Sample records for direct colorimetric detection

  1. Polymeric assay film for direct colorimetric detection


    Charych, Deborah; Nagy, Jon; Spevak, Wayne


    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  2. Polymeric assay film for direct colorimetric detection


    Charych, Deborah; Nagy, Jon; Spevak, Wayne


    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  3. Sol-gel matrices for direct colorimetric detection of analytes


    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey


    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  4. Sol-Gel Matrices For Direct Colorimetric Detection Of Analytes


    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey


    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  5. Direct visualization of lead corona and its nanomolar colorimetric detection using anisotropic gold nanoparticles.


    Dwivedi, Charu; Chaudhary, Abhishek; Gupta, Abhishek; Nandi, Chayan K


    The study presents dithiothreitol (DTT) functionalized anisotropic gold nanoparticles (GNP) based colorimetric sensor for detection of toxic lead ions in water. Our results demonstrate the selectivity and sensitivity of the developed sensor over various heavy metal ions with detection limit of ∼9 nM. The mechanism of sensing is explained on the basis of unique corona formation around the DTT functionalized anisotropic GNP.

  6. Evaluation of Direct Colorimetric MTT Assay for Rapid Detection of Rifampicin and Isoniazid Resistance in Mycobacterium tuberculosis

    PubMed Central

    Woldemeskel, Dawit; Gessesse, Amare


    With the spread of multidrug-resistant tuberculosis (MDR-TB) strains there is an increasing need for new accurate and cost-effective methods for a rapid diagnostic and drug susceptibility testing (DST), particularly in low-income countries where tuberculosis is hyperendemic. A colorimetric assay using 3-(4, 5-dimethylthiazol-2-yl)-2, 5- diphenyltetrazolium bromide (MTT) has been suggested as a promising method for DST, especially to rifampicin. In this study, we standardized and evaluated the MTT assay for a rapid direct detection of rifampicin and isoniazid resistant Mycobacterium tuberculosis strains from sputum specimens using Lowenstein-Jensen (LJ) culture medium as a gold standard. The MTT assay sensitivity, specificity, positive and negative predictive values for rifampicin were 100%, 86%, 100%, 99%, respectively. For isoniazid, the MTT assay had a 100% sensitivity, specificity, positive and negative predictive values. Interestingly, the MTT assay gave interpretable results within two weeks for 94% of the samples compared to 7–14 weeks for LJ media. Overall, an excellent agreement was observed between MTT assay and LJ proportion method (Kappa, 0.91 for rifampicin and 1.00 for isoniazid). In conclusion, the direct colorimetric MTT assay simultaneously detects susceptible and resistant strains of M. tuberculosis within three weeks. It significantly shortens the time required to obtain a DST result and could be a reliable alternative method for rapid detection of drug-resistant TB strains in high-TB-burden resource-limited settings. PMID:28030634

  7. Label free colorimetric and fluorimetric direct detection of methylated DNA based on silver nanoclusters for cancer early diagnosis.


    Dadmehr, Mehdi; Hosseini, Morteza; Hosseinkhani, Saman; Ganjali, Mohammad Reza; Sheikhnejad, Reza


    Epigenetic changes such as DNA methylation of CpG islands located in the promoter region of some tumor suppressor genes are very common in human diseases such as cancer. Detection of aberrant methylation pattern could serve as an excellent diagnostic approach. Recently, the direct detection of methylated DNA sequences without using chemical and enzymatic treatments or antibodies has received great deal of attentions. In this study, we report a colorimetric and fluorimetric technique for direct detection of DNA methylation. Here, the DNA is being used as an effective template for fluorescent silver nanoclusters formation without any chemical modification or DNA labeling. The sensitivity test showed that upon the addition of target methylated DNA, the fluorescence intensity is decreased in a linear range when the concentration of methylated DNA has increased from 2.0×10(-9) to 6.3 ×10(-7) M with the detection limit of 9.4×10(-10) M. The optical and fluorescence spectral behaviors were highly reproducible and clearly discriminated between unmethylated, methylated and even partially methylated DNA in CpG rich sequences. The results were also reproducible when the human plasma was present in our assay system.

  8. A pH Indicator-linked Immunosorbent assay following direct amplification strategy for colorimetric detection of protein biomarkers.


    Shao, Fengying; Jiao, Lei; Miao, Luyang; Wei, Qin; Li, He


    A new pH indicator-linked immunosorbent assay (PILISA) reached pg/mL sensitivity based on pH indicator molecules loaded carbon nitride nanosheets as signal enhancer has been developed for colorimetric detection of protein biomarkers. As the secondary antibody binds to the carbon nitride nanosheets, the carbon nitride nanosheets and pH indicator complex as the signal amplification platform for colour change by detecting absorbance of pH indicator. The colour change was resulted from the releasing of pH indicator molecules from carbon nitride nanosheets triggered by alkali solution (AS). In this novel PILISA, the intensity absorbance of pH indicator is proportional to the concentration of the disease marker. The outstanding detection performance of the PILISA can be attributed to the following reasons: (1) ultrathin carbon nitride nanosheets with a larger surface area could adsorb abundant phenolphthalein (PP) molecules through hydrophobic interactions as well as the resulted PP anions can be free easily released into aqueous solution, leading to an obvious allochroic response; (2) the signal intensity is precisely determined by the amount of PP molecules loading onto the carbon nitride nanosheets surface, which ensures simple, low-cost and stable colorimetric detection. As expected, this new PILISA method offered an enzyme-free approach followed enzyme-linked immunosorbent assay format, which showed great promising potential as an innovative robust assay method for practical clinical applications.

  9. Incorporating gold nanoclusters and target-directed liposomes as a synergistic amplified colorimetric sensor for HER2-positive breast cancer cell detection

    PubMed Central

    Tao, Yu; Li, Mingqiang; Kim, Bumjun; Auguste, Debra T.


    Breast cancer is the second leading cause of cancer-related mortality in women. Successful development of sensitive nanoprobes for breast cancer cell detection is of great importance for breast cancer diagnosis and symptomatic treatment. Herein, inspired by the intrinsic peroxidase property of gold nanoclusters, high loading, and targeting ability of ErbB2/Her2 antibody functionalized liposomes, we report that gold nanoclusters-loaded, target-directed, functionalized liposomes can serve as a robust sensing platform for amplified colorimetric detection of HER2-positive breast cancer cells. This approach allows HER2-positive breast cancer cell identification at high sensitivity with high selectivity. In addition, the colorimetric “readout” offers extra advantages in terms of low-cost, portability, and easy-to-use applications. The practicality of this platform was further proved by successful detection of HER2-positive breast cancer cells in human serum samples and in breast cancer tissue, which indicated our proposed method has potential for application in cancer theranostics. PMID:28382162

  10. Emergency First Responders' Experience with Colorimetric Detection Methods

    SciTech Connect

    Sandra L. Fox; Keith A. Daum; Carla J. Miller; Marnie M. Cortez


    Nationwide, first responders from state and federal support teams respond to hazardous materials incidents, industrial chemical spills, and potential weapons of mass destruction (WMD) attacks. Although first responders have sophisticated chemical, biological, radiological, and explosive detectors available for assessment of the incident scene, simple colorimetric detectors have a role in response actions. The large number of colorimetric chemical detection methods available on the market can make the selection of the proper methods difficult. Although each detector has unique aspects to provide qualitative or quantitative data about the unknown chemicals present, not all detectors provide consistent, accurate, and reliable results. Included here, in a consumer-report-style format, we provide “boots on the ground” information directly from first responders about how well colorimetric chemical detection methods meet their needs in the field and how they procure these methods.

  11. Colorimetric Method for Beryllium Surface Contamination Detection

    SciTech Connect



    To address the need for real-time accurate total beryllium analyses, Savannah River Technology Center Analytical Development Section personnel evaluated and modified a colorimetric screening method developed at Los Alamos National Lab to measure beryllium on surfaces. This method was based on a color complex formed by beryllium and chromium azurol s . SRTC converted this visual method to a quantitative analysis method using spectrophotometric detection. The addition of a cationic surfactant (hexadecyltrimethylammonium bromide, CTAB) to the Be-CAS system shifted the complex absorbance away from the CAS absorbance and allowed for the detection. Assuming complete dissolution and a 10 mL rinse solution volume to remove the beryllium from the wipe, the detection limit was calculated comfortably below the free release limit. The spectrophotometric method was rugged and simple enough that it could be used as a field method.

  12. A colorimetric sensor array for detection of triacetone triperoxide vapor.


    Lin, Hengwei; Suslick, Kenneth S


    Triacetone triperoxide (TATP), one of the most dangerous primary explosives, has emerged as an explosive of choice for terrorists in recent years. Owing to the lack of UV absorbance, fluorescence, or facile ionization, TATP is extremely difficult to detect directly. Techniques that are able to detect generally require expensive instrumentation, need extensive sample preparation, or cannot detect TATP in the gas phase. Here we report a simple and highly sensitive colorimetric sensor for the detection of TATP vapor with semiquantitative analysis from 50 ppb to 10 ppm. By using a solid acid catalyst to pretreat a gas stream, we have discovered that a colorimetric sensor array of redox sensitive dyes can detect even very low levels of TATP vapor from its acid decomposition products (e.g., H(2)O(2)) with limits of detection (LOD) below 2 ppb (i.e., <0.02% of its saturation vapor pressure). Common potential interferences (e.g., humidity, personal hygiene products, perfume, laundry supplies, volatile organic compounds, etc.) do not generate an array response, and the array can also differentiate TATP from other chemical oxidants (e.g., hydrogen peroxide, bleach, tert-butylhydroperoxide, peracetic acid).

  13. Colorimetric detection of endogenous hydrogen sulfide production in living cells

    NASA Astrophysics Data System (ADS)

    Ahn, Yong Jin; Lee, Young Ju; Lee, Jaemyeon; Lee, Doyeon; Park, Hun-Kuk; Lee, Gi-Ja


    Hydrogen sulfide (H2S) has received great attention as a third gaseous signal transmitter, following nitric oxide and carbon monoxide. In particular, H2S plays an important role in the regulation of cancer cell biology. Therefore, the detection of endogenous H2S concentrations within biological systems can be helpful to understand the role of gasotransmitters in pathophysiology. Although a simple and inexpensive method for the detection of H2S has been developed, its direct and precise measurement in living cells remains a challenge. In this study, we introduced a simple, facile, and inexpensive colorimetric system for selective H2S detection in living cells using a silver-embedded Nafion/polyvinylpyrrolidone (PVP) membrane. This membrane could be easily applied onto a polystyrene microplate cover. First, we optimized the composition of the coating membrane, such as the PVP/Nafion mixing ratio and AgNO3 concentration, as well as the pH of the Na2S (H2S donor) solution and the reaction time. Next, the in vitro performance of a colorimetric detection assay utilizing the silver/Nafion/PVP membrane was evaluated utilizing a known concentration of Na2S standard solution both at room temperature and at 37 °C in a 5% CO2 incubator. As a result, the sensitivity of the colorimetric assay for H2S at 37 °C in the incubator (0.0056 Abs./μM Na2S, R2 = 0.9948) was similar to that at room temperature (0.0055 Abs./μM Na2S, R2 = 0.9967). Moreover, these assays were less sensitive to interference from compounds such as glutathione, L-cysteine (Cys), and dithiothreitol than to the H2S from Na2S. This assay based on the silver/Nafion/PVP membrane also showed excellent reproducibility (2.8% RSD). Finally, we successfully measured the endogenous H2S concentrations in live C6 glioma cells by s-(5‧-adenosyl)-L-methionine stimulation with and without Cys and L-homocysteine, utilizing the silver/Nafion/PVP membrane. In summary, colorimetric assays using silver

  14. Optical fiber waveguide sensor for the colorimetric detection of ammonia

    NASA Astrophysics Data System (ADS)

    Schmitt, Katrin; Rist, Jonas; Peter, Carolin; Wöllenstein, Jürgen


    We present the development and characterization of a fiber-optic colorimetric gas sensor combined with the electronic circuitry for measurement control and RFID communication. The gas sensor detects ammonia using a 300 μm polyolefin fiber coated with a gas-sensitive polymer film. The spectral and time-dependent sensitivity of various polymer films was tested in transmission measurements. Light from a standard LED at λ = 590 nm was coupled into the polyolefin fiber through the front face. A prototype of the gas sensor with the direct coupling method was tested under realistic measurement conditions, i.e. battery-driven and in a completely autonomous mode. The sensor system showed good sensitivity to the ammonia concentrations and response times in the order of minutes. The achievable power consumption was below 100μW.The films contained the pH-sensitive dyes bromocresol purple or bromophenol blue embedded in either ethyl cellulose or polyvinyl butyral, and optionally tributyl phosphate as plasticizer. The bromophenol blue based films showed a strong reaction to ammonia, with saturation concentrations around 1000 ppm and response times of about 15 seconds to 100ppm. The colorimetric reaction was simulated using a simple kinetic model which was in good agreement with the experimental results.

  15. The colorimetric detection and quantitation of total protein.


    Krohn, Randall I


    Protein quantification is an important step for handling protein samples for isolation and characterization; it is a prerequisite step before submitting proteins for chromatographic, electrophoretic, or immunochemical analysis and separation. Colorimetric methods are fast, simple, and not laborious. This unit describes a number of assays able to detect protein concentrations in the low microgram to milligram per milliliter ranges in a variety of formats.

  16. Colorimetric detection for paper-based biosensing applications

    NASA Astrophysics Data System (ADS)

    Brink, C.; Joubert, T.-H.


    Research on affordable point-of-care health diagnostics is rapidly advancing1. Colorimetric biosensor applications are typically qualitative, but recently the focus has been shifted to quantitative measurements2,3. Although numerous qualitative point-of-care (POC) health diagnostic devices are available, the challenge exists of developing a quantitative colorimetric array reader system that complies with the ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Equipment-free, Deliverable to end-users) principles of the World Health Organization4. This paper presents a battery powered 8-bit tonal resolution colorimetric sensor circuit for paper microfluidic assays using low cost photo-detection circuitry and a low-power LED light source. A colorimetric 3×3-pixel array reader was developed for rural environments where resources and personnel are limited. The device sports an ultralow-power E-ink paper display. The colorimetric device includes integrated GPS functionality and EEPROM memory to log measurements with geo-tags for possible analysis of regional trends. The device competes with colour intensity measurement techniques using smartphone cameras, but proves to be a cheaper solution, compensating for the typical performance variations between cameras of different brands of smartphones. Inexpensive methods for quantifying bacterial assays have been shown using desktop scanners, which are not portable, and cameras, which suffer severely from changes in ambient light in different environments. Promising colorimetric detection results have been demonstrated using devices such as video cameras5, digital colour analysers6, flatbed scanners7 or custom portable readers8. The major drawback of most of these methods is the need for specialized instrumentation and for image analysis on a computer.

  17. Colorimetric detection of uranium in water


    DeVol, Timothy A [Clemson, SC; Hixon, Amy E [Piedmont, SC; DiPrete, David P [Evans, GA


    Disclosed are methods, materials and systems that can be used to determine qualitatively or quantitatively the level of uranium contamination in water samples. Beneficially, disclosed systems are relatively simple and cost-effective. For example, disclosed systems can be utilized by consumers having little or no training in chemical analysis techniques. Methods generally include a concentration step and a complexation step. Uranium concentration can be carried out according to an extraction chromatographic process and complexation can chemically bind uranium with a detectable substance such that the formed substance is visually detectable. Methods can detect uranium contamination down to levels even below the MCL as established by the EPA.

  18. Colorimetric Integrated PCR Protocol for Rapid Detection of Vibrio parahaemolyticus

    PubMed Central

    Cheng, Kewen; Pan, Daodong; Teng, Jun; Yao, Li; Ye, Yingwang; Xue, Feng; Xia, Fan; Chen, Wei


    Rapid detection of pathogens is of great significance for food safety and disease diagnosis. A new colorimetric method for rapid and easy detection of Vibrio parahaemolyticus (V. parahaemolyticus or Vp) has been developed in this research. A specific sequence was designed and integrated with the forward primer for molecular detection of Vp. This specific sequence was tested and treated as the horseradish peroxidase (HRP)-mimicking DNAzyme and could be amplified during the polymerase chain reaction (PCR) process. The products of PCR including the sequence of HRP-mimicking DNAzyme could produce the distinguished color in the presence of catalysis substrates. The optical signal of the catalysis reaction, which is in a linear relationship with the initial template of Vp, could be determined with the naked eye or measured with Ultraviolet-visible (UV-vis) for qualitative and quantitative detections, respectively. Based on the optical signal intensity, rapid and easy detection of Vp was successfully achieved with satisfied sensitivity and specificity. Furthermore, the detection of tdh, trh, tlh and toxR virulence genes of two Vp species (Vp 33847 and Vp 17802) were all performed successfully with this developed colorimetric integrated PCR protocol, which demonstrated potential applicability for the rapid detection of other bacteria. PMID:27690041

  19. Colorimetric Detection and Identification of Natural and Artificial Sweeteners

    PubMed Central

    Musto, Christopher J.; Lim, Sung H.; Suslick, Kenneth S.


    A disposable, low-cost colorimetric sensor array has been created by pin-printing onto a hydrophilic membrane 16 chemically responsive nanoporous pigments made from indicators immobilized in an organically modified silane (ormosil). The array has been used to detect and identify 14 different natural and artificial sweeteners at millimolar concentrations as well as commonly used individual serving sweetener packets. The array has shown excellent reproducibility and long shelf-life and has been optimized to work in the biological pH regime. PMID:20337402

  20. Colorimetric detection and identification of natural and artificial sweeteners.


    Musto, Christopher J; Lim, Sung H; Suslick, Kenneth S


    A disposable, low-cost colorimetric sensor array has been created by pin-printing onto a hydrophilic membrane 16 chemically responsive nanoporous pigments that are comprised of indicators immobilized in an organically modified silane (ormosil). The array has been used to detect and identify 14 different natural and artificial sweeteners at millimolar concentrations, as well as commonly used individual-serving sweetener packets. The array has shown excellent reproducibility and long shelf life and has been optimized to work in the biological pH regime.

  1. Method for colorimetric detection of double-stranded nucleic acid using leuco triphenylmethane dyes.


    Miyamoto, Shigehiko; Sano, Sotaro; Takahashi, Koji; Jikihara, Takaaki


    Because loop-mediated isothermal amplification (LAMP) can amplify substantial amounts of DNA under isothermal conditions, its applications for simple genetic testing have attracted considerable attention. A positive LAMP reaction is indicated by the turbidity caused by by-products or by the color change after adding a metallochromic indicator to the reaction solution, but these methods have certain limitations. Leuco crystal violet (LCV), a colorless dye obtained after sodium sulfite treatment of crystal violet (CV), was used as a new colorimetric method for detecting LAMP. LCV is reconverted into CV through contact with double-stranded DNA (dsDNA). Therefore, the positive reaction of LAMP is indicated by color change from colorless to violet. The assay is sensitive enough to detect LAMP products, with a detection limit of 7.1 ng/μl for dsDNA. It is also highly selective to dsDNA, and interference with single-stranded DNA and deoxynucleotide triphosphates (dNTPs) is not observed. LCV facilitates direct colorimetric detection of the main product rather than a by-product of the LAMP reaction; therefore, this method can be used under various reaction conditions such as those with added pyrophosphatase in solution. This colorimetric LAMP detection method using LCV is useful for point-of-care genetic testing given its simplicity.

  2. Passive Leak Detection Using Commercial Hydrogen Colorimetric Indicator

    SciTech Connect

    Hartmann, Kevin; Buttner, William; Burgess, Robert; Rivkin, Carl


    Element One, Inc. (, a small business with in Boulder, CO, has been developing hydrogen detection technology based upon a highly selective colorimetric indicator. In its native state, the indicator pigment is a pale gray color, but becomes black upon exposure to hydrogen. The colorimetric change can be readily observed by the naked eye without the need for supplemental electronics or other hardware. Recently, the colorimetric indicator was integrated into a pliable, self-adhesive tape that can readily wrap around pneumatic fittings to serve as a hydrogen leak detector. A prototype version of the Element One indicator tape was tested within an NREL hydrogen system and successfully identified the unexpected presence of a small leak; a summary document for this case study is presented in Appendix 1. The tape was subsequently configured into 10-foot rolls as a product prototype that has just recently been commercialized and marketed under the tradename DetecTape(R). Figure 1 shows the commercial version of DetecTape along with an indicator sample in its native state and one that had been exposed to hydrogen. DetecTape is a self-adhesive silicone-based tape impregnated with a proprietary hydrogen-sensitive indicator based on transition metal oxides. A length of the tape can be cut from the roll and stretched by a factor of two or three times around a fitting. Due to the self-adhesive property of the tape, this provides a tight seal around the fitting. The seal is not hermetic, and is not intended to prevent the release of a leaking gas. However, a portion of the hydrogen leaking from a wrapped fitting will pass through the tape and react with the active indicator impregnated within the tape, thereby inducing blackening.

  3. Hybrid nanosensor for colorimetric and ultrasensitive detection of nuclease contaminations

    NASA Astrophysics Data System (ADS)

    Cecere, Paola; Valentini, Paola; Pompa, Pier Paolo


    Nucleases are ubiquitous enzymes that degrade DNA or RNA, thus they can prejudice the good outcome of molecular biology experiments involving nucleic acids. We propose a colorimetric test for the naked-eye detection of nuclease contaminations. The system uses an hybrid nanosensor, based on gold nanoparticles functionalized with DNA probes. Our assay is rapid, instrument-free, simple and low-cost. Moreover, it reaches sensitivity equal or better than those of commercial kits, and presents a lot of advantageous aspects. Therefore, it is very competitive, with a real market potential. This test will be relevant in routine process monitoring in scientific laboratories, and in quality control in clinical laboratories and industrial processes, allowing the simultaneous detection of nucleases with different substrate specificities and large-scale screening.

  4. Detection of biological thiols based on a colorimetric method*

    PubMed Central

    Xu, Yuan-yuan; Sun, Yang-yang; Zhang, Yu-juan; Lu, Chen-he; Miao, Jin-feng


    Biological thiols (biothiols), an important kind of functional biomolecules, such as cysteine (Cys) and glutathione (GSH), play vital roles in maintaining the stability of the intracellular environment. In past decades, studies have demonstrated that metabolic disorder of biothiols is related to many serious disease processes and will lead to extreme damage in human and numerous animals. We carried out a series of experiments to detect biothiols in biosamples, including bovine plasma and cell lysates of seven different cell lines based on a simple colorimetric method. In a typical test, the color of the test solution could gradually change from blue to colorless after the addition of biothiols. Based on the color change displayed, experimental results reveal that the percentage of biothiols in the embryonic fibroblast cell line is significantly higher than those in the other six cell lines, which provides the basis for the following biothiols-related study. PMID:27704750

  5. Colorimetric detection of catalytic reactivity of nanoparticles in complex matrices.


    Corredor, Charlie; Borysiak, Mark D; Wolfer, Jay; Westerhoff, Paul; Posner, Jonathan D


    There is a need for new methodologies to quickly assess the presence and reactivity of nanoparticles (NPs) in commercial, environmental, and biological samples since current detection techniques require expensive and complex analytical instrumentation. Here, we investigate a simple and portable colorimetric detection assay that assesses the surface reactivity of NPs, which can be used to detect the presence of NPs, in complex matrices (e.g., environmental waters, serum, urine, and in dissolved organic matter) at as low as part per billion (ppb) or ng/mL concentration levels. Surface redox reactivity is a key emerging property related to potential toxicity of NPs with living cells, and is used in our assays as a key surrogate for the presence of NPs and a first tier analytical strategy toward assessing NP exposures. We detect a wide range of metal (e.g., Ag and Au) and oxide (e.g., CeO2, SiO2, VO2) NPs with a diameter range of 5 to 400 nm and multiple capping agents (tannic acid (TA), polyvinylpyrrolidone (PVP), branched polyethylenimine (BPEI), polyethylene glycol (PEG)). This method is sufficiently sensitive (ppb levels) to measure concentrations typically used in toxicological studies, and uses inexpensive, commercially available reagents.

  6. Colorimetric Detection of Staphylococcus aureus Contaminated Solutions without Purification.


    Tiet, Pamela; Clark, Karen C; McNamara, James O; Berlin, Jacob M


    Current water quality monitoring methods rely on growth-based measurements to detect fecal indicator bacteria, such as Escherichia coli and enterococci, and Staphylococcus aureus (S. aureus). These growth-based measurements, however, can take days to complete. This is a significant limitation in the evaluation of contaminated food and water sources. Various methods for selective in vitro detection of S. aureus have also been reported; however, these strategies, such as ELISA, agar-diffusion, PCR, or liquid chromatography-tandem mass spectrometry, all require overnight culturing or sophisticated instrumentation. There is a pressing need for a portable, simple diagnostic for S. aureus. Here, we demonstrate that oligonucleotide-functionalized gold nanoparticles (Oligo-AuNPs) can be designed to rapidly and selectively detect S. aureus with a colorimetric readout. We have functionalized a chemically modified 11-mer sequence onto AuNPs and have found that aggregation occurs in the presence of S. aureus supernantants. The particles can be stored as a lyophilized powder and reconstituted at time of use, and this has been tested in biologically relevant samples such as creek and ocean water. This approach requires minimal sample preparation and requires no extraneous instrumentation, leading to a rapid and simple diagnostic read-out that could be used in field tests to monitor food and water sources.

  7. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo


    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  8. Highly Sensitive Colorimetric Detection of Ochratoxin A by a Label-Free Aptamer and Gold Nanoparticles

    PubMed Central

    Luan, Yunxia; Chen, Jiayi; Li, Cheng; Xie, Gang; Fu, Hailong; Ma, Zhihong; Lu, Anxiang


    A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OTA) was developed using a cationic polymer and gold nanoparticles (AuNPs). The OTA aptamer was used as a recognition element for the colorimetric detection of OTA based on the aggregation of AuNPs by the cationic polymer. By spectroscopic quantitative analysis, the colorimetric assay could detect OTA down to 0.009 ng/mL with high selectivity in the presence of other interfering toxins. This study offers a new alternative in visual detection methods that is rapid and sensitive for OTA detection. PMID:26690477

  9. Highly Sensitive Colorimetric Detection of Ochratoxin A by a Label-Free Aptamer and Gold Nanoparticles.


    Luan, Yunxia; Chen, Jiayi; Li, Cheng; Xie, Gang; Fu, Hailong; Ma, Zhihong; Lu, Anxiang


    A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OTA) was developed using a cationic polymer and gold nanoparticles (AuNPs). The OTA aptamer was used as a recognition element for the colorimetric detection of OTA based on the aggregation of AuNPs by the cationic polymer. By spectroscopic quantitative analysis, the colorimetric assay could detect OTA down to 0.009 ng/mL with high selectivity in the presence of other interfering toxins. This study offers a new alternative in visual detection methods that is rapid and sensitive for OTA detection.

  10. Hierarchically structured photonic crystals for integrated chemical separation and colorimetric detection.


    Fu, Qianqian; Zhu, Biting; Ge, Jianping


    A SiO2 colloidal photonic crystal film with a hierarchical porous structure is fabricated to demonstrate an integrated separation and colorimetric detection of chemical species for the first time. This new photonic crystal based thin layer chromatography process requires no dyeing, developing and UV irradiation compared to the traditional TLC. The assembling of mesoporous SiO2 particles via a supersaturation-induced-precipitation process forms uniform and hierarchical photonic crystals with micron-scale cracks and mesopores, which accelerate the diffusion of developers and intensify the adsorption/desorption between the analytes and silica for efficient separation. Meanwhile, the chemical substances infiltrated to the voids of photonic crystals cause an increase of the refractive index and a large contrast of structural colors towards the unloaded part, so that the sample spots can be directly recognized with the naked eye before and after separation.

  11. Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin-producing Escherichia coli O157:H7 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for...

  12. Colorimetric Detection of Escherichia coli Based on the Enzyme-Induced Metallization of Gold Nanorods.


    Chen, Juhong; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R


    A novel enzyme-induced metallization colorimetric assay is developed to monitor and measure beta-galactosidase (β-gal) activity, and is further employed for colorimetric bacteriophage (phage)-enabled detection of Escherichia coli (E. coli). This assay relies on enzymatic reaction-induced silver deposition on the surface of gold nanorods (AuNRs). In the presence of β-gal, the substrate p-aminophenyl β-d-galactopyranoside is hydrolyzed to produce p-aminophenol (PAP). Reduction of silver ions by PAP generates a silver shell on the surface of AuNRs, resulting in the blue shift of the longitudinal localized surface plasmon resonance peak and multicolor changes of the detection solution from light green to orange-red. Under optimized conditions, the detection limit for β-gal is 128 pM, which is lower than the conventional colorimetric assay. Additionally, the assay has a broader dynamic range for β-gal detection. The specificity of this assay for the detection of β-gal is demonstrated against several protein competitors. Additionally, this technique is successfully applied to detect E. coli bacteria cells in combination with bacteriophage infection. Due to the simplicity and short incubation time of this enzyme-induced metallization colorimetric method, the assay is well suited for the detection of bacteria in low-resource settings.

  13. Colorimetric detection of copper ions in tap water during the synthesis of silver/dopamine nanoparticles.


    Ma, Yu-rong; Niu, Hong-yun; Zhang, Xiao-le; Cai, Ya-qi


    A facile, economic and eco-friendly colorimetric sensor for Cu(2+) using dopamine/silver nanoparticles was developed. The sensor shows excellent sensitivity and selectivity toward Cu(2+) in the range of 3.2-512 ppb and can be applied for Cu(2+) detection in tap water.

  14. A simple and novel system for colorimetric detection of cobalt ions.


    Liu, Zhimin; Jia, Xinle; Bian, Pingping; Ma, Zhanfang


    A simple and novel method for the colorimetric detection of Co(2+) was developed based on controlling the oxidation level of methylene blue (MB). After a complex was formed between MB, 2-aminothiophenol (ATP) and copper nitrate (MB-ATP-Cu(2+)), the sensing of Co(2+) showed high selectivity. The mechanism of sensing has also been discussed.

  15. A colorimetric sensor based on anodized aluminum oxide (AAO) substrate for the detection of nitroaromatics.

    SciTech Connect

    Liu, Y.; Wang, H. H.; Indacochea, J. E.; Wang, M. L.


    Simple and low cost colorimetric sensors for explosives detection were explored and developed. Anodized aluminum oxide (AAO) with large surface area through its porous structure and light background color was utilized as the substrate for colorimetric sensors. Fabricated thin AAO films with thickness less than {approx} 500 nm allowed us to observe interference colors which were used as the background color for colorimetric detection. AAO thin films with various thickness and pore-to-pore distance were prepared through anodizing aluminum foils at different voltages and times in dilute sulfuric acid. Various interference colors were observed on these samples due to their difference in structures. Accordingly, suitable anodization conditions that produce AAO samples with desired light background colors for optical applications were obtained. Thin film interference model was applied to analyze the UV-vis reflectance spectra and to estimate the thickness of the AAO membranes. We found that the thickness of produced AAO films increased linearly with anodization time in sulfuric acid. In addition, the growth rate was higher for AAO anodized using higher voltages. The thin film interference formulism was further validated with a well established layer by layer deposition technique. Coating poly(styrene sulfonate) sodium salt (PSS) and poly(allylamine hydrochloride) (PAH) layer by layer on AAO thin film consistently shifted its surface color toward red due to the increase in thickness. The red shift of UV-vis reflectance was correlated quantitatively to the number of layers been assembled. This sensitive red shift due to molecular attachment (increase in thickness) on AAO substrate was applied toward nitroaromatics detection. Aminopropyltrimethoxysilane (APTS) which can be attached onto AAO nanowells covalently through silanization and attract TNT molecules was coated and applied for TNT detection. UV-vis spectra of AAO with APTS shifted to the longer wavelength side due to

  16. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.


    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  17. Colorimetric Detection with Aptamer-Gold Nanoparticle Conjugates: Effect of Aptamer Length on Response

    DTIC Science & Technology


    AFRL-RH-WP-TR-2012-0152 COLORIMATETRIC DETECTION WITH APTAMER -GOLD NANOPARTICLE CONJUGATES: EFFECT OF APTAMER LENGTH ON RESPONSE...September 2011 4. TITLE AND SUBTITLE Colorimetric Detection with Aptamer -Gold Nanoparticle Conjugates: Effect of Aptamer Length on Response 5a...SUPPLEMENTARY NOTES 88ABW-2011-6451, cleared 15 Dec 11 14. ABSTRACT A riboflavin binding aptamer (RBA) was used in combination with gold

  18. Molecularly imprinted photonic hydrogels as colorimetric sensors for rapid and label-free detection of vanillin.


    Peng, Hailong; Wang, Shenqi; Zhang, Zhong; Xiong, Hua; Li, Jinhua; Chen, Lingxin; Li, Yanbin


    A novel colorimetric sensor for the rapid and label-free detection of vanillin, based on the combination of photonic crystal and molecular imprinting technique, was developed. The sensing platform of molecularly imprinted photonic hydrogel (MIPH) was prepared by a noncovalent and self-assembly approach using vanillin as a template molecule. Morphology characterization by scanning electron microscope (SEM) showed that the MIPH possessed a highly ordered three-dimensional (3D) macroporous structure with nanocavities. The vanillin recognition events of the created nonocavities could be directly transferred into readable optical signals through a change in Bragg diffraction of the ordered macropores array of MIPH. The Bragg diffraction peak shifted from 451 to 486 nm when the concentration of the vanillin was increased from 10⁻¹² to 10⁻³ mol L⁻¹ within 60 s, whereas there were no obvious peak shifts for methyl and ethyl vanillin, indicating that the MIPH had high selectivity and rapid response for vanillin. The adsorption results showed that the hierarchical porous structure and homogeneous layers were formed in the MIPH with higher adsorption capacity. The application of such a label-free sensor with high selectivity, high sensitivity, high stability, and easy operation might offer a potential method for rapid real-time detection of trace vanillin.

  19. Colorimetric detection of Cd2+ using 1-amino-2-naphthol-4-sulfonic acid functionalized silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Huang, Pengcheng; Liu, Bowen; Jin, Weiwei; Wu, Fangying; Wan, Yiqun


    A colorimetric assay has been developed for facile, rapid, and sensitive detection of Cd2+ using 1-amino-2-naphthol-4-sulfonic acid functionalized silver nanoparticles (ANS-AgNPs). The presence of Cd2+ induces the aggregation of ANS-AgNPs through cooperative metal-ligand interaction. As a result, the characteristic surface plasmon resonance (SPR) peak of ANS-AgNPs at 390 nm was red-shifted to 580 nm, yielding a color change from bright yellow to reddish-brown. The color change is monitored by UV-Vis spectrometer and can be directly read out by the naked eye. Under the optimized conditions, a good linear relationship (correlation coefficient R = 0.997) was obtained between the ratio of the absorbance at 580 nm to that at 390 nm (A580nm/A390nm) and the concentration of Cd2+ over the range of 1.0-10 μM with detection limit of 87 nM. The proposed method is simple and efficient, which has been applied for determining Cd2+ in milk powder, serum, and lake water with satisfactory results.

  20. Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection

    NASA Astrophysics Data System (ADS)

    Chen, Chaohui; Zou, Zhong; Chen, Lu; Ji, Xinghu; He, Zhike


    A colorimetric platform for influenza A virus detection was developed by using the high efficiency of enzymatic catalysis and the reduction of gold ions with hydrogen peroxide. Aptamer-functionalized magnetic microparticles were synthesized to capture the influenza A virus. This was followed by the binding of ConA-GOx-AuNPs to the H3N2 virus through the ConA-glycan interaction. The sandwich complex was subsequently dispersed in glucose solution to trigger an enzymatic reaction to produce hydrogen peroxide, which controlled the growth of gold nanoparticles and produced colored solutions. The determination of H3N2 concentration was realized by comparing the two differently colored gold nanoparticles. This method could detect the target virus as low as 11.16 μg ml-1. Furthermore, it opens new opportunities for sensitive and colorimetric detection of viruses and proteins.

  1. Colorimetric detection of hazardous gases using a remotely operated capturing and processing system.


    Montes-Robles, Roberto; Moragues, María Esperanza; Vivancos, José-Luis; Ibáñez, Javier; Fraile, Rubén; Martínez-Máñez, Ramón; García-Breijo, Eduardo


    This paper presents an electronic system for the automatic detection of hazardous gases. The proposed system implements colorimetric sensing algorithms, thus providing a low-cost solution to the problem of gas sensing. It is remotely operated and it performs the tasks of image capturing and processing, hence obtaining colour measurements in RGB (Red-Green-Blue) space that are subsequently sent to a remote operator via the internet. A prototype of the system has been built to test its performance. Specifically, experiments have been carried out aimed at the detection of CO, CO2, NO, NO2, SO2 and formaldehyde at diverse concentrations by using a chromogenic array composed by 13 active and 2 inert compounds. Statistical analyses of the results reveal a good performance of the electronic system and the feasibility of remote hazardous gas detection using colorimetric sensor arrays.

  2. Colorimetric detection of Shewanella oneidensis based on immunomagnetic capture and bacterial intrinsic peroxidase activity

    NASA Astrophysics Data System (ADS)

    Wen, Junlin; Zhou, Shungui; Chen, Junhua


    Rapid detection and enumeration of target microorganisms is considered as a powerful tool for monitoring bioremediation process that typically involves cleaning up polluted environments with functional microbes. A novel colorimetric assay is presented based on immunomagnetic capture and bacterial intrinsic peroxidase activity for rapidly detecting Shewanella oneidensis, an important model organism for environmental bioremediation because of its remarkably diverse respiratory abilities. Analyte bacteria captured on the immunomagnetic beads provided a bacterial out-membrane peroxidase-amplified colorimetric readout of the immunorecognition event by oxidizing 3, 3', 5, 5'-tetramethylbenzidine (TMB) in the present of hydrogen peroxide. The high-efficiency of immunomagnetic capture and signal amplification of peroxidase activity offers an excellent detection performance with a wide dynamic range between 5.0 × 103 and 5.0 × 106 CFU/mL toward target cells. Furthermore, this method was demonstrated to be feasible in detecting S. oneidensis cells spiked in environmental samples. The proposed colorimetric assay shows promising environmental applications for rapid detection of target microorganisms.

  3. Highly Uniform Gold Nanobipyramids for Ultrasensitive Colorimetric Detection of Influenza Virus.


    Xu, Shaohua; Ouyang, Wenjun; Xie, Peisi; Lin, Yi; Qiu, Bin; Lin, Zhenyu; Chen, Guonan; Guo, Longhua


    Gold nanoparticles (AuNPs) have been frequently utilized for the construction of diverse colorimetric biosensors. Normally, AuNPs with sharp edges could have better sensitivity. However, the poor monodipersity of AuNPs with sharp edges seriously confines their utility for colorimetric biosensing. Herein, we demonstrate the utility of highly uniform gold nanobipyramids (Au NBPs) for ultrasensitive colorimetric detection of H5N1 virus. The proposed method is based on the fact that alkaline phosphatase (ALP) could catalyze the decomposition of 4-aminophenyl phosphate (4-APP) to generate 4-aminophenol (4-AP), which would then reduce silver nitrate to metal silver and then deposited on Au NBPs. The metal silver shell coated on the Au NBPs changed the refractive index of gold and thus resulted in a blue shift of longitudinal localized surface plasmon resonance (LSPR) and accompanied a vivid color change. This method exhibited a higher sensitivity than that of other Au NPs such as gold nanorods due to the high-index-faceted on the tips of the Au NBPs. This method was used to detect the activity of ALP. It exhibited a linear range of 0.1-5 mU/mL with a limit of detection (LOD) of 0.086 mU/mL. Finally, the proposed method was used in immunoassay to detect H5N1 virus. The results showed that the corresponding linear range for the detection of H5N1 virus antigen was 0.001-2.5 ng/mL, and the LOD was determined to be 1 pg/mL, which is more sensitive than those in most of the colorimetric biosensors reported previously.

  4. Label-free colorimetric detection of cadmium ions in rice samples using gold nanoparticles.


    Guo, Yongming; Zhang, Yi; Shao, Huawu; Wang, Zhuo; Wang, Xuefei; Jiang, Xingyu


    A simple and label-free colorimetric method for cadmium ions (Cd(2+)) detection using unmodified gold nanoparticles (AuNPs) is reported. The unmodified AuNPs easily aggregate in a high concentration of NaCl solution, but the presence of glutathione (GSH) can prevent the salt-induced aggregation of AuNPs. When Cd(2+) is added to the stable mixture of AuNPs, GSH, and NaCl, Cd(2+) can coordinate with 4× GSH as a spherical shaped complex, which decreases the amount of free GSH on the surface of gold nanoparticles to weaken the stability of AuNPs, and AuNPs will easily aggregate in high-salt conditions. On the basis of the mechanism, we design a simple, label-free colorimetric method using AuNPs accompanied by GSH in a high-salt environment to detect Cd(2+) in water and digested rice samples.

  5. Rapid colorimetric detection of Salmonella typhimuriumusing a selective filtration technique combined with antibody-magnetic nanoparticle nanocomposites.


    Shim, Won-Bo; Song, Jeong-Eon; Mun, Hyoyoung; Chung, Duck-Hwa; Kim, Min-Gon


    Detection of pathogenic bacteria that pose a great risk to human health requires a rapid, convenient, reliable, and sensitive detection method. In this study, we developed a selective filtration method using monoclonal antibody (MAb)-magnetic nanoparticle (MNP) nanocomposites for the rapid and sensitive colorimetric detection of Salmonella typhimurium. The method contains two key steps: the immunomagnetic separation of the bacteria using MAb-MNP nanocomposites and the filtration of the nanocomposite-bound bacteria. Color signals from the nanocomposites remaining on the membrane were measured, which reflected the amount of bacteria in test samples. Immunomagnetic capture efficiencies of 8 to 90 % for various concentrations of the pathogen (2 × 10(4)-2 × 10(1) cells) were obtained. After optimization of the method, 2 × 10(1) cells of S. typhimurium in pure culture solution was detectable as well as in artificially inoculated vegetables (100 cells/g). The method was confirmed to be highly specific to S. typhimurium without cross-reaction to other pathogenic bacteria and could be concluded within 45 min, yielding results in a shorter or similar time period as compared with recently reported antibody immobilized on magnetic-particle-based methods. This study also demonstrated direct application of MAb-MNP nanocomposites without a dissociation step of bacteria from magnetic beads in colorimetric assays in practice.

  6. A simple ratiometric and colorimetric chemosensor for the selective detection of fluoride in DMSO buffered solution

    NASA Astrophysics Data System (ADS)

    Niu, Hu; Shu, Qinghai; Jin, Shaohua; Li, Bingjun; Zhu, Jiaping; Li, Lijie; Chen, Shusen


    A derivative of squaramide (cyclobuta[b]quinoxaline-1, 2(3H, 8H)-dione) has been synthesized for the ratiometric and colorimetric sensing of F- in aqueous solution in competitive fashion. With F-, probe 1 showed a highly selective naked-eye detectable color change along with a characteristic UV-Vis absorbance over other tested ions, which probably originates from the deprotonation occurred between 1 and F-, as proved by the 1H NMR titration experiments and DFT calculations.

  7. A new rhodamine-based colorimetric chemosensor for naked-eye detection of Cu2 + in aqueous solution

    NASA Astrophysics Data System (ADS)

    Hu, Yang; Zhang, Jing; Lv, Yuan-Zheng; Huang, Xiao-Huan; Hu, Sheng-li


    A new colorimetric probe 1 based on rhodamine B lactam was developed for naked-eye detection of Cu2 +. The optical feature of 1 for Cu2 + was investigated by UV-vis absorption spectroscopy. Upon the addition of Cu2 +, the 1 displayed a distinct color change from colorless to pink, which can be directly detected by the naked eye. The stoichiometry of 1 to Cu2 + complex was found to be 1:1 and the naked-eye detection limit was determined as low as 2 μM. The results suggest that the probe 1 may provide a convenient method for visual detection of Cu2 + with high sensitivity.

  8. A new rhodamine-based colorimetric chemosensor for naked-eye detection of Cu(2+) in aqueous solution.


    Hu, Yang; Zhang, Jing; Lv, Yuan-Zheng; Huang, Xiao-Huan; Hu, Sheng-li


    A new colorimetric probe 1 based on rhodamine B lactam was developed for naked-eye detection of Cu(2+). The optical feature of 1 for Cu(2+) was investigated by UV-vis absorption spectroscopy. Upon the addition of Cu(2+), the 1 displayed a distinct color change from colorless to pink, which can be directly detected by the naked eye. The stoichiometry of 1 to Cu(2+) complex was found to be 1:1 and the naked-eye detection limit was determined as low as 2 μM. The results suggest that the probe 1 may provide a convenient method for visual detection of Cu(2+) with high sensitivity.

  9. An organic indicator functionalized graphene oxide nanocomposite-based colorimetric assay for the detection of sarcosine

    NASA Astrophysics Data System (ADS)

    Xue, Zhonghua; Yin, Bo; Wang, Hui; Li, Mengqian; Rao, Honghong; Liu, Xiuhui; Zhou, Xinbin; Lu, Xiaoquan


    Rapid detection of sarcosine is a key requirement for both diagnosis and treatment of disease. We report here a simple yet sensitive colorimetric nanocomposite platform for rapid detection of sarcosine in alkaline media. The approach exploited the benefits of a rapid color-producing reaction between an organic indicator, 1,2-naphthoquinone-4-sulphonic acid sodium salt (NQS), and the analyte of sarcosine species as well as the good catalytic ability of graphene oxide (GO) to the formation of highly colored products due to its good water dispersibility, extremely large surface area and facile surface modification. As a result, a NQS functionalized GO nanocomposite through π-π stacking has been demonstrated to be useful as a highly efficient catalyst system for the selective and sensitive colorimetric determination of sarcosine by providing a nanocomposite-amplified colorimetric response. Meanwhile, the strategy offered excellent selectivity toward sarcosine species against other amino acids as well as a satisfying detection limit of 0.73 μM. More importantly, by using an electrochemical method, a credible sensing mechanism of GO nanocomposite-based colorimetric platform for a special analyte determination can be easily verified and elucidated, which also provides an attractive alternative to conventional characterization strategies.Rapid detection of sarcosine is a key requirement for both diagnosis and treatment of disease. We report here a simple yet sensitive colorimetric nanocomposite platform for rapid detection of sarcosine in alkaline media. The approach exploited the benefits of a rapid color-producing reaction between an organic indicator, 1,2-naphthoquinone-4-sulphonic acid sodium salt (NQS), and the analyte of sarcosine species as well as the good catalytic ability of graphene oxide (GO) to the formation of highly colored products due to its good water dispersibility, extremely large surface area and facile surface modification. As a result, a NQS

  10. ``Red-to-blue'' colorimetric detection of cysteine via anti-etching of silver nanoprisms

    NASA Astrophysics Data System (ADS)

    Li, Yonglong; Li, Zihou; Gao, Yuexia; Gong, An; Zhang, Yujie; Hosmane, Narayan S.; Shen, Zheyu; Wu, Aiguo


    The reported strategies for cysteine (Cys) colorimetric detection based on noble metal nanomaterials include triggering aggregation, etching or fluorescence quenching of nanomaterials by Cys. In this study, we propose a new strategy for Cys colorimetric detection, i.e. anti-etching of silver nanoprisms (AgNPRs). In the absence of Cys, iodide ions (I-) could etch the corners and edges of AgNPRs and induce the morphology transition from nanoprism to nanodisk, which results in color change of the AgNPR dispersion from blue to red. In its presence, however, Cys can prevent the AgNPRs from I- attack. In that case, the color of the AgNPR dispersion containing I- and Cys remains blue. The mechanism is confirmed by using UV-vis spectra, TEM, DLS, Raman spectra and XPS spectra. According to the sensing effect of the Cys detection system, the concentration of I- incubated with AgNPRs, incubation time of AgNPRs and I-, and pH of AgNPR dispersions are optimized to 5.0 μM, 10 min, and pH 6.2, respectively. Under the optimized conditions, the proposed Cys detection system has excellent selectivity and high sensitivity. The limit of detection (LOD) of our Cys detection system is 25 nM by the naked eye, which is much better than the reported lowest LOD by eye-vision (100 nM), and 10 nM by UV-vis spectroscopy. The results of Cys detection in rabbit urine or plasma samples reinforce that our Cys detection system is applicable for rapid colorimetric detection of Cys in real body fluid samples.The reported strategies for cysteine (Cys) colorimetric detection based on noble metal nanomaterials include triggering aggregation, etching or fluorescence quenching of nanomaterials by Cys. In this study, we propose a new strategy for Cys colorimetric detection, i.e. anti-etching of silver nanoprisms (AgNPRs). In the absence of Cys, iodide ions (I-) could etch the corners and edges of AgNPRs and induce the morphology transition from nanoprism to nanodisk, which results in color change of the

  11. Colorimetric and Electrochemical Bacteria Detection Using Printed Paper- and Transparency-Based Analytic Devices.


    Adkins, Jaclyn A; Boehle, Katherine; Friend, Colin; Chamberlain, Briana; Bisha, Bledar; Henry, Charles S


    The development of transparency-based electrochemical and paper-based colorimetric analytic detection platforms is presented as complementary methods for food and waterborne bacteria detection from a single assay. Escherichia coli and Enterococcus species, both indicators of fecal contamination, were detected using substrates specific to enzymes produced by each species. β-galactosidase (β-gal) and β-glucuronidase (β-glucur) are both produced by E. coli, while β-glucosidase (β-gluco) is produced by Enterococcus spp. Substrates used produced either p-nitrophenol (PNP), o-nitrophenol (ONP), or p-aminophenol (PAP) as products. Electrochemical detection using stencil-printed carbon electrodes (SPCEs) was found to provide optimal performance on inexpensive and disposable transparency film platforms. Using SPCEs, detection limits for electrochemically active substrates, PNP, ONP, and PAP were determined to be 1.1, 2.8, and 0.5 μM, respectively. A colorimetric paper-based well plate system was developed from a simple cardboard box and smart phone for the detection of PNP and ONP. Colorimetric detection limits were determined to be 81 μM and 119 μM for ONP and PNP respectively. While colorimetric detection methods gave higher detection limits than electrochemical detection, both methods provided similar times to positive bacteria detection. Low concentrations (10(1) CFU/mL) of pathogenic and nonpathogenic E. coli isolates and (10(0) CFU/mL) E. faecalis and E. faecium strains were detected within 4 and 8 h of pre-enrichment. Alfalfa sprout and lagoon water samples served as model food and water samples, and while water samples did not test positive, sprout samples did test positive within 4 h of pre-enrichment. Positive detection of inoculated (2.3 × 10(2) and 3.1 × 10(1) CFU/mL or g of E. coli and E. faecium, respectively) sprout and water samples tested positive within 4 and 12 h of pre-enrichment, respectively.

  12. [Detection of viable metabolically active yeast cells using a colorimetric assay].


    Růzicka, F; Holá, V


    The increasing concern of yeasts able to form biofilm brings about the need for susceptibility testing of both planktonic and biofilm cells. Detection of viability or metabolic activity of yeast cells after exposure to antimicrobials plays a key role in the assessment of susceptibility testing results. Colorimetric assays based on the color change of the medium in the presence of metabolically active cells proved suitable for this purpose. In this study, the usability of a colorimetric assay with the resazurin redox indicator for monitoring the effect of yeast inoculum density on the reduction rate was tested. As correlation between the color change rate and inoculum density was observed, approximate quantification of viable cells was possible. The assay would be of relevance to antifungal susceptibility testing in both planktonic and biofilm yeasts.

  13. Colorimetric chemosensor for multi-signaling detection of metal ions using pyrrole based Schiff bases.


    Udhayakumari, Duraisamy; Velmathi, Sivan


    Pyrrole based Schiff bases act as a highly sensitive probe for metal ions in aqueous medium. Both receptors R1 and R2 are sensitive towards Fe(3+), Cu(2+), Hg(2+) and Cr(3+) among the other metal ions. The sensing ability of the receptors are investigated via colorimetric, optical and emission spectroscopic studies. The binding stoichiometries of R1 and R2 with metal ions have been determined as 2:1 by using Job's plot. The colorimetric receptors exhibited high sensitivity with a low detection limit of μM levels. In the presence of metal ions both receptors shows fluorescence quenching. This might be due to the photo induced electron transfer mechanism. The quenching constant was further determined using Stern-Volmer plot.

  14. Label-Free Isothermal Amplification Assay for Specific and Highly Sensitive Colorimetric miRNA Detection

    PubMed Central


    We describe a new method for the detection of miRNA in biological samples. This technology is based on the isothermal nicking enzyme amplification reaction and subsequent hybridization of the amplification product with gold nanoparticles and magnetic microparticles (barcode system) to achieve naked-eye colorimetric detection. This platform was used to detect a specific miRNA (miRNA-10b) associated with breast cancer, and attomolar sensitivity was demonstrated. The assay was validated in cell culture lysates from breast cancer cells and in serum from a mouse model of breast cancer. PMID:27713932

  15. Colorimetric peroxidase mimetic assay for uranyl detection in sea water.


    Zhang, Dingyuan; Chen, Zhuo; Omar, Haneen; Deng, Lin; Khashab, Niveen M


    Uranyl (UO2(2+)) is a form of uranium in aqueous solution that represents the greatest risk to human health because of its bioavailability. Different sensing techniques have been used with very sensitive detection limits especially the recently reported uranyl-specific DNAzymes systems. However, to the best of our knowledge, few efficient detection methods have been reported for uranyl sensing in seawater. Herein, gold nanoclusters (AuNCs) are employed in an efficient spectroscopic method to detect uranyl ion (UO2(2+)) with a detection limit of 1.86 μM. In the absence of UO2(2+), the BSA-stabilized AuNCs (BSA-AuNCs) showed an intrinsic peroxidase-like activity. In the presence of UO2(2+), this activity can be efficiently restrained. The preliminary quenching mechanism and selectivity of UO2(2+) was also investigated and compared with other ions. This design strategy could be useful in understanding the binding affinity of protein-stabilized AuNCs to UO2(2+) and consequently prompt the recycling of UO2(2+) from seawater.

