to its track-binding domain. We discuss how these findings provide a conserved mechanism for dynein functions in living cells that require prolonged microtubule attachments. Copyright © 2012 Elsevier Inc. All rights reserved.

Lis1 Acts as a “Clutch” between the ATPase and Microtubule-Binding Domains of the Dynein Motor

PubMed Central

Huang, Julie; Roberts, Anthony J.; Leschziner, Andres E.; Reck-Peterson, Samara L.

2012-01-01

Summary The lissencephaly protein Lis1 has been reported to regulate the mechanical behavior of cytoplasmic dynein, the primary minus-end-directed microtubule motor. However, the regulatory mechanism remains poorly understood. Here, we address this issue using purified proteins from Saccharomyces cerevisiae and a combination of techniques, including single-molecule imaging and single-particle electron microscopy. We show that rather than binding to the main ATPase site within dynein's AAA+ ring or its microtubule-binding stalk directly, Lis1 engages the interface between these elements. Lis1 causes individual dynein motors to remain attached to microtubules for extended periods, even during cycles of ATP hydrolysis that would canonically induce detachment. Thus, Lis1 operates like a “clutch” that prevents dynein's ATPase domain from transmitting a detachment signal to its track-binding domain. We discuss how these findings provide a conserved mechanism for dynein functions in living cells that require prolonged microtubule attachments. PMID:22939623

Mutations in a CCHC zinc-binding motif of the reovirus sigma 3 protein decrease its intracellular stability.

PubMed Central

Mabrouk, T; Lemay, G

1994-01-01

It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527

Activation of Ftz-F1-Responsive Genes through Ftz/Ftz-F1 Dependent Enhancers

PubMed Central

Field, Amanda; Xiang, Jie; Anderson, W. Ray; Graham, Patricia; Pick, Leslie

2016-01-01

The orphan nuclear receptor Ftz-F1 is expressed in all somatic nuclei in Drosophila embryos, but mutations result in a pair-rule phenotype. This was explained by the interaction of Ftz-F1 with the homeodomain protein Ftz that is expressed in stripes in the primordia of segments missing in either ftz-f1 or ftz mutants. Ftz-F1 and Ftz were shown to physically interact and coordinately activate the expression of ftz itself and engrailed by synergistic binding to composite Ftz-F1/Ftz binding sites. However, attempts to identify additional target genes on the basis of Ftz-F1/ Ftz binding alone has met with only limited success. To discern rules for Ftz-F1 target site selection in vivo and to identify additional target genes, a microarray analysis was performed comparing wildtype and ftz-f1 mutant embryos. Ftz-F1-responsive genes most highly regulated included engrailed and nine additional genes expressed in patterns dependent on both ftz and ftz-f1. Candidate enhancers for these genes were identified by combining BDTNP Ftz ChIP-chip data with a computational search for Ftz-F1 binding sites. Of eight enhancer reporter genes tested in transgenic embryos, six generated expression patterns similar to the corresponding endogenous gene and expression was lost in ftz mutants. These studies identified a new set of Ftz-F1 targets, all of which are co-regulated by Ftz. Comparative analysis of enhancers containing Ftz/Ftz-F1 binding sites that were or were not bona fide targets in vivo suggested that GAF negatively regulates enhancers that contain Ftz/Ftz-F1 binding sites but are not actually utilized. These targets include other regulatory factors as well as genes involved directly in morphogenesis, providing insight into how pair-rule genes establish the body pattern. PMID:27723822

Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

PubMed

Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

2002-12-12

Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Herpes simplex virus glycoprotein D relocates nectin-1 from intercellular contacts

PubMed Central

Bhargava, Arjun K.; Rothlauf, Paul W.; Krummenacher, Claude

2016-01-01

Herpes simplex virus (HSV) uses the cell adhesion molecule nectin-1 as a receptor to enter neurons and epithelial cells. The viral glycoprotein D (gD) is used as a non-canonical ligand for nectin-1. The gD binding site on nectin-1 overlaps with a functional adhesive site involved in nectin-nectin homophilic trans-interaction. Consequently, when nectin-1 is engaged with a cellular ligand at cell junctions, the gD binding site is occupied. Here we report that HSV gD is able to disrupt intercellular homophilic trans-interaction of nectin-1 and induce a rapid redistribution of nectin-1 from cell junctions. This movement does not require the receptor’s interaction with the actin-binding adaptor afadin. Interaction of nectin-1 with afadin is also dispensable for virion surfing along nectin-1-rich filopodia. Cells seeded on gD-coated surfaces also fail to accumulate nectin-1 at cell contact. These data indicate that HSV gD affects nectin-1 locally through direct interaction and more globally through signaling. PMID:27723487