  16. A Simple Colorimetric Assay for Specific Detection of Glutathione-S Transferase Activity Associated with DDT Resistance in Mosquitoes

    PubMed Central

    Rajatileka, Shavanti; Steven, Andrew; Hemingway, Janet; Ranson, Hilary; Paine, Mark; Vontas, John


    Background Insecticide-based methods represent the most effective means of blocking the transmission of vector borne diseases. However, insecticide resistance poses a serious threat and there is a need for tools, such as diagnostic tests for resistance detection, that will improve the sustainability of control interventions. The development of such tools for metabolism-based resistance in mosquito vectors lags behind those for target site resistance mutations. Methodology/Principal Findings We have developed and validated a simple colorimetric assay for the detection of Epsilon class Glutathione transferases (GST)-based DDT resistance in mosquito species, such as Aedes aegypti, the major vector of dengue and yellow fever worldwide. The colorimetric assay is based on the specific alkyl transferase activity of Epsilon GSTs for the haloalkene substrate iodoethane, which produces a dark blue colour highly correlated with AaGSTE2-2-overexpression in individual mosquitoes. The colour can be measured visually and spectrophotometrically. Conclusions/Significance The novel assay is substantially more sensitive compared to the gold standard CDNB assay and allows the discrimination of moderate resistance phenotypes. We anticipate that it will have direct application in routine vector monitoring as a resistance indicator and possibly an important impact on disease vector control. PMID:20824165

  17. Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy.


    Wang, Kun; Fan, Daoqing; Liu, Yaqing; Wang, Erkang


    Simple, rapid, sensitive and specific detection of cancer cells is of great importance for early and accurate cancer diagnostics and therapy. By coupling nanotechnology and dual-aptamer target binding strategies, we developed a colorimetric assay for visually detecting cancer cells with high sensitivity and specificity. The nanotechnology including high catalytic activity of PtAuNP and magnetic separation & concentration plays a vital role on the signal amplification and improvement of detection sensitivity. The color change caused by small amount of target cancer cells (10 cells/mL) can be clearly distinguished by naked eyes. The dual-aptamer target binding strategy guarantees the detection specificity that large amount of non-cancer cells and different cancer cells (10(4) cells/mL) cannot cause obvious color change. A detection limit as low as 10 cells/mL with detection linear range from 10 to 10(5) cells/mL was reached according to the experimental detections in phosphate buffer solution as well as serum sample. The developed enzyme-free and cost effective colorimetric assay is simple and no need of instrument while still provides excellent sensitivity, specificity and repeatability, having potential application on point-of-care cancer diagnosis.

  18. Illumination and device independence for colorimetric detection of urinary biomarkers with smartphone.


    Karisen, Haakon; Tao Dong


    Diaper wearing elderly with functional impairments and/or incontinence is at high risk of contracting urinary tract infections. Nurses struggle with collection of urine samples for analysis. Therefore, a smartphone application is under development as a rapid screening device to work in conjunction with a colorimetric diaper assay that collects and tests urine within a diaper. The focus of this work is to make a practical and useful tool that medical personnel (the user) can use for rapid screening on patients in the field, only with a smartphone and assay available. The main challenge is to achieve illumination and device independency for a wide range of colorimetric biomarkers without using any standardization, such as attachments, special lamps, or boxes. We achieved illumination and device independent semi-quantitative detection by using discriminant analysis and classification of simultaneously photographed colorimetric test results and reference colors to ensure that any variation in image conditions applies approximately equal for reference and test. This requires retraining of classifiers on each analysis, but appears to be the most viable solution to solving the challenges while maintaining the user-friendliness.

  19. Colorimetric detection of senescence-associated β galactosidase.


    Itahana, Koji; Itahana, Yoko; Dimri, Goberdhan P


    Most normal human cells have a finite replicative capacity and eventually undergo cellular senescence, whereby cells cease to proliferate. Cellular senescence is also induced by various stress signals, such as those generated by oncogenes, DNA damage, hyperproliferation, and an oxidative environment. Cellular senescence is well established as an intrinsic tumor suppressive mechanism. Recent progress concerning senescence research has revealed that cellular senescence occurs in vivo and that, unexpectedly, it has a very complex role in tissue repair, promoting tumor progression and aging via the secretion of various cytokines, growth factors, and enzymes. Therefore, the importance of biomarkers for cellular senescence has greatly increased. In 1995, we described the "senescence-associated β galactosidase" (SA-βgal) biomarker, which conveniently identifies individual senescent cells in vitro and in vivo. Here, we describe an updated protocol for the detection of cell senescence based on this widely used biomarker, which contributed to recent advances in senescence, aging and cancer research. We provide an example of detecting SA-βgal together with other senescence markers and a proliferation marker, EdU, in single cells.

  20. Prussian blue nanoparticles as peroxidase mimetics for sensitive colorimetric detection of hydrogen peroxide and glucose.


    Zhang, Weimin; Ma, Diao; Du, Jianxiu


    Prussian blue nanoparticles (PB NPs) exhibits an intrinsic peroxidase-like catalytic activity towards the hydrogen peroxide (H2O2)-mediated oxidation of classical peroxidase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt to produce a colored product. The catalysis follows Michaelis-Menen kinetics and shows strong affinity for H2O2. Using PB NPs as a peroxidase mimetics, a colorimetric method was developed for the detection of 0.05-50.0 μM H2O2, with a detection limit of 0.031 μM. When the catalytic reaction of PB NPs was coupled with the reaction of glucose oxidation catalyzed by glucose oxidase, a sensitive and selective colorimetric method for the detection of glucose was realized. The limit of detection for glucose was determined to be as low as 0.03 μM and the linear range was from 0.1 μM to 50.0 μM. The method was successfully applied to the determination of glucose in human serum. Compared with other nanomaterials-based peroxidase mimetics, PB NPs provides 10-100 times higher sensitivity toward the detection of H2O2 and glucose. The detection platform developed showed great potential applications in varieties of physiological importance substances when merged with appropriate H2O2-producing oxidases.

  1. A Rapid In Situ Colorimetric Assay for Cobalt Detection by the Naked Eye

    PubMed Central

    Kang, Sung-Min; Jang, Sung-Chan; Kim, Gi Yong; Lee, Chang-Soo; Huh, Yun Suk; Roh, Changhyun


    A simple, rapid, and convenient colorimetric chemosensor of a specific target toward the end user is still required for on-site detection and real-time monitoring applications. In this study, we developed a rapid in situ colorimetric assay for cobalt detection using the naked eye. Interestingly, a yellow to light orange visual color transition was observed within 3 s when a Chrysoidine G (CG) chemosensor was exposed to cobalt. Surprisingly, the CG chemosensor had great selectivity toward cobalt without any interference of other metal ions. Under optimized conditions, a lower detection limit of 0.1 ppm via a spectrophotometer and a visual detection limit of 2 ppm with a linear range from 0.4 to 1 ppm (R2 = 0.97) were determined. Moreover, the CG chemosensor is reversible and maintains its functionality after treatment with chelating agents. In conclusion, we show the superior capabilities of the CG chemosensor, which has the potential to provide extremely facile handling, high sensitivity, and a fast response time for applications of on-site detection to real-time cobalt monitoring for the general public. PMID:27144568

  2. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection.


    Oh, Seung Jun; Park, Byung Hyun; Jung, Jae Hwan; Choi, Goro; Lee, Doh C; Kim, Do Hyun; Seo, Tae Seok


    We present a centrifugal microfluidic device which enables multiplex foodborne pathogen identification by loop-mediated isothermal amplification (LAMP) and colorimetric detection using Eriochrome Black T (EBT). Five identical structures were designed in the centrifugal microfluidic system to perform the genetic analysis of 25 pathogen samples in a high-throughput manner. The sequential loading and aliquoting of the LAMP cocktail, the primer mixtures, and the DNA sample solutions were accomplished by the optimized zigzag-shaped microchannels and RPM control. We targeted three kinds of pathogenic bacteria (Escherichia coli O157:H7, Salmonella typhimurium and Vibrio parahaemolyticus) and detected the amplicons of the LAMP reaction by the EBT-mediated colorimetric method. For the limit-of-detection (LOD) test, we carried out the LAMP reaction on a chip with serially diluted DNA templates of E. coli O157:H7, and could observe the color change with 380 copies. The used primer sets in the LAMP reaction were specific only to the genomic DNA of E. coli O157:H7, enabling the on-chip selective, sensitive, and high-throughput pathogen identification with the naked eyes. The entire process was completed in 60min. Since the proposed microsystem does not require any bulky and expensive instrumentation for end-point detection, our microdevice would be adequate for point-of-care (POC) testing with high simplicity and high speed, providing an advanced genetic analysis microsystem for foodborne pathogen detection.

  3. A Rapid In Situ Colorimetric Assay for Cobalt Detection by the Naked Eye.


    Kang, Sung-Min; Jang, Sung-Chan; Kim, Gi Yong; Lee, Chang-Soo; Huh, Yun Suk; Roh, Changhyun


    A simple, rapid, and convenient colorimetric chemosensor of a specific target toward the end user is still required for on-site detection and real-time monitoring applications. In this study, we developed a rapid in situ colorimetric assay for cobalt detection using the naked eye. Interestingly, a yellow to light orange visual color transition was observed within 3 s when a Chrysoidine G (CG) chemosensor was exposed to cobalt. Surprisingly, the CG chemosensor had great selectivity toward cobalt without any interference of other metal ions. Under optimized conditions, a lower detection limit of 0.1 ppm via a spectrophotometer and a visual detection limit of 2 ppm with a linear range from 0.4 to 1 ppm (R² = 0.97) were determined. Moreover, the CG chemosensor is reversible and maintains its functionality after treatment with chelating agents. In conclusion, we show the superior capabilities of the CG chemosensor, which has the potential to provide extremely facile handling, high sensitivity, and a fast response time for applications of on-site detection to real-time cobalt monitoring for the general public.

  4. Colorimetric Immuno-Protein Phosphatase Inhibition Assay for Specific Detection of Microcystins and Nodularins of Cyanobacteria

    PubMed Central

    Metcalf, James S.; Bell, Steven G.; Codd, Geoffrey A.


    A novel immunoassay was developed for specific detection of cyanobacterial cyclic peptide hepatotoxins which inhibit protein phosphatases. Immunoassay methods currently used for microcystin and nodularin detection and analysis do not provide information on the toxicity of microcystin and/or nodularin variants. Furthermore, protein phosphatase inhibition-based assays for these toxins are not specific and respond to other environmental protein phosphatase inhibitors, such as okadaic acid, calyculin A, and tautomycin. We addressed the problem of specificity in the analysis of protein phosphatase inhibitors by combining immunoassay-based detection of the toxins with a colorimetric protein phosphatase inhibition system in a single assay, designated the colorimetric immuno-protein phosphatase inhibition assay (CIPPIA). Polyclonal antibodies against microcystin-LR were used in conjunction with protein phosphatase inhibition, which enabled seven purified microcystin variants (microcystin-LR, -D-Asp3-RR, -LA, -LF, -LY, -LW, and -YR) and nodularin to be distinguished from okadaic acid, calyculin A, and tautomycin. A range of microcystin- and nodularin-containing laboratory strains and environmental samples of cyanobacteria were assayed by CIPPIA, and the results showed good correlation (R2 = 0.94, P < 0.00001) with the results of high-performance liquid chromatography with diode array detection for toxin analysis. The CIPPIA procedure combines ease of use and detection of low concentrations with toxicity assessment and specificity for analysis of microcystins and nodularins. PMID:11157261

  5. Direct Quantification of Carotenoids in Low Fat Baby Foods Via Laser Photoacoustics and Colorimetric Index *

    NASA Astrophysics Data System (ADS)

    Dóka, O.; Ajtony, Zs.; Bicanic, D.; Valinger, D.; Végvári, Gy.


    Carotenoids are important antioxidants found in various foods including those for nutrition of infants. In this investigation, the total carotenoid content (TCC) of nine different commercially available baby foods was quantified using colorimetric index * obtained via reflectance colorimetry (RC) and by laser photoacoustic spectroscopy (LPAS) at 473 nm. The latter requires a minimum of sample preparation and only a one time calibration step which enables practically direct quantification of TCC. Results were verified versus UV-Vis spectrophotometry (SP) as the reference technique. It was shown that RC and LPAS (at 473 nm) provide satisfactory results for *, = 0.9925 and = 0.9972, respectively. Other color indices do not show a correlation with TCC. When determining the TCC in baby foods containing tomatoes, it is necessary to select a different analytical wavelength to compensate for the effect of lycopene's presence in the test samples.

  6. Direct colorimetric determination of formaldehyde in textile fabrics and other materials

    SciTech Connect

    Chrastil, J.; Reinhardt, R.M.


    A colorimetric method for direct determination of formaldehyde in textile fabrics and other materials is described. Color development and breaking formaldehyde bonds of the analyzed material occur simultaneously in the same reaction mixture without destruction of the material. The method is based on the color reaction of formaldehyde with indole-3-acetic acid or tryptophan. Common inorganic salts, higher aliphatic aldehydes, carbohydrates, amino acids (except tryptophan), and many other organic compounds do not react and do not interfere with the color reaction. Some interferences have been exhibited by acetaldehyde and glyoxal. The method was simple, accurate, and relatively insensitive to the reaction conditions. Only very small amounts of material are needed, and the reaction proceeds at room temperature. Different kinds of polymeric materials have been analyzed successfully (cotton, wool, plastics, collagen, wood, and furs). Most of the dyed fabrics or other materials could be analyzed in the same manner because under the reaction conditions the dyes were not extracted in the reaction mixture.

  7. A G-quadruplex DNAzyme-based colorimetric method for facile detection of Alicyclobacillus acidoterrestris.


    Liu, Tao; Zhang, Xiao; Zhu, Wenxin; Liu, Wei; Zhang, Daohong; Wang, Jianlong


    The rapid and sensitive detection of Alicyclobacillus acidoterrestris (AA) has become very important due to the frequent occurrence of fruit juice spoilage by AA. In the present study, using guaiacol, both as the metabolic product of AA related to its concentration and as a green colorimetric substrate of G-quadruplex DNAzyme, a novel G-quadruplex DNAzyme-based colorimetric method for a rapid detection of AA has been developed for the first time. Under optimal conditions, AA has been successfully detected in the concentration range of 10(2)-10(5) cfu mL(-1) with a detection limit of 85 cfu mL(-1). The recoveries ranging from 71.8% to 115.7% with relative standard deviation from 1.2% to 6.6% in spiked apple and orange juice samples were obtained. Results demonstrate that the sensitivity and precision of the developed method is comparable with most other analytical methods and is prominently rapid than them. We believe that the work provides a novel and effective approach and is beneficial for monitoring and reducing the risk of AA contaminations during the process of fruit juice production.

  8. Paper-based vapor detection of hydrogen peroxide: colorimetric sensing with tunable interface.


    Xu, Miao; Bunes, Benjamin R; Zang, Ling


    Vapor detection of hydrogen peroxide still remains challenging for conventional sensing techniques, though such vapor detection implies important applications in various practical areas, including locating IEDs. We report herein a new colorimetric sensor system that can detect hydrogen peroxide vapor down to parts per billion level. The sensory materials are based on the cellulose microfibril network of paper towels, which provide a tunable interface for modification with Ti(IV) oxo complexes for binding and reacting with H(2)O(2). The Ti(IV)-peroxide bond thus formed turns the complex from colorless to bright yellow with an absorption maximum around 400 nm. Such complexation-induced color change is exclusively selective for hydrogen peroxide, with no color change observed in the presence of water, oxygen, common organic reagents or other chelating reagents. This paper-based sensor material is disposable and one-time use, representing a cheap, simple approach to detect peroxide vapors. The reported sensor system also proves the technical feasibility of developing enhanced colorimetric sensing using nanofibril materials that will provide plenty of room to enlarge the surface area (by shrinking the fiber size), so as to enhance the surface interaction with gas phase.

  9. Highly sensitive colorimetric sensor for Hg(2+) detection based on cationic polymer/DNA interaction.


    Zhu, Yingyue; Cai, Yilin; Zhu, Yibo; Zheng, Lixue; Ding, Jianying; Quan, Ying; Wang, Limei; Qi, Bin


    The detection of ultralow concentrations of mercury is a currently significant challenge. Here, a novel strategy is proposed: the colorimetric detection of Hg(2+) based on the aggregation of gold nanoparticles (AuNPs) driven by a cationic polymer. In this three-component system, DNA combines electrostatically with phthalic diglycol diacrylate (PDDA) in a solution of AuNPs. In the presence of Hg(2+), thymine (T)-Hg(2+)-T induced hairpin turns are formed in the DNA strands, which then do not interact with PDDA, enabling the freed PDDA to subsequently facilitate aggregation of the AuNPs. Thus, according to the change in color from wine-red to blue-purple upon AuNPs aggregation, a colorimetric sensor is established to detect Hg(2+). Under optimal conditions, the color change is clearly seen with the naked eye. A linear range of 0.25-500nM was obtained by absorption spectroscopy with a detection limit of approximately 0.15nM. Additionally, the proposed method shows high selectivity toward Hg(2+) in the presence of other heavy metal ions. Real sample analysis was evaluated with the use of lake water and the results suggest good potential for practical application.

  10. Colorimetric detection of glucose based on gold nanoparticles coupled with silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Gao, Yan; Wu, Yiting; Di, Junwei


    We have coupled gold nanoparticles (AuNPs) with silver nanoparticles (AgNPs) to assemble a plasmonic sensing platform for colorimetric detection of glucose. In this system, small AuNPs ( 4 nm) can act as glucose oxidase (GOD) mimic enzyme to catalytically oxidize glucose in the presence of oxygen, producing hydrogen peroxide, which dissolves AgNPs to lead the color changes. Glucose can be detected not only by naked eyes (from yellow to red) but also by spectrophotometer in the concentration range of 5-70 μM, with detection limit of 3 μM. More importantly, we found that L-cysteine added in the system can markedly improve the selectivity for the detection of glucose. The proposed method was used to application for the detection of glucose in human serum with satisfactory results. This system is simple and low cost without using any enzymes and organic chromogenic agents.

  11. Recent progress in luminescent and colorimetric chemosensors for detection of thiols.


    Jung, Hyo Sung; Chen, Xiaoqiang; Kim, Jong Seung; Yoon, Juyoung


    In the past few decades, the development of optical probes for thiols has attracted great attention because of the biological importance of the thiol-containing molecules such as cysteine (Cys), homocysteine (Hcy), and glutathione (GSH). This tutorial review focuses on various thiol detection methods based on luminescent or colorimetric spectrophotometry published during the period 2010-2012. The discussion covers a diversity of sensing mechanisms such as Michael addition, cyclization with aldehydes, conjugate addition-cyclization, cleavage of sulfonamide and sulfonate esters, thiol-halogen nucleophilic substitution, disulfide exchange, native chemical ligation (NCL), metal complex-displace coordination, and nanomaterial-related and DNA-based chemosensors.

  12. Nucleic acid-coupled colorimetric analyte detectors


    Charych, Deborah H.; Jonas, Ulrich


    The present invention relates to methods and compositions for the direct detection of analytes and membrane conformational changes through the detection of color changes in biopolymeric materials. In particular, the present invention provide for the direct colorimetric detection of analytes using nucleic acid ligands at surfaces of polydiacetylene liposomes and related molecular layer systems.

  13. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.


    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill


    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  14. Copper chromogenic reaction based colorimetric immunoassay for rapid and sensitive detection of a tumor biomarker.


    Li, Bo; Lai, Guosong; Zhang, Haili; Hu, Shengli; Yu, Aimin


    A new colorimetric immunoassay method was developed for the rapid and sensitive detection of a tumor biomarker of carcinoembryonic antigen (CEA) by combination of a magnetic bead (MB)-based sandwich immunoassay and a copper chromogenic reaction. The magnetic immunoassay platform was constructed through the covalent immobilization of the capture antibody on the surface of carboxylated magnetic beads. After immuno-recognition of CEA, signal antibody-functionalized copper oxide nanoparticle (CuO NP) probes were applied for sandwich immunoreaction to form an immunocomplex. The CuO NP labels quantitatively captured onto the immunocomplex were then dissolved in acid solution to release high-content copper ions. Based on the coordination of these ions with the newly synthesized chromogenic agent of 1,2-diphenyl-2-(2-(pyridin-2-yl)hydrazono)ethanone, a red complex was produced for the colorimetric signal readout, resulting in the successful construction of a sensitive immunoassay method for CEA detection. Under the optimum conditions, this method showed a wide linear range over three orders of magnitude and a low detection limit of 26 pg/mL. Besides, this method showed excellent performance with low cost, rapid and convenient operation as well as satisfactory reproducibility, stability and accuracy, thus providing great potentials for practical applications.

  15. Simple colorimetric detection of doxycycline and oxytetracycline using unmodified gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Li, Jie; Fan, Shumin; Li, Zhigang; Xie, Yuanzhe; Wang, Rui; Ge, Baoyu; Wu, Jing; Wang, Ruiyong


    The interaction between tetracycline antibiotics and gold nanoparticles was studied. With citrate-coated gold nanoparticles as colorimetric probe, a simple and rapid detection method for doxycycline and oxytetracycline has been developed. This method relies on the distance-dependent optical properties of gold nanoparticles. In weakly acidic buffer medium, doxycycline and oxytetracycline could rapidly induce the aggregation of gold nanoparticles, resulting in red-to-blue (or purple) colour change. The experimental parameters were optimized with regard to pH, the concentration of the gold nanoparticles and the reaction time. Under optimal experimental conditions, the linear range of the colorimetric sensor for doxycycline/oxytetracycline was 0.06-0.66 and 0.59-8.85 μg mL-1, respectively. The corresponding limit of detection for doxycycline and oxytetracycline was 0.0086 and 0.0838 μg mL-1, respectively. This assay was sensitive, selective, simple and readily used to detect tetracycline antibiotics in food products.

  16. Gold Nanoparticle-based Colorimetric Assay for Selenium Detection via Hydride Generation.


    Cao, Guoming; Xu, Fujian; Wang, Shan-Ling; Xu, Kailai; Hou, Xiandeng; Wu, Peng


    Gold nanoparticles (AuNPs)-based colorimetric assays are of particular interest since molecular events can be easily read out with the color changes of AuNPs by naked eye. However, the molecular recognitions occur almost exclusively in the liquid phase, i.e., the interaction between target analytes and AuNPs is always proceeded in the presence of sample matrix. Since the aggregation of the unmodified AuNPs is prone to be influenced by the ionic strength of the solution, sample matrix will cause undesirable interference. Here, we proposed a new type of AuNP-based colorimetric assay, in which target analyte selenium was first converted to its hydride chemical vapor (H2Se) and then delivered into the solution of AuNPs to induce color change. Therefore, sample matrix (for example, high salinity) were eliminated, leading to excellent selectivity and free of sample matrix. With the aid of hydride generation, the proposed method offered a detection limit of 0.05 μM with UV-vis detection and 1 μM with naked eye. Sucessful application of this method for selenium detection in biological and enviromental samples was demonstrated.

  17. Gold nanoparticle aggregation-based colorimetric assay for β-casein detection in bovine milk samples.


    Li, Y S; Zhou, Y; Meng, X Y; Zhang, Y Y; Song, F; Lu, S Y; Ren, H L; Hu, P; Liu, Z S; Zhang, J H


    Traditional Kjeldahl method, used for quality evaluation of bovine milk, has intrinsic defects of time-consuming sample preparation and two analyses to determine the difference between non-protein nitrogen content and total protein nitrogen content. Herein, based upon antibody functionalized gold nanoparticles (AuNPs), we described a colorimetric method for β-casein (β-CN) detection in bovine milk samples. The linear dynamic range and the LOD were 0.08-250 μg mL(-1), and 0.03 μg mL(-1) respectively. In addition, the real content of β-CN in bovine milk was measured by using the developed assay. The results are closely correlated with those from Kjeldahl method. The advantages of β-CN triggered AuNP aggregation-based colorimetric assay are simple signal generation, the high sensitivity and specificity as well as no need of complicated sample preparation, which make it for on-site detection of β-CN in bovine milk samples.

  18. Colorimetric Sensor Arrays for the Detection and Identification of Chemical Weapons and Explosives

    PubMed Central

    Kangas, Michael J.; Burks, Raychelle M.; Atwater, Jordyn; Lukowicz, Rachel M.; Williams, Pat; Holmes, Andrea E.


    ABSTRACT There is a significant demand for devices that can rapidly detect chemical–biological–explosive (CBE) threats on-site and allow for immediate responders to mitigate spread, risk, and loss. The key to an effective reconnaissance mission is a unified detection technology that analyzes potential threats in real time. In addition to reviewing the current state of the art in the field, this review illustrates the practicality of colorimetric arrays composed of sensors that change colors in the presence of analytes. This review also describes an outlook toward future technologies, and describes how they could possibly be used in areas such as war zones to detect and identify hazardous substances. PMID:27636675

  19. Nanomolar colorimetric quantitative detection of Fe3 + and PPi with high selectivity

    NASA Astrophysics Data System (ADS)

    Li, Zhanxian; Li, Haixia; Shi, Caixia; Yu, Mingming; Wei, Liuhe; Ni, Zhonghai


    A novel rhodamine and 8-hydroxyquinoline-based derivative was synthesized, which is shown to act as a colorimetric chemosensor for Fe3 + in aqueous solution with high selectivity over various environmentally and biologically relevant metal ions and anions with a distinct color change from colorless to pink in very fast response time (< 1 min). Fe3 + can be detected quantitatively in the concentration range from 6.7 to 16 μM and the detection limit (LOD) on UV-vis response of the sensor can be as low as 15 nM. The 'in situ' prepared Fe3 + complex (1 ṡ Fe) showed high selectivity toward PPi against many common anions, and sensitivity (the LOD can be as low as 71 nM). In addition, both the chemosensor and the 'in situ' prepared Fe3 + complex are reusable for the detection of Fe3 + and PPi respectively.

  20. Novel pyridyl based azo-derivative for the selective and colorimetric detection of nickel(II)

    NASA Astrophysics Data System (ADS)

    Biswas, Sujan; Acharyya, Samik; Sarkar, Deblina; Gharami, Saswati; Mondal, Tapan Kumar


    A highly sensitive and selective pyridyl based colorimetric chemosensor (H2L) for the efficient detection of Ni2 + has been reported. The synthesized chemosensor H2L is highly efficient in detecting Ni2 + even in the presence of other metal ions that commonly co-exist with Ni2 +. H2L also shows distinct color change from green to deep red visible under naked eye due to specific binding with Ni2 +. This color change is due to formation of a new band at 510 nm upon gradual addition of Ni2 +. The association constant has been found to be 1.27 × 105 M- 1 with limit of detection (LOD) of 8.3 × 10- 7 M. Electronic structure of the H2L-Ni2 + complex and sensing mechanism have been interpreted theoretically by DFT and TDDFT calculations.

  1. Chemically-modified cellulose paper as smart sensor device for colorimetric and optical detection of hydrogen sulfate in water.


    Rull-Barrull, Jordi; d'Halluin, Martin; Le Grognec, Erwan; Felpin, François-Xavier


    A portable, recyclable and highly selective paper-based sensor device for the colorimetric and optical detection of hydrogen sulfate anions in water was developed. The detection system features a rhodamine-based sensor covalently grafted onto the highly hydrophilic surface of cellulose paper.

  2. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.


    Koo, Kevin M; Wee, Eugene J H; Trau, Matt


    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  3. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt


    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  4. Beetroot-Pigment-Derived Colorimetric Sensor for Detection of Calcium Dipicolinate in Bacterial Spores

    PubMed Central

    Gonçalves, Letícia Christina Pires; Da Silva, Sandra Maria; DeRose, Paul C.; Ando, Rômulo Augusto; Bastos, Erick Leite


    In this proof-of-concept study, we describe the use of the main red beet pigment betanin for the quantification of calcium dipicolinate in bacterial spores, including Bacillus anthracis. In the presence of europium(III) ions, betanin is converted to a water-soluble, non-luminescent orange 1∶1 complex with a stability constant of 1.4×105 L mol–1. The addition of calcium dipicolinate, largely found in bacterial spores, changes the color of the aqueous solution of [Eu(Bn)+] from orange to magenta. The limit of detection (LOD) of calcium dipicolinate is around 2.0×10–6 mol L–1 and the LOD determined for both spores, B. cereus and B. anthracis, is (1.1±0.3)×106 spores mL–1. This simple, green, fast and low cost colorimetric assay was selective for calcium dipicolinate when compared to several analogous compounds. The importance of this work relies on the potential use of betalains, raw natural pigments, as colorimetric sensors for biological applications. PMID:24019934

  5. Rational design of aminoanthraquinones for colorimetric detection of heavy metal ions in aqueous solution.


    Ranyuk, Elena; Uglov, Alexei; Meyer, Michel; Bessmertnykh Lemeune, Alla; Denat, Franck; Averin, Alexei; Beletskaya, Irina; Guilard, Roger


    A family of water-soluble colorimetric chemosensors incorporating an anthraquinone signalling subunit functionalized with a polyamine chain that bears hydrophilic diethoxyphosphoryl moieties was prepared with the aim of assaying metal cations. The outstanding UV-Vis absorption properties of the 1-aminoanthraquinone chromophore allowed the efficient visual detection and quantification of copper(II) ions by chelators L(1)-L(3) in buffered aqueous solution. Moreover, the visible response of L(2) is not interfered by addition of large excesses of 13 common metal ions, whereas chemosensor L(3) produces also a color change in the presence of equimolar amounts of lead(II). Considering the 134 nm gap between both absorption maxima, simultaneous colorimetric quantification of lead and copper can be envisaged. Detailed potentiometric and spectrophotometric analysis of Cu(2+) complexation by L(2) and L(3), as well as Pb(2+) and Cd(2+) by L(3) was undertaken in order to gain a deeper insight into the pH-dependent speciation and understanding the color changing process. Furthermore, the inner coordination sphere of the [PbL(3)](2+) complex was probed by NMR spectroscopy.

  6. Detecting Optic Atrophy in Multiple Sclerosis Patients Using New Colorimetric Analysis Software: From Idea to Application.


    Bambo, Maria Pilar; Garcia-Martin, Elena; Perez-Olivan, Susana; Larrosa-Povés, José Manuel; Polo-Llorens, Vicente; Gonzalez-De la Rosa, Manuel


    Neuro-ophthalmologists typically observe a temporal pallor of the optic disc in patients with multiple sclerosis. Here, we describe the emergence of an idea to quantify these optic disc color changes in multiple sclerosis patients. We recruited 12 multiple sclerosis patients with previous optic neuritis attack and obtained photographs of their optic discs. The Laguna ONhE, a new colorimetric software using hemoglobin as the reference pigment in the papilla, was used for the analysis. The papilla of these multiple sclerosis patients showed greater pallor, especially in the temporal sector. The software detected the pallor and assigned hemoglobin percentages below normal reference values. Measurements of optic disc hemoglobin levels obtained with the Laguna ONhE software program had good ability to detect optic atrophy and, consequently, axonal loss in multiple sclerosis patients. This new technology is easy to implement in routine clinical practice.

  7. Detection of meat-borne trimethylamine based on nanoporous colorimetric sensor arrays.


    Xiao-wei, Huang; Zhi-hua, Li; Xiao-bo, Zou; Ji-yong, Shi; Han-ping, Mao; Jie-wen, Zhao; Li-min, Hao; Mel, Holmes


    Trimethylamine (TMA) is a key measurement indicator for meat spoilage. In order to develop simple, cheap, and sensitive sensors for TMA detection, a nanoporous colorimetric sensor array (NCSA) was developed. A sol-gel method has been used to obtain TiO2 nanoporous film as substrate material to improve the sensitivity and stability of the CSA. The sensor enabled the visual detection of TMA gas from the permissible exposure limits (PEL) 10 ppm to 60 ppb concentrations with significant response. Principal component analysis (PCA) was used to characterize the functional relationship between the color difference data and TMA concentrations. Furthermore, the NCSA was used to predict the presence of TMA in Yao-meat. A partial least square (PLS) prediction model was obtained with the correlation coefficients of 0.896 and 0.837 in calibration and prediction sets, respectively. This research suggested that the NCSA offers a useful technology for quality evaluation of TMA in meat.

  8. Colorimetric As (V) detection based on S-layer functionalized gold nanoparticles.


    Lakatos, Mathias; Matys, Sabine; Raff, Johannes; Pompe, Wolfgang


    Herein, we present simple and rapid colorimetric and UV/VIS spectroscopic methods for detecting anionic arsenic (V) complexes in aqueous media. The methods exploit the aggregation of S-layer-functionalized spherical gold nanoparticles of sizes between 20 and 50 nm in the presence of arsenic species. The gold nanoparticles were functionalized with oligomers of the S-layer protein of Lysinibacillus sphaericus JG-A12. The aggregation of the nanoparticles results in a color change from burgundy-red for widely dispersed nanoparticles to blue for aggregated nanoparticles. A detailed signal analysis was achieved by measuring the shift of the particle plasmon resonance signal with UV/VIS spectroscopy. To further improve signal sensitivity, the influence of larger nanoparticles was tested. In the case of 50 nm gold nanoparticles, a concentration of the anionic arsenic (V) complex lower than 24 ppb was detectable.

  9. Colorimetric detection of biological hydrogen sulfide using fluorosurfactant functionalized gold nanorods.


    Zhang, Xuan; Zhou, Wenjuan; Yuan, Zhiqin; Lu, Chao


    As a well-known environmental pollutant but also an important gaseous transmitter, the specific detection of hydrogen sulfide (H2S) is significant in biological systems. In this study, fluorosurfactant functionalized gold nanorods (FSN-AuNRs) have been proposed to act as selective colorimetric nanoprobes for H2S. With the combination of strong gold-S interactions and small FSN bilayer interstices, FSN-AuNRs demonstrate favorable selectivity and sensitivity toward H2S over other anions and small biological molecules. The practical application of the present method in biological H2S detection was validated with human and mouse serum samples. Moreover, the proposed nanoprobe can also be used for evaluating the activity of H2S synthetase.

  10. Simple and Sensitive Paper-Based Device Coupling Electrochemical Sample Pretreatment and Colorimetric Detection.


    Silva, Thalita G; de Araujo, William R; Muñoz, Rodrigo A A; Richter, Eduardo M; Santana, Mário H P; Coltro, Wendell K T; Paixão, Thiago R L C


    We report the development of a simple, portable, low-cost, high-throughput visual colorimetric paper-based analytical device for the detection of procaine in seized cocaine samples. The interference of most common cutting agents found in cocaine samples was verified, and a novel electrochemical approach was used for sample pretreatment in order to increase the selectivity. Under the optimized experimental conditions, a linear analytical curve was obtained for procaine concentrations ranging from 5 to 60 μmol L(-1), with a detection limit of 0.9 μmol L(-1). The accuracy of the proposed method was evaluated using seized cocaine samples and an addition and recovery protocol.

  11. "Naked-eye" colorimetric and "turn-on" fluorometric chemosensors for reversible Hg2+ detection.


    Wanichacheva, Nantanit; Praikaew, Panida; Suwanich, Thanapat; Sukrat, Kanjarat


    Two new Hg(2+)-colorimetric and fluorescent sensors based on 2-[3-(2-aminoethylsulfanyl) propylsulfanyl]ethanamine covalently bound to one and two units of rhodamine-6G moieties, 1 and 2, were synthesised, and their sensing behaviors toward metal ions were investigated by UV/Vis and fluorescence spectroscopy. Upon the addition of Hg(2+), the sensors exhibited highly sensitive "turn-on" fluorescence enhancement as well as a color change from colorless to pink, which was readily noticeable for naked eye detection. Especially, 1 exhibited the reversible behavior and revealed a very high selectivity in the presence of competitive ions, particularly Cu(2+), Ag(+), Pb(2+), Ca(2+), Cd(2+), Co(2+), Fe(2+), Mn(2+), Na(+), Ni(2+), K(+), Ba(2+), Li(+) and Zn(2+), with a low detection limit of 1.7 ppb toward Hg(2+).

  12. New colorimetric screening assays for the directed evolution of fungal laccases to improve the conversion of plant biomass

    PubMed Central


    Background Fungal laccases are multicopper oxidases with huge applicability in different sectors. Here, we describe the development of a set of high-throughput colorimetric assays for screening laccase libraries in directed evolution studies. Results Firstly, we designed three colorimetric assays based on the oxidation of sinapic acid, acetosyringone and syringaldehyde with λmax of 512, 520 and 370 nm, respectively. These syringyl-type phenolic compounds are released during the degradation of lignocellulose and can act as laccase redox mediators. The oxidation of the three compounds by low and high-redox potential laccases evolved in Saccharomyces cerevisiae produced quantifiable and linear responses, with detection limits around 1 mU/mL and CV values below 16%. The phenolic substrates were also suitable for pre-screening mutant libraries on solid phase format. Intense colored-halos were developed around the yeast colonies secreting laccase. Furthermore, the oxidation of violuric acid to its iminoxyl radical (λmax of 515 nm and CV below 15%) was devised as reporter assay for laccase redox potential during the screening of mutant libraries from high-redox potential laccases. Finally, we developed three dye-decolorizing assays based on the enzymatic oxidation of Methyl Orange (470 nm), Evans Blue (605 nm) and Remazol Brilliant Blue (640 nm) giving up to 40% decolorization yields and CV values below 18%. The assays were reliable for direct measurement of laccase activity or to indirectly explore the oxidation of mediators that do not render colored products (but promote dye decolorization). Every single assay reported in this work was tested by exploring mutant libraries created by error prone PCR of fungal laccases secreted by yeast. Conclusions The high-throughput screening methods reported in this work could be useful for engineering laccases for different purposes. The assays based on the oxidation of syringyl-compounds might be valuable tools for

  13. Colorimetric chemosensor of symmetrical benzoylthiourea derivatives as for detection of Cu2+ in aqueous solution

    NASA Astrophysics Data System (ADS)

    Hamedan, N. A.; Hasan, S.; Zaki, H. M.; Alias, N. Z.


    A novel receptor, designed with a combination of oxygen (O), nitrogen (N) and sulfur (S) -binding sites for metal ions was synthesized. Ortho (A), meta (B) and para (C) bearing benzoyl thiourea were designed and synthesized with triamine group to apply as colorimetric chemosensors for detection of Cu2+. The structure was confirmed by characterized the compound using Elemental analysis, Fourier Infrared (FTIR) and proton Nuclear Magnetic Resonance (1H NMR) spectroscopy. Functional groups of C=O, N-H, C=N and C=S were found at 1677 cm-1, 3240 cm-1, 1591 cm-1, 1024 cm-1 respectively while 1H NMR shows peaks of alkane (CH2), benzene (Ar-H), CONH, CSNH at 3.68 – 4.14, 7.16 – 7.86, 8.74, and 9.2 respectively. Elemental analysis for A, B and C C20H21N5O2S2Br2 found was compatible with the expected theoretical calculation. For an application, all of these three sensors showed excellent colorimetric specific selectivity and high sensitivity for Cu2+ in acetonitrile/water binary solutions, so only A was selected for further studies towards sensitivity. When Cu2+ was added to the solution of A, a dramatic color change from yellow to green, while other cations Fe2+, Zn2+, Ni2+, Co2+, Cr3+ and Mn2+ did not interfere with the recognition process for Cu2+. The detection limit of the sensor C toward Cu2+ was 1.15 x 10-5 M, which is less sensitive that sensor A and B with a detection limit of 6.2 x 10-6 M and 1.5 x 10-6 M respectively. This indicated that the sensor A and B might be useful as an efficient chemical sensor.

  14. Highly sensitive colorimetric detection of lead using maleic acid functionalized gold nanoparticles.


    Ratnarathorn, Nalin; Chailapakul, Orawon; Dungchai, Wijitar


    Highly sensitive colorimetric detection for Pb(2+) has been developed using maleic acid (MA) functionalized GNP. The -COOH on MA was used to modify GNP surface whereas the other -COOH functional group have strong affinity to coordination behavior of Pb(2+) allowing the selective formation more than other ions. MA-GNPs solution changed from red to blue color after the addition of Pb(2+) due to nanoparticle aggregation. The different optical absorption and discriminate of particle size between the MA-GNPs solution with and without Pb(2+) were characterized by UV-visible spectroscopy and transmission electron microscopy (TEM), respectively. The color intensity as a function of Pb(2+) concentration gave a linear response in the range of 0.0-10.0 µg L(-1) (R(2)=0.990). The detection limit was found at 0.5 µg L(-1) by naked eye and can be completed the analysis within 15 min. The MA-GNPs aggregated with Pb(2+) showed high selectivity when was compared to other metal ions (As(3+), Ca(2+), Cd(2+), Co(2+), Cu(2+), Fe(3+), Hg(2+), Mg(2+), Mn(2+), Ni(2+), Pb(2+) and Zn(2+)) and anions (Cl(-), NO3(-) and SO4(2-)). Our proposed method was also applied for the determination of Pb(2+) in real drinking water samples from 5 sources. The result of real water samples were not statistically significant different from the standard methods at the 95% confidence level (pair t-test method). Moreover, we evaluated our proposed method for the determination of trace Pb(2+) concentration in real breast milk samples. The recoveries were acceptable and ranged from 101 to 104% for spiked Pb(2+) in real breast milk samples. Thus, MA-GNP colorimetric sensing provides a simple, rapid, sensitive, easy-to-use, inexpensive and low detection limit for the monitoring of Pb(2+).

  15. A fast, sensitive and easy colorimetric assay for chitinase and cellulase activity detection

    PubMed Central


    Background Most of the current colorimetric methods for detection of chitinase or cellulase activities on the insoluble natural polymers chitin and cellulose depend on a chemical redox reaction. The reaction involves the reducing ends of the hydrolytic products. The Schales’ procedure and the 3,5-dinitrosalicylic acid (DNS) method are two examples that are commonly used. However, these methods lack sensitivity and present practical difficulties of usage in high-throughput screening assays as they require boiling or heating steps for color development. Results We report a novel method for colorimetric detection of chitinase and cellulase activity. The assay is based on the use of two oxidases: wild-type chito-oligosaccharide oxidase, ChitO, and a mutant thereof, ChitO-Q268R. ChitO was used for chitinase, while ChitO-Q268R was used for cellulase activity detection. These oxidases release hydrogen peroxide upon the oxidation of chitinase- or cellulase-produced hydrolytic products. The hydrogen peroxide produced can be monitored using a second enzyme, horseradish peroxidase (HRP), and a chromogenic peroxidase substrate. The developed ChitO-based assay can detect chitinase activity as low as 10 μU within 15 minutes of assay time. Similarly, cellulase activity can be detected in the range of 6 to 375 mU. A linear response was observed when applying the ChitO-based assay for detecting individual chito-oligosaccharides and cello-oligosaccharides. The detection limits for these compounds ranged from 5 to 25 μM. In contrast to the other commonly used methods, the Schales’ procedure and the DNS method, no boiling or heating is needed in the ChitO-based assays. The method was also evaluated for detecting hydrolytic activity on biomass-derived substrates, that is, wheat straw as a source of cellulose and shrimp shells as a source of chitin. Conclusion The ChitO-based assay has clear advantages for the detection of chitinase and cellulase activity over the conventional

  16. Functional surface modification of natural cellulose substances for colorimetric detection and adsorption of Hg2+ in aqueous media.


    Zhang, Xuehai; Huang, Jianguo


    Immobilization of ruthenium dye or mercaptosilane monolayer onto metal oxide ultrathin film pre-coated cellulose nanofibres of natural cellulose substances yielded colorimetric sensing materials with high sensitivity and selectivity as well as good reversibility, and trapping materials with high efficiency for detection and adsorption of Hg(2+) ions in aqueous media.

  17. Colorimetric Detection of Plasmodium vivax in Urine Using MSP10 Oligonucleotides and Gold Nanoparticles

    PubMed Central

    Alnasser, Yossef; Ferradas, Cusi; Clark, Taryn; Calderon, Maritza; Gurbillon, Alejandro; Gamboa, Dionicia; McKakpo, Uri S.; Quakyi, Isabella A.; Bosompem, Kwabena M.; Sullivan, David J.; Vinetz, Joseph M.; Gilman, Robert H.


    Plasmodium vivax is the most prevalent cause of human malaria in the world and can lead to severe disease with high potential for relapse. Its genetic and geographic diversities make it challenging to control. P. vivax is understudied and to achieve control of malaria in endemic areas, a rapid, accurate, and simple diagnostic tool is necessary. In this pilot study, we found that a colorimetric system using AuNPs and MSP10 DNA detection in urine can provide fast, easy, and inexpensive identification of P. vivax. The test exhibited promising sensitivity (84%), high specificity (97%), and only mild cross-reactivity with P. falciparum (21%). It is simple to use, with a visible color change that negates the need for a spectrometer, making it suitable for use in austere conditions. Using urine eliminates the need for finger-prick, increasing both the safety profile and patient acceptance of this model. PMID:27706158

  18. Smartphone based health accessory for colorimetric detection of biomarkers in sweat and saliva.


    Oncescu, Vlad; O'Dell, Dakota; Erickson, David


    The mobile health market is rapidly expanding and portable diagnostics tools offer an opportunity to decrease costs and increase the availability of healthcare. Here we present a smartphone based accessory and method for the rapid colorimetric detection of pH in sweat and saliva. Sweat pH can be correlated to sodium concentration and sweat rate in order to indicate to users the proper time to hydrate during physical exercise and avoid the risk of muscle cramps. Salivary pH below a critical threshold is correlated with enamel decalcification, an acidic breakdown of calcium in the teeth. We conduct a number of human trials with the device on a treadmill to demonstrate the ability to monitor changes in sweat pH due to exercise and electrolyte intake and predict optimal hydration. Additionally, we perform trials to measure salivary pH over time to monitor the effects of diet on oral health risks.

  19. Bio-functionalized silver nanoparticles: a novel colorimetric probe for cysteine detection.


    Borase, Hemant P; Patil, Chandrashekhar D; Salunkhe, Rahul B; Suryawanshi, Rahul K; Kim, Beom S; Bapat, Vishwas A; Patil, Satish V


    Chemical interactions between nanoparticles and biomolecules are vital for applying nanoparticles in medicine and life science. Development of sensitive, rapid, low-cost, and eco-friendly sensors for the detection of molecules acting as disease indicator is need of an hour. In the present investigation, a green trend for silver nanoparticle synthesis was followed using leaf extract of Calotropis procera. Silver nanoparticles exhibited surface plasmon absorption peak at 421 nm, spherical shape with average size of 10 nm, and zeta potential of -22.4 mV. The as-synthesized silver nanoparticles were used for selective and sensitive detection of cysteine. Cysteine induces aggregation in stable silver nanoparticles owing to selective and strong interaction of -SH group of cysteine with silver nanoparticle surface. Cysteine-induced silver nanoparticle aggregation can be observed visually by change in color of silver nanoparticles from yellow to pink. Cysteine concentration was estimated colorimetrically by measuring absorption at surface plasmon wavelength. Limit of detection for cysteine using silver nanoparticles is ultralow, i.e., 100 nM. The mechanistic insight into cysteine detection by silver nanoparticles was investigated using FT-IR, TEM, DLS, and TLC analysis. Proposed method can be applied for the detection of cysteine in blood plasma and may give rise to a new insight into development of eco-friendly fabricated nanodiagnostic device in future.

  20. Colorimetric detection of melamine based on methanobactin-mediated synthesis of gold nanoparticles.


    Xin, Jia-ying; Zhang, Lan-xuan; Chen, Dan-dan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu


    A simple and rapid field-portable colorimetric method for the detection of melamine in liquid milk was reported. Methanobactin (Mb) could reduce Au (III) to Au (0) and mediate the synthesis of gold nanoparticles (Au-NPs). Upon the addition of melamine, melamine interacted with oxazolone ring of Mb, which interrupted the formation of Au-NPs. Melamine could also stimulate the aggregation of formed Au-NPs. In this paper, these characteristics have been used to detect melamine in liquid milk by naked eyes observation with a detection limit of 5.56 × 10(-6)M (0.7 mg/kg). Further, the plasmon absorbance of the formed Au-NPs allowed the quantitative detection of melamine by UV-vis spectrometer. A linear correlation was existed between the absorbance and the melamine concentration ranging from 3.90 × 10(-7)M to 3.97 × 10(-6)M with a correlation coefficient of 0.9685. The detection limit (3σ) obtained by UV-vis spectrum was as low as 2.38 × 10(-7)M (i.e., 0.03 mg/kg).

  1. Highly sensitive and selective colorimetric detection of cartap residue in agricultural products.


    Liu, Wei; Zhang, Daohong; Tang, Yafan; Wang, Yashan; Yan, Fei; Li, Zhonghong; Wang, Jianlong; Zhou, H Susan


    The residue of pesticide has posed a serious threat to human health. Fast, broad-spectrum detection methods are necessary for on-site screening of various types of pesticides. With citrate-coated Au nanoparticles (Au NPs) as colorimetric probes, a visual and spectrophotometric method for rapid assay of cartap, which is one of the most important pesticides in agriculture, is reported for the first time. Based on the color change of Au colloid solution from wine-red to blue resulting from the aggregation of Au NPs, cartap could be detected in the concentration range of 0.05-0.6 mg/kg with a low detection limit of 0.04 mg/kg, which is much lower than the strictest cartap safety requirement of 0.1 mg/kg. Due to the limited research on the rapid detection of cartap based on Au NPs, the performance of the present method was evaluated through aggregation kinetics, interference influence, and sample pretreatment. To further demonstrate the selectivity and applicability of the method, cartap detection is realized in cabbage and tea with excellent analyte concentration recovery. These results demonstrate that the present method provides an easy and effective way to analyze pesticide residue in common products, which is of benefit for the rapid risk evaluation and on-site screening of pesticide residue.

  2. Comparative Evaluation of Colorimetric Microtiter Plate Systems for Detection of Herpes Simplex Virus in Cerebrospinal Fluid

    PubMed Central

    Tang, Yi-Wei; Rys, Paul N.; Rutledge, Barbara J.; Mitchell, P. Shawn; Smith, Thomas F.; Persing, David H.


    In the past few years, application of the PCR to the detection of herpes simplex virus (HSV) DNA in the cerebrospinal fluid (CSF) from patients with encephalitis and meningitis has become standard laboratory practice. However, from an operational perspective, the true diagnostic value of PCR in this setting is yet to be realized because most laboratories subject the amplification products to lengthy probe hybridization procedures by Southern blotting. As alternatives to Southern blotting, we evaluated colorimetric microtiter plate (MTP) systems from ViroMed Laboratories, Inc. (PrimeCapture), CPG, Inc. (Quanti-PATH), and Incstar Corp. (GEN-ETI-K), in addition to a system developed at the Mayo Clinic with the PCR ELISA system (Boehringer Mannheim Corp.). We tested PCR products from 86 clinical CSF specimens submitted to our Molecular Microbiology Laboratory. The CSF specimens used had to have sufficient volume for comparative analysis. By conventional Southern blotting methods, 54 were positive and 32 were negative for HSV DNA. Compared with Southern blotting, the sensitivity and specificity were 63.0 and 100.0%, respectively, for the PrimeCapture system, 98.2 and 96.9%, respectively, for the Quanti-PATH system, 98.2 and 100.0%, respectively, for the GEN-ETI-K system, and 100.0 and 96.9%, respectively, for the Mayo system. All four MTP systems had turnaround times 12 to 24 h less than that for Southern blotting. There were no significant differences in costs or technologist time between the Mayo system and Southern blotting. Other features of the Mayo system include type-specific genotypic identification of HSV and the potential for determination of drug resistance by DNA sequencing. Overall, we found that colorimetric MTP systems were likely to improve test turnaround times and patient care at no additional cost. PMID:9705419

  3. A novel colorimetric triple-helix molecular switch aptasensor for ultrasensitive detection of tetracycline.


    Ramezani, Mohammad; Mohammad Danesh, Noor; Lavaee, Parirokh; Abnous, Khalil; Mohammad Taghdisi, Seyed


    Detection methods of antibiotic residues in blood serum and animal derived foods are of great interest. In this study a colorimetric aptasensor was designed for sensitive, selective and fast detection of tetracycline based on triple-helix molecular switch (THMS) and gold nanoparticles (AuNPs). As a biosensor, THMS shows distinct advantages including high stability, sensitivity and preserving the selectivity and affinity of the original aptamer. In the absence of tetracycline, THMS is stable, leading to the aggregation of AuNPs by salt and an obvious color change from red to blue. In the presence of tetracycline, aptamer binds to its target, signal transduction probe (STP) leaves the THMS and adsorbs on the surface of AuNPs. So the well-dispersed AuNPs remain stable against salt-induced aggregation with a red color. The presented aptasensor showed high selectivity toward tetracyclines with a limit of detection as low as 266 pM for tetracycline. The designed aptasensor was successfully applied to detect tetracycline in serum and milk.

  4. A novel colorimetric competitive aptamer assay for lysozyme detection based on superparamagnetic nanobeads.


    Mishra, Rupesh K; Hayat, Akhtar; Mishra, Geetesh K; Catanante, Gaëlle; Sharma, Vinay; Marty, Jean-Louis


    Lysozyme (Lys) commonly presents in wines and are known to cause toxicological impact on human health. The need of highly sensitive and reliable detection methods are evident in such matrix. In this work, we developed a competitive aptamer based assay for detection of Lys by employing carboxylated magnetic beads as a support to immobilize the target molecule Lys. The used aptamer sequence was biotinylated which further binds with Streptavidin-Alkaline phosphatase (Stp-ALP) in the micro wells. Colorimetric tests were performed in order to optimize different experimental parameters. The Lys assay showed a good linearity in the range of 5-140nM with a limit of detection (LOD) 10nM. The mid-point value (IC50) 110nM and the analysis time (60min) validated the developed aptasensor as a promising tool for routine use. The assay displayed good recoveries of Lys in the range 99.00-99.27% and was demonstrated for the detection of Lys in wine samples.

  5. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.


    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed


    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria.

  6. Seed-mediated grown silver nanoparticles as a colorimetric sensor for detection of ascorbic acid.


    Rostami, Simindokht; Mehdinia, Ali; Jabbari, Ali


    A simple and sensitive approach was demonstrated for detection of ascorbic acid (AA) based on seed-mediated growth of silver nanoparticles (Ag NPs). According to the seeding strategy, silver ions existing in the growth solution were reduced to silver atoms on the surface of silver seeds via redox reaction between silver ions and AA. This process -led to appear an absorption band in near 420nm owing to the localized surface plasmon resonance peak of the generated Ag NPs. This change in absorption spectra of Ag NPs caused a change in color of the mixture from colorless to yellow. It was found that the changes in absorption intensity at 420nm have a good relationship with the concentration of AA. Also, detection of AA was achieved through the established colorimetric sensor in the range of 0.25-25μM with detection limit of 0.054μM. Moreover, the selectivity of the method was evaluated with considering potential interferences. The method showed high selectivity toward AA rather than potential interferences and coexisted molecules with AA. It was successfully applied for detection and determination of AA in pharmaceutical tablets and commercial lemonade.

  7. A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticles.


    Ma, Xiaoyuan; Song, Liangjing; Zhou, Nixin; Xia, Yu; Wang, Zhouping


    A simple, fast and convenient colorimetric aptasensor was fabricated for the detection of Salmonella typhimurium (S. typhimurium) which was based on the color change effect of gold nanoparticles (GNPs). S. typhimurium is one of the most common causes of food-associated disease. Aptamers with specific recognition toward S. typhimurium was modified to the surface of prepared GNPs. They play a role for the protection of GNPs from aggregation toward high concentrations of NaCl. With the addition of S. typhimurium, aptamers preferably combined to S. typhimurium and the protection effect was broken. With more S. typhimurium, more aptamers detached from GNPs. In such a situation, the exposed GNPs would aggregated to some extent with the addition of NaCl. The color changed from red, purple to blue which could be characterized by UV-Vis spectrophotometer. The absorbance spectra of GNPs redshifted constantly and the intensity ratio of A700/A521 changed regularly. This could be calculated for the basis of quantitative detection of S. typhimurium from 10(2)cfu/mL to 10(7)cfu/mL. The obtained linear correlation equation was y=0.1946x-0.2800 (R(2)=0.9939) with a detection limit as low as 56cfu/mL. This method is simple and rapid, results in high sensitivity and specificity, and can be used to detect actual samples.

  8. Colorimetric Detection of Some Highly Hydrophobic Flavonoids Using Polydiacetylene Liposomes Containing Pentacosa-10,12-diynoyl Succinoglycan Monomers

    PubMed Central

    Yun, Deokgyu; Jeong, Daham; Cho, Eunae; Jung, Seunho


    Flavonoids are a group of plant secondary metabolites including polyphenolic molecules, and they are well known for antioxidant, anti-allergic, anti-inflammatory and anti-viral propertied. In general, flavonoids are detected with various non-colorimetric detection methods such as column liquid chromatography, thin-layer chromatography, and electrochemical analysis. For the first time, we developed a straightforward colorimetric detection system allowing recognition of some highly hydrophobic flavonoids such as alpha-naphthoflavone and beta-naphthoflavone, visually using 10,12-pentacosadiynoic acid (PCDA) derivatized with succinoglycan monomers isolated from Sinorhizobium meliloti. Besides changes in visible spectrum, we also demonstrate fluorescence changes using our detection system in the presence of those flavonoids. The succinoglycan monomers attached to PCDA molecules may function as an unstructured molecular capturer for some highly hydrophobic flavonoids by hydrophobic interactions, and transmit their molecular interactions as a color change throughout the PCDA liposome. PMID:26600071

  9. Sensitive and specific colorimetric DNA detection by invasive reaction coupled with nicking endonuclease-assisted nanoparticles amplification.


    Zou, Bingjie; Cao, Xiaomei; Wu, Haiping; Song, Qinxin; Wang, Jianping; Kajiyama, Tomoharu; Kambara, Hideki; Zhou, Guohua


    Colorimetric DNA detection is preferable to methods in clinical molecular diagnostics, because no expensive equipment is required. Although many gold nanoparticle-based colorimetric DNA detection strategies have been developed to analyze DNA sequences of interest, few of them can detect somatic mutations due to their insufficient specificity. In this study, we proposed a colorimetric DNA detection method by coupling invasive reaction with nicking endonuclease-assisted nanoparticles amplification (IR-NEANA). A target DNA firstly produces many flaps by invasive reaction. Then the flaps are converted to targets of nicking reaction-assisted nanoparticles amplification by ligation reaction to produce the color change of AuNPs, which can be observed by naked eyes. The detection limit of IR-NEANA was determined as 1pM. Most importantly, the specificity of the method is high enough to pick up as low as 1% mutant from a large amount of wild-type DNA backgrounds. The EGFR gene mutated at c.2573 T>G in 9 tissue samples from non-small cell lung cancer patients were successfully detected by using IR-NEANA, suggesting that our proposed method can be used to detect somatic mutations in biological samples.

  10. Colorimetric paper-based detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes of agricultural water.


    Bisha, Bledar; Adkins, Jaclyn A; Jokerst, Jana C; Chandler, Jeffrey C; Pérez-Méndez, Alma; Coleman, Shannon M; Sbodio, Adrian O; Suslow, Trevor V; Danyluk, Michelle D; Henry, Charles S; Goodridge, Lawrence D


    This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (µPADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the µPAD. Alternatively, digital images of the reacted µPADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24 hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

  11. Field-deployable colorimetric biosensor system for the rapid detection of pathogenic organisms

    NASA Astrophysics Data System (ADS)

    Duy, Janice

    The rapid identification of pathogenic organisms is necessary for recognizing and managing human and environmental health risks. Numerous detection schemes are available, but most are difficult to employ in non-laboratory settings due to their need for bulky, specialized equipment, multiple reagents, or highly trained personnel. To address this problem, a rapid, field-compatible biosensor system based on the colorimetric detection of nucleic acid hybrids was developed. Peptide nucleic acid (PNA) probes were used to capture ribosomal RNA sequences from environmental samples. Non-target nucleic acids, including single-base mismatches flanked by adenines and uracils, were removed with a micrococcal nuclease digestion step. Matched PNA-RNA hybrids remained intact and were indicated by the cyanine dye DiSC2(5). PNA-containing duplexes function as templates for the aggregation of DiSC2(5), visualized as a change in solution color from blue to purple. This transition can be measured as an increase in the solution absorbance at 540 nm (dye aggregate) at the expense of the dye monomer peak at 650 nm. These concomitant spectral changes were used to calculate a "hybridization signal" using the ratio A aggregate/Amonomer ≈ A540/A650. Testing with pathogenic environmental samples was accomplished using two model organisms: the harmful algal bloom-causing dinoflagellate Alexandrium species, and the potato wart disease-causing fungus Synchytrium endobioticum. In both cases, the colorimetric approach was able to distinguish the targets with sensitivities rivaling those of established techniques, but with the advantages of decreased hands-on time and cost. Assay fieldability was tested with a portable colorimeter designed to quantify the dye-indicated hybridization signal and assembled from commercially available components. Side-by-side testing revealed no difference in the sensing performance of the colorimeter compared to a laboratory spectrophotometer (Pearson's r=0

  12. Ultrasmall Pt Nanoclusters as Robust Peroxidase Mimics for Colorimetric Detection of Glucose in Human Serum.


    Jin, Lihua; Meng, Zheng; Zhang, Yongqing; Cai, Shijie; Zhang, Zaihua; Li, Cong; Shang, Li; Shen, Yehua


    In this work, a new type of ultrasmall Pt nanoclusters (Pt NCs) has been prepared via a facile one-pot approach by using yeast extract as the reductant and stabilizer. Besides their excellent water-solubility, these yeast extract-stabilized Pt NCs also possess attractive peroxidase mimics property. They can efficiently catalyze the oxidation of 3,3,5,5-tetramethylbenzidine (TMB) in the coexistence of hydrogen peroxide (H2O2). Catalytic mechanism analysis suggested that the peroxidase mimics activity of these Pt NCs might originate from their characteristic of accelerating electron transfer between TMB and H2O2, and their enzymatic kinetics followed typical Michaelis-Menten theory. Based on these findings, we developed a new highly sensitive colorimetric method for glucose detection, and the limit of detection was calculated as low as 0.28 μM (S/N = 3). Further application of the present system for glucose detection in human serum has been successfully demonstrated, suggesting its promising utilization as robust peroxidase mimics in the clinical diagnosis, pharmaceutical and environmental chemistry fields.

  13. Colorimetric detection of copper in water using a Schiff base derivative

    NASA Astrophysics Data System (ADS)

    Peralta Domínguez, D.; Ramos-Ortiz, G.; Maldonado, J. L.; Rodriguez, M.; Meneses-Nava, M. A.; Barbosa-Garcia, O.; Santillan, R.; Farfán, N.


    Organic molecular sensors have the advantage of being used through an easy, fast, economical and reliable optical method for detecting toxic metal ions in our environment. In this work, we present a simple but highly specific organic ligand compound 5-Chloro-2-((E)-((E)-3-(4-(dimethylamino)phenyl)allylidene)amino)phenol (L1) that acts as a colorimetric sensor for ions in a mixture of acetonitrile/water (ratio 10:1, v:v). Binding interaction between L1 and various metal-ions has been established by ultraviolet-visible spectroscopic measurements that indicate favorable coordination of the ligand with selective metal ions, particularly, with copper. These results showed that the electronic transition band shape of L1 change after binding with copper in aqueous solution. L1 exhibited binding-induced color changes from yellow to pink one detected by the naked eye. This new sensor presented 2.5 × 10-6 M as limit detection, even under the presence of other metal ions.

  14. [Rapid Detection of Trace Dimethoate Pesticide Residues Based on Colorimetric Spectroscopy].


    Li, Wen; Sun, Ming; Li, Min-zan; Sun, Hong


    In order to detect dimethoate pesticide residues rapidly and safely, a feasible method based on colorimetric spectroscopy was developed. Because dimethoate is one of organophosphorus pesticides containing sulfur, its sulfenyl can react with Pd2+ to produce a yellow complex named palladium sulfide. PdCl2 was used as the color agent, which was dissolved in acetic acid instead of the common concentrated hydrochloric acid. The dimethoate solution was prepared by dissolving the commercial pesticides into distilled water at different concentrations. The pesticide samples were reacted with the same amount of PdC2 solution respectively. The absorbance spectra of the samples after coloring reaction were measured in the region of 300-900 nm by a spectrophotometer. The result showed that the effect of using acetic acid instead of concentrated hydrochloric acid was not only safe but also preferable, and 0.5 mg x kg(-1) was the minimum concentration of the pesticide that could be distinguished in the spectra. The result met the pesticide residue detecting requirements of part fruits and vegetables in the national standard GB2763-2012 regulations. Further studies on random 40 dimethoate samples from 0.5 to 88 mg x kg(-1) were carried out. Thirty samples were randomly selected to establish the training model and remaining 10 samples were used to test the model. The preprocessing methods were carried on the spectrum data such as normalization and smoothing to get a better effect through comparison their prediction results with the correlation coefficient (r) and the root mean square error of cross-validation (RMSEP). The principal component analysis (PCA) method and partial least squares (PLS) method were used to establish prediction models respectively in the different wave ranges. By calculating the correlation coefficient of dimethoate samples in 350-900 nm the maximum of 0.9572 was obtained at wavelength 458 nm, so 453-463 and 400-600 nm were selected as feather regions

  15. Rapid and sensitive detection of cholera toxin using gold nanoparticle-based simple colorimetric and dynamic light scattering assay.


    Khan, Sadia Afrin; DeGrasse, Jeffrey A; Yakes, Betsy Jean; Croley, Timothy R


    Herein, a rapid and simple gold nanoparticle based colorimetric and dynamic light scattering (DLS) assay for the sensitive detection of cholera toxin has been developed. The developed assay is based on the distance dependent properties of gold nanoparticles which cause aggregation of antibody-conjugated gold nanoparticles in the presence of cholera toxin resulting discernible color change. This aggregation induced color change caused a red shift in the plasmon band of nanoparticles which was measured by UV-Vis spectroscopy. In addition, we employed DLS assay to monitor the extent of aggregation in the presence of different concentration of cholera toxin. Our assay can visually detect as low as 10 nM of cholera toxin which is lower than the previously reported colorimetric methods. The reported assay is very fast and showed an excellent specificity against other diarrhetic toxins. Moreover, we have demonstrated the feasibility of our method for cholera toxin detection in local lake water.

  16. [Comparative research into sensitivity and specificity of immune-enzyme analysis with chemiluminescence and colorimetric detection for detecting antigens and antibodies to avian influenza viruses and newcastle disease].


    Vitkova, O N; Kapustina, T P; Mikhailova, V V; Safonov, G A; Vlasova, N N; Belousova, R V


    The goal of this work was to demonstrate the results of the development of the enzyme-linked immunosorbent tests with chemiluminescence detection and colorimetric detection of specific viral antigens and antibodies for identifying the avian influenza and the Newcastle disease viruses: high sensitivity and specificity of the immuno- chemiluminescence assay, which are 10-50 times higher than those of the ELISA colorimetric method. The high effectiveness of the results and the automation of the process of laboratory testing (using a luminometer) allow these methods to be recommended for including in primary screening tests for these infectious diseases.

  17. Folic acid functionalized silver nanoparticles with sensitivity and selectivity colorimetric and fluorescent detection for Hg2+ and efficient catalysis

    NASA Astrophysics Data System (ADS)

    Su, Dongyue; Yang, Xin; Xia, Qingdong; Zhang, Qi; Chai, Fang; Wang, Chungang; Qu, Fengyu


    In this research, folic acid functionalized silver nanoparticles (FA-AgNPs) were selected as a colorimetric and a ‘turn on’ fluorescent sensor for detecting Hg2+. After being added into Hg2+, AgNPs can emit stable fluorescence at 440 nm when the excitation wavelength is selected at 275 nm. The absorbance and fluorescence of the FA-AgNPs could reflect the concentration of the Hg2+ ions. Thus, we developed a simple, sensitive analytical method to detect Hg2+ based on the colorimetric and fluorescence enhancement of FA-AgNPs. The sensor exhibits two linear response ranges between absorbance and fluorescence intensity with Hg2+ concentration, respectively. Meanwhile, a detection limit of 1 nM is estimated based on the linear relationship between responses with a concentration of Hg2+. The high specificity of Hg2+ with FA-AgNPs interactions provided the excellent selectivity towards detecting Hg2+ over other metal ions (Pb2+, Mg2+, Zn2+, Ni2+, Cu2+, Co2+, Ca2+, Mn2+, Fe2+, Cd2+, Ba2+, Cr6+ and Cr3+). This will provide a simple, effective and multifunctional colorimetric and fluorescent sensor for on-site and real-time Hg2+ ion detection. The proposed method can be applied to the analysis of trace Hg2+ in lake water. Additionally, the FA-AgNPs can be used as efficient catalyst for the reduction of 4-nitrophenol and potassium hexacyanoferrate (III).

  18. Non-crosslinking gold nanoprobe-LAMP for simple, colorimetric, and specific detection of Salmonella typhi

    NASA Astrophysics Data System (ADS)

    Bozorgmehr, Ali; Yazdanparast, Razieh; Mollasalehi, Hamidreza


    In this study, we developed a non-crosslinking gold nanoprobe loop-mediated isothermal amplification (LAMP) method for nanodiagnosis of bacterial typhoid fever source, Salmonella typhi. Therefore, a unique region in the S. typhi genomic DNA was targeted for LAMP amplification using a specific set of four precisely designed primers. Also, for specific colorimetric visualization of the amplicons, a thiolated oligonucleotide probe, complementary to the single-stranded loop region of the amplicons between F2 and F1C segments, was designed. The probe was bound to the surface of gold nanoparticles via covalent bonds. Increasing the salt concentration in the detection reaction medium led to aggregation of nanoprobes in the blank and the negative vessels in a time-dependent form. That was followed by a change in the surface plasmon resonance (SPR) leading to blue/black color that was observable by the naked eyes after about 5 min. Meanwhile, the original pink/red color was retained in the positive sample due to the large interparticle spaces and the stability against the ionic strength elevation which persisted for about 30 min. The whole process of DNA extraction, amplification, and detection took less than 2 h with a sensitivity of 20 CFU/ml. The developed gold nanoprobe-LAMP could serve as a simple, rapid, and cost-effective method for nanodiagnosis of S. typhi in point-of-need applications.

  19. Screening and development of DNA aptamers as capture probes for colorimetric detection of patulin.


    Wu, Shijia; Duan, Nuo; Zhang, Weixiao; Zhao, Sen; Wang, Zhouping


    Patulin (PAT) is a kind of mycotoxin that has serious harmful impacts on both food quality and human health. A high-affinity ssDNA aptamer that specifically binds to patulin was generated using systemic evolution of ligands by exponential enrichment (SELEX) assisted by graphene oxide (GO). After 15 rounds of positive and negative selection, a highly enriched ssDNA pool was sequenced and the representative sequences were subjected to binding assays to evaluate their affinity and specificity. Of the eight aptamer candidates tested, the sequence PAT-11 bound to patulin with high affinity and excellent selectivity with a dissociation constant (Kd) of 21.83 ± 5.022 nM. The selected aptamer, PAT-11, was subsequently used as a recognition element to develop a detection method for patulin based on an enzyme-chromogenic substrate system. The colorimetric aptasensor exhibited a linear range from 50 to 2500 pg mL(-1), and the limit of detection was found to be 48 pg mL(-1). The results indicated that GO-SELEX technology was appropriate for the screening of aptamers against small-molecule toxins, offering a promising application for aptamer-based biosensors.

  20. Colorimetric detection of pathogenic bacteria using platinum-coated magnetic nanoparticle clusters and magnetophoretic chromatography.


    Kwon, Donghoon; Lee, Sanghee; Ahn, Myung Mo; Kang, In Seok; Park, Ki-Hwan; Jeon, Sangmin


    A colorimetric method that uses platinum-coated magnetic nanoparticle clusters (Pt/MNCs) and magnetophoretic chromatography is developed to detect pathogenic bacteria. Half-fragments of monoclonal Escherichia coli O157:H7 (EC) antibodies were functionalized to Pt/MNCs and used to capture E. coli bacteria in milk. After magnetic separation of free Pt/MNCs and Pt/MNC-EC complexes from the milk, a precision pipette was used to imbibe the E. coli-containing solution, then a viscous polyethylene glycol solution. Due to difference in viscosities, the solutions separate into two liquid layers inside the pipette tip. The Pt/MNC-EC complexes were separated from the free Pt/MNCs by applying an external magnetic field, then added to a tetramethylbenzidine (TMB) solution. Catalytic oxidation of TMB by Pt produced color changes of the solution, which enabled identification of the presence of 10 cfu mL(-1) E. coli bacteria with the naked eye. The total assay time including separation, binding and detection was 30 min.

  1. Colorimetric detection of DNA damage by using hemin-graphene nanocomposites

    NASA Astrophysics Data System (ADS)

    Wei, W.; Zhang, D. M.; Yin, L. H.; Pu, Y. P.; Liu, S. Q.


    A colorimetric method for detection of DNA damage was developed by using hemin-graphene nanosheets (H-GNs). H-GNs were skillfully synthesized by adsorping of hemin on graphene through π-π interactions. The as-prepared H-GNs possessed both the ability of graphene to differentiate the damage DNA from intact DNA and the catalytic action of hemin. The damaged DNA made H-GNs coagulated to different degrees from the intact DNA because there were different amount of negative charge exposed on their surface, which made a great impact on the solubility of H-GNs. As a result, the corresponding centrifugal supernatant of H-GNs solution showed different color in the presence of 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2, which could be discriminated by naked eyes or by ultraviolet (UV)-visible spectrometer. Based on this, the damaged effects of styrene oxide (SO), NaAsO2 and UV radiation on DNA were studied. Results showed that SO exerted most serious damage effect on DNA although all of them damaged DNA seriously. The new method for detection of DNA damage showed good prospect in the evaluation of genotoxicity of new compounds, the maximum limit of pesticide residue, food additives, and so on, which is important in the fields of food science, pharmaceutical science and pesticide science.

  2. Colorimetric-Based Detection of TNT Explosives Using Functionalized Silica Nanoparticles

    PubMed Central

    Idros, Noorhayati; Ho, Man Yi; Pivnenko, Mike; Qasim, Malik M.; Xu, Hua; Gu, Zhongze; Chu, Daping


    This proof-of-concept study proposes a novel sensing mechanism for selective and label-free detection of 2,4,6-trinitrotoluene (TNT). It is realized by surface chemistry functionalization of silica nanoparticles (NPs) with 3-aminopropyl-triethoxysilane (APTES). The primary amine anchored to the surface of the silica nanoparticles (SiO2-NH2) acts as a capturing probe for TNT target binding to form Meisenheimer amine–TNT complexes. A colorimetric change of the self-assembled (SAM) NP samples from the initial green of a SiO2-NH2 nanoparticle film towards red was observed after successful attachment of TNT, which was confirmed as a result of the increased separation between the nanoparticles. The shift in the peak wavelength of the reflected light normal to the film surface (λpeak) and the associated change of the peak width were measured, and a merit function taking into account their combined effect was proposed for the detection of TNT concentrations from 10−12 to 10−4 molar. The selectivity of our sensing approach is confirmed by using TNT-bound nanoparticles incubated in AptamerX, with 2,4-dinitrotoluene (DNT) and toluene used as control and baseline, respectively. Our results show the repeatable systematic color change with the TNT concentration and the possibility to develop a robust, easy-to-use, and low-cost TNT detection method for performing a sensitive, reliable, and semi-quantitative detection in a wide detection range. PMID:26046595

  3. Colorimetric Sensor Array Allows Fast Detection and Simultaneous Identification of Sepsis-Causing Bacteria in Spiked Blood Culture

    PubMed Central

    Mix, Samantha; Xu, Zeyu; Taba, Brian; Budvytiene, Indre; Berliner, Anders N.; Queralto, Nuria; Churi, Yair S.; Huang, Richard S.; Eiden, Michael; Martino, Raymond A.; Rhodes, Paul


    Sepsis is a medical emergency demanding early diagnosis and tailored antimicrobial therapy. Every hour of delay in initiating effective therapy measurably increases patient mortality. Blood culture is currently the reference standard for detecting bloodstream infection, a multistep process which may take one to several days. Here, we report a novel paradigm for earlier detection and the simultaneous identification of pathogens in spiked blood cultures by means of a metabolomic “fingerprint” of the volatile mixture outgassed by the organisms. The colorimetric sensor array provided significantly faster detection of positive blood cultures than a conventional blood culture system (12.1 h versus 14.9 h, P < 0.001) while allowing for the identification of 18 bacterial species with 91.9% overall accuracy within 2 h of growth detection. The colorimetric sensor array also allowed for discrimination between unrelated strains of methicillin-resistant Staphylococcus aureus, indicating that the metabolomic fingerprint has the potential to track nosocomial transmissions. Altogether, the colorimetric sensor array is a promising tool that offers a new paradigm for diagnosing bloodstream infections. PMID:24478493

  4. Colorimetric sensor array allows fast detection and simultaneous identification of sepsis-causing bacteria in spiked blood culture.


    Lim, Sung H; Mix, Samantha; Xu, Zeyu; Taba, Brian; Budvytiene, Indre; Berliner, Anders N; Queralto, Nuria; Churi, Yair S; Huang, Richard S; Eiden, Michael; Martino, Raymond A; Rhodes, Paul; Banaei, Niaz


    Sepsis is a medical emergency demanding early diagnosis and tailored antimicrobial therapy. Every hour of delay in initiating effective therapy measurably increases patient mortality. Blood culture is currently the reference standard for detecting bloodstream infection, a multistep process which may take one to several days. Here, we report a novel paradigm for earlier detection and the simultaneous identification of pathogens in spiked blood cultures by means of a metabolomic "fingerprint" of the volatile mixture outgassed by the organisms. The colorimetric sensor array provided significantly faster detection of positive blood cultures than a conventional blood culture system (12.1 h versus 14.9 h, P < 0.001) while allowing for the identification of 18 bacterial species with 91.9% overall accuracy within 2 h of growth detection. The colorimetric sensor array also allowed for discrimination between unrelated strains of methicillin-resistant Staphylococcus aureus, indicating that the metabolomic fingerprint has the potential to track nosocomial transmissions. Altogether, the colorimetric sensor array is a promising tool that offers a new paradigm for diagnosing bloodstream infections.

  5. Convenient, inexpensive quantification of elemental sulfur by simultaneous in situ reduction and colorimetric detection.


    Kwasniewski, Misha T; Allison, Rachel B; Wilcox, Wayne F; Sacks, Gavin L


    Rapid, inexpensive, and convenient methods for quantifying elemental sulfur (S(0)) with low or sub-μgg(-1) limits of detection would be useful for a range of applications where S(0) can act as a precursor for noxious off-aromas, e.g., S(0) in pesticide residues on winegrapes or as a contaminant in drywall. However, existing quantification methods rely on toxic reagents, expensive and cumbersome equipment, or demonstrate poor selectivity. We have developed and optimized an inexpensive, rapid method (∼15 min per sample) for quantifying S(0) in complex matrices. Following dispersion of the sample in PEG-400 and buffering, S(0) is quantitatively reduced to H(2)S in situ by dithiothreitol and simultaneously quantified by commercially available colorimetric H(2)S detection tubes. By employing multiple tubes, the method demonstrated linearity from 0.03 to 100 μg S(0) g(-1) for a 5 g sample (R(2)=0.994, mean CV=6.4%), and the methodological detection limit was 0.01 μg S(0) g(-1). Interferences from sulfite or sulfate were not observed. Mean recovery of an S(0) containing sulfur fungicide in grape macerate was 84.7% with a mean CV of 10.4%. Mean recovery of S(0) in a colloidal sulfur preparation from a drywall matrix was 106.6% with a mean CV of 6.9%. Comparable methodological detection limits, sensitivity, and recoveries were achieved in grape juice, grape macerate and with 1g drywall samples, indicating that the methodology should be robust across a range of complex matrices.

  6. A C-di-GMP-proflavine-hemin supramolecular complex has peroxidase activity--implication for a simple colorimetric detection.


    Nakayama, Shizuka; Roelofs, Kevin; Lee, Vincent T; Sintim, Herman O


    Herein, we demonstrate that the bacterial signaling molecule, c-di-GMP, can enhance the peroxidation of hemin when proflavine is present. The c-di-GMP-proflavine-hemin nucleotidezyme can oxidize the colorless compound 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ABTS, to the colored radical cation ABTS˙(+) and hence provides simple colorimetric detection of c-di-GMP at low micromolar concentrations.

  7. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob


    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  8. Gold nanoparticles mediated colorimetric assay for HIV-Tat protein detection

    NASA Astrophysics Data System (ADS)

    Hashwan, Saeed S. Ba; Ruslinda, A. Rahim; Fatin, M. F.; Gopinath, Subash C. B.; Thivina, V.; Tony, V. C. S.; Arshad, M. K. Md.; Hashim, U.


    Gold-nanoparticle (AuNP) based colorimetric assays have been formulated for different biomolecular interactions. With this assay the probe such as antibody immobilized on the Au surface and in the presence of appropriate binding partner (antigen), will interact with each other on the Au surface. By following this strategy, herein we formulated a detection system with two anti-HIV-Tat antibodies, Mono (McAb) - and polyclonal (PcAb) by immobilizing them independently with different AuNPs. Under this condition, these two antibodies are under dispersed condition, and in the presence of HIV-Tat antigen, these molecules will be connected and forms the aggregation of AuNPs. This strategy yield rapid results, can be monitored by the spectral changes in UV-Vis spectrophotometry. Experiments were performed with two different methods using two anti-HIV-Tats monoclonal and one Polyclonal antibody against the antigen HIV-Tat. Between these methods conjugation of HIV-Tat and McAb on the AuNP followed by addition of PcAb yielded better results.

  9. Revisiting noncovalent So2- amine chemistry: an indicator-displacement assay for colorimetric detection of So2.


    Leontiev, Alexander V; Rudkevich, Dmitry M


    A supramolecular approach for potential detection of SO2 is presented, which is based on the "old" donor-acceptor chemistry between SO2 and amines and includes an indicator-displacement assay. When amines were added to Zn-tetraphenylporphyrin 1 in CHCl3, the solution changed from red to dark green. A bathochromic shift of Deltalambda approximately 10 nm was observed for the Soret band, indicating the formation of 1*amine complexes. After this, SO2 gas was introduced, and the original red color of the solution was restored. The Soret band returned to its position for free porphyrin 1. The 1*amine complexes dissociated, and new SO2*amine adducts formed. Porphyrin 1 thus served as an indirect colorimetric indicator for SO2. The system discriminates between SO2 and such typical exhaust gases as COX, NOX, and H2O. From the indicator-displacement assay, the Kassoc values between 1000 and 30 000 M-1 for SO2*amine complexes were determined, which are comparable to those obtained by direct titration experiments between SO2 and the amines. Spectroscopic features of SO2*amine complexes are also presented.

  10. Colorimetric Sensor for Label Free Detection of Porcine PCR Product (ID: 18)

    NASA Astrophysics Data System (ADS)

    Ali, M. E.; Hashim, U.; Bari, M. F.; Dhahi, Th. S.


    This report described the use of 40±5 nm in diameter citrate-coated gold nanoparticles (GNPs) as colorimetric sensor to visually detect the presence of a 17-base swine specific conserved sequence and nucleotide mismatch in the mixed PCR products of pig, deer and shad cytochrome b genes. The size of these PCR amplicons was 109 base-pair and was amplified with a pair of common primers. Colloidal GNPs changed color from pinkish- red to purple-gray in 2 mM PBS buffer by losing its characteristic surface plasmon resonance peak at 530 nm and gaining new features between 620 and 800 nm in the absorption spectrum indicating strong aggregation. The particles were stabilized against salt induced aggregation, retained spectral features and characteristic color upon adsorption of single-stranded DNA. The PCR products without any additional processing were hybridized with a 17-nucleotide swine probe prior to exposure to GNPs. At a critical annealing temperature (55° C) that differentiated between the match and mismatch pairing, the probe was hybridized with the pig PCR product and dehybridized from the deer's and shad's. The interaction of dehybridized probe to GNPs prevented them from salt-induced aggregation, retaining their characteristic red color. The assay did not need any surface modification chemistry or labeling steps. The results were determined visually and validated by absorption spectroscopy. The entire assay (hybridization plus visual detection) was performed in less than 10 min. The assay obviated the need of complex RFLP, sequencing or blotting to differentiate the same size PCR products. We find the application of the assay for species assignment in food analysis, mismatch detection in genetic screening and homology study among closely related species.

  11. Detecting Extrasolar Planets Directly

    NASA Astrophysics Data System (ADS)

    Guenther, E. W.; Neuhäuser, R.; Huélamo, N.; Ott, T.; Brandner, W.; Alves, J.; Comerón, F.; Eckart, A.; Hatzes, A.

    Up to now, all extrasolar planets have been found by means of indirect methods. Direct detection of planets orbiting even the nearest stars seems at first glance to be impossible with present day equipment, because of the enormous difference in brightness between the star and the planet, and the small angular separation between them. However, young planets which are still in the contraction phase of evolution are comparatively bright in the infrared, and since many of the extrasolar planets detected have excentric orbits, where they are most of the time at a relatively large distance from the stars, the prospect of detecting young planets directly is much better. In fact, it is principle be possible to detect an extrasolar giant planet, if the planet is younger than 100 millon years, and if the distance is less than 100 pc. Three years ago we thus have embarked on a survey to observe more than one-hundred young, nearby stars in the near infrared. In this talk, we will review the status of the survey. In order to find out whether these stars have additionally a planet at a small distance from the star, we also carried out sensitive radial velocity observation of a subsample using an iodine-cell and the Echelle spectrograph of the Alfred-Jensch Telescope in Tautenburg.

  12. A novel colorimetric assay for rapid detection of cysteine and Hg²⁺ based on gold clusters.


    Wang, Yi-Wei; Tang, Shurong; Yang, Huang-Hao; Song, Hongbo


    Inhibition and recovery of the catalytic activity of bovine serum albumin-capped gold nanoclusters (BSA-AuNCs) is observed for the first time by introduction of cysteine and Hg(2+). The prepared BSA-AuNCs possess highly intrinsic peroxidase-like activity. It can catalyze the oxidation of 3, 3, 5, 5-tetramethylbenzidine by H2O2 to produce a blue colored product. Based on this phenomenon, a new colorimetric assay for rapid, selective and sensitive detection of cysteine and Hg(2+) in aqueous solution has been demonstrated. The interaction process between target molecule and BSA-AuNCs is very fast, so that the whole test can be completed within ten minutes. Moreover, the fabricated colorimetric sensor is simple and cost-effective, without the need of nucleic acid based recognition element and complicated washing, separation and labeling process, thus holds great promise for routine analysis of cysteine and Hg(2+) in real samples.

  13. Colorimetric detection of melamine based on p-chlorobenzenesulfonic acid-modified AuNPs

    NASA Astrophysics Data System (ADS)

    Li, Jianfang; Huang, Pengcheng; Wu, Fangying


    A highly selective and sensitive method is developed for colorimetric detection of melamine using gold nanoparticles (AuNPs) functionalized with p-chlorobenzenesulfonic acid. The addition of melamine induced the aggregation of AuNPs, as evidenced from the morphological characterizations and the color changed from red wine to blue, which could also be monitored by the UV-visible spectrometer and even naked eyes. This process caused a significant increase in the absorbance ratio (A650nm/A520nm) of p-chlorobenzenesulfonic acid-AuNPs. Under optimized conditions, the system exhibited a linear response to melamine in the range of 6.0 × 10-7-1.5 × 10-6 mol L-1 with a correlation coefficient of 0.997, and the limit of detection can even be 2.3 nM, which was much lower than some other methods and the safe limits (20 μM in both the USA and EU, 8.0 μM for infant formula in China, 1.2 μM in the CAC (Codex Alimentarius Commission) review for melamine in liquid infant formula). More importantly, the developed method presented excellent tolerance to coexisting common metal ions such as Ca2+, Zn2+, whose concentration is 1000 times of melamine, so that it had been applied to the analysis of melamine in liquid milk and milk powder with the recovery of 97.0-101 % and 100-103 %, respectively, indicating that the proposed method is quite a highly effective means to determine melamine in milk products.

  14. Efficient reaction based colorimetric probe for sensitive detection, quantification, and on-site analysis of nitrite ions in natural water resources.


    Adarsh, Nagappanpillai; Shanmugasundaram, Madhesh; Ramaiah, Danaboyina


    We have developed a novel aza-BODIPY probe for the sensitive colorimetric detection of the nitrite ions in the aqueous medium by a simple and direct method. This probe selectively recognizes the nitrite ions through a distinct visual color change from bright blue to intense green with a sensitivity of 20 ppb. Uniquely, this probe can be coated on a glass surface to fabricate a simple solid-state dipstick device that can be used for the visual detection of the nitrite ions in the presence of other competing anions in distilled as well as natural water resources like a sea, lake, and river. Furthermore, this probe can be used for the sensitive detection of the nitrate ions when coupled to a reduction step. Our results demonstrate that this probe not only can be used for the on-site analysis and quantification but also can replace the conventional spot test carried out for the nitrite ions in the laboratory practical experiments.

  15. Simple, field portable colorimetric detection device for organic peroxides and hydrogen peroxide


    Pagoria, Philip F.; Mitchell, Alexander R.; Whipple, Richard E.; Carman, M. Leslie; Reynolds, John G.; Nunes, Peter; Shields, Sharon J.


    A simple and effective system for the colorimetric determination of organic peroxides and hydrogen peroxide. A peroxide pen utilizing a swipe material attached to a polyethylene tube contains two crushable vials. The two crushable vials contain a colorimetric reagent separated into dry ingredients and liquid ingredients. After swiping a suspected substance or surface the vials are broken, the reagent is mixed thoroughly and the reagent is allowed to wick into the swipe material. The presence of organic peroxides or hydrogen peroxide is confirmed by a deep blue color.

  16. Synthetic multivalent DNAzymes for enhanced hydrogen peroxide catalysis and sensitive colorimetric glucose detection.


    Yang, Deng-Kai; Kuo, Chia-Jung; Chen, Lin-Chi


    A peroxidase-mimic DNAzyme is a G-quadruplex (G4) DNA-hemin complex, in which the G4-DNA resembles an apoenzyme, and hemin is the cofactor for hydrogen peroxide (H2O2) catalysis. Twenty-one-mer CatG4 is a well-proven G4-DNA as well as a hemin-binding aptamer for constituting a DNAzyme. This work studied if a multivalent DNAzyme with accelerated catalysis could be constructed using a multimeric CatG4 with hemin. We compared CatG4 monomer, dimer, trimer, and tetramer, which were prepared by custom oligo synthesis, for G4 structure formation. According to circular dichroism (CD) analysis, we found that a CatG4 multimer exhibited more active G4 conformation than the sum effect of equal-number CatG4 monomers. However, the DNAzyme kinetics was not improved monotonically along with the subunit number of a multimeric CatG4. It was the trivalent DNAzyme, trimeric CatG4:hemin, resulting in the rapidest H2O2 catalysis instead of a tetravalent one. We discovered that the trivalent DNAzyme's highest catalytic rate was correlated to its most stable hemin-binding G4 structure, evidenced by CD melting temperature analysis. Finally, a trivalent DNAzyme-based colorimetric glucose assay with a detection limit as low as 10 μM was demonstrated, and this assay did not need adenosine 5'-tri-phosphate disodium salt hydrate (ATP) as a DNAzyme boosting agent.

  17. Green synthesis of silver nanoparticle for the selective and sensitive colorimetric detection of mercury (II) ion.


    Kumar, Vijay; Singh, Devendra K; Mohan, Sweta; Bano, Daraksha; Gundampati, Ravi Kumar; Hasan, Syed Hadi


    An ecofriendly and zero cost approach has been developed for the photoinduced synthesis of more stable AgNPs using an aqueous extract of Murraya koenigii (AEM) as a reducing and stabilizing agent. The exposed reaction mixture of AEM and AgNO3 to sunlight turned dark brown which primarily confirmed the biosynthesis of AgNPs. The biosynthesis was monitored by UV-vis spectroscopy which exhibited a sharp SPR band at 430nm after 30min of sunlight exposure. The optimum conditions for biosynthesis of AgNPs were 30min of sunlight exposure, 2.0% (v/v) of AEM inoculuam dose and 4.0mM AgNO3 concentration. TEM analysis confirmed the presence of spherical AgNPs with average size 8.6nm. The crystalline nature of the AgNPs was confirmed by XRD analysis where the Bragg's diffraction pattern at (111), (200), (220) and (311) corresponded to face centered cubic crystal lattice of metallic silver. The surface texture was analyzed by AFM analysis where the average roughness of the synthesized AgNPs was found 1.8nm. FTIR analysis was recorded between 4000 and 400cm(-1) which confirmed the involvement of various functional groups in the synthesis of AgNPs. On the basis of the linear relationship between SPR band intensity and different concentration of Hg(2+), the synthesized AgNPs can be used for colorimetric detection of Hg(2+) with a linear range from 50nm to 500μM. Based on experimental findings, an oxidation-reduction mechanism between AgNPs and Hg(2+) was also proposed.

  18. An engineered nano-plasmonic biosensing surface for colorimetric and SERS detection of DNA-hybridization events

    NASA Astrophysics Data System (ADS)

    Heydari, Esmaeil; Thompson, David; Graham, Duncan; Cooper, Jonathan M.; Clark, Alasdair W.


    We report a versatile nanophotonic biosensing platform that enables both colorimetric detection and enhanced Raman spectroscopy detection of molecular binding events. Through the integration of electron-beam lithography, dip-pennanolithography and molecular self-assembly, we demonstrate plasmonic nanostructures which change geometry and plasmonic properties in response to molecularly-mediated nanoparticle binding events. These biologically-active nanostructured surfaces hold considerable potential for use as multiplexed sensor platforms for point-of-care diagnostics, and as scaffolds for a new generation of molecularly dynamic metamaterials.

  19. Label-free detection of specific DNA sequence-telomere using unmodified gold nanoparticles as colorimetric probes

    NASA Astrophysics Data System (ADS)

    Qi, Yingying; Li, Li; Li, Baoxin


    A simple and sensitive label-free colorimetric detection of telomere DNA has been developed. It was based on the color change of gold nanoparticles (AuNPs) due to DNA hybridization. UV-vis spectra and transmission electron microscopy (TEM) were used to investigate the change of AuNPs. Under the optimized conditions, the linear range for determination of telomere DNA was 5.7 × 10 -13 to 4.5 × 10 -6 mol/L. The detection limit (3 σ) of this method has decreased to pico-molar level.

  20. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline

    NASA Astrophysics Data System (ADS)

    He, Yi; Peng, Rufang


    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl4 with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (˜25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  1. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline.


    He, Yi; Peng, Rufang


    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl₄ with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (∼25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  2. A colorimetric aptasensor for sulfadimethoxine detection based on peroxidase-like activity of graphene/nickel@palladium hybrids.


    Wang, Aicheng; Zhao, Huimin; Chen, Xiaochi; Tan, Bing; Zhang, Yaobin; Quan, Xie


    A sensitive, rapid and label-free colorimetric aptasensor for sulfadimethoxine (SDM) detection was developed based on the tunable peroxidase-like activity of graphene/nickel@palladium nanoparticle (Gr/Ni@Pd) hybrids. The addition of the SDM aptamer could inhibit the peroxidase-like catalytic activity of the hybrids. However, the target SDM and aptamer could be triggered tightly and recover the catalytic activity of the Gr/Ni@Pd hybrids. Due to the peroxidase-like catalytic activity, Gr/Ni@Pd could catalyze the decomposition of H2O2 with releasing hydroxyl radicals which further oxidized reagent 3, 3', 5, 5'-Tetramethylbenzidine (TMB) to oxTMB accompanied with a colorless-to-blue color change. The original color change could be applied to obtain quantitative detection of SDM, due to the relationship between the concentration of the target and the color difference. As a result, this approach performed a linear response for SDM from 1 to 500 ng/mL with a limit detection of 0.7 ng/mL (S/N = 3) under the optimized conditions and realized the detection of SDM in spiked lake water samples. Therefore, this colorimetric aptasensor was an alternative assay for SDM detection in real water. Moreover, with its design principle, this work might be applied to detecting other small molecule by employing appropriate aptamer.

  3. Label-free colorimetric detection of cancer related gene based on two-step amplification of molecular machine.


    Xu, Huo; Wu, Dong; Li, Chen-Qiao; Lu, Zheng; Liao, Xiao-Yun; Huang, Jie; Wu, Zai-Sheng


    Highly sensitive detection of K-ras gene is of great significance in biomedical research and clinical diagnosis. Here, we developed a colorimetric biosensing system for the detection of proto-oncogene K-ras based on enhanced amplification effect of DNA molecular machine, where dual isothermal circular strand-displacement amplification (D-SDA) occurs on two arms in one-to-one correspondence. Specifically, we designed a primer-locked hairpin probe (HP) and a primer-contained linear polymerization template (PPT). In the presence of target gene, HP can hybridize with PPT, forming a DNA molecular machine with dual functional arms (called DFA-machine). Each of the two probes in this machine is able to be extended by polymerase on its counterpart species. Moreover, with the help of nicking endonuclease, the dual isothermal polymerization is converted into dual circular strand-displacement amplification, generating a large amount of anti-hemin aptamer-contained products. After binding to hemins, the aptamer/hemin duplex, horseradish peroxidase (HRP)-mimicking DNAzyme, was formed and catalyzed the oxidation of colorless ABTS by H2O2, producing a visible green color. The proposed colorimetric assay exhibits a wide linear range from 0.01 to 150nM with a low detection limit of 10pM. More interestingly, the mutations existing in target gene are easily observed by the naked eye. It should be noted that this colorimetric system was proved by the analysis of K-ras gene of SW620 cell lines. The simple and powerful DFA-machine is expected to provide promising potential in the sensitive detection of biomarkers for cancer diagnosis, prognosis and therapy.

  4. A colorimetric detection of acrylamide in potato chips based on nucleophile-initiated thiol-ene Michael addition.


    Hu, Qinqin; Fu, Yingchun; Xu, Xiahong; Qiao, Zhaohui; Wang, Ronghui; Zhang, Ying; Li, Yanbin


    Acrylamide (AA), a neurotoxin and a potential carcinogen, has been found in various thermally processed foods such as potato chips, biscuits, and coffee. Simple, cost-effective, and sensitive methods for the rapid detection of AA are needed to ensure food safety. Herein, a novel colorimetric method was proposed for the visual detection of AA based on a nucleophile-initiated thiol-ene Michael addition reaction. Gold nanoparticles (AuNPs) were aggregated by glutathione (GSH) because of a ligand-replacement, accompanied by a color change from red to purple. In the presence of AA, after the thiol-ene Michael addition reaction between GSH and AA with the catalysis of a nucleophile, the sulfhydryl group of GSH was consumed by AA, which hindered the subsequent ligand-replacement and the aggregation of AuNPs. Therefore, the concentration of AA could be determined by the visible color change caused by dispersion/aggregation of AuNPs. This new method showed high sensitivity with a linear range from 0.1 μmol L(-1) to 80 μmol L(-1) and a detection limit of 28.6 nmol L(-1), and especially revealed better selectivity than the fluorescence sensing method reported previously. Moreover, this new method was used to detect AA in potato chips with a satisfactory result in comparison with the standard methods based on chromatography, which indicated that the colorimetric method can be expanded for the rapid detection of AA in thermally processed foods.

  5. A pH-responsive colorimetric strategy for DNA detection by acetylcholinesterase catalyzed hydrolysis and cascade amplification.


    Guo, Yuehua; Yang, Kaili; Sun, Jiachen; Wu, Jie; Ju, Huangxian


    A pH-responsive colorimetric strategy was designed for sensitive and convenient biosensing by introducing acetylcholinesterase (AChE) catalyzed hydrolysis of acetylcholine to change solution pH and phenol red as an indicator. Using DNA as a target model, this technique was successfully employed for sensitive DNA analysis by labeling AChE to DNA. The sensitivity could be greatly improved by coupling a newly designed magnetic probe with target DNA-triggered nonenzymatic cascade amplification. In the presence of a help DNA (H) and the functional probe, the cascade assembly via toehold-mediated strand displacement released the AChE-conjugated sequence from magnetic beads, which could be simply separated from the reaction mixture to catalyze the hydrolysis of ACh in detection solution. The color change of detection solution from pink to orange-red, orange-yellow and ultimately yellow could be used for target DNA detection by naked eye and colorimetry with the absorbance ratio of detection solution at 558nm to 432nm as the signal. The nonenzymatically sensitized colorimetric strategy showed a linear range from 50pM to 50nM with a detection limit of 38pM, indicating a promising application in DNA analysis.

  6. Directional Antineutrino Detection

    NASA Astrophysics Data System (ADS)

    Safdi, B. R.; Suerfu, J.


    We propose the first truly directional antineutrino detector for antineutrinos near the threshold for the inverse beta decay (IBD) of hydrogen, with potential applications including the spatial mapping of geo-neutrinos, searches for stellar antineutrinos, and the monitoring of nuclear reactors. The detector consists of adjacent and separated target and neutron-capture layers. The IBD events, which result in a neutron and a positron, take place in the target layers. These layers are thin enough so that the neutrons escape without scattering elastically. The neutrons are detected in the thicker neutron-capture layers. The location of the IBD event is determined from the energy deposited by the positron as it slows in the medium and from the two gamma rays that come from the positron annihilation. Since the neutron recoils in the direction of the antineutrino's motion, a line may then be drawn between the IBD event location and the neutron-capture location to approximate the antineutrino's velocity. In some events, we may even measure the positron's velocity, which further increases our ability to reconstruct the antineutrino's direction of motion. Our method significantly improves upon previous methods by allowing the neutron to freely travel a long distance before diffusing and being captured. Moreover, our design is a straightforward modification of existing antineutrino detectors; a prototype could easily be built with existing technology. We verify our design through Monte Carlo simulations in Geant4, using commercially-available boron-loaded plastic scintillators for the target and neutron-capture layer materials. We are able to discriminate from background using multiple coincidence signatures within a short, ~microsecond time interval. We conclude that the detector could likely operate above ground with minimal shielding.

  7. Size-optimized galactose-capped gold nanoparticles for the colorimetric detection of heat-labile enterotoxin at nanomolar concentrations.


    Poonthiyil, Vivek; Golovko, Vladimir B; Fairbanks, Antony J


    The development of a galactose-capped gold nanoparticle-based colorimetric sensor for the detection of the lectin heat-labile enterotoxin is reported. Heat-labile enterotoxin is one of the pathogenic agents responsible for the intestinal disease called 'traveller's diarrhoea'. By means of specific interaction between galactose moieties attached to the surface of gold nanoparticles and receptors on the B-subunit of heat-labile enterotoxin (LTB), the gold nanoparticles reported here act as an efficient colorimetric sensor, which can detect the toxin at nanomolar concentrations. The effect of gold nanoparticle size on the detection sensitivity was investigated in detail. Amongst the various sizes of gold nanoparticles studied (2, 7, 12, and 20 nm), the 12 nm sized gold nanoparticles were found to be the most efficient, with a minimum heat-labile enterotoxin detection concentration of 100 nM. The red to purple colour change of the gold nanoparticle solution occurred within two minutes, indicating rapid toxin sensing.

  8. Highly-sensitive colorimetric detection of H2O2 based on the Pt@Te nanorods

    NASA Astrophysics Data System (ADS)

    Wan, Li-Juan; Huang, Xing-Jiu; Liu, Jin-Huai; Zhang, Zhong-Xiang; Hou, Shi-Li; Liu, Wei-Jing


    Te nanorods (NRs) were prepared from TeO2 in the presence of hydrazine hydrate without using any surfactants under ambient conditions. Te NRs were then used as sacrificial templates to prepare Pt@Te NRs by spontaneous redox galvanic replacement between Te and Pt ions. The as-synthesized Pt@Te NRs exhibit a strong catalytic activity for the colorimetric detection of H2O2 using 2, 2‧-azino-bis (3-ethylbenzo-thiazoline-6-sulfonic acid) diammonium salt (ABTS) as an indicator.

  9. Colorimetric Biosensor for Detection of Cancer Biomarker by Au Nanoparticle-Decorated Bi2Se3 Nanosheets.


    Xiao, Liangping; Zhu, Aimei; Xu, Qingchi; Chen, Ying; Xu, Jun; Weng, Jian


    The colorimetric biosensors have attracted intensive interest; however, their relatively low sensitivity limits their applications in clinic detection. Herein, we develop an effective colorimetric biosensor based on highly catalytic active Au nanoparticle-decorated Bi2Se3 (Au/Bi2Se3) nanosheets. Au/Bi2Se3 nanosheets are facilely synthesized by simply sonicating Au precursor with the as-synthesized Bi2Se3 nanosheets in aqueous solution. Because of the low redox potential and typical topological insulating properties, Bi2Se3 nanosheets is capable of providing and accumulating electrons on its surface. Such unique properties of Bi2Se3 nanosheets contribute to strong synergistic catalytic effects with Au nanoparticles, particularly when Au/Bi2Se3 nanosheets are utilized for catalyzing the reduction of 4-nitrophenol (4-NP) by NaBH4 (K = 386.67 s(-1)g(-1)). The excellent catalytic activity of Au/Bi2Se3 nanosheets can be "switched off" upon treatment of antibody of cancer biomarker such as anticarcinoembryonic antibody (anti-CEA). Addition of the corresponding antigen such as cancer biomarker carcinoembryonic antibody (CEA) can successively help "switch on" the catalytic activity of Au/Bi2Se3 nanosheets, where the resuming degree however depends on the antigen concentration. This cancer biomarker depended catalytic behavior therefore allows Au/Bi2Se3 nanosheets to be employed as a colorimetric sensor for detection of a particular cancer biomarker, for the reduction of 4-nitrophenol (4-NP) by NaBH4 itself involves apparent color change. The sensor shows high sensitivity and selectivity for the cancer biomarker, even for a concentration as low as 160 pg/mL for CEA, which fully satisfies the requirement for real clinical applications. The developed colorimetric sensor shows good generality for detection of different types of cancer biomarkers, such as α-fetoprotein (AFP) and prostate-specific antigen (PSA). Furthermore, real clinic sample analyzing result shows that the

  10. Multiplexed Colorimetric Solid-Phase Extraction

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.


    Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).

  11. Gold nanoparticles for the colorimetric and fluorescent detection of ions and small organic molecules

    NASA Astrophysics Data System (ADS)

    Liu, Dingbin; Wang, Zhuo; Jiang, Xingyu


    In recent years, gold nanoparticles (AuNPs) have drawn considerable research attention in the fields of catalysis, drug delivery, imaging, diagnostics, therapy and biosensors due to their unique optical and electronic properties. In this review, we summarized recent advances in the development of AuNP-based colorimetric and fluorescent assays for ions including cations (such as Hg2+, Cu2+, Pb2+, As3+, Ca2+, Al3+, etc) and anions (such as NO2-, CN-, PF6-, F-, I-, oxoanions), and small organic molecules (such as cysteine, homocysteine, trinitrotoluene, melamine and cocaine, ATP, glucose, dopamine and so forth). Many of these species adversely affect human health and the environment. Moreover, we paid particular attention to AuNP-based colorimetric and fluorescent assays in practical applications.

  12. Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing


    A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

  13. Facile colorimetric method for simple and rapid detection of endotoxin based on counterion-mediated gold nanorods aggregation.


    Wang, Yashan; Zhang, Daohong; Liu, Wei; Zhang, Xiao; Yu, Shaoxuan; Liu, Tao; Zhang, Wentao; Zhu, Wenxin; Wang, Jianlong


    Existence of endotoxin in food and injection products indicates bacterial contaminations and therefore poses threat to human health. Herein, a simple and rapid colorimetric method for the effective detection of endotoxin in food and injections based on counterion-mediated gold nanorods aggregation is first proposed. By taking advantage of the color change of unmodified gold nanorods resulted from endotoxin mediated gold nanorods aggregation, endotoxin could be detected in the concentration range of 0.01-0.6 μM. Further, we studied the performance of gold nanorods with different aspect ratios (2.7 and 3.3) in determination of endotoxin and found that gold nanorods with higher aspect ratio (AR) showed superiority in the sensing sensitivity of endotoxin. A good specificity for endotoxin, a detection limit of 0.0084 μM and recoveries ranging from 84% to 109% in spiked food and injection samples are obtained with the colorimetric method. Results demonstrate that the present method provides a novel and effective approach for on-site screening of endotoxin in common products, which is beneficial for monitoring and reducing the risk of bacterial contaminations in food and injections production.

  14. A sensitive aptasensor for colorimetric detection of adenosine triphosphate based on the protective effect of ATP-aptamer complexes on unmodified gold nanoparticles.