Crystal Structure of Cockroach Allergen Bla g 2, an Unusual Zinc Binding Aspartic Protease with a Novel Mode of Self-inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gustchina, Alla; Li, Mi; Wunschmann, Sabina

2010-07-19

The crystal structure of Bla g 2 was solved in order to investigate the structural basis for the allergenic properties of this unusual protein. This is the first structure of an aspartic protease in which conserved glycine residues, in two canonical DTG triads, are substituted by different amino acid residues. Another unprecedented feature revealed by the structure is the single phenylalanine residue insertion on the tip of the flap, with the side-chain occupying the S1 binding pocket. This and other important amino acid substitutions in the active site region of Bla g 2 modify the interactions in the vicinity ofmore » the catalytic aspartate residues, increasing the distance between them to {approx}4 {angstrom} and establishing unique direct contacts between the flap and the catalytic residues. We attribute the absence of substantial catalytic activity in Bla g 2 to these unusual features of the active site. Five disulfide bridges and a Zn-binding site confer stability to the protein, which may contribute to sensitization at lower levels of exposure than other allergens.« less

Mutations in Human Tubulin Proximal to the Kinesin-Binding Site Alter Dynamic Instability at Microtubule Plus- and Minus-Ends

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ti, Shih-Chieh; Pamula, Melissa C.; Howes, Stuart C.

The assembly of microtubule-based cellular structures depends on regulated tubulin polymerization and directional transport. In this research, we have purified and characterized tubulin heterodimers that have human β-tubulin isotype III (TUBB3), as well as heterodimers with one of two β-tubulin mutations (D417H or R262H). Both point mutations are proximal to the kinesin-binding site and have been linked to an ocular motility disorder in humans. Compared to wild-type, microtubules with these mutations have decreased catastrophe frequencies and increased average lifetimes of plus- and minus-end-stabilizing caps. Importantly, the D417H mutation does not alter microtubule lattice structure or Mal3 binding to growing filaments.more » Instead, this mutation reduces the affinity of tubulin for TOG domains and colchicine, suggesting that the distribution of tubulin heterodimer conformations is changed. Together, our findings reveal how residues on the surface of microtubules, distal from the GTP-hydrolysis site and inter-subunit contacts, can alter polymerization dynamics at the plus- and minus-ends of microtubules.« less

Herpes simplex virus glycoprotein D relocates nectin-1 from intercellular contacts.

PubMed

Bhargava, Arjun K; Rothlauf, Paul W; Krummenacher, Claude

2016-12-01

Herpes simplex virus (HSV) uses the cell adhesion molecule nectin-1 as a receptor to enter neurons and epithelial cells. The viral glycoprotein D (gD) is used as a non-canonical ligand for nectin-1. The gD binding site on nectin-1 overlaps with a functional adhesive site involved in nectin-nectin homophilic trans-interaction. Consequently, when nectin-1 is engaged with a cellular ligand at cell junctions, the gD binding site is occupied. Here we report that HSV gD is able to disrupt intercellular homophilic trans-interaction of nectin-1 and induce a rapid redistribution of nectin-1 from cell junctions. This movement does not require the receptor's interaction with the actin-binding adaptor afadin. Interaction of nectin-1 with afadin is also dispensable for virion surfing along nectin-1-rich filopodia. Cells seeded on gD-coated surfaces also fail to accumulate nectin-1 at cell contact. These data indicate that HSV gD affects nectin-1 locally through direct interaction and more globally through signaling. Copyright © 2016 Elsevier Inc. All rights reserved.

Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.

PubMed

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M

2014-01-07

The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Topography of the ISW2–nucleosome complex: insights into nucleosome spacing and chromatin remodeling

PubMed Central

Kagalwala, Mohamedi N; Glaus, Benjamin J; Dang, Weiwei; Zofall, Martin; Bartholomew, Blaine

2004-01-01

Linker DNA was found to be critical for the specific docking of ISW2 with nucleosomes as shown by mapping the physical contacts of ISW2 with nucleosomes at base-pair resolution. Hydroxyl radical footprinting revealed that ISW2 not only extensively interacts with the linker DNA, but also approaches the nucleosome from the side perpendicular to the axis of the DNA superhelix and contacts two disparate sites on the nucleosomal DNA from opposite sides of the superhelix. The topography of the ISW2–nucleosome was further delineated by finding which of the ISW2 subunits are proximal to specific sites within the linker and nucleosomal DNA regions by site-directed DNA photoaffinity labeling. Although ISW2 was shown to contact ∼63 bp of linker DNA, a minimum of 20 bp of linker DNA was required for stable binding of ISW2 to nucleosomes. The remaining ∼43 bp of flanking linker DNA promoted more efficient binding under competitive binding conditions and was functionally important for enhanced sliding of nucleosomes when ISW2 was significantly limiting. PMID:15131696