    Huo, Yuan; Qi, Liang; Lv, Xiao-Jun; Lai, Ting; Zhang, Jing; Zhang, Zhi-Qi


    Adenosine triphosphate (ATP) is the most direct source of energy in organisms. This study is the first to demonstrate that ATP-aptamer complexes provide greater protection for unmodified gold nanoparticles (AuNPs) against salt-induced aggregation than either aptamer or ATP alone. This protective effect was confirmed using transmission electron microscopy, dynamic light scattering, Zeta potential measurement, and fluorescence polarization techniques. Utilizing controlled particle aggregation/dispersion as a gauge, a sensitive and selective aptasensor for colorimetric detection of ATP was developed using ATP-binding aptamers as the identification element and unmodified AuNPs as the probe. This aptasensor exhibited a good linear relationship between the absorbance and the logarithm concentration of ATP within a 50-1000 nM range. ATP analogs such as guanosine triphosphate, uridine triphosphate and cytidine triphosphate resulted in little or no interference in the determination of ATP.

  15. A colorimetric method for highly sensitive and accurate detection of iodide by finding the critical color in a color change process using silver triangular nanoplates.


    Yang, Xiu-Hua; Ling, Jian; Peng, Jun; Cao, Qiu-E; Ding, Zhong-Tao; Bian, Long-Chun


    In this contribution, we demonstrated a novel colorimetric method for highly sensitive and accurate detection of iodide using citrate-stabilized silver triangular nanoplates (silver TNPs). Very lower concentration of iodide can induce an appreciable color change of silver TNPs solution from blue to yellow by fusing of silver TNPs to nanoparticles, as confirmed by UV-vis absorption spectroscopy and transmission electron microscopy (TEM). The principle of this colorimetric assay is not an ordinary colorimetry, but a new colorimetric strategy by finding the critical color in a color change process. With this strategy, 0.1 μM of iodide can be recognized within 30 min by naked-eyes observation, and lower concentration of iodide down to 8.8 nM can be detected using a spectrophotometer. Furthermore, this high sensitive colorimetric assay has good accuracy, stability and reproducibility comparing with other ordinary colorimetry. We believe this new colorimetric method will open up a fresh insight of simple, rapid and reliable detection of iodide and can find its future application in the biochemical analysis or clinical diagnosis.

  16. Ultrasensitive colorimetric detection of circulating tumor DNA using hybridization chain reaction and the pivot of triplex DNA

    NASA Astrophysics Data System (ADS)

    Li, Ruimin; Zou, Li; Luo, Yanwei; Zhang, Manjun; Ling, Liansheng


    This work presents an amplified colorimetric biosensor for circulating tumor DNA (ctDNA), which associates the hybridization chain reaction (HCR) amplification with G-Quadruplex DNAzymes activity through triplex DNA formation. In the presence of ctDNA, HCR occurs. The resulting HCR products are specially recognized by one sequence to include one GGG repeat and the other containing three GGG repeats, through the synergetic effect of triplex DNA and asymmetrically split G-Quadruplex forming. Such design takes advantage of the amplification property of HCR and the high peroxidase-like catalytic activity of asymmetrically split G-Quadruplex DNAzymes by means of triplex DNA formation, which produces color signals in the presence of ctDNA. Nevertheless, in the absence of ctDNA, no HCR happens. Thus, no triplex DNA and G-Quadruplex structure is formed, producing a negligible background. The colorimetric sensing platform is successfully applied in complex biological environments such as human blood plasma for ctDNA detection, with a detection limit corresponding to 0.1 pM. This study unambiguously uses triplex DNA forming as the pivot to integrate nucleic acid amplification and DNAzymes for producing a highly sensitive signal with low background.

  17. Multifunctional Janus hematite-silica nanoparticles: mimicking peroxidase-like activity and sensitive colorimetric detection of glucose.


    Lu, Chang; Liu, Xiangjiang; Li, Yunfeng; Yu, Fang; Tang, Longhua; Hu, Yanjie; Ying, Yibin


    The design and engineering of multifunctional nanostructures with multiple components and synergistic properties are in urgent demand for variety of acceptable biosensing platforms, enabling users to fulfill multiple tasks in a single nanosystem. Herein, we report using an asymmetric hematite-silica hybrid of Janus γ-Fe2O3/SiO2 nanoparticles (JFSNs) as a multifunctional biosensing platform for sensitive colorimetric detection of H2O2 and glucose. It was demonstrated that JFSNs exhibit an intrinsic peroxidase-like catalytic activity. Compared with natural enzyme, JFSNs nanoenzymes could be used over a wider range of pH and temperatures and were more stable over time. Importantly, besides its excellent catalytic activity, the asymmetric properties of the Janus nanoparticle enable it to form the multiple functional utilities for various biosensing applications, including the ease of surface modification without deactivation of catalytic activity and recoverable use by magnetic separation. Thus, we utilized JFSNs with glucose oxidase (GOx) immobilization for glucose-sensitive colorimetric detection, which exhibited both catalytic activity of glucose oxidase and peroxidase with high selectivity and acceptable reproducibility. By combining these two analysis systems into Janus particles, an all-in-one and reusable sensor for blood glucose was formed and has the capability for determination of glucose in complex samples such as serum. These results suggest that such Janus nanosystems have the potential to construct robust nanoarchitecture with multiple functionalities for various biosensing applications.

  18. Ultrasensitive colorimetric detection of circulating tumor DNA using hybridization chain reaction and the pivot of triplex DNA

    PubMed Central

    Li, Ruimin; Zou, Li; Luo, Yanwei; Zhang, Manjun; Ling, Liansheng


    This work presents an amplified colorimetric biosensor for circulating tumor DNA (ctDNA), which associates the hybridization chain reaction (HCR) amplification with G-Quadruplex DNAzymes activity through triplex DNA formation. In the presence of ctDNA, HCR occurs. The resulting HCR products are specially recognized by one sequence to include one GGG repeat and the other containing three GGG repeats, through the synergetic effect of triplex DNA and asymmetrically split G-Quadruplex forming. Such design takes advantage of the amplification property of HCR and the high peroxidase-like catalytic activity of asymmetrically split G-Quadruplex DNAzymes by means of triplex DNA formation, which produces color signals in the presence of ctDNA. Nevertheless, in the absence of ctDNA, no HCR happens. Thus, no triplex DNA and G-Quadruplex structure is formed, producing a negligible background. The colorimetric sensing platform is successfully applied in complex biological environments such as human blood plasma for ctDNA detection, with a detection limit corresponding to 0.1 pM. This study unambiguously uses triplex DNA forming as the pivot to integrate nucleic acid amplification and DNAzymes for producing a highly sensitive signal with low background. PMID:28276503

  19. Colorimetric monitoring of rolling circle amplification for detection of H5N1 influenza virus using metal indicator.


    Hamidi, Seyed Vahid; Ghourchian, Hedayatollah


    A new colorimetric method for monitoring of rolling circle amplification was developed. At first H5N1 target hybrids with padlock probe (PLP) and then PLP is circularized upon the action of T4 ligase enzyme. Subsequently, the circular probe is served as a template for hyperbranched rolling circle amplification (HRCA) by utilizing Bst DNA polymerase enzyme. By improving the reaction, pyrophosphate is produced via DNA polymerization and chelates the Mg(2+) in the buffer solution. This causes change in solution color in the presence of hydroxy naphthol blue (HNB) as a metal indicator. By using pH shock instead of heat shock and isothermal RCA reaction not only the procedure becomes easier, but also application of HNB for colorimetric detection of RCA reaction further simplifies the assay. The responses of the biosensor toward H5N1 were linear in the concentration range from 0.16 to 1.20 pM with a detection limit of 28 fM.

  20. Colorimetric detection of kanamycin based on analyte-protected silver nanoparticles and aptamer-selective sensing mechanism.


    Xu, Yuanyuan; Han, Tian; Li, Xiaqing; Sun, Linghao; Zhang, Yujuan; Zhang, Yuanshu


    In this work, a novel colorimetric detection method for kanamycin (Kana), a widely used aminoglycoside antibiotic, has been developed using unmodified silver nanoparticles (AgNPs) as sensing probe. The method is designed based on the finding that the analyte (Kana) can protect AgNPs against salt-induced aggregation, and nucleic acid aptamers can decrease the risk of false positives through an aptamer-selective sensing mechanism. By use of the proposed method, selective quantification of Kana can be achieved over the concentration range from 0.05 to 0.6 μg mL(-1) within 20 min. The detection limit is estimated to be 2.6 ng mL(-1), which is much lower than the allowed maximum residue limit. Further studies also demonstrate the applicability of the proposed method in milk samples, revealing that the method may possess enormous potential for practical detection of Kana in the future.

  1. Colorimetric and electrochemical phosphodiesterase inhibition assays for yessotoxin detection: development and comparison with LC-MS/MS.


    Campàs, Mònica; de la Iglesia, Pablo; Fernández-Tejedor, Margarita; Diogène, Jorge


    This work describes the development and applicability of two functional assays for the detection of yessotoxin (YTX), a polycyclic ether marine toxin produced by dinoflagellates. The assays are based on the interaction between this toxin and the phosphodiesterase (PDE) enzyme and the subsequent measurement of the enzyme activity by colorimetric and electrochemical methods. Firstly, several enzyme substrates were tested in order to select those able to be detected by colorimetry or electrochemistry after enzymatic hydrolysis. The substrates that provided the highest absorbance values and density currents were p-nitrophenyl phenylphosphonate and alpha-naphthyl phosphate, respectively. After optimisation of the experimental parameters, limits of detection of 0.8 and 0.6 microM were attained by colorimetry and electrochemistry, respectively. An inhibitory effect of YTX on the PDE activity was observed. The assays have been applied to the analysis of YTX production by Protoceratium reticulatum cultures, and results were compared with liquid chromatography-tandem mass spectrometry analysis.

  2. Simple Colorimetric Detection of Amyloid β-peptide (1-40) based on Aggregation of Gold Nanoparticles in the Presence of Copper Ions.


    Zhou, Yanli; Dong, Hui; Liu, Lantao; Xu, Maotian


    A simple method for specific colorimetric sensing of Alzheimer's disease related amyloid-β peptide (Aβ) is developed based on the aggregation of gold nanoparticles in the presence of copper ion. The detection of limit for Aβ(1-40) is 0.6 nM and the promising results from practical samples (human serum) indicate the great potential for the routine detection.

  3. A colorimetric biosensor for detection of attomolar microRNA with a functional nucleic acid-based amplification machine.


    Li, Dandan; Cheng, Wei; Yan, Yurong; Zhang, Ye; Yin, Yibing; Ju, Huangxian; Ding, Shijia


    A functional nucleic acid-based amplification machine was designed for simple and label-free ultrasensitive colorimetric biosensing of microRNA (miRNA). The amplification machine was composed of a complex of trigger template and C-rich DNA modified molecular beacon (MB) and G-rich DNA (GDNA) as the probe, polymerase and nicking enzyme, and a dumbbell-shaped amplification template. The presence of target miRNA triggered MB mediated strand displacement to cyclically release nicking triggers, which led to a toehold initiated rolling circle amplification to produce large amounts of GDNAs. The formed GDNAs could stack with hemin to form G-quadruplex/hemin DNAzyme, a well-known horseradish peroxidase (HRP) mimic, for catalyzing a colorimetric reaction. The modified MB improved the stringent target recognition and reduced background signal. The proposed sensing strategy showed very high sensitivity and selectivity with a wide dynamic range from 10 aM to 1.0 nM, and enabled successful visual analysis of trace amount of miRNA in real sample by the naked eye. This rapid and highly efficient signal amplification strategy provided a simple and sensitive platform for miRNA detection. It would be a versatile and powerful tool for clinical molecular diagnostics.

  4. “Naked-eye” colorimetric and “turn-on” fluorometric chemosensors for reversible Hg2+ detection

    NASA Astrophysics Data System (ADS)

    Wanichacheva, Nantanit; Praikaew, Panida; Suwanich, Thanapat; Sukrat, Kanjarat


    Two new Hg2+-colorimetric and fluorescent sensors based on 2-[3-(2-aminoethylsulfanyl) propylsulfanyl]ethanamine covalently bound to one and two units of rhodamine-6G moieties, 1 and 2, were synthesised, and their sensing behaviors toward metal ions were investigated by UV/Vis and fluorescence spectroscopy. Upon the addition of Hg2+, the sensors exhibited highly sensitive “turn-on” fluorescence enhancement as well as a color change from colorless to pink, which was readily noticeable for naked eye detection. Especially, 1 exhibited the reversible behavior and revealed a very high selectivity in the presence of competitive ions, particularly Cu2+, Ag+, Pb2+, Ca2+, Cd2+, Co2+, Fe2+, Mn2+, Na+, Ni2+, K+, Ba2+, Li+ and Zn2+, with a low detection limit of 1.7 ppb toward Hg2+.

  5. A Simple and Green Route for Room-Temperature Synthesis of Gold Nanoparticles and Selective Colorimetric Detection of Cysteine.


    Bagci, Pelin Onsekizoglu; Wang, Yi-Cheng; Gunasekaran, Sundaram


    Gold nanoparticles (AuNPs) were synthesized at room temperature following a simple, rapid, and green route using fresh-squeezed apple juice as a reducing reagent. The optimal AuNPs, based on the particle color, stability, and color change suitable for colorimetric detection of cysteine (Cys), are synthesized using 5 mL of 10% apple juice, 1 mL of 10 mM gold precursor solution, and 1 mL of 0.1 M NaOH. Under this set of parameters, the AuNPs are synthesized within 30 min at room temperature. The average size (11.1 ± 3.2 nm) and ζ potential (-36.5 mV) of the AuNPs synthesized were similar to those of AuNPs prepared via the conventional citrate-reduction method. In the presence of Cys, unlike with any other amino acid, the AuNPs aggregated, possibly due to the gold-sulfur covalent interaction, yielding red-to-purple color change of the sample solution. The red-shift of the localized surface plasmon resonance peak of the AuNPs responsible for the color change was recorded by UV-vis spectrometer. The effect of other potential interferents such as glucose, ascorbic acid, K(+) , Na(+) , Ca(2+) , Zn(2+) , Ag(+) , Ni(2+) , Cu(2+) , Co(2+) , and Hg(2+) were also examined. The results show that AuNPs can be used to selectively detect and measure Cys with a linear dependency in the range of 2 to 100 μM and a limit of detection (signal-to-noise ratio > 3) of 50 nM. The results suggest that the green-synthesized AuNPs are useful for simple, rapid, and sensitive colorimetric detection of Cys, which is an essential amino acid in food and biological systems.

  6. Hydroxamate-based colorimetric method for direct screening of transglutaminase-producing bacteria.


    Bourneow, Chaiwut; Benjakul, Soottawat; H-Kittikun, Aran


    Microbial transglutaminase (MTGase) is a commercial enzyme that has been applied to many protein containing foods to improve their textural property. The screening of MTGase-producing microorganisms from various sources might lead to the discovery of a new MTGase with different characteristics. This report demonstrates the use of a direct detection method for MTGase-producing bacteria grown on an agar plate by filter paper disc (FPD) assay. The principle of the assay is the formation of a red burgundy color by the hydroxamate-ferric complex. The color developed intensity was linearly correlated by the concentration of hydroxamic acid in the range of 0.1-0.8 μM and was visually scored at 4 levels: 0, 1, 2 and 3. Streptoverticillium mobaraense DSM 40847, a positive MTGase-producer, was chosen for the verification and improving of the proposed method. The colonies grown on the nutrient agar plate at 37°C for 24 h were covered with FPDs and 30 μl of substrates (CBZ-Gln-Gly and hydroxylamine). After incubation, 10 μl of the ferric-TCA-HCl solution was placed on the FPD. The optimal time taken to catalyze the formation of CBZ-Gln-Gly-hydroxamic acid by the MTGase and the time taken for the hydroxamate-ferric complex to form color were 180 and 60 min, respectively. Using this assay, 30 of 189 colonies isolated from wastewater and floating-floc samples showed MTGase-positive colonies which were well correlated to the quantitative screening of MTGase activity (R(2) = 0.9758). The results revealed that the FPD assay could be used for the qualitative screening of MTGase-producing bacteria.

  7. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators

    NASA Astrophysics Data System (ADS)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui


    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples.An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the

  8. A simple "clickable" biosensor for colorimetric detection of copper(II) ions based on unmodified gold nanoparticles.


    Shen, Qinpeng; Li, Wenhua; Tang, Shiyun; Hu, Yufang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo


    A novel colorimetric copper(II) biosensor has been developed based on the high specificity of alkyne-azide click reaction to the catalysis of copper ions and unmodified gold nanoparticles (AuNPs) as the signal reporter. The clickable DNA probe consists of two parts: an azide group-modified double-stranded DNA (dsDNA) hybrid with an elongated tail and a short alkyne-modified single-stranded DNA (ssDNA). Because of low melting temperature of the short ssDNA, these two parts are separated in the absence of Cu(2+). Copper ion-induced azide-alkyne click ligation caused a structural change of probe from the separated form to entire dsDNA form. This structural change of probe can be monitored by the unmodified AuNPs via mediating their aggregation with a red-to-blue colorimetric read-out because of the differential ability of ssDNA and dsDNA to protect AuNPs against salt-induced aggregation. Under the optimum conditions, this biosensor can sensitively and specifically detect Cu(2+) with a low detection limit of 250 nM and a linear range of 0.5-10 μM. The method is simple and economic without dual-labeling DNA and AuNPs modification. It is also highly selective for Cu(2+) in the presence of high concentrations of other environmentally relevant metal ions because of the great specificity of the copper-caused alkyne-azide click reaction, which potentially meets the requirement of the detection in real samples.

  9. [Colorimetric detection of human influenza A H1N1 virus by reverse transcription loop mediated isothermal amplification].


    Nie, Kai; Wang, Da-Yan; Qin, Meng; Gao, Rong-Bao; Wang, Miao; Zou, Shu-Mei; Han, Feng; Zhao, Xiang; Li, Xi-Yan; Shu, Yue-Long; Ma, Xue-Jun


    A simple, rapid and sensitive colorimetric Reverse Transcription Loop Mediated Isothermal Amplification (RT-LAMP) method was established to detect human influenza A H1N1 virus. The method employed a set of six specially designed primers that recognized eight distinct sequences of the HA gene for amplification of nucleic acid under isothermal conditions at 65 degrees C for one and half hour. The amplification process of RT-LAMP was monitored by the addition of HNB (Hydroxy naphthol blue) dye prior to amplification. A positive reaction was indicated by a color change from violet to sky blue and confirmed by agarose electrophoresis. The specificity of the RT-LAMP assay was validated by cross-reaction with different swine and human influenza virus including human seasonal influenza A /H1N1 A /H3N2, influenza B and swine A /H1N1. The sensitivity of this assay was evaluated by serial dilutions of RNA molecules from in vitro transcription of human influenza A H1N1 HA gene. The assay was further evaluated with 30 clinical specimens with suspected pandemic influenza A H1N1 virus infection in parallel with RT-PCR detection and 26 clinical specimens with seasonal influenza virus infection. Our results showed that the RT-LAMP was able to achieve a sensitivity of 60 RNA copies with high specificity, and detection rate was comparable to that of the RT-PCR with the clinical samples of pandemic influenza A H1N1 infection. The RT-LAMP reaction with HNB could also be measured at 650nm in a microplate reader for quantitative analysis. Thus, we concluded that this colorimetric RT-LAMP assay had potential for the rapid screening of the human influenza A H1N1 virus infection in National influenza monitoring network laboratories and sentinel hospitals of provincial and municipal region in China.

  10. Fe3O4 magnetic nanoparticle peroxidase mimetic-based colorimetric assay for the rapid detection of organophosphorus pesticide and nerve agent.


    Liang, Minmin; Fan, Kelong; Pan, Yong; Jiang, Hui; Wang, Fei; Yang, Dongling; Lu, Di; Feng, Jing; Zhao, Jianjun; Yang, Liu; Yan, Xiyun


    Rapid and sensitive detection methods are in urgent demand for the screening of extensively used organophosphorus pesticides and highly toxic nerve agents for their neurotoxicity. In this study, we developed a novel Fe(3)O(4) magnetic nanoparticle (MNP) peroxidase mimetic-based colorimetric method for the rapid detection of organophosphorus pesticides and nerve agents. The detection assay is composed of MNPs, acetylcholinesterase (AChE), and choline oxidase (CHO). The enzymes AChE and CHO catalyze the formation of H(2)O(2) in the presence of acetylcholine, which then activates MNPs to catalyze the oxidation of colorimetric substrates to produce a color reaction. After incubation with the organophosphorus neurotoxins, the enzymatic activity of AChE was inhibited and produced less H(2)O(2), resulting in a decreased catalytic oxidation of colorimetric substrates over MNP peroxidase mimetics, accompanied by a drop in color intensity. Three organophosphorus compounds were tested on the assay: acephate and methyl-paraoxon as representative organophosphorus pesticides and the nerve agent Sarin. The novel assay displayed substantial color change after incubation in organophosphorus neurotoxins in a concentration-dependent manner. As low as 1 nM Sarin, 10 nM methyl-paraoxon, and 5 μM acephate are easily detected by the novel assay. In conclusion, by employing the peroxidase-mimicking activity of MNPs, the developed colorimetric assay has the potential of becoming a screening tool for the rapid and sensitive assessment of the neurotoxicity of an overwhelming number of organophosphate compounds.

  11. A readily available colorimetric and near-infrared fluorescent turn-on probe for rapid and selective detection of cysteine in living cells.


    Xue, Shuanghong; Ding, Shuangshuang; Zhai, Qisong; Zhang, Haiyan; Feng, Guoqiang


    A readily available naphthofluorescein-based near-infrared (NIR) fluorescent probe was reported for rapid, colorimetric and NIR fluorescent turn-on detection of cysteine (Cys) with high selectivity and sensitivity over various analytes including the similar structured homocysteine (Hcy) and glutathione (GSH). This probe was successfully applied to bioimage intracellular Cys in living cells with low cytotoxicity.

  12. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    PubMed Central

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  13. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    NASA Astrophysics Data System (ADS)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  14. Smartphone-based colorimetric analysis for detection of saliva alcohol concentration.


    Jung, Youngkee; Kim, Jinhee; Awofeso, Olumide; Kim, Huisung; Regnier, Fred; Bae, Euiwon


    A simple device and associated analytical methods are reported. We provide objective and accurate determination of saliva alcohol concentrations using smartphone-based colorimetric imaging. The device utilizes any smartphone with a miniature attachment that positions the sample and provides constant illumination for sample imaging. Analyses of histograms based on channel imaging of red-green-blue (RGB) and hue-saturation-value (HSV) color space provide unambiguous determination of blood alcohol concentration from color changes on sample pads. A smartphone-based sample analysis by colorimetry was developed and tested with blind samples that matched with the training sets. This technology can be adapted to any smartphone and used to conduct color change assays.

  15. Colorimetric and plasmonic detection of lectins using core-shell gold glyconanoparticles prepared by copper-free click chemistry.


    Hu, Xi-Le; Jin, Hong-Ying; He, Xiao-Peng; James, Tony D; Chen, Guo-Rong; Long, Yi-Tao


    This study describes the simple preparation of core-shell glycosyl gold nanoparticles (AuNPs) using stepwise, copper-free click chemistry-promoted self-assembly. The as-formed glyco-AuNPs can be used for the selective detection of sugar-lectin interactions, which are vital to many important physiological and pathological processes. The approach uses AuNPs as bioprobes since they produce, sensitively, changes in both color visible to the naked eye and surface plasmon resonance (SPR), on aggregation. Strain-promoted click reaction of an azido galactoside with a lipid cyclooctyne affords a galactolipid that can be embedded into polyethylene glycol (PEG)-coated AuNP via self-assembly. Subsequently, using naked-eye and plasmon resonance scattering spectroscopy, we were able to observe the colorimetric and plasmonic variations of the glyco-AuNPs, respectively, in the presence of a selective lectin over other proteins.

  16. Microgel coating of magnetic nanoparticles via bienzyme-mediated free-radical polymerization for colorimetric detection of glucose

    NASA Astrophysics Data System (ADS)

    Wu, Qing; Wang, Xia; Liao, Chuanan; Wei, Qingcong; Wang, Qigang


    This study describes a new strategy for the fabrication of magnetic core-shell microgels by free-radical polymerization triggered by the cascade reaction of glucose oxidase (GOx) and horseradish peroxidase (HRP). The mild polymerization around the interface of the magnetic nanoparticles permits the mild coating of the microgel layer with excellent characteristics for various applications in biocatalysis and medical diagnostics, as well as in clinical fields. The immobilized bienzyme within the microgel has a largely retained activity relative to the non-immobilized one. The confining effect of the microgel and the well designed distance between the two enzymes can benefit the diffusion of intermediates to the HRP active site. The final microgels can be incontestably employed as sensitive biosensors for colorimetric glucose detection.This study describes a new strategy for the fabrication of magnetic core-shell microgels by free-radical polymerization triggered by the cascade reaction of glucose oxidase (GOx) and horseradish peroxidase (HRP). The mild polymerization around the interface of the magnetic nanoparticles permits the mild coating of the microgel layer with excellent characteristics for various applications in biocatalysis and medical diagnostics, as well as in clinical fields. The immobilized bienzyme within the microgel has a largely retained activity relative to the non-immobilized one. The confining effect of the microgel and the well designed distance between the two enzymes can benefit the diffusion of intermediates to the HRP active site. The final microgels can be incontestably employed as sensitive biosensors for colorimetric glucose detection. Electronic supplementary information (ESI) available: Experimental details and ESI figures. See DOI: 10.1039/c5nr05716g

  17. The combined rapid detection and species-level identification of yeasts in simulated blood culture using a colorimetric sensor array

    PubMed Central

    Lim, Sung H.; Wilson, Deborah A.; SalasVargas, Ana Victoria; Churi, Yair S.; Rhodes, Paul A.; Mazzone, Peter J.; Procop, Gary W.


    Background A colorimetric sensor array (CSA) has been demonstrated to rapidly detect and identify bacteria growing in blood cultures by obtaining a species-specific “fingerprint” of the volatile organic compounds (VOCs) produced during growth. This capability has been demonstrated in prokaryotes, but has not been reported for eukaryotic cells growing in culture. The purpose of this study was to explore if a disposable CSA could differentially identify 7 species of pathogenic yeasts growing in blood culture. Methods Culture trials of whole blood inoculated with a panel of clinically important pathogenic yeasts at four different microorganism loads were performed. Cultures were done in both standard BacT/Alert and CSA-embedded bottles, after adding 10 mL of spiked blood to each bottle. Color changes in the CSA were captured as images by an optical scanner at defined time intervals. The captured images were analyzed to identify the yeast species. Time to detection by the CSA was compared to that in the BacT/Alert system. Results One hundred sixty-two yeast culture trials were performed, including strains of several species of Candida (Ca. albicans, Ca. glabrata, Ca. parapsilosis, and Ca. tropicalis), Clavispora (synonym Candida) lusitaniae, Pichia kudriavzevii (synonym Candida krusei) and Cryptococcus neoformans, at loads of 8.2 × 105, 8.3 × 103, 8.5 × 101, and 1.7 CFU/mL. In addition, 8 negative trials (no yeast) were conducted. All negative trials were correctly identified as negative, and all positive trials were detected. Colorimetric responses were species-specific and did not vary by inoculum load over the 500000-fold range of loads tested, allowing for accurate species-level identification. The mean sensitivity for species-level identification by CSA was 74% at detection, and increased with time, reaching almost 95% at 4 hours after detection. At an inoculum load of 1.7 CFU/mL, mean time to detection with the CSA was 6.8 hours (17%) less than with the

  18. Single-layer MnO2 nanosheets for sensitive and selective detection of glutathione by a colorimetric method

    NASA Astrophysics Data System (ADS)

    Di, Weihua; Zhang, Xiang; Qin, Weiping


    The rapid, sensitive and selective detection of glutathione (GSH) is of great importance in the biological systems. In this work, a template-free and one-step method was used to synthesize the single-layer MnO2 nanosheets via a redox reaction. The resulting product was characterized by XRD, TEM, FTIR, XPS and UV-vis absorption. The addition of GSH results in the change of solution color depth owing to the occurrence of a redox reaction between MnO2 and GSH, enabling colorimetric detection of GSH. At a pH of 3.6, the proposed sensor gives a linear calibration over a GSH concentration range of 10-100 μM, with a rapid response of less than 2 min and a low detection limit of 0.5 μM. The relative standard deviation for seven repeated determinations of GSH is lower than 5.6%. Furthermore, the chemical response of the synthesized MnO2 nanosheets toward GSH is selective. Owing to the advantages with good water solubility, rapid response, high sensitivity, good biocompatibility and operation simplicity, this two-dimensional MnO2-based sensing material might be potential for detecting GSH in biological applications.

  19. Colorimetric method for rapid detection of Oxacillin resistance in Staphylococcus aureus and its comparison with PCR for mec A gene

    PubMed Central

    Ghanwate, Niraj; Thakare, Prashant; Bhise, P. R.; Gawande, Sonali


    Rapid and accurate detection of Methicillin Resistant Staphylococcus aureus (MRSA) is an important role of clinical microbiology laboratories to avoid treatment failure. The detection of MRSA is based on phenotypic assays which require at least 24 h to perform. Detection of the mecA gene or of PBP 2a is the “gold standard”, but not always available. The aim of this study was to evaluate a rapid method for detection of MRSA by using 3 (4, 5 dimethyl thiazole -2-yl) -2, 5 diphenyl tetrazolium bromide (MTT). Total 126 isolates of MRSA were collected from tertiary healthcare center and were confirmed by oxacillin screening agar test as per CLSI guidelines. Amplification of mecA gene was performed by using PCR. MTT assay was carried out for all the isolates in 96 well Microtitre plate and compared with standard methods of CLSI. Out of 126 isolates, 98 were found to be mecA positive. MTT method was found to be 98.98% sensitive and 96.43% specific. The MTT based colorimetric method is rapid and simple test for screening of oxacillin resistance in Staphylococcus aureus. It significantly shortens the time to just 7 h required to obtained a drug susceptibility test and could be useful to screen MRSA. PMID:26960268

  20. Detection of measles, mumps and rubella viruses by immuno-colorimetric assay and its application in focus reduction neutralization tests.


    Vaidya, Sunil R; Kumbhar, Neelakshi S; Bhide, Vandana S


    Measles, mumps and rubella are vaccine-preventable diseases; however limited epidemiological data are available from low-income or developing countries. Thus, it is important to investigate the transmission of these viruses in different geographical regions. In this context, a cell culture-based rapid and reliable immuno-colorimetric assay (ICA) was established and its utility studied. Twenty-three measles, six mumps and six rubella virus isolates and three vaccine strains were studied. Detection by ICA was compared with plaque and RT-PCR assays. In addition, ICA was used to detect viruses in throat swabs (n = 24) collected from patients with suspected measles or mumps. Similarly, ICA was used in a focus reduction neutralization test (FRNT) and the results compared with those obtained by a commercial IgG enzyme immuno assay. Measles and mumps virus were detected 2 days post-infection in Vero or Vero-human signaling lymphocytic activation molecule cells, whereas rubella virus was detected 3 days post-infection in Vero cells. The blue stained viral foci were visible by the naked eye or through a magnifying glass. In conclusion, ICA was successfully used on 35 virus isolates, three vaccine strains and clinical specimens collected from suspected cases of measles and mumps. Furthermore, an application of ICA in a neutralization test (i.e., FRNT) was documented; this may be useful for sero-epidemiological, cross-neutralization and pre/post-vaccine studies.

  1. Novel cellulose polyampholyte-gold nanoparticle-based colorimetric competition assay for the detection of cysteine and mercury(II).


    You, Jun; Hu, Haoze; Zhou, Jinping; Zhang, Lina; Zhang, Yaping; Kondo, Tetsuo


    We provide a highly sensitive and selective assay to detect cysteine (Cys) and Hg(2+) in aqueous solutions using Au nanoparticles (NPs) stabilized by carboxylethyl quaternized cellulose (CEQC). This method is based on the thiophilicity of Hg(2+) and Au NPs as well as the unique optical properties of CEQC-stabilized Au NPs. CEQC chains are good stabilizing agents for Au NPs even in a high-salt solution. The addition of Cys results in the aggregation of CEQC-stabilized Au NPs, which induces the visible color change and obvious redshift in UV-visible absorption spectra. On the other hand, Hg(2+) is more apt to interact with thiols than Au NPs; thus, it can remove the Cys and trigger Au NP aggregate redispersion again. By taking advantage of this mechanism, a novel off-on colorimetric sensor has been established for Cys and Hg(2+) detection. This new assay could selectively detect Cys and Hg(2+) with the detection limits as low as 20 and 40 nM in aqueous solutions, respectively.

  2. Ultratrace Naked-Eye Colorimetric Detection of Hg(2+) in Wastewater and Serum Utilizing Mercury-Stimulated Peroxidase Mimetic Activity of Reduced Graphene Oxide-PEI-Pd Nanohybrids.


    Zhang, Shouting; Zhang, Dongxu; Zhang, Xuehong; Shang, Denghui; Xue, Zhonghua; Shan, Duoliang; Lu, Xiaoquan


    Herein, we developed a general strategy for rapid, highly selective, and ultratrace naked-eye colorimetric detection of Hg(2+) in aqueous solutions. Two dimensional rGO/PEI/Pd nanohybrids, where rGO, PEI, and Pd were referred to as reduced graphene oxide, polyethylenimine, and Pd nanoparticles, respectively, were synthesized and used as mimetic peroxidase for selective and ultrasensitive detection of Hg(2+) in water and human serum samples. In the presence of mercury ions, the peroxidase mimetic activity of rGO/PEI/Pd nanohybrids was found to be stimulated and enhanced significantly, which promoted the effective oxidation and color change of 3,3',5,5'-tetramethylbenzidine (TMB) in solution to dark blue that was detected by the naked-eye and the absorption spectroscopic method. The proposed sensing strategy coupled with spectroscopic detection method showed an ultralow detection limit of 0.39 nM for Hg(2+) in ddH2O and ∼1 nM in wastewater as well as serum samples, respectively. On the basis of the colorimetric assay, a minimum concentration of ∼10 nM for Hg(2+) in wastewater and human serum can be detected with the naked-eye. The naked-eye-based colorimetric assay for sensitive and selective detection of mercury is expected to hold huge potentials in applications such as environmental monitoring, clinical diagnosis, and pharmaceutical analysis.

  3. Magnetic beads-based DNA hybridization chain reaction amplification and DNAzyme recognition for colorimetric detection of uranyl ion in seafood.


    Zhang, Hongyan; Cheng, Xian; Chen, Lian; Mo, Fan; Xu, LiangJun; Fu, FengFu


    A novel colorimetric biosensor, which employs DNAzyme-functionalized magnetic beads (MBs) as recognition probe, enzyme-assisted catalytic oxidation of TMB (3,3',5,5'-tetramethylbenzidine sulfate) as signal and DNA hybridization chain reaction as amplification strategy, has been developed for detecting trace uranyl ion (UO2(2+)) in seafood and aqueous environment with high sensitivity and specificity. We demonstrated that UO2(2+) can specifically cleave DNAzyme immobilized on MBs surface to release a short single-strand DNA (primer), and the released primer trigger DNA hybridization chain reaction to form a long one dimensional DNA concatamer on the MBs surface. The resulting long DNA concatamer could capture a large amount of HRP to generate the one UO2(2+)-to-multiple HRP amplification effect. Upon the addition of TMB-H2O2 solution, the HRP-tagged DNA concatamer-MBs conjugates could catalyze the H2O2-mediated oxidation of TMB, and thus results in a color change from colorless to blue in solution. This provided a sensitive and selective sensing platform for the visual or colorimetric detection of UO2(2+). The proposed biosensor has high sensitivity and strong anti-interference capability, it can be used to detect as low as 2.5 ppb (9.25 nM) of UO2(2+) by naked-eye observation and 0.09 ppb (0.33 nM) of UO2(2+) by UV-visible spectrometry with no interference of other ions and a RSD ≤ 6% (n = 5). With the help of this method, we have successfully determined trace UO2(2+) in fish muscle and river water with a recovery of 93-106%. High sensitivity and specificity, as well operation convenience, low cost and strong resistibility to the matrix, which makes our method a potential approach for the on-site detection of UO2(2+) in seafood and aqueous environment.

  4. A sensitive and selective colorimetric method for detection of copper ions based on anti-aggregation of unmodified gold nanoparticles.


    Hormozi-Nezhad, M Reza; Abbasi-Moayed, Samira


    A highly sensitive and selective colorimetric method for detection of copper ions, based on anti-aggregation of D-penicillamine (D-PC) induced aggregated gold nanoparticles (AuNPs) was developed. Copper ions can hinder the aggregation of AuNPs induced by D-PC, through formation of mixed-valence complex with D-PC that is a selective copper chelator. In the presence of a fixed amount of D-PC, the aggregation of AuNPs decreases with increasing concentrations of Cu(2+) along with a color change from blue to red in AuNPs solution and an increase in the absorption ratio (A520/A650). Under the optimum experimental conditions (pH 7, [AuNPs] =3.0 nmol L(-1) and [NaCl]=25 mmol L(-1)), a linear calibration curve for Cu(2+) was obtained within the range of 0.05-1.85 µmol L(-1) with a limit of detection (3Sb) of 30 nmol L(-1). Excellent selectivity toward Cu(2+) was observed among various metal ions due to a specific complex formation between Cu(2+) and D-PC. The proposed method has been successfully applied for the detection of Cu(2+) in various real samples.

  5. Novel colorimetric molecular switch based on copper(I)-catalyzed azide-alkyne cycloaddition reaction and its application for flumioxazin detection.


    Xie, Lidan; Zheng, Hanye; Ye, Wenmei; Qiu, Suyan; Lin, Zhenyu; Guo, Longhua; Qiu, Bin; Chen, Guonan


    A novel colorimetric switch based on the copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) reaction has been developed. G-quadruplex-hemin DNAzyme catalyzes the oxidation of 2,2'-azinobis(3-ethylbenzothiozoline)-6-sulfonic acid (ABTS) to form ABTS˙(+), the UV absorbance of the solution increased greatly and the color of the solution changed to dark green. However, in the presence of an azide complex, the absorbance signal decreased and the solution became light green since the catalytic ability of the hemin was inhibited by the azide groups. However, once propargylamine has been added into the above reaction system, which would react with azide groups through the CuAAC reaction, the solution becomes dark green again and the absorption intensity of the system is also increased. The proposed switch allows a good reversibility and can be identified clearly by the naked eye. In addition, the method has been applied to detect some pesticides, which have alkynyl groups (flumioxazin), with high sensitivity and selectivity, where the UV absorbance has a direct linear relationship with the logarithm of flumioxazin concentrations in the range of 0.14-14 nM, and the limit of detection was 0.056 nM (S/N = 3), which can meet the requirement of the maximum residue limits (MRLs) of United States of America (56 nM).

  6. Sensitive and selective colorimetric detection of glutathione in human plasma with 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) and Ag+ ion

    NASA Astrophysics Data System (ADS)

    Li, Yinhuan; Liu, Xiaoying; Zhang, Ruyi


    Glutathione is of vital importance to human beings through involving in many cellular functions. Simple and sensitive methods capable of detecting glutathione in biological samples are significant to diagnosis and prevention of disease. Here a simple, label-free, and sensitive colorimetric method was developed for the determination of glutathione. It was observed that Ag+ ion could directly oxidize 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), a commonly used peroxidase substrate, to produce a green solution, which possessed a maximum absorbance at 420 nm. The presence of glutathione hindered the oxidation process and decreased the absorbance at 420 nm owing to its ability to bind with Ag+ ion. The procedure allowed the measurement of 0.1-4.0 μM glutathione with a detection limit of 59 nM. The relative standard deviation was 1.8% in eleven replicated measurements of 1.0 μM glutathione solution. The method was applied to the determination of glutathione in human plasma with satisfactory results.

  7. Selenocysteine detection and bioimaging in living cells by a colorimetric and near-infrared fluorescent turn-on probe with a large stokes shift.


    Li, Meixing; Feng, Weiyong; Zhai, Qisong; Feng, Guoqiang


    Selenocysteine (Sec) has emerged as an important sensing target in recent years. In this paper, a colorimetric and near-infrared fluorescent turn-on probe for Sec was developed. This probe features a remarkable large Stokes shift (146nm) and shows a rapid, highly selective detection process for Sec with obvious colorimetric and near-infrared fluorescent (Em 706nm with Ex 560nm) turn-on responses. In addition, this probe can be used to quantitatively detect Sec with high sensitivity with a detection limit of 62nM over a wide linear range (0.2-80μM). Moreover, it was further demonstrated that this NIR fluorescent probe can be employed to image both exogenous and endogenous Sec in living cells, indicating that this probe has great potential for biological applications.

  8. Visual and highly sensitive detection of cancer cells by a colorimetric aptasensor based on cell-triggered cyclic enzymatic signal amplification.


    Zhang, Xianxia; Xiao, Kunyi; Cheng, Liwei; Chen, Hui; Liu, Baohong; Zhang, Song; Kong, Jilie


    Rapid and efficient detection of cancer cells at their earliest stages is one of the central challenges in cancer diagnostics. We developed a simple, cost-effective, and highly sensitive colorimetric method for visually detecting rare cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and linker DNAs stably coexist in solution, and the linker DNA assembles DNA-AuNPs, producing a purple solution. In the presence of target cells, the specific binding of HAPs to the target cells triggers a conformational switch that results in linker DNA hybridization and cleavage by nicking endonuclease-strand scission cycles. Consequently, the cleaved fragments of linker DNA can no longer assemble into DNA-AuNPs, resulting in a red color. UV-vis spectrometry and photograph analyses demonstrated that this CTCESA-based method exhibited selective and sensitive colorimetric responses to the presence of target CCRF-CEM cells, which could be detected by the naked eye. The linear response for CCRF-CEM cells in a concentration range from 10(2) to 10(4) cells was obtained with a detection limit of 40 cells, which is approximately 20 times lower than the detection limit of normal AuNP-based methods without amplification. Given the high specificity and sensitivity of CTCESA, this colorimetric method provides a sensitive, label-free, and cost-effective approach for early cancer diagnosis and point-to-care applications.

  9. Colorimetric microtiter plate receptor-binding assay for the detection of freshwater and marine neurotoxins targeting the nicotinic acetylcholine receptors

    USGS Publications Warehouse

    Rubio, Fernando; Kamp, Lisa; Carpino, Justin; Faltin, Erin; Loftin, Keith A.; Molgó, Jordi; Aráoz, Rómulo


    Anatoxin-a and homoanatoxin-a, produced by cyanobacteria, are agonists of nicotinic acetylcholine receptors (nAChRs). Pinnatoxins, spirolides, and gymnodimines, produced by dinoflagellates, are antagonists of nAChRs. In this study we describe the development and validation of a competitive colorimetric, high throughput functional assay based on the mechanism of action of freshwater and marine toxins against nAChRs. Torpedo electrocyte membranes (rich in muscle-type nAChR) were immobilized and stabilized on the surface of 96-well microtiter plates. Biotinylated α-bungarotoxin (the tracer) and streptavidin-horseradish peroxidase (the detector) enabled the detection and quantitation of anatoxin-a in surface waters and cyclic imine toxins in shellfish extracts that were obtained from different locations across the US. The method compares favorably to LC/MS/MS and provides accurate results for anatoxin-a and cyclic imine toxins monitoring. Study of common constituents at the concentrations normally found in drinking and environmental waters, as well as the tolerance to pH, salt, solvents, organic and inorganic compounds did not significantly affect toxin detection. The assay allowed the simultaneous analysis of up to 25 samples within 3.5 h and it is well suited for on-site or laboratory monitoring of low levels of toxins in drinking, surface, and ground water as well as in shellfish extracts.

  10. AuPt Alloy Nanostructures with Tunable Composition and Enzyme-like Activities for Colorimetric Detection of Bisulfide

    NASA Astrophysics Data System (ADS)

    He, Weiwei; Han, Xiangna; Jia, Huimin; Cai, Junhui; Zhou, Yunlong; Zheng, Zhi


    Tuning the enzyme-like activity and studying the interaction between biologically relevant species and nano-enzymes may facilitate the applications of nanostructures in mimicking natural enzymes. In this work, AuPt alloy nanoparticles (NPs) with varying compositions were prepared through a facile method by co-reduction of Au3+ and Pt2+ in aqueous solutions. The composition could be tuned easily by adjusting the molar ratios of added Pt2+ to Au3+. It was found that both peroxidase-like and oxidase-like activity of AuPt alloy NPs were highly dependent on the alloy compositions, which thus suggesting an effective way to tailor their catalytic properties. By investigating the inhibitory effects of HS‑ on the enzyme-like activity of AuPt alloy NPs and natural enzyme, we have developed a method for colorimetric detection of HS‑ and evaluation of the inhibiting effects of inhibitors on natural and artificial enzymes. In addition, the responsive ability of this method was influenced largely by the composition: AuPt alloy NPs show much lower limit of detection for HS‑ than Pt NPs while Pt NPs show wider linear range than AuPt alloy NPs. This study suggests the facile way not only for synthesis of alloy nanostructures, but also for tuning their catalytic activities and for use in bioanalysis.

  11. AuPt Alloy Nanostructures with Tunable Composition and Enzyme-like Activities for Colorimetric Detection of Bisulfide

    PubMed Central

    He, Weiwei; Han, Xiangna; Jia, Huimin; Cai, Junhui; Zhou, Yunlong; Zheng, Zhi


    Tuning the enzyme-like activity and studying the interaction between biologically relevant species and nano-enzymes may facilitate the applications of nanostructures in mimicking natural enzymes. In this work, AuPt alloy nanoparticles (NPs) with varying compositions were prepared through a facile method by co-reduction of Au3+ and Pt2+ in aqueous solutions. The composition could be tuned easily by adjusting the molar ratios of added Pt2+ to Au3+. It was found that both peroxidase-like and oxidase-like activity of AuPt alloy NPs were highly dependent on the alloy compositions, which thus suggesting an effective way to tailor their catalytic properties. By investigating the inhibitory effects of HS− on the enzyme-like activity of AuPt alloy NPs and natural enzyme, we have developed a method for colorimetric detection of HS− and evaluation of the inhibiting effects of inhibitors on natural and artificial enzymes. In addition, the responsive ability of this method was influenced largely by the composition: AuPt alloy NPs show much lower limit of detection for HS− than Pt NPs while Pt NPs show wider linear range than AuPt alloy NPs. This study suggests the facile way not only for synthesis of alloy nanostructures, but also for tuning their catalytic activities and for use in bioanalysis. PMID:28051159

  12. BSA-stabilized Pt nanozyme for peroxidase mimetics and its application on colorimetric detection of mercury(II) ions.


    Li, Wei; Chen, Bin; Zhang, Haixiang; Sun, Yanhua; Wang, Jun; Zhang, Jinli; Fu, Yan


    Bovine serum albumin (BSA) is chosen as the nucleation templates to synthesize Pt-based peroxidase nanomimetics with the average diameter of 2.0nm. The efficient Pt nanozymes consist of 57% Pt(0) and 43% Pt(2+), which possess highly peroxidase-like activity with the Km values of 0.119mM and 41.8mM toward 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2), respectively. Interestingly, Hg(2+) is able to down-regulate the enzymatic activity of Pt nanoparticles, mainly through the interactions between Hg(2+) and Pt(0). It is the first report to explore a colorimetric Hg(2+) sensing system on the basis of peroxidase mimicking activities of Pt nanoparticles. One of our most intriguing results is that BSA-stabilized Pt nanozymes demonstrate the ability to sense Hg(2+) ions in aqueous solution without significant interference from other metal ions. The Hg(2+) detection limit of 7.2nM is achieved with a linear response range of 0-120nM, and the developed sensing system is potentially applicable for quantitative determination of Hg(2+) in drinking water.

  13. Highly selective and quantitative colorimetric detection of mercury(II) ions by carrageenan-functionalized Ag/AgCl nanoparticles.


    Narayanan, Kannan Badri; Han, Sung Soo


    The natural algal polysaccharide carrageenan was used for the greener synthesis of silver/silver chloride nanoparticles (Carr-Ag/AgCl NPs) without any toxic chemicals. We report the robust, highly selective, and sensitive colorimetric sensing of Hg(2+) ions using Carr-Ag/AgCl NPs without any further surface modification. The dark-brown color of a solution of Carr-Ag/AgCl NPs turned to white in a concentration-dependent manner with the addition of Hg(2+) ions, confirming the interaction of Carr-Ag/AgCl NPs with Hg(2+) ions. The plot of the extinction ratio of absorbance at 350nm to 450nm (A350/A450) for Carr-Ag/AgCl NPs against the concentration of [Hg(2+)] ions was linear, and the calibration curve was A350/A450=1.05254+0.00318×CHg with a lower detection limit of 1μM. This portable and cost-effective method for mercury(II) ion sensing is widely applicable in on-field qualitative and quantitative measurements of [Hg(2+)] ions in environmental or biological samples.

  14. Colorimetric Strategy for Highly Sensitive and Selective Simultaneous Detection of Histidine and Cysteine Based on G-Quadruplex-Cu(II) Metalloenzyme.


    Wu, Changtong; Fan, Daoqing; Zhou, Chunyang; Liu, Yaqing; Wang, Erkang


    In this present work, we proposed a colorimetric strategy for simultaneous detection of histidine and cysteine based on G-quadruplex-Cu(II) metalloenzyme for the first time. Because of the adding of histidine or cysteine, the formation of G-quadruplex-Cu(II) metalloenzyme will be disturbed, thus the catalytic activity to TMB-H2O2 reaction is inversely proportional to the concentration of histidine or cysteine. With this strategy, the limit of detection in experimental measurement for histidine and cysteine is 10 nM and 5 nM, respectively, which are both lower than previous colorimetric arrays. With the help of NEM, cysteine is alkylated and the reaction between Cu(2+) is inhibited, so the selectivity can also be guaranteed. The cost is quite low since the developed array is label free and enzyme free by using low-cost DNA and Cu(2+). More importantly, the colorimetric detection operation is very simple without any further modification process.

  15. Red Emission B, N, S-co-Doped Carbon Dots for Colorimetric and Fluorescent Dual Mode Detection of Fe(3+) Ions in Complex Biological Fluids and Living Cells.


    Liu, Yinghua; Duan, Wenxiu; Song, Wei; Liu, Juanjuan; Ren, Cuiling; Wu, Jiang; Liu, Dan; Chen, Hongli


    Colorimetric and fluorescent dual mode detection methods have gained much attention in recent years; however, it is still desirable to develop new colorimetric and fluorescent dual mode nanosensors with more simple preparation procedures, low cost, and excellent biocompatibility. Herein, a colorimetric and fluorescent nanosensor based on B, N, S-co-doped carbon dots (BNS-CDs) was synthesized by one-step hydrothermal treatment of 2,5-diaminobenzenesulfonic acid and 4-aminophenylboronic acid hydrochloride. Using this nanosensor, a highly sensitive assay of Fe(3+) in the range of 0.3-546 μM with a detection limit of 90 nM was provided by quenching the red emission fluorescence. It is more attractive that Fe(3+) can also be visualized by this nanosensor via evident color changes of the solution (from red to blue) under sunlight without the aid of an ultraviolet (UV) lamp. Furthermore, the designed nanosensor can be applied for efficient detection of intracellular Fe(3+) with excellent biocompatibility and cellular imaging capability, and it holds great promise in biomedical applications.

  16. Target recycling amplification for label-free and sensitive colorimetric detection of adenosine triphosphate based on un-modified aptamers and DNAzymes.


    Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin


    Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins.

  17. A significant enhancement of color transition from an on-off type achromatic colorimetric nanosensor for highly sensitive multi-analyte detection with the naked eye.


    Heo, Jun Hyuk; Yi, Gyu Sung; Lee, Byoung Sang; Cho, Hui Hun; Lee, Jin Woong; Lee, Jung Heon


    Here, we report the development of an achromatic nanoparticle-based colorimetric sensor (achromatic nanosensor) with an on-off type color change that significantly enhances the color transition and increases the sensitivity of the sensor for naked-eye inspection. The achromatic nanosensor was prepared via a modified CMYK (CRYK) subtractive color model by combining DNA-functionalized gold nanoparticles (AuNPs-DNA), silver nanoparticles (AgNPs-DNA), and gold nanorods (AuNRs-DNA). The initially black-colored achromatic nanosensor not only allowed multiplexed detection by generating target-specific diverse color changes, but also improved the recognition of color changes by the naked eye. Thus, this on-off type color change enabled analysis near the limit of detection (LOD) with the naked eye. In addition, we developed a new image processing method adapted for this achromatic sensor. By quantifying the saturation value of the color images of the achromatic sensor, we could significantly amplify the color signal of the samples, which is difficult to achieve with general colorimetric sensors. The practical application of this achromatic nanosensor for biomarker detection was demonstrated with thrombin and platelet-derived growth factor (PDGF) in human blood plasma. These results provide a new sensing platform that is applicable to most NP-based colorimetric sensing systems for a wide range of applications, including biomolecular diagnosis, chemical pollutant sensing, environmental monitoring, etc.

  18. Highly sensitive colorimetric detection of glucose in a serum based on DNA-embeded Au@Ag core-shell nanoparticles

    NASA Astrophysics Data System (ADS)

    Kang, Fei; Hou, Xiangshu; Xu, Kun


    Glucose is a key energy substance in diverse biology and closely related to the life activities of the organism. To develop a simple and sensitive method for glucose detection is extremely urgent but still remains a key challenge. Herein, we report a colorimetric glucose sensor in a homogeneous system based on DNA-embedded core-shell Au@Ag nanoparticles. In this assay, a glucose substrate was first catalytically oxidized by glucose oxidase to produce H2O2 which would further oxidize and gradually etch the outer silver shell of Au@Ag nanoparticles. Afterwards, the solution color changed from yellow to red and the surface plasmon resonance (SPR) band of Au@Ag nanoparticles declined and red-shifted from 430 to 516 nm. Compared with previous silver-based glucose colorimetric detection strategies, the distinctive SPR band change is superior to the color variation, which is critical to the high sensitivity of this assay. Benefiting from the outstanding optical property, robust stability and well-dispersion of the core-shell Au@AgNPs hybrid, this colorimetric assay obtained a detection limit of glucose as low as 10 nM, which is at least a 10-fold improvement over other AgNPs-based procedures. Moreover, this optical biosensor was successfully employed to the determination of glucose in fetal bovine serum.

  19. Microfluidic toner-based analytical devices: disposable, lightweight, and portable platforms for point-of-care diagnostics with colorimetric detection.


    Oliveira, Karoliny Almeida; de Souza, Fabrício Ribeiro; de Oliveira, Cristina Rodrigues; da Silveira, Lucimeire Antonelli; Coltro, Wendell Karlos Tomazelli


    This chapter describes the development of microfluidic toner-based analytical devices (μTADs) to perform clinical diagnostics using a scanner or cell-phone camera. μTADs have been produced in a platform composed of polyester and toner by the direct-printing technology (DPT) in a matter of minutes. This technology offers simplicity and versatility, and it does not require any sophisticated instrumentation. Toner-based devices integrate the current generation of disposable analytical devices along paper-based chips. The cost of one μTAD has been estimated to be lower than $0.10. In addition, these platforms are lightweight and portable thus enabling their use for point-of-care applications. In the last 5 years, great efforts have been dedicated to spread out the use of μTADs in bioassays. The current chapter reports the fabrication of printed microplates and integrated microfluidic toner-based devices for dengue diagnostics and rapid colorimetric assays with clinically relevant analytes including cholesterol, triglycerides, total proteins, and glucose. The use of μTADs associated with cell-phone camera may contribute to the health care, in special, to people housed in developing regions or with limited access to clinics and hospitals.

  20. Multiplex paper-based colorimetric DNA sensor using pyrrolidinyl peptide nucleic acid-induced AgNPs aggregation for detecting MERS-CoV, MTB and HPV oligonucleotides.


    Tee-Ngam, Prinjaporn; Siangproh, Weena; Tuantranont, Adisorn; Vilaivan, Tirayut; Chailapakul, Orawon; Henry, Charles S


    The development of simple fluorescent and colorimetric assays that enable point-of-care DNA and RNA detection has been a topic of significant research because of the utility of such assays in resource limited settings. The most common motifs utilize hybridization to a complementary detection strand coupled with a sensitive reporter molecule. Here, apaper-based colorimetric assay for DNA detection based on pyrrolidinyl peptide nucleic acid (acpcPNA)-induced nanoparticle aggregationis reported as an alternative to traditional colorimetric approaches. PNA probes are an attractive alternative to DNA and RNA probes because they are chemically and biologically stable, easily synthesized, and hybridize efficiently with the complementary DNA strands. The acpcPNA probe contains a single positive charge from the lysine at C-terminus and causes aggregation of citrate anion-stabilized silver nanoparticles (AgNPs) in the absence of complementary DNA. In the presence of target DNA, formation of the anionic DNA-acpcPNA duplex results in dispersion of the AgNPs as a result of electrostatic repulsion, giving rise to a detectable color change. Factors affecting the sensitivity and selectivity of this assay were investigated, including ionic strength, AgNP concentration, PNA concentration, and DNA strand mismatches. The method was used for screening of synthetic Middle East respiratory syndrome coronavirus (MERS-CoV), mycobacterium tuberculosis (MTB) and human papillomavirus (HPV)DNA based on a colorimetric paper-based analytical device developed using the aforementioned principle. The oligonucleotide targets were detected by measuring the color change of AgNPs, giving detection limits of 1.53 nM (MERS-CoV), 1.27 nM (MTB) and 1.03 nM (HPV).The acpcPNA probe exhibited high selectivity for the complementary oligonucleotides over single-base-mismatch, two-base-mismatch and non-complementary DNA targets. The proposed paper-based colorimetric DNA sensor has potential to be an alternative

  1. Glutathione Modified Gold Nanoparticles for Sensitive Colorimetric Detection of Pb(2+) Ions in Rainwater Polluted by Leaking Perovskite Solar Cells.


    Yu, Yaming; Hong, Ying; Gao, Peng; Nazeeruddin, Mohammad Khaja


    In the past few years, the advent of lead halide perovskite solar cells (PSCs) has revolutionized the prospects of the third- generation photovoltaics and the reported power conversion efficiency (PCE) has been updated to 22%. Nevertheless, two main challenges, including the poisonous content of Pb and the vexing instability toward water, still lie between the lab-based PSCs technology and large scale commercialization. With this background, we first evaluated Pb(2+) concentration from the rainwater samples polluted by three types of markets promising PSCs with inductively coupled plasma mass spectrometry measurements (ICP-MS) as a case study. The influence of possible conditions (pH value and exposure time) on the contents of Pb(2+) from the three PSCs was systematically compared and discussed. Furthermore, an optimized glutathione functionalized gold nanoparticles (GSH-AuNPs) colorimetric sensing assay was used to determine Pb(2+) leaking from PSCs for the first time. The Pb(2+)-induced aggregation of sensing assay could be monitored via both naked eye and UV-vis spectroscopy with a detection limit of 15 and 13 nM, which are all lower than the maximum level in drinking water permitted by WHO. The quantitative detection results were compared and in good agreement with that of ICP-MS. The results indicate that the content of Pb(2+) from three PSCs are in the same order of magnitude under various conditions. By the use of the prepared GSH-AuNPs self-assembled sensing assay, the fast and on-site detection of Pb(2+) from PSCs can be realized.

  2. Immunosorbent analysis of ricin contamination in milk using colorimetric, chemiluminescence, and electrochemiluminescence detection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analytical methodology to detect ricin in food matrices is important because of the potential use of foodborne ricin as a terrorist weapon. Monoclonal antibodies (mAbs) that bind ricin were used for both capture and detection in sandwich enzyme-linked immunosorbent assay (ELISA) and electrochemilumi...

  3. Direct detection with dark mediators

    NASA Astrophysics Data System (ADS)

    Curtin, David; Surujon, Ze'ev; Tsai, Yuhsin


    We introduce dark mediator Dark Matter (dmDM) where the dark and visible sectors are connected by at least one light mediator ϕ carrying the same dark charge that stabilizes DM. ϕ is coupled to the Standard Model via an operator q bar qϕϕ* / Λ, and to dark matter via a Yukawa coupling yχχc bar χϕ. Direct detection is realized as the 2 → 3 process χN → χ bar Nϕ at tree-level for mϕ ≲ 10 keV and small Yukawa coupling, or alternatively as a loop-induced 2 → 2 process χN → χN. We explore the direct-detection consequences of this scenario and find that a heavy O (100 GeV) dmDM candidate fakes different O (10 GeV) standard WIMPs in different experiments. Large portions of the dmDM parameter space are detectable above the irreducible neutrino background and not yet excluded by any bounds. Interestingly, for the mϕ range leading to novel direct detection phenomenology, dmDM is also a form of Self-Interacting Dark Matter (SIDM), which resolves inconsistencies between dwarf galaxy observations and numerical simulations.

  4. Colorimetric gas detection by the varying thickness of a thin film of ultrasmall PTSA-coated TiO2 nanoparticles on a Si substrate

    PubMed Central

    Joost, Urmas; Šutka, Andris; Visnapuu, Meeri; Tamm, Aile; Lembinen, Meeri; Antsov, Mikk; Utt, Kathriin; Smits, Krisjanis; Nõmmiste, Ergo


    Colorimetric gas sensing is demonstrated by thin films based on ultrasmall TiO2 nanoparticles (NPs) on Si substrates. The NPs are bound into the film by p-toluenesulfonic acid (PTSA) and the film is made to absorb volatile organic compounds (VOCs). Since the color of the sensing element depends on the interference of reflected light from the surface of the film and from the film/silicon substrate interface, colorimetric detection is possible by the varying thickness of the NP-based film. Indeed, VOC absorption causes significant swelling of the film. Thus, the optical path length is increased, interference wavelengths are shifted and the refractive index of the film is decreased. This causes a change of color of the sensor element visible by the naked eye. The color response is rapid and changes reversibly within seconds of exposure. The sensing element is extremely simple and cheap, and can be fabricated by common coating processes. PMID:28243561

  5. Colorimetric gas detection by the varying thickness of a thin film of ultrasmall PTSA-coated TiO2 nanoparticles on a Si substrate.


    Joost, Urmas; Šutka, Andris; Visnapuu, Meeri; Tamm, Aile; Lembinen, Meeri; Antsov, Mikk; Utt, Kathriin; Smits, Krisjanis; Nõmmiste, Ergo; Kisand, Vambola


    Colorimetric gas sensing is demonstrated by thin films based on ultrasmall TiO2 nanoparticles (NPs) on Si substrates. The NPs are bound into the film by p-toluenesulfonic acid (PTSA) and the film is made to absorb volatile organic compounds (VOCs). Since the color of the sensing element depends on the interference of reflected light from the surface of the film and from the film/silicon substrate interface, colorimetric detection is possible by the varying thickness of the NP-based film. Indeed, VOC absorption causes significant swelling of the film. Thus, the optical path length is increased, interference wavelengths are shifted and the refractive index of the film is decreased. This causes a change of color of the sensor element visible by the naked eye. The color response is rapid and changes reversibly within seconds of exposure. The sensing element is extremely simple and cheap, and can be fabricated by common coating processes.

  6. Phenazine-based colorimetric and fluorescent sensor for the selective detection of cyanides based on supramolecular self-assembly in aqueous solution

    NASA Astrophysics Data System (ADS)

    Zhang, Hai-Li; Wei, Tai-Bao; Li, Wen-Ting; Qu, Wen-Juan; Leng, Yan-Li; Zhang, Jian-Hui; Lin, Qi; Zhang, You-Ming; Yao, Hong


    Taking advantages of both the well-known phenazine structure and the mechanism of the supramolecular self-assembly and deprotonation process, the fluorescent and colorimetric sensor (ZL) was designed and synthesized, behaving as a circulation utilization (above 10 times) receptor for selective detection of cyanide anion (CN-) in aqueous media. Upon the addition of CN-, the sensor displayed obvious color changes from yellow to jacinth by naked eyes and the fluorescence immediately quenched (< 10 s). With respect to other common anions, the sensor possessed high selectivity and sensitivity (0.05 μM) for cyanide anions. In addition, the test strips of ZL were fabricated, which could serve as practical colorimetric and fluorescent sensor for "in-the-field" measurements.

  7. A label-free colorimetric isothermal cascade amplification for the detection of disease-related nucleic acids based on double-hairpin molecular beacon.


    Wu, Dong; Xu, Huo; Shi, Haimei; Li, Weihong; Sun, Mengze; Wu, Zai-Sheng


    K-Ras mutations at codon 12 play an important role in an early step of carcinogenesis. Here, a label-free colorimetric isothermal cascade amplification for ultrasensitive and specific detection of K-Ras point mutation is developed based on a double-hairpin molecular beacon (DHMB). The biosensor consists of DHMB probe and a primer-incorporated polymerization template (PPT) designed partly complementary to DHMB. In the presence of polymerase, target DNA is designed to trigger strand displacement amplification (SDA) via promote the hybridization of PPT with DHMB and subsequently initiates cascade amplification process with the help of the nicking endonuclease. During the hybridization and enzymatic reaction, G-quadruplex/hemin DNAzymes are generated, catalyzing the oxidation of ABTS(2-) by H2O2 in the presence of hemin. Utilizing the proposed facile colorimetric scheme, the target DNA can be quantified down to 4 pM with the dynamic response range of 5 orders of magnitude, indicating the substantially improved detection capability. Even more strikingly, point mutation in K-ras gene can be readily observed by the naked eye without the need for the labeling or expensive equipment. Given the high-performance for K-Ras analysis, the enhanced signal transduction capability associated with double-hairpin structure of DHMB provides a novel rout to screen biomarkers, and the descripted colorimetric biosensor seems to hold great promise for diagnostic applications of genetic diseases.

  8. Visual and colorimetric detection of p-aminophenol in environmental water and human urine samples based on anisotropic growth of Ag nanoshells on Au nanorods.


    Lin, Tianran; Li, Zhihong; Song, Zhiping; Chen, Huan; Guo, Liangqia; Fu, Fengfu; Wu, Zujian


    A simple, sensitive, selective and high-resolution colorimetric method has been developed for the detection of p-aminophenol in environmental water and human urine samples. In the presence of p-aminophenol, silver ions are reduced to silver atoms and subsequently Ag nanoshells anisotropically grow on the surface of Au nanorods to generate orange slice-like Au@Ag core-shell nanocrystals, thereby resulting in the blue-shift of longitudinal surface plasmon resonance band of Au nanorods accompanying a sharp-contrast multicolor change. Using Au@Ag core-shell nanocrystals as the transducer, sub-micromolar p-aminophenol can be detected by the colorimetric method and 10 μmol L(-1) p-aminophenol can be visual readout by the naked eyes. Furthermore, a simple, cheap, portable test kit is constructed for the visual assay of urinary p-aminophenol without complicated sample pretreatment and sophisticated instruments. The proposed colorimetric method has the potential for the rapid and on-site analyses of p-aminophenol in environmental water and human urine samples.

  9. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA

    NASA Astrophysics Data System (ADS)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum


    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system.

  10. Multiplexed colorimetric detection of Kaposi's sarcoma associated herpesvirus and Bartonella DNA using gold and silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Mancuso, Matthew; Jiang, Li; Cesarman, Ethel; Erickson, David


    Kaposi's sarcoma (KS) is an infectious cancer occurring most commonly in human immunodeficiency virus (HIV) positive patients and in endemic regions, such as Sub-Saharan Africa, where KS is among the top four most prevalent cancers. The cause of KS is the Kaposi's sarcoma-associated herpesvirus (KSHV, also called HHV-8), an oncogenic herpesvirus that while routinely diagnosed in developed nations, provides challenges to developing world medical providers and point-of-care detection. A major challenge in the diagnosis of KS is the existence of a number of other diseases with similar clinical presentation and histopathological features, requiring the detection of KSHV in a biopsy sample. In this work we develop an answer to this challenge by creating a multiplexed one-pot detection system for KSHV DNA and DNA from a frequently confounding disease, bacillary angiomatosis. Gold and silver nanoparticle aggregation reactions are tuned for each target and a multi-color change system is developed capable of detecting both targets down to levels between 1 nM and 2 nM. The system developed here could later be integrated with microfluidic sample processing to create a final device capable of solving the two major challenges in point-of-care KS detection.

  11. Colorimetric detection of cephradine in pharmaceutical formulations via fluorosurfactant-capped gold nanoparticles.


    Lu, Chao; Zhang, Nan; Li, Jinge; Li, Qianqian


    The aggregation of gold nanoparticles (GNPs) capped with nonionic fluorosurfactant (FSN) could be induced rapidly and selectively by cephradine degradation products, but not by cephradine and other excipients in pharmaceutical formulations. A new detection method for cephradine has been developed based on the cephradine degradation products-induced aggregation of the GNPs. The present approach offers various advantages, such as simplicity and high selectivity. Under optimum conditions, the lowest detectable concentration of cephradine through this approach (S/N=3) is 0.8 microg mL(-1). The calibration curve was linear over the range of 2.0-10.0 microg mL(-1) for the detection of cephradine. The recoveries of cephradine were found to fall in the range between 97% and 105%. We have validated the applicability of our method through the analyses of cephradine in pharmaceutical formulations. Good agreements were obtained for the determination of cephradine between the present approach and official method.


    EPA Science Inventory

    A commercially available DNA hydribization assay (Gene-trak , Framingham, MA. USA) was compared with the EC-MUG procedure for the detection of Escherichia coli in water. The gene probe gave positive responses for pure cultures of E. coli 0157:H7, E. fergusonii, Shigella sonnei, S...

  13. Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids.


    Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong


    Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease.

  14. A Novel Porphyrin-Containing Polyimide Nanofibrous Membrane for Colorimetric and Fluorometric Detection of Pyridine Vapor

    PubMed Central

    Lv, Yuanyuan; Zhang, Yani; Du, Yanglong; Xu, Jiayao; Wang, Junbo


    A novel zinc porphyrin-containing polyimide (ZPCPI) nanofibrous membrane for rapid and reversible detection of trace amounts of pyridine vapor is described. The membrane displays a distinct color change, as well as dramatic variations in absorption and fluorescent emission spectra, upon exposure to pyridine vapor. This condition allows the detection of the analyte at concentrations as low as 0.041 ppm. The vapochromic and spectrophotometric responses of the membrane are attributed to the formation of the ZPCPI-pyridine complex upon axial coordination. From surface plasmon resonance analysis, the affinity constant of ZPCPI-pyridine complex was calculated to be (3.98 ± 0.25) × 104 L·mol−1. The ZPCPI nanofibrous membrane also showed excellent selectivity for pyridine vapor over other common amines, confirming its applicability in the manufacture of pyridine-sensitive gas sensors. PMID:24256976

  15. Polydiacetylene-coated polyvinylidene fluoride strip aptasensor for colorimetric detection of zinc(II).


    Wen, Jessica T; Bohorquez, Karen; Tsutsui, Hideaki


    We report a new polydiacetylene (PDA) sensor strip for simple visual detection of zinc ions in aqueous solution. The specificity of this sensor comes from Zn(2+) DNA aptamer probes conjugated onto PDA. Effects of aptamer length and structure on the sensitivity of PDA's color transition were first investigated. PDA conjugated with the optimal aptamer sequence was then coated onto a strip of polyvinylidene fluoride membrane and photopolymerized by UV exposure. The newly developed sensor successfully exhibited a blue-to-red chromatic change in a semi-quantitative manner in response to zinc ions. No discernable change was observed in solutions containing other common ions. Advantages of this sensor include its ease of fabrication, high specificity, and equipment-free detection, all of which are desirable for in-field applications and use in resource-limited settings.

  16. Gold nanoflowers based colorimetric detection of Hg2+ and Pb2+ ions

    NASA Astrophysics Data System (ADS)

    Nalawade, Pradnya; Kapoor, Sudhir


    An optical detection method based on the interaction of gold nanoflowers with Hg2+ and Pb2+ has been described. After interaction, gold nanoflowers change the color from violet to wine red. The nanoflowers are capable of determining Hg2+ and Pb2+ over a dynamic range of 1.0 × 10-6 and 1.0 × 10-5 M, respectively. The response time of nanoflowers depends on the concentration of ions. The presence of both Hg2+ and Pb2+ ions in the mixture having Au nanoflowers induced color changes of the solution within several seconds even at 1.0 × 10-6 M. Common metal ions were chosen to investigate their interference in Hg2+ and Pb2+ detection, and the concentration of each metal ion studied was 1.0 × 10-5 M. Other metallic ions could not induce color change even at 1.0 × 10-5 M. The feasibility of our method to detect Hg2+ and Pb2+ ions at high concentration in real water samples was verified. Water samples were from our own laboratory and no pretreatment was made. As the particles are stable they can be used for more than 3 months without observing any major deviation.

  17. Development and evaluation of a colorimetric PCR system for the detection and typing of human papillomaviruses.


    Chouhy, Diego; Gil, Lisandro Benítez; Nocito, Ana L; Wojdyla, Daniel; Ornella, Leonardo; Cittadini, Jorge; Gardiol, Daniela; Giri, Adriana A


    In developing countries, the introduction of human papillomaviruses (HPV) DNA testing as an adjunct to cytological screening programs has been delayed due to the lack of high performance and cost effective diagnostic nucleic acid methods. In this study we report the development and evaluation of the L1HPVPCR, a PCR-based method for the detection and typing of five of the most prevalent high-risk HPV types. The L1HPVPCR assay combines amplification with the MY09/11 HPV consensus primer system, liquid hybridization of the PCR products with no radioactive probes and enzyme immunoassay analysis. The technique is a user-friendly system that allows accurate HPV DNA detection and typing with inexpensive instrumentation that could be performed with not sophisticated reagents in almost any laboratory. Different cutoff points for generic and specific HPV detection were determined using reproducibility analysis and receiver operating characteristic curves to ensure good analytical sensitivity and clinical effectiveness. We used the L1HPVPCR assay to estimate the prevalence of HPV infection in 127 women at risk of cervical cancer from the city of Rosario (Argentina), where no epidemiological data has been previously reported. Further, we explored the clinical utility of the L1HPVPCR assay respect the Pap smear using a combined diagnosis of cytology, histology and colposcopy as gold standard. In conclusion, our results indicate that the assay described here provides a tool for accurate HPV DNA testing and could be applied in regions where no commercial tests are available.

  18. High selectivity of colorimetric detection of p-nitrophenol based on Ag nanoclusters

    NASA Astrophysics Data System (ADS)

    Qu, Fei; Chen, Ping; Zhu, Shuyun; You, Jinmao


    Ag nanoclusters (Ag NCs) templated by hyperbranched polyethyleneimine (PEI) with different terminal groups and molecular weights had been developed as a special optical sensor for detecting p-nitrophenol (p-NP). When adding p-NP into Ag NCs, an obvious color change from pale yellow to deep yellow could be observed by naked eyes, accompanying with an apparent red-shift of absorption peak, and the reason was attributed to the formation of oxygen anion of p-NP based on the transfer of H+ from p-NP to amine groups of PEI. The molecular weights of template would greatly affect the sensitivity of p-NP. Ag NCs capped by PEI terminated ethylenediamine (EDA) possessed better sensitivity than other Ag NCs, showing good linear range from 5 to 140 μM with the limit of detection as low as 1.28 μM. Most importantly, this present system displayed high selectivity toward p-NP even in the presence of other nitrophenols and nitrotoluenes. This reliable method had been successfully applied for the detection of p-NP in real water and soil samples.

  19. High selectivity of colorimetric detection of p-nitrophenol based on Ag nanoclusters.


    Qu, Fei; Chen, Ping; Zhu, Shuyun; You, Jinmao


    Ag nanoclusters (Ag NCs) templated by hyperbranched polyethyleneimine (PEI) with different terminal groups and molecular weights had been developed as a special optical sensor for detecting p-nitrophenol (p-NP). When adding p-NP into Ag NCs, an obvious color change from pale yellow to deep yellow could be observed by naked eyes, accompanying with an apparent red-shift of absorption peak, and the reason was attributed to the formation of oxygen anion of p-NP based on the transfer of H(+) from p-NP to amine groups of PEI. The molecular weights of template would greatly affect the sensitivity of p-NP. Ag NCs capped by PEI terminated ethylenediamine (EDA) possessed better sensitivity than other Ag NCs, showing good linear range from 5 to 140μM with the limit of detection as low as 1.28μM. Most importantly, this present system displayed high selectivity toward p-NP even in the presence of other nitrophenols and nitrotoluenes. This reliable method had been successfully applied for the detection of p-NP in real water and soil samples.

  20. Old tree with new shoots: silver nanoparticles for label-free and colorimetric mercury ions detection

    NASA Astrophysics Data System (ADS)

    Gao, Shuyan; Jia, Xiaoxia; Chen, Yanli


    Mercury in the environment from global mercury emissions as well as various forms of contamination poses severe threats to both human health and the environment. Long-term exposure to high levels of Hg-based toxins results in serious and irreversible damage of the central nervous system and other organs. Therefore, the development of effective sensing systems for mercury detection becomes an increasing demand. In this article, a yogurt-mediated silver nanostructure is reported to be unprecedentedly used in the naked-eye and label-free detection of mercury. The method relies on the redox reaction resulting from the electrode potential difference between Ag+/Ag (0.7996 V) and Hg2+/Hg2 2+ (0.920 V) that makes colorless Hg2+ ions which oxidize colored silver nanoparticle (AgNP) to colorless Ag+. The labor-intensive modification of AgNPs and expensive labeling are avoided, and the traditional AuNPs are substituted by AgNPs in this Hg2+ ions sensing platform, which makes it facile, low-cost, and particularly useful for home, clinic, or field applications as well as resource-limited conditions. This sensing system achieves a detection limit as low as 10 nM, lower than the toxicity level of Hg2+ ions in drinking water (30 nM) defined by World Health Organization, and exhibits excellent selectivity, largely free from the matrix effect of the real water samples. This visual label-free Hg2+ ions sensing motif shows great promise for sensing Hg2+ ions in terms of sensitivity, selectivity, cost, and maneuverability. It is also a good example for the organic combination of green chemistry and functional materials, which may trigger interest in furthering biosystems for environmental science applications.

  1. Colorimetric detection of Cr3+ using gold nanoparticles functionalized with 4-amino hippuric acid

    NASA Astrophysics Data System (ADS)

    Jin, Weiwei; Huang, Pengcheng; Chen, Yueji; Wu, Fangying; Wan, Yiqun


    A facile and effective technique for monitoring Cr3+ concentration based on 4-amino hippuric acid (PAH) decorated Au nanoparticles (PAH-AuNPs) is introduced. The modified AuNPs were easily aggregated in the presence of Cr3+, resulting in the color change from red to violet or blue, which is in response to the surface plasmon absorption of dispersed or aggregated nanoparticles. Under the optimized conditions, a good linear relationship (correlation coefficient r = 0.998) was obtained between the ratio of the absorbance at 635 nm to that at 520 nm ( A 635 nm/ A 520 nm), and the concentration of Cr3+ was over the range of 5.0-120 µM with detection limit of 1.17 µM. This method exhibited excellent selectivity for Cr3+ over other tested heavy metal ions. Furthermore, there was no significant difference for the parameters of calibration equation between the presence and absence of ethylenediamine tetraacetic acid (EDTA), which suggests that the method can be applied in various real samples owing to the strong masking ability of EDTA. The assay was used to detect the concentrations of Cr3+ in liquid milk, milk power, and lake water samples with recoveries ranging from 93.5 to 114 %, indicating that the method could be used for extensive practical application.

  2. Higher catalytic activity of porphyrin functionalized Co₃O ₄ nanostructures for visual and colorimetric detection of H₂ O₂ and glucose.


    Liu, Qingyun; Zhu, Renren; Du, Hui; Li, Hui; Yang, Yanting; Jia, Qingyan; Bian, Bing


    5,10,15,20-Tetrakis(4-carboxyl pheyl)-porphyrin (H2TCPP) functionalized chain-like Co3O4 nanoparticles (NPs) were prepared by a facile two-step method. The H2TCPP-Co3O4 nanocomposites were demonstrated to display enhanced peroxidase-like activity than that of pure Co3O4 nanoparticles without modification with H2TCPP molecules, catalyzing oxidation of peroxidase substrate 3,3',5,5'-tetramethyl-benzidine (TMB) in the presence of H2O2 to produce a blue color reaction. Furthermore, H2TCPP-Co3O4 nanocomposites showed typical Michaelis-Menten kinetics and higher affinity to H2O2 and TMB than that of pure Co3O4 NPs alone. Based on H2TCPP-Co3O4 nanocomposites, a simple, sensitive and selective colorimetric method with TMB as the substrate for the detection of H2O2 and glucose was successfully established. This colorimetric method can be used for the colorimetric detection of H2O2 with a low detection limit of 4×10(-7)mol·L(-1) and a dynamic range of 1×10(-6)mol·L(-1) to 75×10(-6)mol·L(-1). This method was designed to detect glucose when combined with glucose oxidase at a low detection limit of 8.6×10(-7)mol·L(-1) and a dynamic range of 1×10(-6)mol·L(-1) to 10×10(-6)mol·L(-1). Results of a fluorescent probe suggested that the peroxidase-mimic activity of the H2TCPP-Co3O4 nanocomposites effectively catalyzed the decomposition of H2O2 into [OH] radicals.

  3. Importance of nanoparticle size in colorimetric and SERS-based multimodal trace detection of Ni(II) ions with functional gold nanoparticles.


    Krpetić, Zeljka; Guerrini, Luca; Larmour, Iain A; Reglinski, John; Faulds, Karen; Graham, Duncan


    Colorimetric detection of analytes using gold nanoparticles along with surface-enhanced Raman spectroscopy (SERS) are areas of intense research activity since they both offer sensing of very low concentrations of target species. Multimodal detection promotes the simultaneous detection of a sample by a combination of different techniques; consequently, surface chemistry design in the development of multimodal nanosensors is important for rapid and sensitive evaluation of the analytes by diverse analytical methods. Herein it is shown that nanoparticle size plays an important role in the design of functional nanoparticles for colorimetric and SERS-based sensing applications, allowing controlled nanoparticle assembly and tunable sensor response. The design and preparation of robust nanoparticle systems and their assembly is reported for trace detection of Ni(II) ions as a model system in an aqueous solution. The combination of covalently attached nitrilotriacetic acid moieties along with the L-carnosine dipeptide on the nanoparticle surface represents a highly sensitive platform for rapid and selective detection of Ni(II) ions. This systematic study demonstrates that significantly lower detection limits can be achieved by finely tuning the assembly of gold nanoparticles of different core sizes. The results clearly demonstrate the feasibility and usefulness of a multimodal approach.

  4. Colorimetric detection of manganese(II) ions using gold/dopa nanoparticles

    NASA Astrophysics Data System (ADS)

    Narayanan, Kannan Badri; Park, Hyun Ho


    We report here a one-pot, greener, eco-friendly strategy for the synthesis of gold nanoparticles using L-dopa. The as-prepared dopa-functionalized gold nanoparticles (AuNPs/dopa) can detect low concentrations of manganese(II) metal ions in aqueous solution. The binding forces between dopa and Mn2+ ions cause dopa-functionalized gold nanoparticles to come closer together, decreasing the interparticle distance and aggregating it with a change in color of colloidal solution from red to purplish-blue. Dynamic light scattering (DLS) analysis showed a decreased surface charge on the surface of gold nanoparticles when exposed to Mn2+ ions, which caused cross-linking aggregation. Transmission electron microscopic (TEM) images also revealed the aggregation of gold nanoparticles with the addition of Mn2+ ions. The extinction ratio of absorbance at 700-550 nm (A700/A550) was linear against the concentration of [Mn2+] ions. Thus, the optical absorption spectra of gold colloidal solution before and after the addition of Mn2+ ions reveal the concentration of Mn2+ ions in solution.

  5. Colorimetric detection of manganese(II) ions using gold/dopa nanoparticles.


    Narayanan, Kannan Badri; Park, Hyun Ho


    We report here a one-pot, greener, eco-friendly strategy for the synthesis of gold nanoparticles using L-dopa. The as-prepared dopa-functionalized gold nanoparticles (AuNPs/dopa) can detect low concentrations of manganese(II) metal ions in aqueous solution. The binding forces between dopa and Mn(2+) ions cause dopa-functionalized gold nanoparticles to come closer together, decreasing the interparticle distance and aggregating it with a change in color of colloidal solution from red to purplish-blue. Dynamic light scattering (DLS) analysis showed a decreased surface charge on the surface of gold nanoparticles when exposed to Mn(2+) ions, which caused cross-linking aggregation. Transmission electron microscopic (TEM) images also revealed the aggregation of gold nanoparticles with the addition of Mn(2+) ions. The extinction ratio of absorbance at 700-550nm (A700/A550) was linear against the concentration of [Mn(2+)] ions. Thus, the optical absorption spectra of gold colloidal solution before and after the addition of Mn(2+) ions reveal the concentration of Mn(2+) ions in solution.

  6. Self-assembly of core-satellite gold nanoparticles for colorimetric detection of copper ions.


    Weng, Ziqing; Wang, Hongbin; Vongsvivut, Jitraporn; Li, Runqing; Glushenkov, Alexey M; He, Jin; Chen, Ying; Barrow, Colin J; Yang, Wenrong


    Molecule-coated nanoparticles are hybrid materials which can be engineered with novel properties. The molecular coating of metal nanoparticles can provide chemical functionality, enabling assembly of the nanoparticles that are important for applications, such as biosensing devices. Herein, we report a new self-assembly of core-satellite gold nanoparticles linked by a simple amino acid l-Cysteine for biosensing of Cu(2+). The plasmonic properties of core-satellite nano-assemblies were investigated, a new red shifted absorbance peak from about 600 to 800 nm was found, with specific wavelength depending on ratios with assembly of large and small gold nanoparticles. The spectral features obtained using surface-enhanced Raman spectroscopy (SERS) provided strong evidence for the assembly of the Cu(2+) ions to the L-Cysteine molecules leading to the successful formation of the core-satellite Cu(l-Cysteine) complex on the gold surfaces. In addition, a linear relationship between the concentration of mediating Cu(2+) and absorbance of self-assembled gold nanoparticles (GNPs) at 680 nm was obtained. These results strongly address the potential strategy for applying the functionalized GNPs as novel biosensing tools in trace detections of certain metal ions.

  7. Blocked Enzymatic Etching of Gold Nanorods: Application to Colorimetric Detection of Acetylcholinesterase Activity and Its Inhibitors.


    Saa, Laura; Grinyte, Ruta; Sánchez-Iglesias, Ana; Liz-Marzán, Luis M; Pavlov, Valeri


    The anisotropic morphology of gold nanorods (AuNRs) has been shown to lead to nonuniform ligand distribution and preferential etching through their tips. We have recently demonstrated that this effect can be achieved by biocatalytic oxidation with hydrogen peroxide, catalyzed by the enzyme horseradish peroxidase (HRP). We report here that modification of AuNRs with thiol-containing organic molecules such as glutathione and thiocholine hinders enzymatic AuNR etching. Higher concentrations of thiol-containing molecules in the reaction mixture gradually decrease the rate of enzymatic etching, which can be monitored by UV-vis spectroscopy through changes in the AuNR longitudinal plasmon band. This effect can be applied to develop novel optical assays for acetylcholinesterase (AChE) activity. The biocatalytic hydrolysis of acetylthiocholine by AChE yields thiocholine, which prevents enzymatic AuNR etching in the presence of HRP. Additionally, the same bioassay can be used for the detection of nanomolar concentrations of AChE inhibitors such as paraoxon and galanthamine.

  8. Plasma dark matter direct detection

    SciTech Connect

    Clarke, J.D.; Foot, R. E-mail:


    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken U(1)' gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed U(1)' neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless 'dark photon' (the U(1)' gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA annual modulation signal is due primarily to electron recoils (or even a combination of electron recoils and nuclear recoils). The importance of diurnal modulation (in addition to annual modulation) as a means of probing this kind of dark matter is also emphasised.

  9. Colorimetric detection of platelet-derived growth factors through competitive interactions between proteins and functional gold nanoparticles.


    Lin, Tzu-En; Chen, Wei-His; Shiang, Yen-Chun; Huang, Chih-Ching; Chang, Huan-Tsung


    We have developed a colorimetric assay-using aptamer modified 13-nm gold nanoparticles (Apt-Au NPs) and fibrinogen adsorbed Au NPs (Fib-Au NPs, 56nm)-for the highly selective and sensitive detection of platelet-derived growth factors (PDGF). Apt-Au NPs and Fib-Au NPs act as recognition and reporting units, respectively. PDGF-binding-aptamer (Apt(PDGF)) and 29-base-long thrombin-binding-aptamer (Apt(thr29)) are conjugated with Au NPs to prepare functional Apt-Au NPs (Apt(PDGF)/Apt(thr29)-Au NPs) for specific interaction with PDGF and thrombin, respectively. Thrombin interacts with Fib-Au NPs in solutions to catalyze the formation of insoluble fibrillar fibrin-Au NPs agglutinates through the polymerization of the unconjugated and conjugated fibrinogen. The activity of thrombin is suppressed once it interacts with the Apt(PDGF)/Apt(thr29)-Au NPs. The suppression decreases due to steric effects through the specific interaction of PDGF with Apt(PDGF), occurring on the surfaces of Apt(PDGF)/Apt(thr29)-Au NPs. Under optimal conditions [Apt(PDGF)/Apt(thr29)-Au NPs (25pM), thrombin (400pM) and Fib-Au NPs (30pM)], the Apt(PDGF)/Apt(thr29)-Au NPs/Fib-Au NPs probe responds linearly to PDGF over the concentration range of 0.5-20nM with a correlation coefficient of 0.96. The limit of detection (LOD, signal-to-noise ratio=3) for each of the three PDGF isoforms is 0.3nM in the presence of bovine serum albumin at 100μM. When using the Apt(PDGF)/Apt(thr29)-Au NPs as selectors for the enrichment of PDGF and for the removal of interferences from cell media, the LOD for PDGF provided by this probe is 35pM. The present probe reveals that the concentration of PDGF in the three cell media is 230 (±20)pM, showing its advantages of simplicity, sensitivity, and specificity.

  10. Real-time colorimetric detection of target DNA using isothermal target and signaling probe amplification and gold nanoparticle cross-linking assay.


    Jung, Cheulhee; Chung, Ji Won; Kim, Un Ok; Kim, Min Hwan; Park, Hyun Gyu


    We describe a facile gold nanoparticle (AuNP)-mediated colorimetric method for real-time detection of target DNA in conjugation with our unique isothermal target and signaling probe amplification (iTPA) method, comprising novel ICA (isothermal chain amplification) and CPT (cycling probe technology). Under isothermal conditions, the iTPA simultaneously amplifies the target and signaling probe through two displacement events induced by a combination of four specially designed primers, the strand displacement activity of DNA polymerase, and the RNA degrading activity of RNase H. The resulting target amplicons are hybridized with gold nanoparticle cross-linking assay (GCA) probes having a DNA-RNA-DNA chimeric form followed by RNA cleavage by RNase H in the CPT step. The intact GCA probes were designed to cross-link two sets of DNA-AuNPs conjugates in the absence of target DNA, inducing aggregation (blue color) of AuNPs. On the contrary, the presence of target DNA leads to cleavage of the GCA probes in proportion to the amount of amplified target DNA and the solution remains red in color without aggregation of AuNPs. Relying on this strategy, 10(2) copies of target Chlamydia trachomatis plasmid were successfully detected in a colorimetric manner. Importantly, all the procedures employed up to the final detection of the target DNA were performed under isothermal conditions without requiring any detection instruments. Therefore, this strategy would greatly benefit convenient, real-time monitoring technology of target DNA under restricted environments.

  11. A Colorimetric Sensor for the Highly Selective Detection of Sulfide and 1,4-Dithiothreitol Based on the In Situ Formation of Silver Nanoparticles Using Dopamine

    PubMed Central

    Zhao, Lingzhi; Zhao, Liu; Miao, Yanqing; Liu, Chunye; Zhang, Chenxiao


    Hydrogen sulfide (H2S) has attracted attention in biochemical research because it plays an important role in biosystems and has emerged as the third endogenous gaseous signaling compound along with nitric oxide (NO) and carbon monoxide (CO). Since H2S is a kind of gaseous molecule, conventional approaches for H2S detection are mostly based on the detection of sulfide (S2−) for indirectly reflecting H2S levels. Hence, there is a need for an accurate and reliable assay capable of determining sulfide in physiological systems. We report here a colorimetric, economic, and green method for sulfide anion detection using in situ formation of silver nanoparticles (AgNPs) using dopamine as a reducing and protecting agent. The changes in the AgNPs absorption response depend linearly on the concentration of Na2S in the range from 2 to 15 μM, with a detection limit of 0.03 μM. Meanwhile, the morphological changes in AgNPs in the presence of S2− and thiol compounds were characterized by transmission electron microscopy (TEM). The as-synthetized AgNPs demonstrate high selectivity, free from interference, especially by other thiol compounds such as cysteine and glutathione. Furthermore, the colorimetric sensor developed was applied to the analysis of sulfide in fetal bovine serum and spiked serum samples with good recovery. PMID:28335506

  12. Smartphone spectrometer for colorimetric biosensing.


    Wang, Yi; Liu, Xiaohu; Chen, Peng; Tran, Nhung Thi; Zhang, Jinling; Chia, Wei Sheng; Boujday, Souhir; Liedberg, Bo


    We report on a smartphone spectrometer for colorimetric biosensing applications. The spectrometer relies on a sample cell with an integrated grating substrate, and the smartphone's built-in light-emitting diode flash and camera. The feasibility of the smartphone spectrometer is demonstrated for detection of glucose and human cardiac troponin I, the latter in conjunction with peptide-functionalized gold nanoparticles.

  13. Silver nanoparticles deposited on amine-functionalized silica spheres and their amalgamation-based spectral and colorimetric detection of Hg(II) ions

    NASA Astrophysics Data System (ADS)

    Rameshkumar, Perumal; Manivannan, Shanmugam; Ramaraj, Ramasamy


    A facile synthetic method to decorate amine-functionalized silica spheres (SiO2) by silver nanoparticles (Ag NPs) is reported. The transmission electron microscopic (TEM) images showed that spherical Ag NPs with an average particle size of 14 nm were deposited on 250 nm-sized SiO2 spheres (SiO2/Ag NPs). The spectral and colorimetric detection of Hg(II) ions were carried out using the synthesized SiO2/Ag NPs with an experimental detection limit of 5 μM. It was found that the addition of Hg(II) ions (150 μM) into the solution of SiO2/Ag NPs completely quenched the SPR band of the Ag NPs due to the formation of anisotropic Ag amalgam crystals (AgHg). The selective detection of Hg(II) ions by SiO2/Ag NPs in the presence of other environmentally relevant metal ions was also demonstrated using spectral and colorimetric methods.

  14. MicroRNA-triggered, cascaded and catalytic self-assembly of functional ``DNAzyme ferris wheel'' nanostructures for highly sensitive colorimetric detection of cancer cells

    NASA Astrophysics Data System (ADS)

    Zhou, Wenjiao; Liang, Wenbin; Li, Xin; Chai, Yaqin; Yuan, Ruo; Xiang, Yun


    The construction of DNA nanostructures with various sizes and shapes has significantly advanced during the past three decades, yet the application of these DNA nanostructures for solving real problems is still in the early stage. On the basis of microRNA-triggered, catalytic self-assembly formation of the functional ``DNAzyme ferris wheel'' nanostructures, we show here a new signal amplification platform for highly sensitive, label-free and non-enzyme colorimetric detection of a small number of human prostate cancer cells. The microRNA (miR-141), which is catalytically recycled and reused, triggers isothermal self-assembly of a pre-designed, G-quadruplex sequence containing hairpin DNAs into ``DNAzyme ferris wheel''-like nanostructures (in association with hemin) with horseradish peroxidase mimicking activity. These DNAzyme nanostructures catalyze an intensified color transition of the probe solution for highly sensitive detection of miR-141 down to 0.5 pM with the naked eye, and the monitoring of as low as 283 human prostate cancer cells can also, theoretically, be achieved in a colorimetric approach. The work demonstrated here thus offers new opportunities for the construction of functional DNA nanostructures and for the application of these DNA nanostructures as an effective signal amplification means in the sensitive detection of nucleic acid biomarkers.

  15. [Fe(CN)6]4- decorated mesoporous gelatin thin films for colorimetric detection and as sorbents of heavy metal ions.


    Shi, Li; Huang, Hubiao; Sun, Luwei; Lu, Yanping; Du, Binyang; Mao, Yiyin; Li, Junwei; Ye, Zhizhen; Peng, Xinsheng


    [Fe(CN)6](4-) decorated mesoporous gelatin films, acting as colorimetric sensors and sorbents for heavy metal ions, were prepared by incorporating [Fe(CN)6](4-) ions into the mesoporous gelatin films through electrostatic interaction. Gelatin-Prussian blue (PB) and gelatin-PB analogue composite films were successfully synthesized by immersing the [Fe(CN)6](4-) decorated gelatin films into aqueous solutions of metal ions, such as Fe(3+), Cu(2+), Co(2+), Pb(2+) and Cd(2+) (all as nitrates). The in situ formation process of PB or its analogues in the films was investigated using quartz crystal microbalance (QCM) measurements. According to the different colors of the PB nanoparticles and its analogues, the [Fe(CN)6](4-) decorated mesoporous gelatin films demonstrated colorimetric sensor abilities for detecting the corresponding metal ions by the naked eye with sufficient sensitivity at 1 ppm level and a quite short response time of 5 minutes. Moreover, due to the [Fe(CN)6](4-) functionality and other functional groups of gelatin itself, this [Fe(CN)6](4-) decorated mesoporous gelatin film shows a tens times higher adsorption ability for heavy metal ions in water than that of activated carbon. Due to both the efficient detection and high adsorption ability for heavy metal ions, this film has wide potential applications for the detection and purification of heavy metal ions from polluted water.

  16. A highly selective colorimetric and "turn-on" fluorimetric chemosensor for detecting CN- based on unsymmetrical azine derivatives in aqueous media

    NASA Astrophysics Data System (ADS)

    Sun, You; Hu, Jing-Han; Qi, Jing; Li, Jian-Bin


    A novel highly selective chemosensor S1 for cyanide based on unsymmetrical azine derivative was successfully designed and synthesized, which showed both colorimetric and fluorescence turn-on responses for cyanide ions in aqueous. This structurally simple chemosensor could detect CN- anion over other anions in aqueous solution DMSO/H2O (v/v = 3:2) undergo deprotonation reaction. Results showed that the chemosensor S1 exhibited 50 fold enhancement in fluorescence at 530 nm and showed an obvious change in color from colorless to yellow that could be detected by naked eye under the UV-lamp after the addition of CN- in aqueous solution. Moreover, the detection limit on fluorescence response of the sensor to CN- is down to 6.17 × 10- 8 M by titration method. Test strips based on S1 were obtain, which could be used as a convenient and efficient CN- test kit to detect CN- in aqueous solution.

  17. A rapid molecular diagnosis of cutaneous leishmaniasis by colorimetric malachite green-loop-mediated isothermal amplification (LAMP) combined with an FTA card as a direct sampling tool.


    Nzelu, Chukwunonso O; Cáceres, Abraham G; Guerrero-Quincho, Silvia; Tineo-Villafuerte, Edwin; Rodriquez-Delfin, Luis; Mimori, Tatsuyuki; Uezato, Hiroshi; Katakura, Ken; Gomez, Eduardo A; Guevara, Angel G; Hashiguchi, Yoshihisa; Kato, Hirotomo


    Leishmaniasis remains one of the world's most neglected diseases, and early detection of the infectious agent, especially in developing countries, will require a simple and rapid test. In this study, we established a quick, one-step, single-tube, highly sensitive loop-mediated isothermal amplification (LAMP) assay for rapid detection of Leishmania DNA from tissue materials spotted on an FTA card. An FTA-LAMP with pre-added malachite green was performed at 64°C for 60min using a heating block and/or water bath and DNA amplification was detected immediately after incubation. The LAMP assay had high detection sensitivity down to a level of 0.01 parasites per μl. The field- and clinic-applicability of the colorimetric FTA-LAMP assay was demonstrated with 122 clinical samples collected from patients suspected of having cutaneous leishmaniasis in Peru, from which 71 positives were detected. The LAMP assay in combination with an FTA card described here is rapid and sensitive, as well as simple to perform, and has great potential usefulness for diagnosis and surveillance of leishmaniasis in endemic areas.

  18. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    PubMed Central

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge


    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage. PMID:26559602

  19. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    NASA Astrophysics Data System (ADS)

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge


    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage.

  20. Colorimetric detection of anions in aqueous media using N-monosubstituted diaminomaleonitrile-based azo-azomethine receptors: Real-life applications

    NASA Astrophysics Data System (ADS)

    Khanmohammadi, Hamid; Rezaeian, Khatereh; Abdollahi, Alieh


    New N-monosubstituted diaminomaleonitrile-based azo-azomethine dyes have been synthesized in order to develop colorimetric sensors for detection of biologically important anions in aqueous media. Importantly, the reported sensor decorated with strong electron-withdrawing group can detect inorganic fluoride in water even at 0.037 ppm level, which is lower than WHO permissible level (below 1 ppm). Successfully, the prepared dyes were used for qualitative and quantitative detection of inorganic fluoride in toothpaste and mouthwash. The anion recognition mechanism was also investigated by detailed UV-Vis and 1H NMR experiments. The detailed 1H NMR experiments corroborated that anion recognition is based on the deprotonation phenomenon.

  1. An integrated slidable and valveless microdevice with solid phase extraction, polymerase chain reaction, and immunochromatographic strip parts for multiplex colorimetric pathogen detection.


    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Kim, Do Hyun; Seo, Tae Seok


    A total integrated genetic analysis microsystem was developed, which consisted of solid phase extraction (SPE), polymerase chain reaction (PCR), and immunochromatographic strip (ICS) parts for multiplex colorimetric detection of pathogenic Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) on a portable genetic analyzer. Utilizing a slidable chamber, which is a movable glass wafer, complex microvalves could be eliminated for fluidic control in the microchannel, which could simplify the chip design and chip operation. The integrated slidable microdevice was composed of 4 layers: a 4-point Pt/Ti resistance temperature detector (RTD) wafer, a micro-patterned channel wafer, a 2 μL volume slidable chamber, and an ICS. The entire process from the DNA extraction in the SPE chamber to the detection of the target gene expression by the ICS was serially performed by simply sliding the slidable chamber from one part to another functional part. The total process for multiplex pathogenic S. aureus and E. coli O157:H7 detection on the integrated slidable microdevice was accomplished within 55 min with a detection limit of 5 cells. Furthermore, spiked bacteria samples in milk were also successfully analysed on the portable genetic analysis microsystem with sample-in-answer-out capability. The proposed total integrated microsystem is adequate for point-of-care DNA testing in that no microvalves and complex tubing systems are required due to the use of the slidable chamber and the bulky and expensive fluorescence or electrochemical detectors are not necessary due to the ICS based colorimetric detection.

  2. Selective and sensitive detection of free bilirubin in blood serum using human serum albumin stabilized gold nanoclusters as fluorometric and colorimetric probe.


    Santhosh, Mallesh; Chinnadayyala, Somasekhar R; Kakoti, Ankana; Goswami, Pranab


    We report here a fluorescence quenching based non-enzymatic method for sensitive and reliable detection of free bilirubin in blood serum samples using human serum albumin (HSA) stabilized gold nanoclusters (HSA-AuNCs) as fluorescent probe. The fluorescence of the nanoclusters was strongly quenched by bilirubin in a concentration dependent manner by virtue of the inherent specific interaction between bilirubin and HSA. A strong binding constant of 0.55×10(6) L mole(-1) between the HSA-AuNC and bilirubin was discerned. The nano clusters each with size ~1.0 nm (in diameter) and a core of Au18 were homogeneously distributed in HSA molecules as revealed from the respective high resolution transmission electron microscopic and mass spectroscopic studies. The fluorescence quenching phenomena which obeyed a simple static quenching mechanism, was utilized for interference free detection of bilirubin with minimum detection limit (DL) of 248±12 nM (S/N=3). The fluorescence response of HSA-AuNCs against bilirubin was practically unaltered over a wide pH (6-9) and temperature (25-50 °C) range. Additionally, peroxidase-like catalytic activity of these nanoclusters was exploited for colorimetric detection of bilirubin in serum sample with a DL of 200±19 nM by following the decrease in absorbance (at λ440 nm) of the reaction and its rate constant (Kp) of 2.57±0.63 mL μg(-1) min(-1). Both these fluorometric and colorimetric methods have been successfully used for detection of free bilirubin in blood serum samples.

  3. Coupling Activity-Based Detection, Target Amplification, Colorimetric and Fluorometric Signal Amplification, for Quantitative Chemosensing of Fluoride Generated from Nerve Agents.


    Sun, Xiaolong; Reuther, James F; Phillips, Scott T; Anslyn, Eric V


    The G-class nerve agents, which include sarin, soman, and cyclosarin, react readily with nucleophilic reagents to produce fluoride. Thus, a chemosensing protocol has been designed for these agents that pairs the nucleophilic reactivity of oximates for generating fluoride with an autoinductive target amplification reaction to amplify the quantity of fluoride for facile colorimetric and fluorescent optical quantification. The chemosensing protocol was demonstrated by using the nerve agent surrogate diisopropyl fluorophosphate (DFP) and benzaldoxime as the nucleophile. Autoinductive fluoride amplification responds to fluoride released from DFP by amplifying the fluoride concentration and a yellow reporter molecule. The reporter is a conjugated oligomer with a nominal repeating unit that originates from 4-aminobenzaldehyde. Exposure of the amplified fluoride to a fluoride-specific ratiometric fluorescent reporter provides a fluorescent readout, in which three fluorophores are generated per fluoride. Both colorimetric and fluorescent readouts enable quantitative assays with low micromolar limits of detection for fluoride resulting from DFP. More importantly, this work demonstrates the successful merging of multiple complex reactions for achieving selective, sensitive, and quantitative chemosensing.

  4. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    NASA Astrophysics Data System (ADS)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao, A1"/>


    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays.

  5. A Biocompatible Colorimetric Triphenylamine- Dicyanovinyl Conjugated Fluorescent Probe for Selective and Sensitive Detection of Cyanide Ion in Aqueous Media and Living Cells

    PubMed Central

    Zheng, Zi-Hua; Li, Zhi-Ke; Song, Lin-Jiang; Wang, Qi-Wei; Huang, Qing-Fei; Yang, Li


    A colorimetric and turn-on fluorescent probe 1 bearing triphenylamine-thiophene and dicyanovinyl groups has been synthesized and used to detect cyanide anion via a nucleophilic addition reaction. Probe 1 exhibited prominent selectivity and sensitivity towards CN− in aqueous media, even in the presence of other anions such as S2−, HS−, SO32−, S2O32−, S2O82−, I−, Br−, Cl−, F−, NO2−, N3−, SO42−, SCN−, HCO3−, CO32− and AcO−. Moreover, a low detection limit (LOD, 51 nM) was observed. In addition, good cell membrane permeability and low cytotoxicity to HeLa cells were also observed, suggesting its promising potential in bio-imaging. PMID:28218723

  6. Highly selective colorimetric detection and estimation of Hg2+ at nano-molar concentration by silver nanoparticles in the presence of glutathione.


    Alam, Ayesha; Ravindran, Aswathy; Chandran, Preethy; Sudheer Khan, S


    The present study investigated the colorimetric detection of mercury (Hg(2+)) ions by using silver nanoparticles (Ag NPs) in the presence of glutathione. The nanoparticles used in the study were synthesized biologically by using Polyalthia longifolia leaf extract. The synthesized nanoparticles were characterized by UV-visible spectrophotometer, transmission electron microscope, X-ray diffraction, particle size analyzer and zeta sizer. The particles were spherical in shape and it possesses the effective diameter of 5 nm. The zeta potential of the particles was determined to be -28.6 mV. Ag NPs-glutathione conjugates were able to detect Hg(2+) in nanomolar level. Ag NPs-glutathione conjugates upon interaction with Hg(2+) changes from yellowish brown to pale yellow and finally colorless. The study may be applied for the qualitative and quantitative estimation of mercury at very low concentration.

  7. A new pyrene-based Schiff-base: A selective colorimetric and fluorescent chemosensor for detection of Cu(II) and Fe(III)

    NASA Astrophysics Data System (ADS)

    Bhorge, Yeshwant Ramchandra; Tsai, Haw-Tyng; Huang, Keh-Feng; Pape, Albert J.; Janaki, Sudhakar Narasimha; Yen, Yao-Pin


    A new receptor 1 was prepared, for the detection of Cu2+ and Fe3+ in solutions as a colorimetric and fluorescent sensor, respectively. Receptor 1 shows highly selective and sensitive recognition toward Cu2+ and Fe3+ by naked eye UV-Vis and fluorescent color changes in aqueous solution (DMSO/H2O = 8/2, v/v), respectively. The sensitivity toward Cu2+ or Fe3+ was not interfered with by the presence of other metal ions such as Mg2+, Cd2+, Ag+, Zn2+, Ni2+, Co2+, Mn2+, Cr3+, Ca2+, Na+, Pb2+, K+, Fe2+, Li+ and Hg2+ ions. Receptor 1 can be used for semi-quantitative recognition of Cu2+ ions at ppm level. The fluorescence microscopy experiments showed that the receptor is efficient for detection of Fe3+ in vitro, developing a good image of the biological organelles.

  8. Low-cost preparation of photoluminescent carbon nanodots and application as peroxidase mimetics in colorimetric detection of H2O2 and glucose.


    Wu, Di; Deng, Xiang; Huang, Xiaomei; Wang, Kun; Liu, Qingye


    A low-cost and facile preparation of water-soluble photoluminescent carbon nanodots (CDs) with a quantum yield of approximately 12.4% by hydrothermal method utilizing the leaves of Olea Europaea, a large number of planted trees in southwest of China, as a carbon source is developed for the first time. The prepared photoluminescent CDs not only show favorable photoluminescent properties, but also possess intrinsic peroxidase-like activity for colorimetric and UV-Vis absorption detection of hydrogen oxide (H2O2) and glucose. This sensing system exhibits excellent sensitivity toward H2O2 and glucose with the limit of detection as low as 0.6 microM and 5.2 microM. The practical use of this system for glucose determination in serum samples is also demonstrated successfully. The stability and low cost of photoluminescent CDs make them a powerful tool for a wide range of potential applications in biochemical analysis.

  9. A Comparison of Colorimetric Assessment of Vaginal pH with Nugent Score for the Detection of Bacterial Vaginosis

    PubMed Central

    Bellad, Mrutyunjaya B.; Charantimath, Umesh S.; Kavi, Avinash; Nagmoti, Jyoti M.; Nagmoti, Mahantesh B.; Mallapur, Ashalata A.; Katageri, Geetanjali M.; Ramadurg, Umesh Y.; Bannale, Sheshidhar G.; Revankar, Amit P.; Ganachari, M. S.; Derman, Richard J.; Goudar, Shivaprasad S.


    Background. A Nugent score > 7 has been defined as the gold standard for the diagnosis for bacterial vaginosis (BV), though it is resource intensive and impractical as point of care testing. We sought to determine if colorimetric assessment of vaginal pH can accurately predict the occurrence of BV. Methods. We performed a planned subanalysis of 1,216 pregnant women between 13 0/7 and 19 6/7 weeks who underwent vaginal examination as part of a randomized controlled trial. Using a standardized technique, specimens were obtained for colorimetric assessment and two separate slides for Gram staining. These slides were subsequently evaluated by two independent blinded microbiologists for Nugent scoring. Results. Interrater reliability of the interpretation of the Nugent score was excellent (intraclass correlation-individual 0.93 (95 CI 0.92 to 0.94) and average 0.96 (95% CI 0.95 to 0.97)). The sensitivity of an elevated pH > 5 for a Nugent score > 7 was 21.9% while the specificity was 84.5%. The positive predictive value in our population was 33.7% with a negative predictive value of 75.0%. Conclusion. Though the Nugent score is internally accurate, the prediction of BV using vaginal pH alone has poor sensitivity and specificity. PMID:28293099

  10. A signal-amplified electrochemical DNA biosensor incorporated with a colorimetric internal control for Vibrio cholerae detection using shelf-ready reagents.


    Low, Kim-Fatt; Zain, Zainiharyati Mohd; Yean, Chan Yean


    A novel enzyme/nanoparticle-based DNA biosensing platform with dual colorimetric/electrochemical approach has been developed for the sequence-specific detection of the bacterium Vibrio cholerae, the causative agent of acute diarrheal disease in cholera. This assay platform exploits the use of shelf-stable and ready-to-use (shelf-ready) reagents to greatly simplify the bioanalysis procedures, allowing the assay platform to be more amenable to point-of-care applications. To assure maximum diagnosis reliability, an internal control (IC) capable of providing instant validation of results was incorporated into the assay. The microbial target, single-stranded DNA amplified with asymmetric PCR, was quantitatively detected via electrochemical stripping analysis of gold nanoparticle-loaded latex microspheres as a signal-amplified hybridization tag, while the incorporated IC was analyzed using a simplified horseradish peroxidase enzyme-based colorimetric scheme by simple visual observation of enzymatic color development. The platform showed excellent diagnostic sensitivity and specificity (100%) when challenged with 145 clinical isolate-spiked fecal specimens. The limits of detection were 0.5ng/ml of genomic DNA and 10 colony-forming units (CFU)/ml of bacterial cells with dynamic ranges of 0-100ng/ml (R(2)=0.992) and log10 (1-10(4) CFU/ml) (R(2)=0.9918), respectively. An accelerated stability test revealed that the assay reagents were stable at temperatures of 4-37°C, with an estimated ambient shelf life of 200 days. The versatility of the biosensing platform makes it easily adaptable for quantitative detection of other microbial pathogens.

  11. Molecular recognition and colorimetric detection of cholera toxin by poly(diacetylene) liposomes incorporating G{sub m1} ganglioside

    SciTech Connect

    Pan, J.J.; Charych, D.


    Molecular recognition sites on cell membranes serve as the main communication channels between the inside of a cell and its surroundings. Upon receptor binding, cellular messages such as ion channel opening or activation of enzymes are triggered. In this report, we demonstrate that artificial cell membranes made from conjugated lipid polymers (poly(diacetylene)) can, on a simple level, mimic membrane processes of molecular recognition and signal transduction. The ganglioside GM1 was incorporated into poly(diacetylene) liposomes. Molecular recognition of cholera toxin at the interface of the liposome resulted in a change of the membrane color due to conformational charges in the conjugated (ene-yne) polymer backbone. The `colored liposomes` might be used as simple colorimetric sensors for drug screening or as new tools to study membrane-membrane or membrane-receptor interactions. 21 refs., 3 figs.

  12. Microwave assisted synthesis of tyrosine protected gold nanoparticles for dual (colorimetric and fluorimetric) detection of spermine and spermidine in biological samples.


    Rawat, Karuna A; Bhamore, Jigna R; Singhal, Rakesh Kumar; Kailasa, Suresh Kumar


    In this work, tyrosine-protected gold nanoparticles (Tyr-Au NPs) were fabricated by one-step reduction of Au(3+) ion using Tyr as a reducing and capping agent under microwave irradiation. The Tyr-Au NPs were successfully used as a dual probe for colorimetric and fluorescence turn-on assays of spermine and spermidine in biological samples. Upon addition of spermine and spermidine, the characteristic surface plasmon resonance (SPR) band of Tyr-Au NPs was red-shifted to 596 and 616nm and the emission peak (Tyr) at 410nm was gradually increased with increasing concentration of both analytes, confirming the aggregation of Tyr-Au NPs induced by spermine and spermidine, which results to restore fluorescence of Tyr on the surfaces of Au NPs. In addition, it shows high selectivity for sensitive detection of prostatic cancer biomarkers spermine and spermidine in real clinical applications with reduced sample preparations.

  13. A triphenylamine-based colorimetric and fluorescent probe with donor–bridge–acceptor structure for detection of G-quadruplex DNA.


    Wang, Ming-Qi; Zhu, Wen-Xiang; Song, Zhuan-Zhuan; Li, Shuo; Zhang, Yong-Zhao


    In this Letter, three triphenylamine-based dyes (TPA-1, TPA-2a and TPA-2b) with donor–bridge–acceptor (D–p–A) structure were designed and synthesized for the purpose of G-quadruplexes recognition. In aqueous conditions, the interactions of the dyes with G-quadruplexes were studied with the aim to establish the influence of the geometry of the dyes on their binding and probing properties. Results indicate that TPA-2b displays significant selective colorimetric and fluorescent changes upon binding of G-quadruplex DNA. More importantly, its distinct color change enables visual detection and differentiation of G-quadruplexes from single and duplex DNA structures. CD titration date reveals that TPA-2b could induce and stabilize the formation of G-quadruplex structure. All these remarkable properties of TPA-2b suggest that it should have promising application in the field of G-quadruplexes research.

  14. A rhodamine 6G derived Schiff base as a fluorescent and colorimetric probe for pH detection and its crystal structure

    NASA Astrophysics Data System (ADS)

    Guo, Ping; Liu, Lijuan; Shi, Qian; Yin, Chunyan; Shi, Xuefang


    A fluorescent and colorimetric pH probe based on a rhodamine 6G derivative, RP1, was designed and synthesized. The probe was based on the pH induced change in the structure between the spirocyclic (non-fluorescent, colorless) and quinoid (fluorescent, pink) forms of rhodamine 6G. The effect of the acid concentration on the fluorescence "off-on" behaviors of RP1 was investigated. RP1 was fluorescent in the pH range of 1.1-3.1 and has a pKa value of 2.08 (±0.07). Thus RP1 should be useful for studies in strongly acidic environments. Possible interferences from fourteen common metal ions were tested and excluded showing the excellent selectivity of the probe. Finally, the probe exhibits an intense color change at pH values lower than 3.1 which makes it useful for naked-eye pH detection.

  15. A reversible and reusable selective chemosensor for fluoride detection using a phenolic OH-containing BODIPY dye by both colorimetric 'naked-eye' and fluorometric modes.


    Wang, Lingyun; Fang, Guipo; Cao, Derong


    A novel BODIPY-based probe 1 was designed and synthesized as a selective fluorescent and colorimetric chemosensor for fluoride. The spectral responses of 1 to fluoride in acetonitrile were studied: an approximately 118 nm red shift in absorption and 'turn-off' emission response was observed. The striking pink to indigo change in ambient light was thought to be due to the deprotonation of the phenol moiety by way of O-H · · · F hydrogen bonding interactions. Interestingly, when the nonfluorescent 1-F(-) solution treated with trifluoroacetic acid (TFA) resulted in color change from indigo to pink and a significant enhancement of fluorescence intensity (10-fold). Furthermore, the reversibility and reusability of probe 1 for the detection of F(-) ion was tested for four cycles indicating the probe 1 could be used in reversible manner.

  16. Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.


    Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy


    The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field.

  17. Gaze Direction Detection in Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Forgeot d'Arc, Baudouin; Delorme, Richard; Zalla, Tiziana; Lefebvre, Aline; Amsellem, Frédérique; Moukawane, Sanaa; Letellier, Laurence; Leboyer, Marion; Mouren, Marie-Christine; Ramus, Franck


    Detecting where our partners direct their gaze is an important aspect of social interaction. An atypical gaze processing has been reported in autism. However, it remains controversial whether children and adults with autism spectrum disorder interpret indirect gaze direction with typical accuracy. This study investigated whether the detection of…

  18. Colorimetric Method of Loop-Mediated Isothermal Amplification with the Pre-Addition of Calcein for Detecting Flavobacterium columnare and its Assessment in Tilapia Farms.


    Suebsing, Rungkarn; Kampeera, Jantana; Sirithammajak, Sarawut; Withyachumnarnkul, Boonsirm; Turner, Warren; Kiatpathomchai, Wansika


    Flavobacterium columnare, the causative agent of columnaris disease in fish, affects many economically important freshwater fish species. A colorimetric method of loop-mediated isothermal amplification with the pre-addition of calcein (LAMP-calcein) was developed and used to detect the presence of F. columnare in farmed tilapia (Nile Tilapia Oreochromis niloticus and red tilapia [Nile Tilapia × Mozambique Tilapia O. mossambicus]) and rearing water. The detection method, based on a change in color from orange to green, could be performed within 45 min at 63°C. The method was highly specific, as it had no cross-detections with 14 other bacterial species, including other fish pathogens and two Flavobacterium species. The method has a minimum detection limit of 2.2 × 10(2) F. columnare CFU; thus, it is about 10 times more sensitive than conventional PCR. With this method, F. columnare was detected in gonad, gill, and blood samples from apparently healthy tilapia broodstock as well as in samples of fertilized eggs, newly hatched fry, and rearing water. The bacteria isolated from the blood were further characterized biochemically and found to be phenotypically identical to F. columnare. The amplified products from the LAMP-calcein method had 97% homology with the DNA sequence of F. columnare.

  19. The US Dark Matter Direct Detection Program

    NASA Astrophysics Data System (ADS)

    Baer, Howard


    Recently, the joint HEPAP/AAAS DMSAG (Dark matter Scientific Assessment Group) outlined a strategy for the future of dark matter direct detection. I will discuss the motivations for dark matter detection, possible DM candidates from theory, and the variety of techniques proposed to push the search forward into the most interesting regimes of parameter space. These techniques include cryogenic detection, detection via noble liquids, and directional detection. Coupled with results from LHC in the next few years, we may be on our way to revealing the identity of the mysterious dark matter particle.

  20. UV-vis spectroscopy and colorimetric models for detecting anthocyanin-metal complexes in plants: An overview of in vitro and in vivo techniques.


    Fedenko, Volodymyr S; Shemet, Sergiy A; Landi, Marco


    Although anthocyanin (ACN) biosynthesis is one of the best studied pathways of secondary metabolism in plants, the possible physiological and ecological role(s) of these pigments continue to intrigue scientists. Like other dihydroxy B-ring substituted flavonoids, ACNs have an ability to bind metal and metalloid ions, a property that has been exploited for a variety of purposes. For example, the metal binding ability may be used to stabilize ACNs from plant food sources, or to modify their colors for using them as food colorants. The complexation of metals with cyanidin derivatives can also be used as a simple, sensitive, cheap, and rapid method for determination concentrations of several metals in biological and environmental samples using UV-vis spectroscopy. Far less information is available on the ecological significance of ACN-metal complexes in plant-environment interactions. Metalloanthocyanins (protocyanin, nemophilin, commelinin, protodelphin, cyanosalvianin) are involved in the copigmentation phenomenon that leads to blue-pigmented petals, which may facilitate specific plant-pollinator interactions. ACN-metal formation and compartmentation into the vacuole has also been proposed to be part of an orchestrated detoxification mechanism in plants which experience metal/metalloid excess. However, investigations into ACN-metal interactions in plant biology may be limited because of the complexity of the analytical techniques required. To address this concern, here we describe simple methods for the detection of ACN-metal both in vitro and in vivo using UV-vis spectroscopy and colorimetric models. In particular, the use of UV-vis spectra, difference absorption spectra, and colorimetry techniques will be described for in vitro determination of ACN-metal features, whereas reflectance spectroscopy and colorimetric parameters related to CIE L(*)a(*)b(*) and CIE XYZ systems will be detailed for in vivo analyses. In this way, we hope to make this high-informative tool

  1. Efficient ensemble system based on the copper binding motif for highly sensitive and selective detection of cyanide ions in 100% aqueous solutions by fluorescent and colorimetric changes.


    Jung, Kwan Ho; Lee, Keun-Hyeung


    A peptide-based ensemble for the detection of cyanide ions in 100% aqueous solutions was designed on the basis of the copper binding motif. 7-Nitro-2,1,3-benzoxadiazole-labeled tripeptide (NBD-SSH, NBD-SerSerHis) formed the ensemble with Cu(2+), leading to a change in the color of the solution from yellow to orange and a complete decrease of fluorescence emission. The ensemble (NBD-SSH-Cu(2+)) sensitively and selectively detected a low concentration of cyanide ions in 100% aqueous solutions by a colorimetric change as well as a fluorescent change. The addition of cyanide ions instantly removed Cu(2+) from the ensemble (NBD-SSH-Cu(2+)) in 100% aqueous solutions, resulting in a color change of the solution from orange to yellow and a "turn-on" fluorescent response. The detection limits for cyanide ions were lower than the maximum allowable level of cyanide ions in drinking water set by the World Health Organization. The peptide-based ensemble system is expected to be a potential and practical way for the detection of submicromolar concentrations of cyanide ions in 100% aqueous solutions.

  2. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    NASA Astrophysics Data System (ADS)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.


    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  3. Rapid colorimetric sensing of tetracycline antibiotics with in situ growth of gold nanoparticles.


    Shen, Li; Chen, Jing; Li, Na; He, Pingli; Li, Zhen


    A colorimetric assay utilizing the formation of gold nanoparticles was developed to detect tetracycline antibiotics in fluidic samples. Tetracycline antibiotics showed the capability of directly reducing aurate salts into atomic gold which form gold nanoparticles spontaneously under proper conditions. The resulted gold nanoparticles showed characteristic plasmon absorbance at 526 nm, which can be visualized by naked eyes or with a spectrophotometer. UV-vis absorbance of the resulted gold nanoparticles is correlated directly with the concentrations of tetracycline antibiotics in the solution, allowing for quantitative colorimetric detection of tetracycline antibiotics. Reaction conditions, such as pH, temperature, reaction time, and ionic strength were optimized. Sensitivity of the colorimetric assay can be enhanced by the addition of gold nanoparticle seeds, a LOD as low as 20 ng mL(-1) can be achieved with the help of seed particles. The colorimetric assay showed minimum interference from ethanol, methanol, urea, glucose, and other antibiotics such as sulfonamides, amino glycosides etc. Validity of the method was also evaluated on urine samples spiked with tetracycline antibiotics. The method provides a broad spectrum detection method for rapid and sensitive detection of reductive substances such as tetracycline antibiotics in liquid and biological samples.

  4. High sensitivity, loop-mediated isothermal amplification combined with colorimetric gold-nanoparticle probes for visual detection of high risk human papillomavirus genotypes 16 and 18.


    Kumvongpin, Ratchanida; Jearanaikool, Patcharee; Wilailuckana, Chotechana; Sae-Ung, Nattaya; Prasongdee, Prinya; Daduang, Sakda; Wongsena, Metee; Boonsiri, Patcharee; Kiatpathomchai, Wansika; Swangvaree, Sukumarn Sanersak; Sandee, Alisa; Daduang, Jureerut


    High-risk human papillomavirus (HR-HPV) causes cervical cancer. HPV16 and HPV18 are the most prevalent strains of the virus reported in women worldwide. Loop-mediated isothermal amplification (LAMP) is an alternative method for DNA detection under isothermal conditions. However, it results in a turbid amplified product which is not easily detected by the naked eye. This study aimed to develop an improved technique by using gold nanoparticles (AuNPs) attached to a single-stranded DNA probe for the detection of HPV16 and HPV18. Detection of the LAMP product by AuNP color change was compared with detection by visual turbidity. The optimal conditions for this new LAMP-AuNP assay were an incubation time of 20min and a temperature of 65°C. After LAMP amplification was complete, its products were hybridized with the AuNP probe for 5min and then detected by the addition of magnesium salt. The color changed from red to blue as a result of aggregation of the AuNP probe under high ionic strength conditions produced by the addition of the salt. The sensitivity of the LAMP-AuNP assay was greater than the LAMP turbidity assay by up to 10-fold for both HPV genotypes. The LAMP-AuNP assay showed higher sensitivity and ease of visualization than did the LAMP turbidity for the detection of HPV16 and HPV18. Additionally, AuNP-HPV16 and AuNP-HPV18 probes were stable for over 1year. The combination of LAMP and the AuNP-probe colorimetric assay offers a simple, rapid and highly sensitive alternative diagnostic tool for the detection of HPV16 and HPV18 in district hospitals or field studies.

  5. Dark matter directional detection: comparison of the track direction determination

    NASA Astrophysics Data System (ADS)

    Couturier, C.; Zopounidis, J. P.; Sauzet, N.; Naraghi, F.; Santos, D.


    Several directional techniques have been proposed for a directional detection of Dark matter, among others anisotropic crystal detectors, nuclear emulsion plates, and low-pressure gaseous TPCs. The key point is to get access to the initial direction of the nucleus recoiling due to the elastic scattering by a WIMP. In this article, we aim at estimating, for each method, how the information of the recoil track initial direction is preserved in different detector materials. We use the SRIM simulation code to emulate the motion of the first recoiling nucleus in each material. We propose the use of a new observable, D, to quantify the preservation of the initial direction of the recoiling nucleus in the detector. We show that in an emulsion mix and an anisotropic crystal, the initial direction is lost very early, while in a typical TPC gas mix, the direction is well preserved.

  6. Colorimetric and fluorometric dual-modal probes for cyanide detection based on the doubly activated Michael acceptor and their bioimaging applications.


    Li, Hongda; Chen, Tie; Jin, Longyi; Kan, Yuhe; Yin, Bingzhu


    In this study, we synthesized CTB and CB probes based on doubly activated Michael acceptors to selectively detect cyanide (CN(-)) anions through a one-step condensation reaction of coumarinyl acrylaldehyde with the corresponding derivatives of malonyl urea (thiourea). Through the conjugated addition of CN(-) to the β-site of the Michael acceptor, both probes displayed colorimetric and fluorometric dual-modal responses that were highly reactive and selective. CTB generates an active fluorescent response, whereas CB displays a ratiometric fluorescent response. The fluorescent signal of the probes reached its maximum given only 1 CN(-) equivalent and the signal change was linearly proportional to CN(-) concentrations ranging from 0 to 5 μM with the detection limits 18 and 23 nM, respectively. The reaction rate of the probes is highly dependent on the methylene acidity of malonyl urea derivatives. Thus, the response rate of CTB to CN(-) is 1.2-fold faster than that of CB, and the response rate of CB to CN(-) is 1.2-fold faster than that of the previously examined CM. We then verified the highly reactive nature of the β-site of the probes through density functional reactivity theory calculations. In addition, according to proof-of-concept experiments, these probes may be applied to analyze CN(-) contaminated water and biomimetic samples. Finally, cell cytotoxicity and bioimaging studies revealed that the probes were cell-permeable and could be used to detect CN(-) with low cytotoxicity.

  7. Hierarchical NiCo2O4 Hollow Sphere as a Peroxidase Mimetic for Colorimetric Detection of H2O2 and Glucose

    PubMed Central

    Huang, Wei; Lin, Tianye; Cao, Yang; Lai, Xiaoyong; Peng, Juan; Tu, Jinchun


    In this work, the hierarchical NiCo2O4 hollow sphere synthesized via a “coordinating etching and precipitating” process was demonstrated to exhibit intrinsic peroxidase-like activity. The peroxidase-like activity of NiCo2O4, NiO, and Co3O4 hollow spheres were comparatively studied by the catalytic oxidation reaction of 3,3,5,5-tetramethylbenzidine (TMB) in presence of H2O2, and a superior peroxidase-like activity of NiCo2O4 was confirmed by stronger absorbance at 652 nm. Furthermore, the proposed sensing platform showed commendable response to H2O2 with a linear range from 10 μM to 400 μM, and a detection limit of 0.21 μM. Cooperated with GOx, the developed novel colorimetric and visual glucose-sensing platform exhibited high selectivity, favorable reproducibility, satisfactory applicability, wide linear range (from 0.1 mM to 4.5 mM), and a low detection limit of 5.31 μM. In addition, the concentration-dependent color change would offer a better and handier way for detection of H2O2 and glucose by naked eye. PMID:28124997

  8. Doped colorimetric assay liposomes


    Charych, Deborah; Stevens, Raymond C.


    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  9. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.


    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  10. Synthesis, characterization and application of poly(acrylamide-co-methylenbisacrylamide) nanocomposite as a colorimetric chemosensor for visual detection of trace levels of Hg and Pb ions.


    Sedghi, Roya; Heidari, Bahareh; Behbahani, Mohammad


    In this study, a new colorimetric chemosensor based on TiO2/poly(acrylamide-co-methylenbisacrylamide) nanocomposites was designed for determination of mercury and lead ions at trace levels in environmental samples. The removal and preconcentration of lead and mercury ions on the sorbent was achieved due to sharing an electron pair of N and O groups of polymer chains with the mentioned heavy metal ions. The hydrogel sensor was designed by surface modification of a synthesized TiO2 nanoparticles using methacryloxypropyltrimethoxysilan (MAPTMS), which provided a reactive C=C bond that polymerized the acrylamide and methylenbisacrylamide. The sorbent was characterized using X-ray diffraction (XRD), thermogravimetric analysis (TGA), scanning electron microscope (SEM), EDS analysis and Fourier transform in frared (FT-IR) spectrometer. This nanostructured composite with polymer shell was developed as a sensitive and selective sorbent for adsorption of mercury and lead ions from aqueous solution at optimized condition. This method involves two-steps: (1) preconcentration of mercury and lead ions by the synthesized sorbent and (2) its selective monitoring of the target ions by complexation with dithizone (DZ). The color of the sorbent in the absence and presence of mercury and lead ions shifts from white to violet and red, respectively. The detection limit of the synthesized nanochemosensor for mercury and lead ions was 1 and 10 μg L(-1), respectively. The method was successfully applied for trace detection of mercury and lead ions in tap, river, and sea water samples.

  11. A simple green route to prepare stable silver nanoparticles with pear juice and a new selective colorimetric method for detection of cysteine.


    Huang, Jing Tao; Yang, Xiao Xi; Zeng, Qiao Ling; Wang, Jian


    In this work, a new cost-effective, rapid and simple method for the preparation of stable silver nanoparticles (AgNPs) was developed, which can be completed within 15 minutes at room temperature by oxidizing the reductants in pear juice with AgNO3. Compared with the most used citrate-capped AgNPs, the as-prepared AgNPs showed high stability, good biocompatibility and enhanced antibacterial activity. Based on the formation of Ag-S covalent bonds between cysteine and AgNPs as well as the electrostatic interaction of COO(-) and NH4(+) between cysteine molecules, which selectively lead to the aggregation of the as-prepared AgNPs and give a specific yellow-to-red colour change, a new selective colorimetric method for detection of cysteine was proposed with the as-prepared AgNPs by coupling the decrease of the characteristic localized surface plasmon resonance (LSPR) absorption at 406 nm of the as-prepared AgNPs and the increase of the new aggregation-induced band at 530 nm. The ratio of the absorbance at 530 nm to 406 nm (A530/A406) was found to be linearly dependent on the cysteine concentrations in the range of 5.0 × 10(-7) to 1.0 × 10(-5) M with a limit of detection of 6.8 × 10(-8) M.

  12. Enzyme-free and label-free ultra-sensitive colorimetric detection of Pb(2+) using molecular beacon and DNAzyme based amplification strategy.


    Yun, Wen; Cai, Dingzhou; Jiang, JiaoLai; Zhao, Pengxiang; Huang, Yu; Sang, Ge


    An enzyme-free and label-free colorimetric Pb(2+) sensor based on DNAzyme and molecular beacon (MB) has been developed and demonstrated by recycle using enzyme strand for signal amplification. The substrate strand DNA (S-DNA) of DNAzyme could be converted into MB structure with base pairs of stem part at the both ends. The MB could hybridize with enzyme strand DNA (E-DNA) to form DNAzyme, and be activated and cleaved in the presence of Pb(2+). The cleaved MB is much less stable, releasing from the DNAzyme as two product pieces. The product pieces of MB are flexible and could bind to unmodified AuNPs to effectively stabilize them against salt-induced aggregation. Then, the E-DNA is liberated to catalyze the next reaction and amplify the response signal. By taking advantage of repeated using of E-DNA, our proposed method exhibited high sensitive for Pb(2+) detection in a linear range from 0.05 to 5 nM with detection limit of 20 pM by UV-vis spectrometer. Moreover, this method was also used for determination of Pb(2+) in river water samples with satisfying results. Importantly, this strategy could reach high sensitivity without any modification and complex enzymatic or hairpins based amplification procedures.

  13. Colorimetric Detection of Hg(2+) Based on the Growth of Aptamer-Coated AuNPs: The Effect of Prolonging Aptamer Strands.


    Tan, Lulu; Chen, Zhengbo; Zhang, Chi; Wei, Xiangcong; Lou, Tianhong; Zhao, Yan


    Herein, a versatile and sensitive colorimetric sensor for Hg(2+) based on aptamer-target specific binding and target-mediated growth of AuNPs is reported. The 15 T bases are first designed to detect Hg(2+) through T-Hg(2+) -T coordination. Aptamer-target binding results in the desorption of the aptamer from AuNP surface, the remaining aptamers adsorbed on AuNP surface trigger the growth of AuNPs with morphologically varied nanostructures, and then different colored solutions are formed. On this occasion, the limit of detection (LOD) of 9.6 × 10(-9) m is obtained. The other two aptamer strands (25- and 59-mer) are designed by increasing A bases on either side and both sides of 15 T, respectively. The interaction of the binding domain and Hg(2+) makes desorption of 15 T from AuNP surface, whereas excess bases not committed to the binding domain still adsorbed on AuNP surface. These excess bases control the growth of AuNPs, and enhance the sensitivity. The LODs are 4.05 and 3 × 10(-9) m for 25- and 59-mer aptamers, respectively. In addition, the 59-mer aptamer system is applied to identify Hg(2+) in real river samples, the LOD of 6.2 × 10(-9) m is obtained.

  14. Label-free colorimetric detection of biological thiols based on target-triggered inhibition of photoinduced formation of AuNPs

    NASA Astrophysics Data System (ADS)

    Lim Jung, Ye; Park, Jung Hun; Kim, Moon Il; Park, Hyun Gyu


    A label-free colorimetric method for the detection of biological thiols (biothiols) was developed. This method is based on prevention of the photoinduced reduction of auric ions (Au(III)) in the presence of amino acids (acting as a reducing agent) by biothiols; the photoinduced reduction is inhibited due to the strong interaction of the biothiols with Au(III). In this method, the sample was first incubated in an assay solution containing Au(III) and threonine; the sample solution was then exposed to 254 nm UV light. For samples without biothiols, this process led to the photoreduction of Au(III) followed by growth of gold nanoparticles accompanied by the visually detectable development of a red coloration typified by an absorption peak at ca 530 nm. Conversely, in the presence of biothiols, reduction of Au(III) to Au(0) was prevented by entrapment of Au(III) within the biothiols via the thiol group. The solution thus remained colorless even after UV irradiation, which was used as an indicator of the presence of biothiols. Using this strategy, biothiols were very conveniently analyzed by monitoring color changes of the samples with the naked eye or a UV-vis spectrometer. The strategy based on this interesting phenomenon exhibited high selectivity toward biothiols over common amino acids and was successfully employed for reliable quantification of biothiols present in human plasma, demonstrating its great potential for clinical applications.

  15. Hemin-graphene hybrid nanosheets with intrinsic peroxidase-like activity for label-free colorimetric detection of single-nucleotide polymorphism.


    Guo, Yujing; Deng, Liu; Li, Jing; Guo, Shaojun; Wang, Erkang; Dong, Shaojun


    This paper demonstrated for the first time a simple wet-chemical strategy for synthesizing hemin-graphene hybrid nanosheets (H-GNs) through the π-π interactions. Significantly, this new material possesses the advantages of both hemin and graphene and exhibits three interesting properties. First, H-GNs have intrinsic peroxidase-like activity, which can catalyze the reaction of peroxidase substrate, due to the existence of hemin on the graphene surface. Second, their dispersion follow the 2D Schulze-Hardy rule, that is to say, the coagulation of H-GNs in electrolyte solution results from the interplay between van der Waals attraction and electric double-layer repulsion. Third, H-GNs exhibit the ability to differentiate ss- and ds-DNA in optimum electrolyte concentration, owing to the different affinities of ss- and ds-DNA to the H-GNs. On the basis of these unique properties of the as-prepared H-GNs, we have developed a label-free colorimetric detection system for single-nucleotide polymorphisms (SNPs) in disease-associated DNA. To our knowledge, this is the first report concerning on SNPs detection using functionalized graphene nanosheets. Owing to its easy operation and high specificity, it was expected that the proposed procedure might hold great promise in the pathogenic diagnosis and genetic diseases.

  16. Paper-based magnetic nanoparticle-peptide probe for rapid and quantitative colorimetric detection of Escherichia coli O157:H7.


    Suaifan, Ghadeer A R Y; Alhogail, Sahar; Zourob, Mohammed


    There is a critical and urgent demand for a simple, rapid and specific qualitative and quantitative colorimetric biosensor for the detection of the food contaminant Escherichia coli O157:H7 (E. coli O157:H7) in complex food products due to the recent outbreaks of food-borne diseases. Traditional detection techniques are time-consuming, require expensive instrumentation and are labour-intensive. To overcome these limitations, a novel, ultra-rapid visual biosensor was developed based on the ability of E. coli O157:H7 proteases to change the optical response of a surface-modified, magnetic nanoparticle-specific (MNP-specific) peptide probe. Upon proteolysis, a gradual increase in the golden color of the sensor surface was visually observed. The intensification of color was correlated with the E. coli O157:H7 concentration. The color change resulting from the dissociation of the self-assembled monolayer (SAM) was detected by the naked eye and analysed using an image analysis software (ImageJ) for the purpose of quantitative detection. This biosensor demonstrated high sensitivity and applicability, with lower limits of detection of 12CFUmL(-1) in broth samples and 30-300CFUmL(-1) in spiked complex food matrices. In conclusion, this approach permits the use of a disposable biosensor chip that can be mass-produced at low cost and can be used not only by food manufacturers but also by regulatory agencies for better control of potential health risks associated with the consumption of contaminated foods.

  17. Enhancing sensitivity and selectivity in a label-free colorimetric sensor for detection of iron(II) ions with luminescent molybdenum disulfide nanosheet-based peroxidase mimetics.


    Wang, Yong; Hu, Jie; Zhuang, Qianfen; Ni, Yongnian


    In the present study, we demonstrated that the luminescent molybdenum disulfide (MoS2) nanosheets, which were prepared hydrothermally by using sodium molybdate and thiourea as precursors, possessed peroxidase-like activity, and could catalyze the oxidation of peroxidase substrate o-phenylenediamine (OPD) in the presence of hydrogen peroxide (H2O2) to produce a yellow color reaction. Further addition of Fe(2+) into the nanosheets led to peroxidase mimetics with greatly enhanced catalytic activity. The observation was exploited to develop a label-free colorimetric nanozyme sensor for detection of Fe(2+). The fabricated MoS2/OPD/H2O2 sensor showed a wide linear range of 0.01-0.8 µM with a detection limit of 7 nM. Moreover, it was found that the MoS2/OPD/H2O2 sensor displayed enhanced sensitivity and selectivity toward Fe(2+) compared with the OPD/H2O2 sensor, suggesting that the MoS2 nanosheets could improve the performance of the Fe(2+) sensor. An advanced chemometrics algorithm, multivariate curve resolution by alternating least squares (MCR-ALS), was further applied to interpret the origin of enhancing sensitivity and selectivity in the Fe(2+) sensor with the MoS2 nanosheets. The time-dependent UV-vis spectral data of the studied systems were collected, and submitted to the MCR-ALS. The results showed that the increased sensitivity and selectivity of the MoS2/OPD/H2O2 sensor for Fe(2+) detection likely arose from its large reaction rate constant. Finally, the proposed MoS2/OPD/H2O2 sensor was successfully applied for detection of Fe(2+) in water samples.

  18. Biomarker detection technologies and future directions.


    Nimse, Satish Balasaheb; Sonawane, Mukesh Digambar; Song, Keum-Soo; Kim, Taisun


    Biomarkers play a vital role in disease detection and treatment follow-up. It is important to note that diseases in the early stage are typically treated with the greatest probability of success. However, due to various technical difficulties in current technologies for the detection of biomarkers, the potential of biomarkers is not explored completely. Therefore, the developments of technologies, which can enable the accurate detection of prostate cancer at an early stage with simple, experimental protocols are highly inevitable. This critical review evaluates the current methods and technologies used in the detection of biomarkers. The aim of this article is to provide a comprehensive review covering the advantages and disadvantages of the biomarker detection methods. Future directions for the development of technologies to achieve highly selective and sensitive detection of biomarkers for point-of-care applications are also commented on.

  19. Disentangling Dark Matter Dynamics with Directional Detection

    SciTech Connect

    Lisanti, Mariangela; Wacker, Jay G.; /SLAC


    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a non-minimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  20. Directional structures detection using steerable pyramid

    NASA Astrophysics Data System (ADS)

    Denis, Florence; Baskurt, Atilla M.


    The object of the work described in this paper concerns directional structures detection for particular aspects of inspection, such as scratches and marbling defect detection in leather images. Because of the very specific geometry of these structures, we intend to apply a multiscale and orientation-shiftable method. Scratches and marbling have various shapes and sizes. Multiscale approaches using oriented filters have proved to be efficient to detect such curvilinear patterns. We first use the information given by the increase of gray levels in the image to locate suspicious regions. The detection is then based on steerable filters, which can be steered to any orientation fixed by the user, and are synthesized using a limited number of basic filters. These filters are used in a recursive multi-scale transform: the steerable pyramid. Then, the curvilinear structures are extracted from the directional images at different scales.

  1. Disulfide-induced self-assembled targets: A novel strategy for the label free colorimetric detection of DNAs/RNAs via unmodified gold nanoparticles.


    Shokri, Ehsan; Hosseini, Morteza; Davari, Mehdi D; Ganjali, Mohammad R; Peppelenbosch, Maikel P; Rezaee, Farhad


    A modified non-cross-linking gold-nanoparticles (Au-NPs) aggregation strategy has been developed for the label free colorimetric detection of DNAs/RNAs based on self-assembling target species in the presence of thiolated probes. Two complementary thiol- modified probes, each of which specifically binds at one half of the target introduced SH groups at both ends of dsDNA. Continuous disulfide bond formation at 3' and 5' terminals of targets leads to the self-assembly of dsDNAs into the sulfur- rich and flexible products with different lengths. These products have a high affinity for the surface of Au-NPs and efficiently protect the surface from salt induced aggregation. To evaluate the assay efficacy, a small part of the citrus tristeza virus (CTV) genome was targeted, leading to a detection limit of about 5 × 10(-9) mol.L(-1) over a linear ranged from 20 × 10(-9) to 10 × 10(-7) mol.L(-1). This approach also exhibits good reproducibility and recovery levels in the presence of plant total RNA or human plasma total circulating RNA extracts. Self-assembled targets can be then sensitively distinguished from non-assembled or mismatched targets after gel electrophoresis. The disulfide reaction method and integrating self-assembled DNAs/RNAs targets with bare AuNPs as a sensitive indicator provide us a powerful and simple visual detection tool for a wide range of applications.

  2. Disulfide-induced self-assembled targets: A novel strategy for the label free colorimetric detection of DNAs/RNAs via unmodified gold nanoparticles

    PubMed Central

    Shokri, Ehsan; Hosseini, Morteza; Davari, Mehdi D.; Ganjali, Mohammad R.; Peppelenbosch, Maikel P.; Rezaee, Farhad


    A modified non-cross-linking gold-nanoparticles (Au-NPs) aggregation strategy has been developed for the label free colorimetric detection of DNAs/RNAs based on self-assembling target species in the presence of thiolated probes. Two complementary thiol- modified probes, each of which specifically binds at one half of the target introduced SH groups at both ends of dsDNA. Continuous disulfide bond formation at 3′ and 5′ terminals of targets leads to the self-assembly of dsDNAs into the sulfur- rich and flexible products with different lengths. These products have a high affinity for the surface of Au-NPs and efficiently protect the surface from salt induced aggregation. To evaluate the assay efficacy, a small part of the citrus tristeza virus (CTV) genome was targeted, leading to a detection limit of about 5 × 10−9 mol.L−1 over a linear ranged from 20 × 10−9 to 10 × 10−7 mol.L−1. This approach also exhibits good reproducibility and recovery levels in the presence of plant total RNA or human plasma total circulating RNA extracts. Self-assembled targets can be then sensitively distinguished from non-assembled or mismatched targets after gel electrophoresis. The disulfide reaction method and integrating self-assembled DNAs/RNAs targets with bare AuNPs as a sensitive indicator provide us a powerful and simple visual detection tool for a wide range of applications. PMID:28387331

  3. Microgels for multiplex and direct fluorescence detection

    NASA Astrophysics Data System (ADS)

    Causa, Filippo; Aliberti, Anna; Cusano, Angela M.; Battista, Edmondo; Netti, Paolo A.


    Blood borne oligonucleotides fragments contain useful clinical information whose detection and monitoring represent the new frontier in liquid biopsy as they can transform the current diagnosis procedure. For instance, recent studies have identified a new class of circulating biomarkers such as s miRNAs, and demonstrated that changes in their concentration are closely associated with the development of cancer and other pathologies. However, direct detection of miRNAs in body fluids is particularly challenging and demands high sensitivity -concentration range between atto to femtomolarspecificity, and multiplexing Here we report on engineered multifunctional microgels and innovative probe design for a direct and multiplex detection of relevant clinical miRNAs in fluorescence by single particle assay. Polyethyleneglycol-based microgels have a coreshell architecture with two spectrally encoded fluorescent dyes for multiplex analyses and are endowed with fluorescent probes for miRNA detection. Encoding and detection fluorescence signals are distinguishable by not overlapping emission spectra. Tuneable fluorescence probe conjugation and corresponding emission confinement on single microgel allows for enhanced target detection. Such suspension array has indeed high selectivity and sensitivity with a detection limit of 10-15 M and a dynamic range from 10-9 to 10-15 M. We believe that sensitivity in the fM concentration range, signal background minimization, multiplexed capability and direct measurement of such microgels will translate into diagnostic benefits opening up new roots toward liquid biopsy in the context of point-of-care testing through an easy and fast detection of sensitive diagnostic biomarkers directly in serum.

  4. A Colorimetric Bioassay for Perchlorate

    NASA Astrophysics Data System (ADS)

    Heinnickel, M. L.; Smith, S.; Coates, J. D.


    Recognition of perchlorate (ClO4-) as a widespread contaminant across the United States and its potential adverse affects towards human health has motivated the EPA to place ClO4- on its contaminant candidate list for drinking water supplies. While a federal MCL has not yet been set, a recommended public health goal of 1 ppb (μg.L-1) was established by the US EPA in 2002. To date, methods of detection require use of sensitive ion chromatographic equipment that are expensive, time consuming, and require highly trained personnel for use. Our studies are focused on the development of a highly sensitive, simple, and robust colorimetric bioassay based on the primary enzyme involved in microbial ClO4- reduction, the perchlorate reductase (Pcr). A previously published assay used reduced methyl viologen (MV, the dye is reduced with sodium hydrosulfite) as an electron donor to demonstrate Pcr activity. The assay directly correlates the amount of MV oxidized with the amount of ClO4- reduced by assuming a transfer of four electrons. To test this assumption, we compared actual concentrations of MV oxidized to ClO4- reduced in this assay. ClO4- concentrations were determined using a Dionex ICS-500 ion chromatography system, while MV concentrations were determined using a standard curve generated at 578 nm. Comparisons between the two revealed that twelve molecules of MV were oxidized for each molecule of ClO4- reduced. The oxidation of these additional eight MV molecules is explained by the interaction of the dye with chlorite (the product of the Pcr reaction) and other contaminants that could be present in the enzyme prep. This unsettling result indicated this assay would be problematic for the detection of ClO4- in soil, which has many chemicals that could react with MV. To improve upon this assay, we have tried to reduce ClO4- using less reactive dyes and reductants. The reductants ascorbic acid, NADH, and dithiothreitol drive Pcr catalyzed ClO4- reduction, however, they

  5. Integrating Deoxyribozymes into Colorimetric Sensing Platforms

    PubMed Central

    Chang, Dingran; Zakaria, Sandy; Deng, Mimi; Allen, Nicholas; Tram, Kha; Li, Yingfu


    Biosensors are analytical devices that have found a variety of applications in medical diagnostics, food quality control, environmental monitoring and biodefense. In recent years, functional nucleic acids, such as aptamers and nucleic acid enzymes, have shown great potential in biosensor development due to their excellent ability in target recognition and catalysis. Deoxyribozymes (or DNAzymes) are single-stranded DNA molecules with catalytic activity and can be isolated to recognize a wide range of analytes through the process of in vitro selection. By using various signal transduction mechanisms, DNAzymes can be engineered into fluorescent, colorimetric, electrochemical and chemiluminescent biosensors. Among them, colorimetric sensors represent an attractive option as the signal can be easily detected by the naked eye. This reduces reliance on complex and expensive equipment. In this review, we will discuss the recent progress in the development of colorimetric biosensors that make use of DNAzymes and the prospect of employing these sensors in a range of chemical and biological applications. PMID:27918487

  6. A colorimetric sensor for determination of cysteine by carboxymethyl cellulose-functionalized gold nanoparticles.


    Wei, Xiaoyi; Qi, Li; Tan, Junjun; Liu, Ruigang; Wang, Fuyi


    A simple and sensitive colorimetric method for cysteine detection was established based on the carboxymethyl cellulose-functionalized gold nanoparticles (CMC-AuNPs). The nanoparticles were directly synthesized with sodium carboxymethyl cellulose by a simple approach, which would protect particles against salt-induced aggregation. Then the CMC-AuNPs solution exhibited a high colorimetric selectivity to cysteine. The assay results indicated that the introduction of cysteine could induce the aggregation of the colloidal solutions at the presence of sodium chloride, displaying changes in color and in UV-vis absorption spectra. Thus an exceptionally simple, rapid method for detecting cysteine was obtained at the linear range of 10.0-100.0 microM with the relative coefficient of 0.997. The proposed method possessed the advantages of simplicity and sensitivity, and was applied to real urine sample detection. The results were satisfying and the proposed method was especially appropriate for detection of cysteine in biological samples.

  7. Hydrophilic-Hydrophobic Patterned Molecularly Imprinted Photonic Crystal Sensors for High-Sensitive Colorimetric Detection of Tetracycline.


    Hou, Jue; Zhang, Huacheng; Yang, Qiang; Li, Mingzhu; Jiang, Lei; Song, Yanlin


    A hydrophilic-hydrophobic patterned molecularly imprinted (MIP) photonic crystal (PC) sensor is fabricated for highly sensitive tetracycline detection. The relationship between the tetracycline concentration, its corresponding color of the sensor, and the diameter of MIP-PC dot is found using a fan-shaped color card. This work provides a new strategy to design the sensors with tunable detection ranges for practical applications.

  8. A FRET-based ratiometric fluorescent and colorimetric probe for the facile detection of organophosphonate nerve agent mimic DCP.


    Xuan, Weimin; Cao, Yanting; Zhou, Jiahong; Wang, Wei


    A FRET ratiometric fluorescent probe enabling a fast and highly sensitive response to OP nerve agent mimic DCP within 1 min and with as low as 0.17 ppm concentration detection limit has been developed. Moreover, the probe exhibits noticeable color changes under UV light and even with the naked eye. It is also demonstrated that it can detect both liquid and gas nerve agents.

  9. Development of a new colorimetric assay for detection of bisphenol-A in aqueous media using green synthesized silver chloride nanoparticles: experimental and theoretical study.


    Khalililaghab, Shiva; Momeni, Safieh; Farrokhnia, Maryam; Nabipour, Iraj; Karimi, Sadegh


    In the present study, a cost-effective, green and simple synthesis method was applied for preparation of stable silver chloride nanoparticles (AgCl-NPs). The method was done by forming AgCl-NPs from Ag(+) ions using aqueous extract of brown algae (Sargassum boveanum) obtained from the Persian Gulf Sea. This extract served as capping agent during the formation of AgCl-NPs. Creation of AgCl-NPs was confirmed by UV-visible spectroscopy, powder X-ray diffraction, energy-dispersive X-ray spectroscopy, and high-resolution transmission electron microscopy, while the morphology and size analyses were characterized using high-resolution transmission electron microscopy and dynamic light scattering. After optimization of some experimental conditions, particularly pH, a simple and facile system was developed for the naked-eye detection of bisphenol-A. Moreover, a theoretical study of AgCl interaction with bisphenol-A was performed at the density functional level of theory in both gas and solvent phases. Theoretical results showed that electrostatic and van der Waal interactions play important roles in complexation of bisphenol-A with AgCl-NPs, which can lead to aggregation of the as-prepared AgCl-NPs and results in color change from specific yellow to dark purple, where a new aggregation band induced at 542 nm appears. The absorbance at 542 nm was found to be linearly dependent on the bisphenol-A concentration in the range of 1 × 10(-6)-1 × 10(-4) M, with limit of detection of 45 nM. In conclusion, obtained results from the present study can open up an innovative application of the green synthesis of AgCl-NPs using brown algae extract as colorimetric sensors.

  10. Dark matter direct-detection experiments

    NASA Astrophysics Data System (ADS)

    Marrodán Undagoitia, Teresa; Rauch, Ludwig


    In recent decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focusing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  11. Detection of directed information flow in biosignals.


    Winterhalder, Matthias; Schelter, Björn; Hesse, Wolfram; Schwab, Karin; Leistritz, Lutz; Timmer, Jens; Witte, Herbert


    Several analysis techniques have been developed for time series to detect interactions in multidimensional dynamic systems. When analyzing biosignals generated by unknown dynamic systems, awareness of the different concepts upon which these analysis techniques are based, as well as the particular aspects the methods focus on, is a basic requirement for drawing reliable conclusions. For this purpose, we compare four different techniques for linear time series analysis. In general, these techniques detect the presence of interactions, as well as the directions of information flow, in a multidimensional system. We review the different conceptual properties of partial coherence, a Granger causality index, directed transfer function, and partial directed coherence. The performance of these tools is demonstrated by application to linear dynamic systems.

  12. A new fluorescent probe for colorimetric and ratiometric detection of sulfur dioxide derivatives in liver cancer cells

    PubMed Central

    Li, Dong-Peng; Wang, Zhao-Yang; Cui, Jie; Wang, Xin; Miao, Jun-Ying; Zhao, Bao-Xiang


    A new ratiometric fluorescent probe was constructed with hemicyanine and 7-nitrobenzofurazan for detection of sulfur dioxide derivatives (HSO3−/SO32−). The ratiometric response mode could be attributed to the efficient FRET (Förster resonance energy transfer) platform. The probe exbihited some desirable properties including fast response (within 2 minutes), good selectivity and high sensitivity. Moreover, the probe could detect endogenous HSO3− in liver cancer cells rather than normal liver cells, implying the diagnosal potential of the probe. PMID:28349998

  13. An unusual red-to-brown colorimetric sensing method for ultrasensitive silver(I) ion detection based on a non-aggregation of hyperbranched polyethylenimine derivative stabilized gold nanoparticles.


    Liu, Yi; Liu, Yang; Li, Zhongfa; Liu, Junshen; Xu, Li; Liu, Xunyong


    Here we have developed a facile and rapid colorimetric method for the sensitive and selective detection of Ag(+) based on the non-aggregation of gold nanoparticles (Au NPs) capped with hyperbranched polyethylenimine derivatives. In the detection process, an unusual colour change from red to brown was observed due to the formation of Au-Ag core-shell nanoparticles, which was more sensitive than that of the usual colorimetric assays (red to blue) based on the aggregation of Au NPs. After the colour changed, the non-aggregation-based Au-Ag core-shell nanomaterials did not aggregate further and could remain stable for a long time, which was convenient to record, detect and observe. The sensing probe exhibited a drastically long observing time for detecting Ag(+) owing to the stability of the Au-Ag core-shell non-aggregates, high sensitivity with a low detection limit of 8.76 nM by the naked eye and 1.09 nM by using a UV-vis spectrophotometer and a good linear relationship within the range from 1.09 to 109 nM. The colour change of the system is very fast, occurring within 1 to 2 minutes. Moreover, the proposed method also showed a remarkably high selectivity toward Ag(+) and was successfully used in tap water and drinking water samples. Therefore, this unusual colorimetric assay based on the non-aggregation of Au NPs has a great potential as a simple, rapid, sensitive and selective detection method for the detection of Ag(+).

  14. Pd/V.sub.2O.sub.5 device for colorimetric H.sub.2 detection


    Liu, Ping; Tracy, C. Edwin; Pitts, J. Roland; Smith, II, R. Davis; Lee, Se-Hee


    A sensor structure for chemochromic optical detection of hydrogen gas over a wide response range, that exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas, comprising: a glass substrate (20); a vanadium oxide layer (21) coated on the glass substrate; and a palladium layer (22) coated on the vanadium oxide layer.

  15. Microfluidic paper-based analytical devices for colorimetric detection of urinary tract infection biomarkers on adult diapers.


    Chaohao Chen; Tao Dong


    Urinary tract infections (UTI) are common infection diseases in elderly patients. The conventional method of detecting UTI involves the collection of significant urine samples from the elderly patients. However, this is a very difficult and time-consuming procedure. This paper addresses the development of a microfluidic paper-based analytical device (μPAD) to detect UTI from urine collected from adult diapers. The design and fabrication for the μPAD is shown. The fabrication process involves melting solid wax on top of filter paper using a hot plate, followed by pattern transfer using a mold with rubbed wax. To demonstrate the feasibility of the proposed method, the μPAD with deposited nitrite reagent had detected different concentrations of nitrite solutions from 0.5 ppm to 100 ppm spiked in urine samples. A calibration curve was obtained by plotting the gray scale intensity values against the various nitrite concentrations. The results showed that the proposed paper-based device holds great potential as low-cost, disposable solution to sensitively detect UTI markers in urine sampled from diapers.

  16. Detection of possible economically motivated adulterants in heparin sodium and low molecular weight heparins with a colorimetric microplate based assay.


    Sommers, Cynthia D; Keire, David A


    Recently, we described a 96-well plate format assay for visual detection of oversulfated chondroitin sulfate A (OSCS) contamination in heparin samples based on a water-soluble cationic polythiophene polymer (3-(2-(N-(N'-methylimidazole))ethoxy)-4-methylthiophene (LPTP)) and heparinase digestion of heparin. Here, we establish the specificity of the LPTP/heparinase test with a unique set of reagents that define the structural requirements for significant LPTP chemosensor color change. For example, we observed a biphasic behavior of larger shifts to the red in the UV absorbance spectra with decreasing average molecular weight of heparin chains with a break below 12-mer chain lengths. In addition, the oversulfation of chondroitin sulfate A (CSA) to a partially (PSCS) or fully (OSCS) sulfated form caused progressively less red shift of LPTP solutions. Furthermore, glycosaminoglycans (GAGs) containing glucuronic acid caused distinct spectral patterns compared to iduronic acid containing GAGs. We applied the LPTP/heparinase test to detection of OSCS (≥0.03% (w/w) visually or 0.01% using a plate reader) in 10 μg amounts of low molecular weight heparins (LMWHs; i.e. dalteparin, tinzaparin, or enoxaparin). Furthermore, because other oversulfated GAGs are possible economically motivated adulterants (EMAs) in heparin sodium, we tested the capacity of the LPTP/heparinase assay to detect oversulfated dermatan sulfate (OSDS), heparin (OSH), and heparan sulfate (OSHS). These potential EMAs were visually detectable at a level of ∼0.1% when spiked into heparin sodium. We conclude that the LPTP/heparinase test visually detects oversulfated GAGs in heparin sodium and LMWHs in a format potentially amenable to high-throughput screening.

  17. Direct Cavity Detection of Majorana Pairs

    NASA Astrophysics Data System (ADS)

    Dartiailh, Matthieu C.; Kontos, Takis; Douçot, Benoit; Cottet, Audrey


    No experiment could directly test the particle-antiparticle duality of Majorana fermions, so far. However, this property represents a necessary ingredient towards the realization of topological quantum computing schemes. Here, we show how to complete this task by using microwave techniques. The direct coupling between a pair of overlapping Majorana bound states and the electric field from a microwave cavity is extremely difficult to detect due to the self-adjoint character of Majorana fermions which forbids direct energy exchanges with the cavity. We show theoretically how this problem can be circumvented by using photoassisted tunneling to fermionic reservoirs. The absence of a direct microwave transition inside the Majorana pair in spite of the light-Majorana coupling would represent a smoking gun for the Majorana self-adjoint character.

  18. Wind measurement via direct detection lidar

    NASA Astrophysics Data System (ADS)

    Afek, I.; Sela, N.; Narkiss, N.; Shamai, G.; Tsadka, S.


    Wind sensing Lidar is considered a promising technology for high quality wind measurements required for various applications such as hub height wind resource assessment, power curve measurements and advanced, real time, forward looking turbine control. Until recently, the only available Lidar technology was based on coherent Doppler shift detection, whose market acceptance has been slow primarily due to its exuberant price. Direct detection Lidar technology provides an alternative to remote sensing of wind by incorporating high precision measurement, a robust design and an affordable price tag.

  19. Novel antibody/gold nanoparticle/magnetic nanoparticle nanocomposites for immunomagnetic separation and rapid colorimetric detection of Staphylococcus aureus in milk.


    Sung, Yun Ju; Suk, Ho-Jun; Sung, Hwa Young; Li, Taihua; Poo, Haryoung; Kim, Min-Gon


    We demonstrated the new antibody/gold nanoparticle/magnetic nanoparticle nanocomposites (antibody/AuNP/MNPs) and their application in the detection of the foodborne pathogen, Staphylococcus aureus (S. aureus), in milk. The nanocomposites were synthesized by coating the MNPs with bovine serum albumin (BSA) then adsorbing the AuNPs and anti-S. aureus antibodies on their surface. Using the completed immunomagnetic nanostructures, S. aureus inoculated in the milk sample was captured and isolated from the medium using the permanent magnet. The nanoparticle-bound cells as well as the unbound cells in the supernatant were enumerated via surface plating to evaluate the target binding capacity of the nanocomposites. The capture efficiencies of the antibody/AuNP/MNPs were 96% and 78% for S. aureus in PBS and the milk sample respectively, which were significantly higher than those of the antibody-coupled MNPs without any AuNP. The captured cells were also applied to the selective filtration system to produce color signals that were used for the detection of the target pathogen. During the filtration, the cells bound to the antibody/AuNP/MNPs remained on the surface of the membrane filter while unbound nanoparticles passed through the uniform pores of the membrane. After the gold enhancement, the cells-particles complex resting on the membrane surface rendered a visible color, and the signal intensity became higher as the target cell concentration increased. The detection limits of this colorimetric sensor were 1.5×10(3) and 1.5×10(5)CFU for S. aureus in PBS and the milk sample respectively. This sensing mechanism also had the high specificity for S. aureus over the other pathogens such as Escherichia coli, Listeria monocytogenes, and Salmonella enterica. The assay required only 40min to obtain the results. With the use of the appropriate antibodies, our immunomagnetic nanocomposites-based detection strategy can provide an easy, convenient, and rapid sensing method for a

  20. Chitosan-capped silver nanoparticles as a highly selective colorimetric probe for visual detection of aromatic ortho-trihydroxy phenols.


    Chen, Zhaohui; Zhang, Xiaodan; Cao, Haiyan; Huang, Yuming


    We reported a new application of silver nanoparticles (NPs) for the visual sensing of aromatic polyphenols, such as gallic acid, pyrogallol and tannic acid, which is based on the intensified plasmon absorbance signals and visual changes from yellow to orange due to hydrogen-bonding recognition and subsequent catalytic oxidation of the target phenols by chitosan-capped Ag NPs (Ch-Ag NPs). The Ch-Ag NPs are generated by the well-known reaction of AgNO3 with NaBH4 and stabilized with chitosan which is a polysaccharide biopolymer with excellent dispersive properties and stability in aqueous media. After optimizing some experimental conditions, a very simple and facile sensing system has been developed for the detection of gallic acid, pyrogallol and tannic acid in water samples. The proposed system promises high selectivity toward gallic acid, pyrogallol and tannic acid, and other phenolic compounds including p-aminobenzoic acid, pentachlorophenol, 2,4,6-trinitrophenol, 2,4-dinitrophenol, p-nitrophenol, 1-naphthol, β-naphthol, p-aminophenol, catechol, hydroquinone, m-dihydroxybenzene, phloroglucin and phenol could not induce a color change even at 0.1 mM. The outstanding selectivity property of the proposed method for gallic acid, pyrogallol and tannic acid resulted from the Ch-Ag NPs-mediated reduction of Ag(+) by the target phenols. Also, a wide linear response range was obtained for the three targets. The linear response ranges for gallic acid, pyrogallol, and tannic acid were from 1 × 10(-5) to 1 × 10(-3) M, 1 × 10(-5) to 1 × 10(-2) M and 1 × 10(-6) to 1 × 10(-4) M with a respective detection limit (DL) of 1 × 10(-5), 1 × 10(-5), and 1 × 10(-6) M. The proposed method was successfully applied to detect target phenols in environmental water samples. Furthermore, because the color change from yellow to orange is observable by the naked eye, it is easy to realize visual detection of the target phenols without any instrumentation or complicated design. The

  1. On the direct detection of gravitational waves

    NASA Astrophysics Data System (ADS)

    Pustovoit, V. I.


    Different types of gravitational wave (GW) detectors are considered. It is noted that interferometric techniques offer the greatest prospects for GW registration due to their high sensitivity and extremely wide frequency band. Using laser interferometers, proposed as far back as 1962 in the work by M E Gertsenshtein and V I Pustovoit published in Russian (Zh. Eksp. Teor. Fiz., vol. 43, p. 605, 1962) and in English translation (Sov. Phys. JETP, vol. 16, p. 433, 1963), it proved possible for the first time to directly detect GW emission from a merger of two black holes. It is noted that the assertion that Gertsen-shtein-Pustovoit's work was unknown to some of those experts involved in direct GW detection is inconsistent with reality. The problems of high-power laser radiation affecting the electrostatic polarization of free-mass mirrors are discussed. It is shown that mirror polarization can lead to additional links with electrically conducting elements of the design resulting in the interferometer's reduced sensitivity. Some new prospects for developing high reflection structures are discussed and heat extraction problems are considered. This article is the revised and extended version of the report “On the first direct detection of gravitational waves” delivered by V I Pustovoit at the Scientific Session of the Physical Sciences Division of the Russian Academy of Sciences (March 2, 2016). All other reports presented at the session were published in the preceding issue of Physics-Uspekhi (September 2016) (see Refs [108, 111-113]). (Editorial note)

  2. Community detection in directed acyclic graphs

    NASA Astrophysics Data System (ADS)

    Speidel, Leo; Takaguchi, Taro; Masuda, Naoki


    Some temporal networks, most notably citation networks, are naturally represented as directed acyclic graphs (DAGs). To detect communities in DAGs, we propose a modularity for DAGs by defining an appropriate null model (i.e., randomized network) respecting the order of nodes. We implement a spectral method to approximately maximize the proposed modularity measure and test the method on citation networks and other DAGs. We find that the attained values of the modularity for DAGs are similar for partitions that we obtain by maximizing the proposed modularity (designed for DAGs), the modularity for undirected networks and that for general directed networks. In other words, if we neglect the order imposed on nodes (and the direction of links) in a given DAG and maximize the conventional modularity measure, the obtained partition is close to the optimal one in the sense of the modularity for DAGs. Contribution to the Topical Issue "Temporal Network Theory and Applications", edited by Petter Holme.

  3. Aberration features in directional dark matter detection

    SciTech Connect

    Bozorgnia, Nassim; Gelmini, Graciela B.; Gondolo, Paolo E-mail:


    The motion of the Earth around the Sun causes an annual change in the magnitude and direction of the arrival velocity of dark matter particles on Earth, in a way analogous to aberration of stellar light. In directional detectors, aberration of weakly interacting massive particles (WIMPs) modulates the pattern of nuclear recoil directions in a way that depends on the orbital velocity of the Earth and the local galactic distribution of WIMP velocities. Knowing the former, WIMP aberration can give information on the latter, besides being a curious way of confirming the revolution of the Earth and the extraterrestrial provenance of WIMPs. While observing the full aberration pattern requires extremely large exposures, we claim that the annual variation of the mean recoil direction or of the event counts over specific solid angles may be detectable with moderately large exposures. For example, integrated counts over Galactic hemispheres separated by planes perpendicular to Earth's orbit would modulate annually, resulting in Galactic Hemisphere Annual Modulations (GHAM) with amplitudes larger than the usual non-directional annual modulation.

  4. Multicenter study of epidemiological cutoff values and detection of resistance in Candida spp. to anidulafungin, caspofungin, and micafungin using the Sensititre YeastOne colorimetric method.


    Espinel-Ingroff, A; Alvarez-Fernandez, M; Cantón, E; Carver, P L; Chen, S C-A; Eschenauer, G; Getsinger, D L; Gonzalez, G M; Govender, N P; Grancini, A; Hanson, K E; Kidd, S E; Klinker, K; Kubin, C J; Kus, J V; Lockhart, S R; Meletiadis, J; Morris, A J; Pelaez, T; Quindós, G; Rodriguez-Iglesias, M; Sánchez-Reus, F; Shoham, S; Wengenack, N L; Borrell Solé, N; Echeverria, J; Esperalba, J; Gómez-G de la Pedrosa, E; García García, I; Linares, M J; Marco, F; Merino, P; Pemán, J; Pérez Del Molino, L; Roselló Mayans, E; Rubio Calvo, C; Ruiz Pérez de Pipaon, M; Yagüe, G; Garcia-Effron, G; Guinea, J; Perlin, D S; Sanguinetti, M; Shields, R; Turnidge, J


    Neither breakpoints (BPs) nor epidemiological cutoff values (ECVs) have been established for Candida spp. with anidulafungin, caspofungin, and micafungin when using the Sensititre YeastOne (SYO) broth dilution colorimetric method. In addition, reference caspofungin MICs have so far proven to be unreliable. Candida species wild-type (WT) MIC distributions (for microorganisms in a species/drug combination with no detectable phenotypic resistance) were established for 6,007 Candida albicans, 186 C. dubliniensis, 3,188 C. glabrata complex, 119 C. guilliermondii, 493 C. krusei, 205 C. lusitaniae, 3,136 C. parapsilosis complex, and 1,016 C. tropicalis isolates. SYO MIC data gathered from 38 laboratories in Australia, Canada, Europe, Mexico, New Zealand, South Africa, and the United States were pooled to statistically define SYO ECVs. ECVs for anidulafungin, caspofungin, and micafungin encompassing ≥97.5% of the statistically modeled population were, respectively, 0.12, 0.25, and 0.06 μg/ml for C. albicans, 0.12, 0.25, and 0.03 μg/ml for C. glabrata complex, 4, 2, and 4 μg/ml for C. parapsilosis complex, 0.5, 0.25, and 0.06 μg/ml for C. tropicalis, 0.25, 1, and 0.25 μg/ml for C. krusei, 0.25, 1, and 0.12 μg/ml for C. lusitaniae, 4, 2, and 2 μg/ml for C. guilliermondii, and 0.25, 0.25, and 0.12 μg/ml for C. dubliniensis. Species-specific SYO ECVs for anidulafungin, caspofungin, and micafungin correctly classified 72 (88.9%), 74 (91.4%), 76 (93.8%), respectively, of 81 Candida isolates with identified fks mutations. SYO ECVs may aid in detecting non-WT isolates with reduced susceptibility to anidulafungin, micafungin, and especially caspofungin, since testing the susceptibilities of Candida spp. to caspofungin by reference methodologies is not recommended.

  5. Multicenter Study of Epidemiological Cutoff Values and Detection of Resistance in Candida spp. to Anidulafungin, Caspofungin, and Micafungin Using the Sensititre YeastOne Colorimetric Method

    PubMed Central

    Alvarez-Fernandez, M.; Cantón, E.; Carver, P. L.; Chen, S. C.-A.; Eschenauer, G.; Getsinger, D. L.; Gonzalez, G. M.; Grancini, A.; Hanson, K. E.; Kidd, S. E.; Klinker, K.; Kubin, C. J.; Kus, J. V.; Lockhart, S. R.; Meletiadis, J.; Morris, A. J.; Pelaez, T.; Rodriguez-Iglesias, M.; Sánchez-Reus, F.; Shoham, S.; Wengenack, N. L.; Borrell Solé, N.; Echeverria, J.; Esperalba, J.; Gómez-G. de la Pedrosa, E.; García García, I.; Linares, M. J.; Marco, F.; Merino, P.; Pemán, J.; Pérez del Molino, L.; Roselló Mayans, E.; Rubio Calvo, C.; Ruiz Pérez de Pipaon, M.; Yagüe, G.; Garcia-Effron, G.; Perlin, D. S.; Sanguinetti, M.; Shields, R.; Turnidge, J.


    Neither breakpoints (BPs) nor epidemiological cutoff values (ECVs) have been established for Candida spp. with anidulafungin, caspofungin, and micafungin when using the Sensititre YeastOne (SYO) broth dilution colorimetric method. In addition, reference caspofungin MICs have so far proven to be unreliable. Candida species wild-type (WT) MIC distributions (for microorganisms in a species/drug combination with no detectable phenotypic resistance) were established for 6,007 Candida albicans, 186 C. dubliniensis, 3,188 C. glabrata complex, 119 C. guilliermondii, 493 C. krusei, 205 C. lusitaniae, 3,136 C. parapsilosis complex, and 1,016 C. tropicalis isolates. SYO MIC data gathered from 38 laboratories in Australia, Canada, Europe, Mexico, New Zealand, South Africa, and the United States were pooled to statistically define SYO ECVs. ECVs for anidulafungin, caspofungin, and micafungin encompassing ≥97.5% of the statistically modeled population were, respectively, 0.12, 0.25, and 0.06 μg/ml for C. albicans, 0.12, 0.25, and 0.03 μg/ml for C. glabrata complex, 4, 2, and 4 μg/ml for C. parapsilosis complex, 0.5, 0.25, and 0.06 μg/ml for C. tropicalis, 0.25, 1, and 0.25 μg/ml for C. krusei, 0.25, 1, and 0.12 μg/ml for C. lusitaniae, 4, 2, and 2 μg/ml for C. guilliermondii, and 0.25, 0.25, and 0.12 μg/ml for C. dubliniensis. Species-specific SYO ECVs for anidulafungin, caspofungin, and micafungin correctly classified 72 (88.9%), 74 (91.4%), 76 (93.8%), respectively, of 81 Candida isolates with identified fks mutations. SYO ECVs may aid in detecting non-WT isolates with reduced susceptibility to anidulafungin, micafungin, and especially caspofungin, since testing the susceptibilities of Candida spp. to caspofungin by reference methodologies is not recommended. PMID:26282428

  6. Direct detection of dark matter axions with directional sensitivity

    SciTech Connect

    Irastorza, Igor G.; García, Juan A. E-mail:


    We study the directional effect of the expected axion dark matter signal in a resonant cavity of an axion haloscope detector, for cavity geometries not satisfying the condition that the axion de Broglie wavelength λ{sub a} is sufficiently larger than the cavity dimensions L for a fully coherent conversion, i.e. λ{sub a}∼>2πL. We focus on long thin cavities immersed in dipole magnets and find, for appropriately chosen cavity lengths, an O(1) modulation of the signal with the cavity orientation with respect the momentum distribution of the relic axion background predicted by the isothermal sphere model for the galactic dark matter halo. This effect can be exploited to design directional axion dark matter detectors, providing an unmistakable signature of the extraterrestrial origin of a possible positive detection. Moreover, the precise shape of the modulation may give information of the galactic halo distribution and, for specific halo models, give extra sensitivity for higher axion masses.

  7. Direct optical nanoscopy with axially localized detection

    NASA Astrophysics Data System (ADS)

    Bourg, N.; Mayet, C.; Dupuis, G.; Barroca, T.; Bon, P.; Lécart, S.; Fort, E.; Lévêque-Fort, S.


    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Here, we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called supercritical-angle fluorescence can be captured using a high-numerical-aperture objective and used to determine the axial position of the fluorophore with nanometre precision. We introduce a new technique for three-dimensional nanoscopy that combines direct stochastic optical reconstruction microscopy (dSTORM) with dedicated detection of supercritical-angle fluorescence emission. We demonstrate that our approach of direct optical nanoscopy with axially localized detection (DONALD) typically yields an isotropic three-dimensional localization precision of 20 nm within an axial range of ∼150 nm above the coverslip.

  8. Bayesian analysis of multiple direct detection experiments

    NASA Astrophysics Data System (ADS)

    Arina, Chiara


    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  9. Discovering the enzyme mimetic activity of metal-organic framework (MOF) for label-free and colorimetric sensing of biomolecules.


    Wang, Ying; Zhu, Yingjing; Binyam, Atsebeha; Liu, Misha; Wu, Yinan; Li, Fengting


    A label-free sensing strategy based on the enzyme-mimicking activity of MOF was demonstrated for colorimetric detection of biomolecules. Firstly obvious blue color was observed due to the high efficiency of peroxidase-like catalytic activity of Fe-MIL-88A (an ion-based MOF material) toward 3,3',5,5'-tetramethylbenzidine (TMB). Then in the presence of target biomolecule and corresponding aptamer, the mimetic activity of Fe-MIL-88A can be strongly inhibited and used directly to realize the colorimetric detection. On the basis of the interesting findings, we designed a straightforward, label-free and sensitive colorimetric method for biomolecule detection by using the enzyme mimetic property of MOF coupling with molecular recognition element. Compared with the existed publications, our work breaks the routine way by setting up an inorganic-organic MOF-aptamer hybrid platform for colorimetric determination of biomolecules, expanding the targets scope from H2O2 or glucose to biomolecules. As a proof of concept, thrombin and thrombin aptamer was used as a model analyte. The limit of detection of 10nM can be achieved with naked eyes and ultrahigh selectivity of thrombin toward numerous interfering substances with 10-fold concentration was demonstrated significantly. Of note, the method was further applied for the detection of thrombin in human serum samples, showing the results in agreement with those values obtained in an immobilization buffer by the colorimetric method. This inorganic-organic MOF-aptamer sensing strategy may in principle be universally applicable for the detection of a range of environmental or biomedical molecules of interests.

  10. Directly detecting exozodiacal dust and disk variability

    NASA Astrophysics Data System (ADS)

    Scott, Nicholas J.


    Dust is common throughout stellar systems. The architecture of stellar systems may be typically comprised of a distant cold debris disk, a warm exozodiacal disk, and a hot inner disk. Dust in this exozodiacal region confounds exoplanet detections by scattering light or mimicking planetary emission. This environment must be well-modelled in order to find Earth-sized exoplanets. Interferometry at the Center for High Resolution Astronomy (CHARA) Array provides the angular resolution to directly detect near-infrared (NIR) excesses originating from warm and hot dust close to the host star. The recently upgraded Fiber-Linked Unit for Optical Recombination (JouFLU) is capable of measuring interferometric visibility contrasts to a precision of <0.1% and dust disk fluxes equal to 1% of the host star. There is likely a connection between these hot interferometrically detected dust disks and the harder-to-detect warm zodiacal dust analogues. In this way interferometric studies can observe the tip-of-the-iceberg of stellar system dust, providing details such as composition and grain size of dust, as well as statistics on the correlation of dust populations and stellar properties. These inner dust regions may exhibit a high degree of variability which should also be characterized and may give hint to the dust origin and replenishment mechanisms. JouFLU is currently involved in a large survey of exozodiacal dust stars of spectral types A through K with the aim to provide statistics about dust disk occurrence in relation to their host stars and the presence of cold dust reservoirs. Complementing this survey is a project of re-observing the earliest excess detections in order to determine their variability. In addition, NASA's InfraRed Telescope Facility (IRTF) provides a method for spectrophotometric detections of excess stellar flux corresponding to the presence of hot/warm exozodiacal dust. Multiple NIR interferometric instruments as well as medium resolution spectroscopy are a

  11. The Earth's velocity for direct detection experiments

    SciTech Connect

    McCabe, Christopher


    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has hitherto received little explicit discussion. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  12. Dark matter direct detection with accelerometers

    NASA Astrophysics Data System (ADS)

    Graham, Peter W.; Kaplan, David E.; Mardon, Jeremy; Rajendran, Surjeet; Terrano, William A.


    The mass of the dark matter particle is unknown, and may be as low as ˜1 0-22 eV . The lighter part of this range, below ˜eV , is relatively unexplored both theoretically and experimentally but contains an array of natural dark matter candidates. An example is the relaxion, a light boson predicted by cosmological solutions to the hierarchy problem. One of the few generic signals such light dark matter can produce is a time-oscillating, equivalence-principle-violating force. We propose searches for this using accelerometers, and consider in detail the examples of torsion balances, atom interferometry, and pulsar timing. These approaches have the potential to probe large parts of unexplored parameter space in the next several years. Thus such accelerometers provide radically new avenues for the direct detection of dark matter.

  13. Direct fast neutron detection: A status report

    SciTech Connect

    Peurrung, A.J.; Hansen, R.R.; Craig, R.A.; Hensley, W.K.; Hubbard, C.W.; Keller, P.E.; Reeder, P.L.; Sunberg, D.S.


    This report describes the status of efforts to develop direct fast-neutron detection via proton recoil within plastic scintillator. Since recording proton recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the different pulse shapes that are to be expected primarily on the basis of the slower speed of the recoiling fission neutrons. Should this effort ultimately prove successful, the resulting novel technology will have the potential to significantly lower cost and increase capability for a number of critical neutron-detection applications. Considerable progress has been made toward a clear and compelling demonstration of this new technique. An exhaustive theoretical and numerical investigation of the method has been completed. The authors have been able to better understand the laboratory results and estimate the performance that could ultimately be achieved using the proposed technique. They have assessed the performance of a number of different algorithms for discriminating between neutron and gamma ray events. The results of this assessment will be critical when the construction of low-cost, field-portable neutron detectors becomes necessary. Finally, a laboratory effort to realize effective discrimination is well underway and has resulted in partial success.

  14. Colorimetric elastase sensor with peptide conjugated cellulose nanocrystals is interfaced to dialysis membranes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clinical detection of human neutrophil elastase (HNE) as point of care biomarker or in situ colorimetric adjuvant to chronic wound dressings presents potential advantages in the management of chronic wounds. A colorimetric approach to the detection of HNE using cotton cellulose nanocrystals (CCN) i...

  15. Direct Exoplanet Detection with Binary Differential Imaging

    NASA Astrophysics Data System (ADS)

    Rodigas, Timothy J.; Weinberger, Alycia; Mamajek, Eric E.; Males, Jared R.; Close, Laird M.; Morzinski, Katie; Hinz, Philip M.; Kaib, Nathan


    Binaries are typically excluded from direct imaging exoplanet surveys. However, the recent findings of Kepler and radial velocity programs show that planets can and do form in binary systems. Here, we suggest that visual binaries offer unique advantages for direct imaging. We show that Binary Differential Imaging (BDI), whereby two stars are imaged simultaneously at the same wavelength within the isoplanatic patch at a high Strehl ratio, offers improved point spread function (PSF) subtraction that can result in increased sensitivity to planets close to each star. We demonstrate this by observing a young visual binary separated by 4″ with MagAO/Clio-2 at 3.9 μm, where the Strehl ratio is high, the isoplanatic patch is large, and giant planets are bright. Comparing BDI to angular differential imaging (ADI), we find that BDI’s 5σ contrast is ˜0.5 mag better than ADI’s within ˜1″ for the particular binary we observed. Because planets typically reside close to their host stars, BDI is a promising technique for discovering exoplanets in stellar systems that are often ignored. BDI is also 2-4× more efficient than ADI and classical reference PSF subtraction, since planets can be detected around both the target and PSF reference simultaneously. We are currently exploiting this technique in a new MagAO survey for giant planets in 140 young nearby visual binaries. BDI on a space-based telescope would not be limited by isoplanatism effects and would therefore be an even more powerful tool for imaging and discovering planets. This paper includes data obtained at the 6.5 m Magellan Telescopes located at Las Campanas Observatory, Chile.

  16. Direct Detection of Soil-Bound Prions

    PubMed Central

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro


    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  17. A Colorimetric Enzyme-Linked Immunosorbent Assay (ELISA) Detection Platform for a Point-of-Care Dengue Detection System on a Lab-on-Compact-Disc.


    Thiha, Aung; Ibrahim, Fatimah


    The enzyme-linked Immunosorbent Assay (ELISA) is the gold standard clinical diagnostic tool for the detection and quantification of protein biomarkers. However, conventional ELISA tests have drawbacks in their requirement of time, expensive equipment and expertise for operation. Hence, for the purpose of rapid, high throughput screening and point-of-care diagnosis, researchers are miniaturizing sandwich ELISA procedures on Lab-on-a-Chip and Lab-on-Compact Disc (LOCD) platforms. This paper presents a novel integrated device to detect and interpret the ELISA test results on a LOCD platform. The system applies absorption spectrophotometry to measure the absorbance (optical density) of the sample using a monochromatic light source and optical sensor. The device performs automated analysis of the results and presents absorbance values and diagnostic test results via a graphical display or via Bluetooth to a smartphone platform which also acts as controller of the device. The efficacy of the device was evaluated by performing dengue antibody IgG ELISA on 64 hospitalized patients suspected of dengue. The results demonstrate high accuracy of the device, with 95% sensitivity and 100% specificity in detection when compared with gold standard commercial ELISA microplate readers. This sensor platform represents a significant step towards establishing ELISA as a rapid, inexpensive and automatic testing method for the purpose of point-of-care-testing (POCT) in resource-limited settings.

  18. Target-catalyzed autonomous assembly of dendrimer-like DNA nanostructures for enzyme-free and signal amplified colorimetric nucleic acids detection.


    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Meng, Yan; Zhou, Cuisong; Long, Yuyin; Zheng, Baozhan; Du, Juan; Guo, Yong; Xiao, Dan


    Self-assembly of DNA nanostructures is of great importance in nanomedicine, nanotechnology and biosensing. Herein, a novel target-catalyzed autonomous assembly pathway for the formation of dendrimer-like DNA nanostructures that only employing target DNA and three hairpin DNA probes was proposed. We use the sticky-ended Y shape DNA (Y-DNA) as the assembly monomer and it was synthesized by the catalyzed hairpin assembly (CHA) instead of the DNA strand annealing method. The formed Y-DNA was equipped with three ssDNA sticky ends and two of them were predesigned to be complementary to the third one, then the dendrimer-like DNA nanostructures can be obtained via an autonomous assembly among these sticky-ended Y-DNAs. The resulting nanostructure has been successfully applied to develop an enzyme-free and signal amplified gold nanoparticle (AuNP)-based colorimetric nucleic acids assay.

  19. Pt74Ag26 nanoparticle-decorated ultrathin MoS2 nanosheets as novel peroxidase mimics for highly selective colorimetric detection of H2O2 and glucose

    NASA Astrophysics Data System (ADS)

    Cai, Shuangfei; Han, Qiusen; Qi, Cui; Lian, Zheng; Jia, Xinghang; Yang, Rong; Wang, Chen


    To extend the functionalities of two-dimensional graphene-like layered compounds as versatile materials, the modification of transition metal dichalcogenide nanosheets such as MoS2 with metal nanoparticles is of great and widespread interest. However, few studies are available on the preparation of bimetallic nanoparticles supported on MoS2. Herein, a facile and efficient method to synthesize MoS2-PtAg nanohybrids by decorating ultrathin MoS2 nanosheets with octahedral Pt74Ag26 alloy nanoparticles has been reported. The as-prepared MoS2-Pt74Ag26 nanohybrids were investigated as novel peroxidase mimics to catalyze the oxidation of classical peroxidase substrate 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2, producing a blue colored reaction and exhibiting typical Michaelis-Menten kinetics. MoS2-Pt74Ag26 has a higher affinity for H2O2 than horseradish peroxidase (HRP) and a higher vmax value with TMB as the substrate than MoS2. The improved catalytic activity of hybrids for colorimetric reactions could be attributed to the synergistic effects of octahedral Pt74Ag26 nanoparticles and ultrathin MoS2 nanosheets as supports. Meanwhile, the generation of active oxygen species (&z.rad;OH) by H2O2 decomposition with MoS2-Pt74Ag26 was responsible for the oxidation of TMB. On the basis of these findings, a colorimetric method based on MoS2-Pt74Ag26 nanohybrids that is highly sensitive and selective was developed for glucose detection. Lower values of the limit of detection (LOD) were obtained, which is more sensitive than MoS2 nanosheets.To extend the functionalities of two-dimensional graphene-like layered compounds as versatile materials, the modification of transition metal dichalcogenide nanosheets such as MoS2 with metal nanoparticles is of great and widespread interest. However, few studies are available on the preparation of bimetallic nanoparticles supported on MoS2. Herein, a facile and efficient method to synthesize MoS2-PtAg nanohybrids by decorating

  20. Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles.


    Liandris, Emmanouil; Gazouli, Maria; Andreadou, Margarita; Comor, Mirjana; Abazovic, Nadica; Sechi, Leonardo A; Ikonomopoulos, John


    Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 microl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples.

  1. Cost Effective Paper-Based Colorimetric Microfluidic Devices and Mobile Phone Camera Readers for the Classroom

    ERIC Educational Resources Information Center

    Koesdjojo, Myra T.; Pengpumkiat, Sumate; Wu, Yuanyuan; Boonloed, Anukul; Huynh, Daniel; Remcho, Thomas P.; Remcho, Vincent T.


    We have developed a simple and direct method to fabricate paper-based microfluidic devices that can be used for a wide range of colorimetric assay applications. With these devices, assays can be performed within minutes to allow for quantitative colorimetric analysis by use of a widely accessible iPhone camera and an RGB color reader application…

  2. Measurement of microbial activity in soil by colorimetric observation of in situ dye reduction: an approach to detection of extraterrestrial life

    PubMed Central

    Crawford, Ronald L; Paszczynski, Andrzej; Lang, Qingyong; Erwin, Daniel P; Allenbach, Lisa; Corti, Giancarlo; Anderson, Tony J; Cheng, I Francis; Wai, Chien; Barnes, Bruce; Wells, Richard; Assefi, Touraj; Mojarradi, Mohammad


    Background Detecting microbial life in extraterrestrial locations is a goal of space exploration because of ecological and health concerns about possible contamination of other planets with earthly organisms, and vice versa. Previously we suggested a method for life detection based on the fact that living entities require a continual input of energy accessed through coupled oxidations and reductions (an electron transport chain). We demonstrated using earthly soils that the identification of extracted components of electron transport chains is useful for remote detection of a chemical signature of life. The instrument package developed used supercritical carbon dioxide for soil extraction, followed by chromatography or electrophoresis to separate extracted compounds, with final detection by voltammetry and tandem mass-spectrometry. Results Here we used Earth-derived soils to develop a related life detection system based on direct observation of a biological redox signature. We measured the ability of soil microbial communities to reduce artificial electron acceptors. Living organisms in pure culture and those naturally found in soil were shown to reduce 2,3-dichlorophenol indophenol (DCIP) and the tetrazolium dye 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide inner salt (XTT). Uninoculated or sterilized controls did not reduce the dyes. A soil from Antarctica that was determined by chemical signature and DNA analysis to be sterile also did not reduce the dyes. Conclusion Observation of dye reduction, supplemented with extraction and identification of only a few specific signature redox-active biochemicals such as porphyrins or quinones, provides a simplified means to detect a signature of life in the soils of other planets or their moons. PMID:12150716

  3. Systematic aspects of direct extrasolar planet detection

    NASA Technical Reports Server (NTRS)

    Brown, Robert A.


    Using the first optical observatory in space, the Hubble Space Telescope, images of possible extrasolar planets will have poor contrast against the background of diffracted and scattered starlight. The very long exposure time required to achieve an adequate signal-to-noise ratio will make their detection infeasible. For a future telescope, a 16-fold increase in either the smoothness of the collecting area of the optics would reduce the exposure time to a tolerable value, but the contrast would remain low and the required photometric precision high. In this situation, the feasibility of detection would be contingent on the careful identification and control of systematic errors.

  4. Direct detection of particle dark matter

    NASA Astrophysics Data System (ADS)

    Rich, J.

    The paper discusses in general terms the problem of detecting and identifying weakly-interacting particles in the galactic halo via the observation of nuclei recoiling from elastic scatters. Emphasis is placed on experimental signatures and on detector requirements as to size, energy sensitivity and background. The problems are illustrated with three popular dark-matter candidates: heavy Diract neutrinos, supersymmetric photinos, and cosmions (particles invented to solve the solar-neutrino problem). Recent progress in the construction of suitable detectors is discussed.

  5. Colorimetric protein assay techniques.


    Sapan, C V; Lundblad, R L; Price, N C


    There has been an increase in the number of colorimetric assay techniques for the determination of protein concentration over the past 20 years. This has resulted in a perceived increase in sensitivity and accuracy with the advent of new techniques. The present review considers these advances with emphasis on the potential use of such technologies in the assay of biopharmaceuticals. The techniques reviewed include Coomassie Blue G-250 dye binding (the Bradford assay), the Lowry assay, the bicinchoninic acid assay and the biuret assay. It is shown that each assay has advantages and disadvantages relative to sensitivity, ease of performance, acceptance in the literature, accuracy and reproducibility/coefficient of variation/laboratory-to-laboratory variation. A comparison of the use of several assays with the same sample population is presented. It is suggested that the most critical issue in the use of a chromogenic protein assay for the characterization of a biopharmaceutical is the selection of a standard for the calibration of the assay; it is crucial that the standard be representative of the sample. If it is not possible to match the standard with the sample from the perspective of protein composition, then it is preferable to use an assay that is not sensitive to the composition of the protein such as a micro-Kjeldahl technique, quantitative amino acid analysis or the biuret assay. In a complex mixture it might be inappropriate to focus on a general method of protein determination and much more informative to use specific methods relating to the protein(s) of particular interest, using either specific assays or antibody-based methods. The key point is that whatever method is adopted as the 'gold standard' for a given protein, this method needs to be used routinely for calibration.

  6. Brief Report: Eye Direction Detection Improves with Development in Autism

    ERIC Educational Resources Information Center

    Webster, Simon; Potter, Douglas D.


    Eye direction detection has been claimed to be intact in autism, but the development of this skill has not been investigated. Eleven children with autism and 11 typically developing children performed a demanding face-to-face eye direction detection task. Younger children with autism demonstrated a deficit in this skill, relative to younger…

  7. Indirect detection of radiation sources through direct detection of radiolysis products


    Farmer, Joseph C.; Fischer, Larry E.; Felter, Thomas E.


    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  8. Direct Detection of the Asteroidal YORP Effect

    NASA Astrophysics Data System (ADS)

    Lowry, Stephen C.; Fitzsimmons, A.; Pravec, P.; Vokrouhlicky, D.; Boehnhardt, H.; Taylor, P. A.; Margot, J. L.; Galád, A.; Irwin, M.; Irwin, J.; Kusnirák, P.


    The Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect is a torque that can modify the rotation rates and obliquities of small bodies in the solar system via the combined effects of incident solar radiation pressure and the recoil effect from anisotropic emission of thermal photons. The YORP effect is the only realistic mechanism for explaining the intriguing spin-axis alignments within the Koronis asteroid family, and quite possibly explains the anomalous distribution of spin rates for small asteroids. YORP is now thought to be an important mechanism in the formation of binary asteroid systems, and has a direct bearing on the related Yarkovsky effect, which affects the orbital motion of small asteroids. Despite its importance, there exists only indirect evidence for the presence of YORP on solar system objects, until now. We conducted an optical-imaging monitoring campaign from 2001-2005 on a small near-Earth asteroid, 2000 PH5, now known as asteroid (54509) YORP. We found that the asteroid has been continuously increasing its sidereal rotation rate by (2.0 ± 0.2)*10-4 deg./day2, over this 4-yr period (Lowry et al., 2007, Science 316, 272-274). The observed YORP strength is consistent with detailed shape-model-based theoretical calculations of the effect (Taylor et al., 2007, Science 316, 274-277). We simulated the asteroid's close Earth approaches from 2001 to 2005, showing that gravitational torques cannot explain the observed spin rate increase. Dynamical simulations suggest that 2000 PH5 may reach a rotation period of just 20 seconds toward the end of its expected lifetime.

  9. Wavelet-based target detection using multiscale directional analysis

    NASA Astrophysics Data System (ADS)

    Chambers, Bradley J.; Reynolds, William D., Jr.; Campbell, Derrick S.; Fennell, Darius K.; Ansari, Rashid


    Efficient processing of imagery derived from remote sensing systems has become ever more important due to increasing data sizes, rates, and bit depths. This paper proposes a target detection method that uses a special class of wavelets based on highly frequency-selective directional filter banks. The approach helps isolate object features in different directional filter output components. These components lend themselves well to the application of powerful denoising and edge detection procedures in the wavelet domain. Edge information is derived from directional wavelet decompositions to detect targets of known dimension in electro optical imagery. Results of successful detection of objects using the proposed method are presented in the paper. The approach highlights many of the benefits of working with directional wavelet analysis for image denoising and detection.

  10. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by gold nanoparticle optical sensing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga-toxin producing Escherichia coli (STEC) strains (“Big Six” – O26, O45, O103, O111, O121, O145, and O157) represent significant groups of pathogens responsible for foodborne diseases. The objective of this study was to develop a colorimetric optical sensing assay that can simultaneously detect ...

  11. Readout technologies for directional WIMP Dark Matter detection

    NASA Astrophysics Data System (ADS)

    Battat, J. B. R.; Irastorza, I. G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.; Colas, P.; Consiglio, L.; Dafni, T.; D'Ambrosio, N.; Deaconu, C.; De Lellis, G.; Descombes, T.; Di Crescenzo, A.; Di Marco, N.; Druitt, G.; Eggleston, R.; Ferrer-Ribas, E.; Fusayasu, T.; Galán, J.; Galati, G.; García, J. A.; Garza, J. G.; Gentile, V.; Garcia-Sciveres, M.; Giomataris, Y.; Guerrero, N.; Guillaudin, O.; Guler, A. M.; Harton, J.; Hashimoto, T.; Hedges, M. T.; Iguaz, F. J.; Ikeda, T.; Jaegle, I.; Kadyk, J. A.; Katsuragawa, T.; Komura, S.; Kubo, H.; Kuge, K.; Lamblin, J.; Lauria, A.; Lee, E. R.; Lewis, P.; Leyton, M.; Loomba, D.; Lopez, J. P.; Luzón, G.; Mayet, F.; Mirallas, H.; Miuchi, K.; Mizumoto, T.; Mizumura, Y.; Monacelli, P.; Monroe, J.; Montesi, M. C.; Naka, T.; Nakamura, K.; Nishimura, H.; Ochi, A.; Papevangelou, T.; Parker, J. D.; Phan, N. S.; Pupilli, F.; Richer, J. P.; Riffard, Q.; Rosa, G.; Santos, D.; Sawano, T.; Sekiya, H.; Seong, I. S.; Snowden-Ifft, D. P.; Spooner, N. J. C.; Sugiyama, A.; Taishaku, R.; Takada, A.; Takeda, A.; Tanaka, M.; Tanimori, T.; Thorpe, T. N.; Tioukov, V.; Tomita, H.; Umemoto, A.; Vahsen, S. E.; Yamaguchi, Y.; Yoshimoto, M.; Zayas, E.


    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  12. A concentration-dependent multicolor conversion strategy for ultrasensitive colorimetric immunoassay with the naked eye.


    Liu, Yingshuai; Zhang, Zeying; Yu, Jie; Xie, Jin; Li, Chang Ming


    Colorimetric immunoassays have been attracting more attention for use in practical applications, especially in point-of-care diagnostics. In comparison with a single color immunoassay, the dose-dependent multicolor strategy greatly improves the detection resolution and accuracy of visual inspection. In the current study, a concentration-dependent multicolor conversion strategy was developed based on gold nanoparticle (AuNP)-mediated copper deposition for signal amplification and Prussian blue for color generation. Under optimal conditions, a dose-dependent multicolor from yellow through green to blue were successfully achieved, which was easier to be differentiated from each other by the naked eyes. With rabbit IgG and prostate specific antigen (PSA) as model analytes, semi-quantitative evaluations were demonstrated in lab buffer and serum by direct readout with the naked eyes. Quantitative detections were also accomplished by measurement of absorbance of Prussian blue with a common UV-Vis spectrophotometer. A limit of detection (LOD) down to sub-picogram per milliliter was determined. In addition, this newly developed colorimetric assay method can be easily adapted for the detection of other biomolecules by simply changing the recognition pairs.

  13. Magnetic colorimetric immunoassay for human interleukin-6 based on the oxidase activity of ceria spheres.


    Peng, Juan; Guan, Jufang; Yao, Huiqin; Jin, Xiaoyong


    A novel magnetic colorimetric immunoassay strategy was designed for sensitive detection of human interleukin-6 (IL-6) using ceria spheres as labels. Ceria spheres showed excellent oxidase activity, which can directly catalyze the oxidation of substrate o-phenylenediamine (OPD) to a stable yellow product, 2,3-diaminophenazine (oxOPD). The absorbance of oxOPD was recorded to reflect the level of IL-6. The relatively mild conditions made the immunoassay strategy more robust, reliable, and easy. A linear relationship between absorbance intensity and the logarithm of IL-6 concentrations was obtained in the range of 0.0001-10 ng mL(-1) with a detection limit of 0.04 pg mL(-1) (S/N = 3). The colorimetric immunoassay exhibited high sensitivity and specificity for the detection of IL-6. This immunoassay has been successfully applied in the detection of IL-6 in serum samples and can be readily extended toward the on-site monitoring of cancer biomarkers in serum samples.

  14. A smartphone-based colorimetric reader for bioanalytical applications using the screen-based bottom illumination provided by gadgets.


    Vashist, Sandeep Kumar; van Oordt, Thomas; Schneider, E Marion; Zengerle, Roland; von Stetten, Felix; Luong, John H T


    A smartphone-based colorimetric reader (SBCR) was developed using a Samsung Galaxy SIII mini, a gadget (iPAD mini, iPAD4 or iPhone 5s), integrated with a custom-made dark hood and base holder assembly. The smartphone equipped with a back camera (5 megapixels resolution) was used for colorimetric imaging via the hood and base-holder assembly. A 96- or 24-well microtiter plate (MTP) was positioned on the gadget's screensaver that provides white light-based bottom illumination only in the specific regions corresponding to the bottom of MTP's wells. The pixel intensity of the captured images was determined by an image processing algorithm. The developed SBCR was evaluated and compared with a commercial MTP reader (MTPR) for three model assays: our recently developed human C-reactive protein sandwich enzyme-linked immunosorbent assay (ELISA), horseradish peroxidase direct ELISA, and bicinchoninic acid protein estimation assay. SBCR had the same precision, dynamic range, detection limit and sensitivity as MTPR for all three assays. With advanced microfabrication and data processing, SBCR will become more compact, lighter, inexpensive and enriched with more features. Therefore, SBCR with a remarkable computing power could be an ideal point-of-care (POC) colorimetric detection device for the next-generation of cost-effective POC diagnostics, immunoassays and diversified bioanalytical applications.

  15. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Quintela, Irwin A.; de Los Reyes, Benildo G.; Lin, Chih-Sheng; Wu, Vivian C. H.


    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g-1, requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide

  16. Direction finding antenna system for spark detection and localization

    NASA Astrophysics Data System (ADS)

    Topor, Raluca E.; Bucuci, Stefania C.; Tamas, Razvan D.; Danisor, Alin; Dumitrascu, Ana; Berescu, Serban


    This paper proposes a novel UWB antenna system for spark detection and localization by using the amplitude comparison direction finding (DF) method. The proposed design consists of two identical axially crossed "padlock" shaped UWB antennas, with unbalanced feeding. Simulation results show that such radiating systems can be used for assessing the direction of arrival for short pulses.

  17. Photonic Crystal Structures with Tunable Structure Color as Colorimetric Sensors

    PubMed Central

    Wang, Hui; Zhang, Ke-Qin


    Colorimetric sensing, which transduces environmental changes into visible color changes, provides a simple yet powerful detection mechanism that is well-suited to the development of low-cost and low-power sensors. A new approach in colorimetric sensing exploits the structural color of photonic crystals (PCs) to create environmentally-influenced color-changeable materials. PCs are composed of periodic dielectrics or metallo-dielectric nanostructures that affect the propagation of electromagnetic waves (EM) by defining the allowed and forbidden photonic bands. Simultaneously, an amazing variety of naturally occurring biological systems exhibit iridescent color due to the presence of PC structures throughout multi-dimensional space. In particular, some kinds of the structural colors in living organisms can be reversibly changed in reaction to external stimuli. Based on the lessons learned from natural photonic structures, some specific examples of PCs-based colorimetric sensors are presented in detail to demonstrate their unprecedented potential in practical applications, such as the detections of temperature, pH, ionic species, solvents, vapor, humidity, pressure and biomolecules. The combination of the nanofabrication technique, useful design methodologies inspired by biological systems and colorimetric sensing will lead to substantial developments in low-cost, miniaturized and widely deployable optical sensors. PMID:23539027

  18. Photonic crystal structures with tunable structure color as colorimetric sensors.


    Wang, Hui; Zhang, Ke-Qin


    Colorimetric sensing, which transduces environmental changes into visible color changes, provides a simple yet powerful detection mechanism that is well-suited to the development of low-cost and low-power sensors. A new approach in colorimetric sensing exploits the structural color of photonic crystals (PCs) to create environmentally-influenced color-changeable materials. PCs are composed of periodic dielectrics or metallo-dielectric nanostructures that affect the propagation of electromagnetic waves (EM) by defining the allowed and forbidden photonic bands. Simultaneously, an amazing variety of naturally occurring biological systems exhibit iridescent color due to the presence of PC structures throughout multi-dimensional space. In particular, some kinds of the structural colors in living organisms can be reversibly changed in reaction to external stimuli. Based on the lessons learned from natural photonic structures, some specific examples of PCs-based colorimetric sensors are presented in detail to demonstrate their unprecedented potential in practical applications, such as the detections of temperature, pH, ionic species, solvents, vapor, humidity, pressure and biomolecules. The combination of the nanofabrication technique, useful design methodologies inspired by biological systems and colorimetric sensing will lead to substantial developments in low-cost, miniaturized and widely deployable optical sensors.

  19. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles.


    Quintela, Irwin A; de los Reyes, Benildo G; Lin, Chih-Sheng; Wu, Vivian C H


    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; "Big Six" - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g(-1), requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.

  20. Comparing readout strategies to directly detect dark matter

    NASA Astrophysics Data System (ADS)

    Billard, J.


    Over the past decades, several ideas and technologies have been developed to directly detect weakly interacting massive particles (WIMP) from the galactic halo. All these detection strategies share the common goal of discriminating a WIMP signal from the residual backgrounds. By directly detecting WIMPs, one can measure some or all of the observables associated to each nuclear recoil candidates, such as their energy and direction. In this study, we compare and examine the discovery potentials of each readout strategies from counting only (bubble chambers) to directional detectors (Time Projection Chambers) with 1d-, 2d-, and 3d-sensitivity. Using a profile likelihood analysis, we show that, in the case of a large and irreducible background contamination characterized by an energy distribution similar to the expected WIMP signal, directional information can improve the sensitivity of the experiment by several orders of magnitude. We also found that 1d directional detection is only less effective than a full 3d directional sensitivity by about a factor of 3, or 10 if we assume no sense recognition, still improving by a factor of 2 or more if only the energy of the events is being measured.

  1. Simple and specific colorimetric detection of Staphylococcus using its volatile 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid in the liquid phase and head space of cultures.


    Saranya, Raju; Aarthi, Raju; Sankaran, Krishnan


    Spread of drug-resistant Staphylococcus spp. into communities pose danger demanding effective non-invasive and non-destructive tools for its early detection and surveillance. Characteristic volatile organic compounds (VOCs) produced by bacteria offer new diagnostic targets and novel approaches not exploited so far in infectious disease diagnostics. Our search for such characteristic VOC for Staphylococcus spp. led to the depiction of 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid (ATMAP), a moderately volatile compound detected both in the culture and headspace when the organism was grown in tryptone soya broth (TSB) medium. A simple and inexpensive colorimetric method (colour change from yellow to orange) using methyl red as the pH indicator provided an absolutely specific way for identifying Staphylococcus spp., The assay performed in liquid cultures (7-h growth in TSB) as well as in the headspace of plate cultures (grown for 10 h on TSA) was optimised in a 96-well plate and 12-well plate formats, respectively, employing a set of positive and negative strains. Only Staphylococcus spp. showed the distinct colour change from yellow to orange due to the production of the above VOC while in the case of other organisms, the reagent remained yellow. The method validated using known clinical and environmental strains (56 including Staphylococcus, Proteus, Pseudomonas, Klebsiella, Bacillus, Shigella and Escherichia coli) was found to be highly efficient showing 100% specificity and sensitivity. Such simple methods of bacterial pathogen identification are expected to form the next generation tools for the control of infectious diseases through early detection and surveillance of causative agents.

  2. An integrated direct loop-mediated isothermal amplification microdevice incorporated with an immunochromatographic strip for bacteria detection in human whole blood and milk without a sample preparation step.


    Lee, Dohwan; Kim, Yong Tae; Lee, Jee Won; Kim, Do Hyun; Seo, Tae Seok


    We have developed an integrated direct loop-mediated isothermal amplification (Direct LAMP) microdevice incorporated with an immunochromatographic strip (ICS) to identify bacteria contaminated in real samples. The Direct LAMP is a novel isothermal DNA amplification technique which does not require thermal cycling steps as well as any sample preparation steps such as cell lysis and DNA extraction for amplifying specific target genes. In addition, the resultant amplicons were colorimetrically detected on the ICS, thereby enabling the entire genetic analysis process to be simplified. The two functional units (Direct LAMP and ICS) were integrated on a single device without use of the tedious and complicated microvalve and tubing systems. The utilization of a slidable plate allows us to manipulate the fluidic control in the microchannels manually and the sequential operation of the Direct LAMP and ICS detection could be performed by switching the slidable plate to each functional unit. Thus, the combination of the direct isothermal amplification without any sample preparation and thermal cycling steps, the ICS based amplicon detection by naked eyes, and the slidable plate to eliminate the microvalves in the integrated microdevice would be an ideal platform for point-of-care DNA diaganotics. On the integrated Direct LAMP-ICS microdevice, we could analyze Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) contaminated in human whole blood or milk at a single-cell level within 1h.

  3. Colorimetric characterization of LED luminaires

    NASA Astrophysics Data System (ADS)

    Costa, C. L. M.; Vieira, R. R.; Pereira, R. C.; Silva, P. V. M.; Oliveira, I. A. A.; Sardinha, A. S.; Viana, D. D.; Barbosa, A. H.; Souza, L. P.; Alvarenga, A. D.


    The Optical Metrology Division of Inmetro - National Institute of Metrology, Quality and Technology has recently started the colorimetric characterization of lamps by implementing Correlated Color Temperature (CCT) and Color Rendering Index (CRI) measurements of incandescent lamps, followed by the CFL, and LED lamps and luminaires. Here we present the results for the verification of the color characterization of samples of SSL luminaires for public as well as indoor illumination that are sold in Brazil.

  4. Colorimetric determination of melamine in milk using unmodified silver nanoparticles.


    Kumar, Naveen; Kumar, Harish; Mann, Bimlesh; Seth, Raman


    Melamine is nitrogen rich chemical compound used as an adulterant in dairy products by unscrupulous people to increase the apparent protein content. This incident prompted the researchers to develop simple methods for easy detection of melamine in food samples. In the present paper, we report a simple and sensitive colorimetric method for detection of melamine in milk based on silver nanoparticles. This method relies upon the principle that melamine causes the aggregation of silver nanoparticles, resulting in abrupt color change from yellow to red under optimized conditions. The concentration of melamine in adulterated sample can be quantitated by monitoring the absorption spectra of silver nanoparticles using ultraviolet-visible (UV-Vis) spectrometer. The present colorimetric method which utilizes silver nanoparticles of 35 nm can reliably detect melamine down to a concentration of 0.04 mg l(-1).

  5. Colorimetric determination of melamine in milk using unmodified silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Kumar, Naveen; Kumar, Harish; Mann, Bimlesh; Seth, Raman


    Melamine is nitrogen rich chemical compound used as an adulterant in dairy products by unscrupulous people to increase the apparent protein content. This incident prompted the researchers to develop simple methods for easy detection of melamine in food samples. In the present paper, we report a simple and sensitive colorimetric method for detection of melamine in milk based on silver nanoparticles. This method relies upon the principle that melamine causes the aggregation of silver nanoparticles, resulting in abrupt color change from yellow to red under optimized conditions. The concentration of melamine in adulterated sample can be quantitated by monitoring the absorption spectra of silver nanoparticles using ultraviolet-visible (UV-Vis) spectrometer. The present colorimetric method which utilizes silver nanoparticles of 35 nm can reliably detect melamine down to a concentration of 0.04 mg l- 1.

  6. Directional detection as a strategy to discover Galactic Dark Matter

    NASA Astrophysics Data System (ADS)

    Billard, J.; Mayet, F.; Macías-Pérez, J. F.; Santos, D.


    Directional detection of Galactic Dark Matter is a promising search strategy for discriminating WIMP events from background. Technical progress on gaseous detectors and read-outs has permitted the design and construction of competitive experiments. However, to take full advantage of this powerful detection method, one need to be able to extract information from an observed recoil map to identify a WIMP signal. We present a comprehensive formalism, using a map-based likelihood method allowing to recover the main incoming direction of the signal and its significance, thus proving its Galactic origin. This is a blind analysis intended to be used on any directional data. Constraints are deduced in the (σ,m) plane and systematic studies are presented in order to show that, using this analysis tool, unambiguous Dark Matter detection can be achieved on a large range of exposures and background levels.

  7. Global limits and interference patterns in dark matter direct detection

    SciTech Connect

    Catena, Riccardo; Gondolo, Paolo


    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  8. Detecting communities by asymmetric intimacy in directed-weighted network

    NASA Astrophysics Data System (ADS)

    Wang, Xingyuan; Qin, Xiaomeng

    Community detection and analysis have attracted wide public concerns over the recent years. Meanwhile, many related algorithms in complex networks have been proposed. However, most of them concentrate on undirected and unweighted networks. Concerning the significant theoretical value and potential application foreground for directed-weighted networks, in this paper, a novel hierarchical communities detection algorithm (termed as DCBAI) has been proposed on the basis of asymmetric intimacy between nodes. Community structures are effectively detected by node clustering algorithm in directed-weighted network, and a set of optimal communities are generated. In addition, a new and asymmetric parameter is adopted to measure the intimate relationship between nodes. We make some simulation using the proposed algorithm in real-world networks and artificial networks, and the result obtained proves that the parameter can describe the direct and indirect relationships between two nodes. Eventually, comparison with similar algorithms shows that our proposed algorithm has better performance.

  9. Global limits and interference patterns in dark matter direct detection

    SciTech Connect

    Catena, Riccardo; Gondolo, Paolo E-mail:


    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  10. Ratiometric and colorimetric near-infrared sensors for multi-channel detection of cyanide ion and their application to measure β-glucosidase

    NASA Astrophysics Data System (ADS)

    Xing, Panfei; Xu, Yongqian; Li, Hongjuan; Liu, Shuhui; Lu, Aiping; Sun, Shiguo


    A near-infrared sensor for cyanide ion (CN-) was developed via internal charge transfer (ICT). This sensor can selectively detect CN- either through dual-ratiometric fluorescence (logarithm of I414/I564 and I803/I564) or under various absorption (356 and 440 nm) and emission (414, 564 and 803 nm) channels. Especially, the proposed method can be employed to measure β-glucosidase by detecting CN- traces in commercial amygdalin samples.

  11. Determination of cysteine, homocysteine, cystine, and homocystine in biological fluids by HPLC using fluorosurfactant-capped gold nanoparticles as postcolumn colorimetric reagents.


    Zhang, Lijuan; Lu, Biqi; Lu, Chao; Lin, Jin-Ming


    We have demonstrated for the first time the suitability of fluorosurfactant-capped spherical gold nanoparticles as HPLC postcolumn colorimetric reagents for the direct assay of cysteine, homocysteine, cystine, and homocystine. The success of this work was based on the use of an on-line tris(2-carboxyethyl)phosphine reduction column for cystine and homocystine. Several parameters affecting the separation efficiency and the postcolumn colorimetric detection were thoroughly investigated. Under the optimized conditions, cysteine, homocysteine, cystine, and homocystine in human urine and plasma samples were determined. Detection limits for cysteine, homocysteine, cystine, and homocystine ranged from 0.16-0.49 μM. The accuracy in terms of recoveries ranged between 94.0-102.1%. This proposed method was rapid, inexpensive, and simple.

  12. Directed dynamical influence is more detectable with noise

    PubMed Central

    Jiang, Jun-Jie; Huang, Zi-Gang; Huang, Liang; Liu, Huan; Lai, Ying-Cheng


    Successful identification of directed dynamical influence in complex systems is relevant to significant problems of current interest. Traditional methods based on Granger causality and transfer entropy have issues such as difficulty with nonlinearity and large data requirement. Recently a framework based on nonlinear dynamical analysis was proposed to overcome these difficulties. We find, surprisingly, that noise can counterintuitively enhance the detectability of directed dynamical influence. In fact, intentionally injecting a proper amount of asymmetric noise into the available time series has the unexpected benefit of dramatically increasing confidence in ascertaining the directed dynamical influence in the underlying system. This result is established based on both real data and model time series from nonlinear ecosystems. We develop a physical understanding of the beneficial role of noise in enhancing detection of directed dynamical influence. PMID:27066763

  13. Directed dynamical influence is more detectable with noise

    NASA Astrophysics Data System (ADS)

    Jiang, Jun-Jie; Huang, Zi-Gang; Huang, Liang; Liu, Huan; Lai, Ying-Cheng


    Successful identification of directed dynamical influence in complex systems is relevant to significant problems of current interest. Traditional methods based on Granger causality and transfer entropy have issues such as difficulty with nonlinearity and large data requirement. Recently a framework based on nonlinear dynamical analysis was proposed to overcome these difficulties. We find, surprisingly, that noise can counterintuitively enhance the detectability of directed dynamical influence. In fact, intentionally injecting a proper amount of asymmetric noise into the available time series has the unexpected benefit of dramatically increasing confidence in ascertaining the directed dynamical influence in the underlying system. This result is established based on both real data and model time series from nonlinear ecosystems. We develop a physical understanding of the beneficial role of noise in enhancing detection of directed dynamical influence.

  14. Working Group Report: WIMP Dark Matter Direct Detection

    SciTech Connect

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.


    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  15. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    PubMed Central


    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  16. Direct detection of antihydrogen atoms using a BGO crystal

    NASA Astrophysics Data System (ADS)

    Nagata, Y.; Kuroda, N.; Ohtsuka, M.; Leali, M.; Lodi-Rizzini, E.; Mascagna, V.; Tajima, M.; Torii, H. A.; Zurlo, N.; Matsuda, Y.; Venturelli, L.; Yamazaki, Y.


    The ASACUSA collaboration has developed a detector consisting of a large size BGO crystal to detect an atomic antihydrogen beam, and performed the direct detection of antihydrogen atoms. Energy spectra from antihydrogen annihilation on the BGO crystal are discussed in comparison to simulation results from the GEANT4 toolkit. Background mainly originating from cosmic rays were strongly suppressed by analyzing the energy deposited in the BGO and requiring a multiplicity of charged pions. Thus antihydrogen events were identified.

  17. Field-stepped direct detection electron paramagnetic resonance.


    Yu, Zhelin; Liu, Tengzhi; Elajaili, Hanan; Rinard, George A; Eaton, Sandra S; Eaton, Gareth R


    The widest scan that had been demonstrated previously for rapid scan EPR was a 155G sinusoidal scan. As the scan width increases, the voltage requirement across the resonating capacitor and scan coils increases dramatically and the background signal induced by the rapidly changing field increases. An alternate approach is needed to achieve wider scans. A field-stepped direct detection EPR method that is based on rapid-scan technology is now reported, and scan widths up to 6200G have been demonstrated. A linear scan frequency of 5.12kHz was generated with the scan driver described previously. The field was stepped at intervals of 0.01 to 1G, depending on the linewidths in the spectra. At each field data for triangular scans with widths up to 11.5G were acquired. Data from the triangular scans were combined by matching DC offsets for overlapping regions of successive scans. This approach has the following advantages relative to CW, several of which are similar to the advantages of rapid scan. (i) In CW if the modulation amplitude is too large, the signal is broadened. In direct detection field modulation is not used. (ii) In CW the small modulation amplitude detects only a small fraction of the signal amplitude. In direct detection each scan detects a larger fraction of the signal, which improves the signal-to-noise ratio. (iii) If the scan rate is fast enough to cause rapid scan oscillations, the slow scan spectrum can be recovered by deconvolution after the combination of segments. (iv) The data are acquired with quadrature detection, which permits phase correction in the post processing. (v) In the direct detection method the signal typically is oversampled in the field direction. The number of points to be averaged, thereby improving the signal-to-noise ratio, is determined in post processing based on the desired field resolution. A degased lithium phthalocyanine sample was used to demonstrate that the linear deconvolution procedure can be employed with field

  18. Real-time colorimetric detection of DNA methylation of the PAX1 gene in cervical scrapings for cervical cancer screening with thiol-labeled PCR primers and gold nanoparticles

    PubMed Central

    Huang, Jin; Liou, Yu-Ligh; Kang, Ya-Nan; Tan, Zhi-Rong; Peng, Ming-Jing; Zhou, Hong-Hao


    Background DNA methylation can induce carcinogenesis by silencing key tumor suppressor genes. Analysis of aberrant methylation of tumor suppressor genes can be used as a prognostic and predictive biomarker for cancer. In this study, we propose a colorimetric method for the detection of DNA methylation of the paired box gene 1 (PAX1) gene in cervical scrapings obtained from 42 patients who underwent cervical colposcopic biopsy. Methods A thiolated methylation-specific polymerase chain reaction (MSP) primer was used to generate MSP products labeled with the thiol group at one end. After bisulfite conversion and MSP amplification, the unmodified gold nanoparticles (AuNPs) were placed in a reaction tube and NaCl was added to induce aggregation of bare AuNPs without generating polymerase chain reaction products. After salt addition, the color of AuNPs remained red in the methylated PAX1 gene samples because of binding to the MSP-amplified products. By contrast, the color of the AuNP colloid solution changed from red to blue in the non-methylated PAX1 gene samples because of aggregation of AuNPs in the absence of the MSP-amplified products. Furthermore, PAX1 methylation was quantitatively detected in cervical scrapings of patients with varied pathological degrees of cervical cancer. Conventional quantitative MSP (qMSP) was also performed for comparison. Results The two methods showed a significant correlation of the methylation frequency of the PAX1 gene in cervical scrapings with severity of cervical cancer (n=42, P<0.05). The results of the proposed method showed that the areas under the receiver operating characteristic curve (AUCs) of PAX1 were 0.833, 0.742, and 0.739 for the detection of cervical intraepithelial neoplasms grade 2 and worse lesions (CIN2+), cervical intraepithelial neoplasms grade 3 and worse lesions (CIN3+), and squamous cell carcinoma, respectively. The sensitivity and specificity for detecting CIN2+ lesions were 0.941 and 0.600, respectively, with

  19. Colorimetric detection of copper and chloride in DMSO/H2O media using bromopyrogallol red as a chemosensor with analytical applications

    NASA Astrophysics Data System (ADS)

    Tavallali, Hossein; Deilamy Rad, Gohar; Parhami, Abolfath; Abbasiyan, Elham


    We report bromopyrogallol red (BPR) as an easily available dye for detection of copper and chloride with distinct visual color changes in DMSO/H2O (9:1 v/v). The chemosensor has a high chromogenic selectivity for Cu2+ over other cations with detection limit of 0.07 μg mL-1. The obtained complex of Cu2+ with BPR displayed ability to detect Cl- up to 0.79 μg mL-1 in DMSO/H2O (9:1 v/v) media over a large number of other anions. The linear dynamic ranges for the determinations of Cu2+ and Cl- were 0.53-14.60 and 6.00-36.00 μg mL-1, respectively. This receptor was successfully applied for the determination of Cl- and Cu2+ in water samples.

  20. Colorimetric detection of copper and chloride in DMSO/H₂O media using bromopyrogallol red as a chemosensor with analytical applications.


    Tavallali, Hossein; Deilamy Rad, Gohar; Parhami, Abolfath; Abbasiyan, Elham


    We report bromopyrogallol red (BPR) as an easily available dye for detection of copper and chloride with distinct visual color changes in DMSO/H(2)O (9:1 v/v). The chemosensor has a high chromogenic selectivity for Cu(2+) over other cations with detection limit of 0.07 μg mL(-1). The obtained complex of Cu(2+) with BPR displayed ability to detect Cl(-) up to 0.79 μg mL(-1) in DMSO/H(2)O (9:1v/v) media over a large number of other anions. The linear dynamic ranges for the determinations of Cu(2+) and Cl(-) were 0.53-14.60 and 6.00-36.00 μg mL(-1), respectively. This receptor was successfully applied for the determination of Cl(-) and Cu(2+) in water samples.

  1. Monolayer g-C3N4 Fluorescent Sensor for Sensitive and Selective Colorimetric Detection of Silver ion from Aqueous Samples.


    Cao, Yujuan; Wu, Wei; Wang, Song; Peng, Hong; Hu, Xiaogang; Yu, Ying


    Rapid and sensitive detection of heavy-metal ions in natural water environments worldwide is urgently needed because of their severe threats to human health. In the present work, monolayer graphite-like flake C3N4 (g-C3N4) materials were applied as a new fluorescent sensor for the detection of trace silver ion in aqueous solution. The thickness of synthesized g-C3N4 was 0.45 nm and obtained by exfoliating twice with ultrasonic. With the presence of ethylene diamine tetraacetic acid as a screening agent, the highly sensitive sensor reached a low detection limit of 52.3 nmol/L for silver (I) ion and there was no disturbance when silver (I) ion coexisted with other metal ions in water samples. Under the optimal conditions, the monolayer g-C3N4 was successfully used to detect trace silver (I) ion in different environmental water and drinking water samples.

  2. A colorimetric and fluorometric dual-signal sensor for arginine detection by inhibiting the growth of gold nanoparticles/carbon quantum dots composite.


    Liu, Ting; Li, Na; Dong, Jiang Xue; Zhang, Ying; Fan, Yu Zhu; Lin, Shu Min; Luo, Hong Qun; Li, Nian Bing


    A bidimensional optical sensing platform which combines the advantages of fluorescence and colorimetry has been designed for arginine (Arg) detection. The system was established by monitoring the influence of Arg on the growth of gold nanoparticles/carbon quantum dots (Au/CQDs) composite, and the CQDs synthesized by ethylene glycol were used as the reducing and stabilizing agent in this paper. Considering that Arg is the only amino acid with guanidine group and has the highest isoelectric point (pI) value at 10.76, Arg would carry positive charges at pH 7.4. Consequently, the positively charged guanidine group of Arg could attract AuCl4(-) and CQDs through electrostatic interaction, which inhibited the growth of Au/CQDs composite. Thereby, the color of the system almost did not change and the fluorescence quenching of CQDs was prevented in the presence of Arg. Based on the color change a low detection limit for Arg was 37nM, and a detection limit of 450nM was obtained by fluorescence spectroscopy. Moreover, this dual-signal sensor also revealed excellent selectivity toward Arg over other amino acids. Besides, Arg can be detected in urine samples with satisfactory results, which demonstrate the potential applications for real analysis.

  3. Directional statistics for realistic weakly interacting massive particle direct detection experiments. II. 2D readout

    NASA Astrophysics Data System (ADS)

    Morgan, Ben; Green, Anne M.


    The direction dependence of the WIMP direct detection rate provides a powerful tool for distinguishing a WIMP signal from possible backgrounds. We study the number of events required to discriminate a WIMP signal from an isotropic background for a detector with 2-d readout using nonparametric circular statistics. We also examine the number of events needed to (i) detect a deviation from rotational symmetry, due to flattening of the Milky Way halo and (ii) detect a deviation in the mean direction due to a tidal stream. If the senses of the recoils are measured then of order 20--70 events (depending on the plane of the 2-d readout and the detector location) will be sufficient to reject isotropy of the raw recoil angles at 90% confidence. If the senses can not be measured these number increase by roughly 2 orders of magnitude (compared with an increase of 1 order of magnitude for the case of full 3-d readout). The distributions of the reduced angles, with the (time-dependent) direction of solar motion subtracted, are far more anisotropic, however, and if the isotropy tests are applied to these angles then the numbers of events required are similar to the case of 3-d readout. A deviation from rotational symmetry will only be detectable if the Milky Way halo is significantly flattened. The deviation in the mean direction due to a tidal stream is potentially detectable, however, depending on the density and direction of the stream. The meridian plane (which contains the Earth’s spin axis) is, for all detector locations, the optimum readout plane for rejecting isotropy. However readout in this plane can not be used for detecting flattening of the Milky Way halo or a stream with direction perpendicular to the galactic plane. In these cases the optimum readout plane depends on the detector location.

  4. Analysis of the theoretical bias in dark matter direct detection

    SciTech Connect

    Catena, Riccardo


    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias.

  5. Comparison of direct and heterodyne detection optical intersatellite communication links

    NASA Technical Reports Server (NTRS)

    Chen, C. C.; Gardner, C. S.


    The performance of direct and heterodyne detection optical intersatellite communication links are evaluated and compared. It is shown that the performance of optical links is very sensitive to the pointing and tracking errors at the transmitter and receiver. In the presence of random pointing and tracking errors, optimal antenna gains exist that will minimize the required transmitter power. In addition to limiting the antenna gains, random pointing and tracking errors also impose a power penalty in the link budget. This power penalty is between 1.6 to 3 dB for a direct detection QPPM link, and 3 to 5 dB for a heterodyne QFSK system. For the heterodyne systems, the carrier phase noise presents another major factor of performance degradation that must be considered. In contrast, the loss due to synchronization error is small. The link budgets for direct and heterodyne detection systems are evaluated. It is shown that, for systems with large pointing and tracking errors, the link budget is dominated by the spatial tracking error, and the direct detection system shows a superior performance because it is less sensitive to the spatial tracking error. On the other hand, for systems with small pointing and tracking jitters, the antenna gains are in general limited by the launch cost, and suboptimal antenna gains are often used in practice. In which case, the heterodyne system has a slightly higher power margin because of higher receiver sensitivity.

  6. Channel simulation for direct-detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.


    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct-detection optical communication system. The system is capable of providing signal fading statistics which obey log-normal, beta, Rayleigh, Ricean, or chi-square density functions. Experimental tests of the performance of the channel simulator are presented.

  7. Halo-Independent Comparison of Direct Dark Matter Detection Data


    Del Nobile, Eugenio


    We review the halo-independent formalism that allows comparing data from different direct dark matter detection experiments without making assumptions on the properties of the dark matter halo. We apply this method to spin-independent WIMP-nuclei interactions, for both isospin-conserving and isospin-violating couplings, and to WIMPs interacting through an anomalous magnetic moment.

  8. Channel simulation for direct detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.


    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct detection optical communication system. The system is capable of providing signal fading statistics which obey log normal, beta, Rayleigh, Ricean or chi-squared density functions. Experimental tests of the performance of the Channel Simulator are presented.

  9. Directed energy active illumination for near-Earth object detection

    NASA Astrophysics Data System (ADS)

    Riley, Jordan; Lubin, Philip; Hughes, Gary B.; O'Neill, Hugh; Meinhold, Peter; Suen, Jonathan; Bible, Johanna; Johansson, Isabella E.; Griswold, Janelle; Cook, Brianna


    On 15 February 2013, a previously unknown ~20 m asteroid struck Earth near Chelyabinsk, Russia, releasing kinetic energy equivalent to ~570 kt TNT. Detecting objects like the Chelyabinsk impactor that are orbiting near Earth is a difficult task, in part because such objects spend much of their own orbits in the direction of the Sun when viewed from Earth. Efforts aimed at protecting Earth from future impacts will rely heavily on continued discovery. Ground-based optical observatory networks and Earth-orbiting spacecraft with infrared sensors have dramatically increased the pace of discovery. Still, less than 5% of near-Earth objects (NEOs) >=100 m/~100 Mt TNT have been identified, and the proportion of known objects decreases rapidly for smaller sizes. Low emissivity of some objects also makes detection by passive sensors difficult. A proposed orbiting laser phased array directed energy system could be used for active illumination of NEOs, enhancing discovery particularly for smaller and lower emissivity objects. Laser fiber amplifiers emit very narrow-band energy, simplifying detection. Results of simulated illumination scenarios are presented based on an orbiting emitter array with specified characteristics. Simulations indicate that return signals from small and low emissivity objects is strong enough to detect. The possibility for both directed and full sky blind surveys is discussed, and the resulting diameter and mass limits for objects in different observational scenarios. The ability to determine both position and speed of detected objects is also discussed.

  10. Detection of Laser Optic Defects Using Gradient Direction Matching

    SciTech Connect

    Chen, B Y; Kegelmeyer, L M; Liebman, J A; Salmon, J T; Tzeng, J; Paglieroni, D W


    That National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) will be the world's largest and most energetic laser. It has thousands of optics and depends heavily on the quality and performance of these optics. Over the past several years, we have developed the NIF Optics Inspection Analysis System that automatically finds defects in a specific optic by analyzing images taken of that optic. This paper describes a new and complementary approach for the automatic detection of defects based on detecting the diffraction ring patterns in downstream optic images caused by defects in upstream optics. Our approach applies a robust pattern matching algorithm for images called Gradient Direction Matching (GDM). GDM compares the gradient directions (the direction of flow from dark to light) of pixels in a test image to those of a specified model and identifies regions in the test image whose gradient directions are most in line with those of the specified model. For finding rings, we use luminance disk models whose pixels have gradient directions all pointing toward the center of the disk. After GDM identifies potential rings locations, we rank these rings by how well they fit the theoretical diffraction ring pattern equation. We perform false alarm mitigation by throwing out rings of low fit. A byproduct of this fitting procedure is an estimate of the size of the defect and its distance from the image plane. We demonstrate the potential effectiveness of this approach by showing examples of rings detected in real images of NIF optics.

  11. Eco-friendly plasmonic sensors: using the photothermal effect to prepare metal nanoparticle-containing test papers for highly sensitive colorimetric detection.


    Tseng, Shao-Chin; Yu, Chen-Chieh; Wan, Dehui; Chen, Hsuen-Li; Wang, Lon Alex; Wu, Ming-Chung; Su, Wei-Fang; Han, Hsieh-Cheng; Chen, Li-Chyong


    Convenient, rapid, and accurate detection of chemical and biomolecules would be a great benefit to medical, pharmaceutical, and environmental sciences. Many chemical and biosensors based on metal nanoparticles (NPs) have been developed. However, as a result of the inconvenience and complexity of most of the current preparation techniques, surface plasmon-based test papers are not as common as, for example, litmus paper, which finds daily use. In this paper, we propose a convenient and practical technique, based on the photothermal effect, to fabricate the plasmonic test paper. This technique is superior to other reported methods for its rapid fabrication time (a few seconds), large-area throughput, selectivity in the positioning of the NPs, and the capability of preparing NP arrays in high density on various paper substrates. In addition to their low cost, portability, flexibility, and biodegradability, plasmonic test paper can be burned after detecting contagious biomolecules, making them safe and eco-friendly.

  12. Direct Detection of Sub-GeV Dark Matter

    SciTech Connect

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer


    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  13. Gold nanoparticle-based simple colorimetric and ultrasensitive dynamic light scattering assay for the selective detection of Pb(II) from paints, plastics, and water samples.


    Beqa, Lule; Singh, Anant Kumar; Khan, Sadia Afrin; Senapati, Dulal; Arumugam, Sri Ranjini; Ray, Paresh Chandra


    Pb (II) is a common water pollutant with high toxicity. According to the CDC, about 310,000 U.S. children of ages 1-5 have high levels of lead in their blood that it is due to the exposure to lead from plastic toys and other products. As a result, the development of ultrasensitive assays for the real-time detection of Pb(II) from plastic toys and paints is very important for water controlling, clinical toxicology and industrial processes. Driven by the need to detect trace amounts of Pb(II) from water samples, we report a label-free, highly selective and ultra sensitive glutathione modified gold nanoparticle based dynamic light scattering (DLS) probe for Pb(II) recognition in 100 ppt level from aqueous solution with excellent discrimination against other heavy metals. The sensitivity of our assay to detect Pb(II) level in water is almost 2 orders of magnitude higher than the EPA standard limit. We have also demonstrated that our DLS assay is capable of measuring the amount of Pb(II) in paint, plastic toys, and water from MS river. A possible mechanism and operating principles of our DLS assay have been discussed. Ultimately, this nanotechnology driven assay could have enormous potential applications in rapid, on-site monitoring of Pb(II) from day-to-day sample.

  14. Rapid onsite detection of bacterial spores of biothreat importance by paper-based colorimetric method using erbium-pyrocatechol violet complex.


    Shivakiran, M S; Venkataramana, M; Lakshmana Rao, P V


    Dipicolinic acid (DPA) is an important chemical marker for the detection of bacterial spores. In this study, complexes of lanthanide series elements such as erbium, europium, neodymium, and terbium were prepared with pyrocatechol violet and effectively immobilized the pyrocatechol violet (PV)-metal complex on a filter paper using polyvinyl alcohol. These filter paper strips were employed for the onsite detection of bacterial spores. The test filter papers were evaluated quantitatively with different concentrations of DPA and spores of various bacteria. Among the four lanthanide ions, erbium displayed better sensitivity than the other ions. The limit of detection of this test for DPA was 60 μM and 5 × 10(6) spores. The effect of other non-spore-forming bacteria and interfering chemicals on the test strips was also evaluated. The non-spore-forming bacteria did not have considerable effect on the test strip whereas chemicals such as EDTA had significant effects on the test results. The present test is rapid and robust, capable of providing timely results for better judgement to save resources on unnecessary decontamination procedures during false alarms.

  15. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo


    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  16. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo


    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  17. Direct Fast-Neutron Detection: A Progress Report

    SciTech Connect

    AJ Peurrung; DC Stromswold; PL Reeder; RR Hansen


    It is widely acknowledged that Mure neutron-detection technologies will need to offer increased performance at lower cost. One clear route toward these goals is rapid and direct detection of fast neutrons prior to moderation. This report describes progress to date in an effort to achieve such neutron detection via proton recoil within plastic scintillator. Since recording proton-recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the substantial difference in the speed of fission neutrons and gamma-ray photons. Should this effort ultimately prove successful, the resulting. technology would make a valuable contribution toward meeting the neutron-detection needs of the next century. This report describes the detailed investigations that have been part of Pacific Northwest National Laborato@s efforts to demonstrate direct fast-neutron detection in the laboratory. Our initial approach used a single, solid piece of scintillator along with the electronics needed for pulse-type differentiation. Work to date has led to the conclusion that faster scintillator and/or faster electronics will be necessary before satisfactory gamma-ray discrimination is achieved with this approach. Acquisition and testing of both faster scintillator and faster electronics are currently in progress. The "advanced" approach to direct fast-neutron detection uses a scintillating assembly with an overall density that is lower than that of ordinary plastic scintillator. The lower average density leads to longer interaction times for both neutrons and gamma rays, allowing easier discrimination. The modeling, optimization, and design of detection systems using this approach are described in detail.

  18. Selective turn-off phosphorescent and colorimetric detection of mercury(II) in water by half-lantern platinum(II) complexes.


    Sicilia, Violeta; Borja, Pilar; Baya, Miguel; Casas, José M


    The platinum(ii) half-lantern dinuclear complexes [{Pt(bzq)(μ-C7H4NS2-κN,S)}2] () and [{Pt(bzq)(μ-C7H4NOS-κN,S)}2] () [bzq = benzo[h]quinolinate, C7H4NS2 = 2-mercaptobenzothiazolate, C7H4NOS = 2-mercaptobenzoxazolate] in solution of DMSO-H2O undergo a dramatic color change from yellowish-orange to purple and turn-off phosphorescence in the presence of a small amount of Hg(2+), being discernible by the naked-eye and by spectroscopic methods. Other metal ions as Ag(+), Li(+), Na(+), K(+), Ca(2+), Mg(2+), Ba(2+), Pb(2+), Cd(2+), Zn(2+) and Tl(+) were tested and, even in a big excess, showed no interference in the selective detection of Hg(2+) in water. Job's plot analysis indicated a 1 : 1 stoichiometry in the complexation mode of Hg(2+) by /. The phosphorescence quenching attributed to the formation of [/ : Hg(2+)] complexes showed binding constants of K = 1.13 × 10(5) M(-1) () and K = 1.99 × 10(4) M(-1) (). The limit of detection has been also evaluated. In addition, dried paper test strips impregnated in DMSO solutions of and can detect concentration of Hg(2+) in water as low as 1 × 10(-5) M for and 5 × 10(-5) M for , making these complexes good candidates to be used as real-time Hg(2+) detectors. The nature of the interaction of the Pt2 half-lantern complex with the Hg(2+) cation, has been investigated by theoretical calculations.

  19. Colorimetric Solid-Phase Extractor

    NASA Technical Reports Server (NTRS)


    The heart of a colorimetric solid phase extractor (CSPE) test kit quickly measures the concentration of the biocides silver or iodine in astronauts' drinking water to determine whether concentrations are safe. When 10 milliliters (ml) of water is drawn through the disk, the disk will turn color (yellow in this picture for iodine) indicating the presence of the biocides. The device could someday be used to test water safety at reservoirs and water treatment plants on Earth. (photo credit: Microanalytical Instrumentation Center, Iowa State University).

  20. Simple colorimetric method determines uranium in tissue

    NASA Technical Reports Server (NTRS)

    Doran, D.; Frigerio, N. A.


    Simple colorimetric micromethod determines concentrations of uranium in tissue. The method involves dry ashing organic extraction, and colorimetric determination of uranyl ferrocyanide. This uranium determination technique could be used in agricultural research, tracer studies, testing of food products, or medical research.

  1. A novel colorimetric and turn-on fluorescent chemosensor for iron(III) ion detection and its application to cellular imaging

    NASA Astrophysics Data System (ADS)

    Luo, Aoheng; Wang, Hongqing; Wang, Yuyuan; Huang, Qiao; Zhang, Qin


    A novel rhodamine-based dual probe Rh-2 for trivalent ferric ions (Fe3 +) was successfully designed and synthesized, which exhibited a highly sensitive and selective recognition towards Fe3 + with an enhanced fluorescence emission in methanol-water media (v/v = 7/3, pH = 7.2). The probe Rh-2 could be applied to the determination of Fe3 + with a linear range covering from 3.0 × 10- 7 to 1.4 × 10- 5 M and a detection limit of 1.24 × 10- 8 M. Meanwhile, the binding ratio of Rh-2 and Fe3 + was found to be 1:1. Most importantly, the fluorescence and color signal changes of the Rh-2 solution were specific to Fe3 + over other commonly coexistent metal ions. Moreover, the probe Rh-2 has been used to image Fe3 + in living cells with satisfying results.

  2. Highly selective colorimetric detection and preconcentration of Bi(III) ions by dithizone complexes anchored onto mesoporous TiO2

    NASA Astrophysics Data System (ADS)

    Faisal, Mohd; Ismail, Adel A.; Harraz, Farid A.; Bouzid, Houcine; Al-Sayari, Saleh A.; Al-Hajry, Ali


    We successfully developed a single-step detection and removal unit for Bi(III) ions based on dithizone (DZ) anchored on mesoporous TiO2 with rapid colorometric response and high selectivity for the first time. [(DZ)3-Bi] complex is easily separated and collected by mesoporous TiO2 as adsorbent and preconcentrator without any color change of the produced complex onto the surface of mesoporous TiO2 (TiO2-[(DZ)3-Bi]) at different Bi(III) concentrations. This is because highly potent mesoporous TiO2 architecture provides proficient channeling or movement of Bi(III) ions for efficient binding of metal ion, and the simultaneous excellent adsorbing nature of mesoporous TiO2 provides an extra plane for the removal of metal ions.

  3. Self-assembly of graphene oxide with a silyl-appended spiropyran dye for rapid and sensitive colorimetric detection of fluoride ions.


    Li, Yinhui; Duan, Yu; Zheng, Jing; Li, Jishan; Zhao, Wenjie; Yang, Sheng; Yang, Ronghua


    Fluoride ion (F(-)), the smallest anion, exhibits considerable significance in a wide range of environmental and biochemical processes. To address the two fundamental and unsolved issues of current F(-) sensors based on the specific chemical reaction (i.e., the long response time and low sensitivity) and as a part of our ongoing interest in the spiropyran sensor design, we reported here a new F(-) sensing approach that, via assembly of a F(-)-specific silyl-appended spiropyran dye with graphene oxide (GO), allows rapid and sensitive detection of F(-) in aqueous solution. 6-(tert-Butyldimethylsilyloxy)-1',3',3'-trimethylspiro [chromene- 2,2'-indoline] (SPS), a spiropyran-based silylated dye with a unique reaction activity for F(-), was designed and synthesized. The nucleophilic substitution reaction between SPS and F(-) triggers cleavage of the Si-O bond to promote the closed spiropyran to convert to its opened merocyanine form, leading to the color changing from colorless to orange-yellow with good selectivity over other anions. With the aid of GO, the response time of SPS for F(-) was shortened from 180 to 30 min, and the detection limit was lowered more than 1 order of magnitude compared to the free SPS. Furthermore, due to the protective effect of nanomaterials, the SPS/GO nanocomposite can function in a complex biological environment. The SPS/GO nanocomposite was characterized by XPS and AFM, etc., and the mechanism for sensing F(-) was studied by (1)H NMR and ESI-MS. Finally, this SPS/GO nanocomposite was successfully applied to monitoring F(-) in the serum.

  4. Spaceborne Simulations of Two Direct-Detection Doppler Lidar Techniques

    NASA Technical Reports Server (NTRS)

    McGill, Matthew J.; Li, Steve X.


    Direct-detection (or incoherent) lidar is now a proven technique for measuring winds in the atmosphere. Over the last few years, several types of direct-detection lidar have evolved. These methods rely on Fabry-Perot interferometers(also termed etalons) or other narrow-passband filters to provide the required spectral resolution. One method, now called the edge (EDG) technique, uses a sharply-sloping filter and measures changes in the filter transmission caused by Doppler shifting of the laser wavelength. A variation of the EDG method, called the double-edge (DEDG) technique, uses two filters. The molecular DEDG method was first demonstrated by Chanin et al. for stratospheric measurements and more recently Korb et al. successfully demonstrated the aerosol DEDG through the troposphere. A second method, here termed the multi-channel (MC) technique, measures Doppler shifts by observing angular displacement of a Fabry-Perot fringe in a spatially resolving detector. The EDG technique thus employs the Fabry-Perot to convert the frequency shift into an amplitude signal, while the MC technique uses the Fabry-Perot to resolve the spectral signature which is then fitted to determine the centroid. The focus of this presentation is on the DEDG and MC methods because these are viewed as the current state of the art in direct-detection lidar. Successful ground-based demonstrations of direct-detection wind measurements have resulted in proposals for spaceborne systems. With this new emphasis on spaceborne systems comes the need for accurate prediction of spaceborne direct-detection Doppler lidar performance. Previously, the EDG and MC methods have been compared although only for aerosol Doppler systems. A recent paper by McGill and Spinhirne compares the DEDG and MC methods in a non-system specific manner for both the aerosol and molecular Doppler systems. The purpose of this presentation is to extend the previous work of McGill and Spinhirne to examine the performance of

  5. Future directions for H sub x O sub y detection

    NASA Technical Reports Server (NTRS)

    Crosley, David R. (Editor); Hoell, James M. (Editor)


    The activities and recommendations of the NASA workshop on the Future Directions for H sub x O sub y detection are given. The objective of this workshop was to access future directions for the measurement of the OH radical as well as other H sub x O sub y species. The workshop discussions were focused by two broad questions: (1) What are the capabilities of potential measurement methods? and (2) Will the results from the most promising method be useful in furthering understanding of tropospheric chemistry?

  6. Thermal and optical characterization of biologically synthesized ZnS nanoparticles synthesized from an endophytic fungus Aspergillus flavus: A colorimetric probe in metal detection

    NASA Astrophysics Data System (ADS)

    Uddandarao, Priyanka; Balakrishnan, Raj Mohan


    Nanostructured semiconductor materials are of great importance for several technological applications due to their optical and thermal properties. The design and fabrication of metal sulfide nanoparticles with tunable properties for advanced applications have drawn a great deal of attention in the field of nanotechnology. ZnS is a potential II-IV group material which is used in hetero-junction solar cells, light emitting diodes, optoelectronic devices, electro luminescent devices and photovoltaic cells. Due to their multiple applications, there is a need to elucidate their thermal and optical properties. In the present study, thermal and optical properties of biologically synthesized ZnS nanoparticles are determined in detail with Thermal Gravimetric Analysis (TGA), Derivative Thermogravimetric Analysis (DTG), Differential Scanning Calorimeter (DSC), Diffuse Reflectance Spectroscopy (DRS), Photoluminescence (PL) and Raman spectroscopy. The results reveal that ZnS NPs exhibit a very strong quantum confinement with a significant increase in their optical band gap energy. These biologically synthesized ZnS NPs contain protein residues that can selectively bind with metal ions in aqueous solutions and can exhibit an aggregation-induced color change. This phenomenon is utilized to quantitatively measure the metal concentrations of Cu2 + and Mn2 + in this study. Further the stability of nanoparticles for the metal sensing process is accessed by UV-Vis spectrometer, zeta potential and cyclic voltammeter. The selectivity and sensitivity of ZnS NPs indicate its potential use as a sensor for metal detection in the ecosystem.

  7. Dispersive liquid-liquid microextraction coupled with digital image colorimetric analysis for detection of total iron in water and food samples.


    Peng, Bo; Chen, Guorong; Li, Kai; Zhou, Min; Zhang, Ji; Zhao, Shengguo


    A simple and low cost assay for total iron in various samples based on dispersive liquid-liquid microextraction (DLLME) coupled with digital scanning image analysis was proposed. Orthogonal experiment design was utilized to optimize the amount of extraction solvent and disperser solvent, O-phenanthroline concentration and buffer pH. Under the optimum conditions, the calibration curve was linear over the range of 0.047-1.0μgmL(-1) (R(2)>0.99) of iron. The limit of detection (LOD) for iron was 14.1μgL(-1) and limit of quantification (LOQ) was 46.5μgL(-1). The relative standard deviations for seven replicate determinations of 0.5μgmL(-1) of iron was 3.75%. The method was successfully applied for analysis of total iron in water and food samples without using any spectral instrument and it could have a potential industrial impact in developing fast and portable devices to analyze the iron content in water and certain foods.

  8. Dark matter effective field theory scattering in direct detection experiments


    Schneck, K.


    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implicationsmore » of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.« less

  9. Directional detection of dark matter in universal bound states

    SciTech Connect

    Laha, Ranjan


    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angular recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.

  10. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.


    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  11. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.


    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  12. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.


    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  13. An Automated Directed Spectral Search Methodology for Small Target Detection

    NASA Astrophysics Data System (ADS)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  14. A colorimetric assay for the determination of acetyl xylan esterase or cephalosporin C acetyl esterase activities using 7-amino cephalosporanic acid, cephalosporin C, or acetylated xylan as substrate.


    Martínez-Martínez, Irene; Montoro-García, Silvia; Lozada-Ramírez, José Daniel; Sánchez-Ferrer, Alvaro; García-Carmona, Francisco


    A bromothymol blue-based colorimetric assay has been devised to screen for acetyl xylan esterase or cephalosporin C (CPC) deacetylase activities using 7-amino cephalosporanic acid (7-ACA), CPC, or acetylated xylan as substrate. These enzymes are not screened with their natural substrates because of the tedious procedures available previously. Acetyl xylan esterase from Bacillus pumilus CECT 5072 was cloned, expressed in Escherichia coli Rosetta (DE3), and characterized using this assay. Similar K(M) values for 7-ACA and CPC were obtained when compared with those described using HPLC methods. The assay is easy to perform and can be carried out in robotic high-throughput colorimetric devices normally used in directed evolution experiments. The assay allowed us to detect improvements in activity at a minimum of twofold with a very low coefficient of variance in 96-well plates. This method is significantly faster and more convenient to use than are known HPLC and pH-stat procedures.

  15. Dual channel sensor for detection and discrimination of heavy metal ions based on colorimetric and fluorescence response of the AuNPs-DNA conjugates.


    Tan, Lulu; Chen, Zhengbo; Zhao, Yan; Wei, Xiangcong; Li, Yonghui; Zhang, Chi; Wei, Xinling; Hu, Xiaochen


    We have presented an extensible, facile and sensitive multidimensional sensor based on DNA-gold nanoparticle (DNA-AuNP) conjugates for heavy metal ions (Ag(+), Hg(2+), Cr(3+), Sn(4+), Cd(2+), Cu(2+), Pb(2+), Zn(2+), and Mn(2+)) discrimination. In the presence of metal ions, the excluded effect of DNA and AuNPs with the same negative charges is disrupted, and the amount of FAM-labeled DNA adsorbed on AuNP surfaces increases, resulting in a more obvious fluorescence quenching effect. With the addition of NH2OH and HAuCl4, AuNPs grow into morphologically varied nanostructures (spherical to branched) depending on the resulting aptamer coverage, which gives rise to different colored solutions (reddish blush, purple and blue) observed by naked eyes. By simply changing the DNA sequences, three sensing elements can be easily obtained and added into this dual-channel multidimensional sensor. 9 heavy metal ions are distinguished by linear discriminant analysis (LDA) and primary component analysis (PCA). A highly sensitive discrimination of metal ion targets with the detection limit as low as 50nM with 100% identification accuracy is obtained. Remarkably, Cu(2+) and Hg(2+) ions with similar catalytic performance at various concentrations (300nM, 400nM, 500nM, respectively) and the mixture of the two metal ions with different volume ratios (total metal ion concentration: 500nM) can be successfully discriminated. In addition, nine heavy metal ions are also well-distinguished in river samples, and the accuracy of discrimination of these metal ions samples reaches 100%. Therefore, it will broaden the application field of DNA-AuNP conjugates-based multidimensional sensors.

  16. A Simple Paper-Based Colorimetric Device for Rapid Mercury(II) Assay

    PubMed Central

    Chen, Weiwei; Fang, Xueen; Li, Hua; Cao, Hongmei; Kong, Jilie


    Contamination of the environment by mercury(II) ions (Hg2+) poses a serious threat to human health and ecosystems. Up to now, many reported Hg2+ sensors require complex procedures, long measurement times and sophisticated instrumentation. We have developed a simple, rapid, low cost and naked-eye quantitative method for Hg2+ environmental analysis using a paper-based colorimetric device (PCD). The sample solution to which platinum nanoparticles (PtNPs) have been added is dispensed to the detection zone on the PCD, where the 3,3,5,5-tetramethylbenzidine (TMB) substrate has been pre-loaded. The PtNPs effect a rapid oxidization of TMB, inducing blue colorization on the PCD. However, Hg2+ in the solution rapidly interact with the PtNPs, suppressing the oxidation capacity and hence causing a decrease in blue intensity, which can be observed directly by the naked eye. Moreover, Hg2+ at concentrations as low as 0.01 uM, can be successfully monitored using a fiber optic device, which gives a digital readout proportional to the intensity of the blue color change. This paper-based colorimetric device (PCD) shows great potential for field measurement of Hg2+. PMID:27554633

  17. Closing supersymmetric resonance regions with direct detection experiments

    SciTech Connect

    Kelso, Chris


    One of the few remaining ways that neutralinos could potentially evade constraints from direct detection experiments is if they annihilate through a resonance, as can occur if 2m{sub χ⁰} falls within about ~10% of either m{sub A/H}, m{sub h}, or m{sub Z}. Assuming a future rate of progress among direct detection experiments that is similar to that obtained over the past decade, we project that within 7 years the light Higgs and Z pole regions will be entirely closed, while the remaining parameter space near the A/H resonance will require that 2m{sub χ₀} be matched to the central value (near m{sub A}) to within less than 4%. At this rate of progress, it will be a little over a decade before multi-ton direct detection experiments will be able to close the remaining, highly-tuned, regions of the A/H resonance parameter space.

  18. Direct detection of classically undetectable dark matter through quantum decoherence

    NASA Astrophysics Data System (ADS)

    Riedel, C. Jess


    Although various pieces of indirect evidence about the nature of dark matter have been collected, its direct detection has eluded experimental searches despite extensive effort. If the mass of dark matter is below 1 MeV, it is essentially imperceptible to conventional detection methods because negligible energy is transferred to nuclei during collisions. Here I propose directly detecting dark matter through the quantum decoherence it causes rather than its classical effects such as recoil or ionization. I show that quantum spatial superpositions are sensitive to low-mass dark matter which is inaccessible to classical techniques. This provides new independent motivation for matter interferometry with large masses, especially on spaceborne platforms. The apparent dark matter wind we experience as the Sun travels through the Milky Way ensures interferometers and related devices are directional detectors, and so are able to provide unmistakable evidence that decoherence has galactic origins. This research was partially supported by the U.S. Department of Energy through the LANL/LDRD program, and by the John Templeton Foundation through grant number 21484.

  19. Physics from solar neutrinos in dark matter direct detection experiments

    NASA Astrophysics Data System (ADS)

    Cerdeño, David G.; Fairbairn, Malcolm; Jubb, Thomas; Machado, Pedro A. N.; Vincent, Aaron C.; Bœhm, Céline


    The next generation of dark matter direct detection experiments will be sensitive to both coherent neutrino-nucleus and neutrino-electron scattering. This will enable them to explore aspects of solar physics, perform the lowest energy measurement of the weak angle sin2 θ W to date, and probe contributions from new theories with light mediators. In this article, we compute the projected nuclear and electron recoil rates expected in several dark matter direct detection experiments due to solar neutrinos, and use these estimates to quantify errors on future measurements of the neutrino fluxes, weak mixing angle and solar observables, as well as to constrain new physics in the neutrino sector. Our analysis shows that the combined rates of solar neutrino events in second generation experiments (SuperCDMS and LZ) can yield a measurement of the pp flux to 2.5% accuracy via electron recoil, and slightly improve the 8B flux determination. Assuming a low-mass argon phase, projected tonne-scale experiments like DARWIN can reduce the uncertainty on both the pp and boron-8 neutrino fluxes to below 1%. Finally, we use current results from LUX, SuperCDMS and CDMSlite to set bounds on new interactions between neutrinos and electrons or nuclei, and show that future direct detection experiments can be used to set complementary constraints on the parameter space associated with light mediators.

  20. Dark matter direct detection with non-Maxwellian velocity structure

    SciTech Connect

    Kuhlen, Michael; Weiner, Neal; Diemand, Jürg; Moore, Ben; Potter, Doug; Stadel, Joachim; Madau, Piero; Zemp, Marcel E-mail: E-mail: E-mail: E-mail:


    The velocity distribution function of dark matter particles is expected to show significant departures from a Maxwell-Boltzmann distribution. This can have profound effects on the predicted dark matter - nucleon scattering rates in direct detection experiments, especially for dark matter models in which the scattering is sensitive to the high velocity tail of the distribution, such as inelastic dark matter (iDM) or light (few GeV) dark matter (LDM), and for experiments that require high energy recoil events, such as many directionally sensitive experiments. Here we determine the velocity distribution functions from two of the highest resolution numerical simulations of Galactic dark matter structure (Via Lactea II and GHALO), and study the effects for these scenarios. For directional detection, we find that the observed departures from Maxwell-Boltzmann increase the contrast of the signal and change the typical direction of incoming DM particles. For iDM, the expected signals at direct detection experiments are changed dramatically: the annual modulation can be enhanced by more than a factor two, and the relative rates of DAMA compared to CDMS can change by an order of magnitude, while those compared to CRESST can change by a factor of two. The spectrum of the signal can also change dramatically, with many features arising due to substructure. For LDM the spectral effects are smaller, but changes do arise that improve the compatibility with existing experiments. We find that the phase of the modulation can depend upon energy, which would help discriminate against background should it be found.

  1. Direct Real-Time Detection of Vapors from Explosive Compounds

    SciTech Connect

    Ewing, Robert G.; Clowers, Brian H.; Atkinson, David A.


    The real-time detection of vapors from low volatility explosives including PETN, tetryl, RDX and nitroglycerine along with various compositions containing these substances is demonstrated. This was accomplished with an atmospheric flow tube (AFT) using a non-radioactive ionization source and coupled to a mass spectrometer. Direct vapor detection was demonstrated in less than 5 seconds at ambient temperature without sample pre-concentration. The several seconds of residence time of analytes in the AFT provides a significant opportunity for reactant ions to interact with analyte vapors to achieve ionization. This extended reaction time, combined with the selective ionization using the nitrate reactant ions (NO3- and NO3-•HNO3), enables highly sensitive explosives detection. Observed signals from diluted explosive vapors indicate detection limits below 10 ppqv using selected ion monitoring (SIM) of the explosive-nitrate adduct at m/z 349, 378, 284 and 289 for tetryl, PETN, RDX and NG respectively. Also provided is a demonstration of the vapor detection from 10 different energetic formulations, including double base propellants, plastic explosives and commercial blasting explosives using SIM for the NG, PETN and RDX product ions.

  2. Clustering and community detection in directed networks: A survey

    NASA Astrophysics Data System (ADS)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis


    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  3. Monthly modulation in dark matter direct-detection experiments

    SciTech Connect

    Britto, Vivian; Meyers, Joel E-mail:


    The signals in dark matter direct-detection experiments should exhibit modulation signatures due to the Earth's motion with respect to the Galactic dark matter halo. The annual and daily modulations, due to the Earth's revolution about the Sun and rotation about its own axis, have been explored previously. Monthly modulation is another such feature present in direct detection signals, and provides a nearly model-independent method of distinguishing dark matter signal events from background. We study here monthly modulations in detail for both WIMP and WISP dark matter searches, examining both the effect of the motion of the Earth about the Earth-Moon barycenter and the gravitational focusing due to the Moon. For WIMP searches, we calculate the monthly modulation of the count rate and show the effects are too small to be observed in the foreseeable future. For WISP dark matter experiments, we show that the photons generated by WISP to photon conversion have frequencies which undergo a monthly modulating shift which is detectable with current technology and which cannot in general be neglected in high resolution WISP searches.

  4. Direct and indirect detection of dissipative dark matter

    SciTech Connect

    Fan, JiJi; Katz, Andrey; Shelton, Jessie E-mail:


    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints.

  5. Direct mass spectrometric detection of trace explosives in soil samples.


    Ma, Lipo; Xin, Bin; Chen, Yi


    The detection of explosives in soil is of great significance in public security programmes and environmental science. In the present work, a ppb-level method was established to directly detect the semi-volatile explosives, RDX and TNT, present in complex soil samples. The method used thermal sampling technique and a direct current atmospheric pressure glow discharge source mounted with a brass cylinder electrode (9 mm × 4.6 mm i.d./5.6 mm o.d.) to face the samples, requiring no sample pretreatment steps such as soil extraction (about ten hours). It was characterized by the merits of easy operation, high sensitivity and fast speed, and has been validated by real soil samples from various locations around a factory or firecracker releasing fields. It took only 5 min per sample, with the limit of detection down to 0.5 ppb (S/N = 3) trinitrohexahydro-1,3,5-triazine in soils heated at 170 °C. It is also extendable to the analysis of other volatile analytes.

  6. Simple Colorimetric Sensor for Trinitrotoluene Testing

    NASA Astrophysics Data System (ADS)

    Samanman, S.; Masoh, N.; Salah, Y.; Srisawat, S.; Wattanayon, R.; Wangsirikul, P.; Phumivanichakit, K.


    A simple operating colorimetric sensor for trinitrotoluene (TNT) determination using a commercial scanner as a captured image was designed. The sensor is based on the chemical reaction between TNT and sodium hydroxide reagent to produce the color change within 96 well plates, which observed finally, recorded using a commercial scanner. The intensity of the color change increased with increase in TNT concentration and could easily quantify the concentration of TNT by digital image analysis using the Image J free software. Under optimum conditions, the sensor provided a linear dynamic range between 0.20 and 1.00 mg mL-1(r = 0.9921) with a limit of detection of 0.10± 0.01 mg mL-1. The relative standard deviation for eight experiments for the sensitivity was 3.8%. When applied for the analysis of TNT in two soil extract samples, the concentrations were found to be non-detectable to 0.26±0.04 mg mL-1. The obtained recovery values (93-95%) were acceptable for soil samples tested.

  7. Direct detection of alpha synuclein oligomers in vivo

    PubMed Central


    Background Rat models of Parkinson’s disease are widely used to elucidate the mechanisms underlying disease etiology or to investigate therapeutic approaches. Models were developed using toxins such as MPTP or 6-OHDA to specifically target dopaminergic neurons resulting in acute neuronal loss in the substantia nigra or by using viral vectors to induce the specific and gradual expression of alpha synuclein in the substantia nigra. The detection of alpha- synuclein oligomers, the presumed toxic species, in these models and others has been possible using only indirect biochemical approaches to date. Here we coinjected AAVs encoding alpha-synuclein fused to the N- or C-terminal half of VenusYFP in rat substantia nigra pars compacta and describe for the first time a novel viral vector rodent model with the unique ability to directly detect and track alpha synuclein oligomers ex vivo and in vivo. Results Viral coinjection resulted in widespread VenusYFP signal within the nigrostriatal pathway, including cell bodies in the substantia nigra and synaptic accumulation in striatal terminals, suggestive of in vivo alpha-synuclein oligomers formation. Transduced rats showed alpha-synuclein induced dopaminergic neuron loss in the substantia nigra, the appearance of dystrophic neurites, and gliosis in the striatum. Moreover, we have applied in vivo imaging techniques in the living mouse to directly image alpha-synuclein oligomers in the cortex. Conclusion We have developed a unique animal model that provides a tool for the Parkinson’s disease research community with which to directly detect alpha- synuclein oligomers in vivo and screen therapeutic approaches targeting alpha-synuclein oligomers. PMID:24252244

  8. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength

    PubMed Central

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide


    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology. PMID:24694515

  9. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength.


    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide


    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology.

  10. Magnetic eigenmaps for community detection in directed networks

    NASA Astrophysics Data System (ADS)

    Fanuel, Michaël; Alaíz, Carlos M.; Suykens, Johan A. K.


    Communities in directed networks have often been characterized as regions with a high density of links, or as sets of nodes with certain patterns of connection. Our approach for community detection combines the optimization of a quality function and a spectral clustering of a deformation of the combinatorial Laplacian, the so-called magnetic Laplacian. The eigenfunctions of the magnetic Laplacian, which we call magnetic eigenmaps, incorporate structural information. Hence, using the magnetic eigenmaps, dense communities including directed cycles can be revealed as well as "role" communities in networks with a running flow, usually discovered thanks to mixture models. Furthermore, in the spirit of the Markov stability method, an approach for studying communities at different energy levels in the network is put forward, based on a quantum mechanical system at finite temperature.

  11. Direct/indirect detection signatures of nonthermally produced dark matter

    SciTech Connect

    Nagai, Minoru; Nakayama, Kazunori


    We study direct and indirect detection possibilities of neutralino dark matter produced nonthermally by, e.g., the decay of long-lived particles, as is easily implemented in the case of anomaly or mirage-mediation models. In this scenario, large self-annihilation cross sections are required to account for the present dark matter abundance, and it leads to significant enhancement of the gamma-ray signature from the galactic center and the positron flux from the dark matter annihilation. It is found that GLAST and PAMELA will find the signal or give tight constraints on such nonthermal production scenarios of neutralino dark matter.

  12. Direct detection of Vibrio cholerae in stool samples.

    PubMed Central

    Varela, P; Pollevick, G D; Rivas, M; Chinen, I; Binsztein, N; Frasch, A C; Ugalde, R A


    A direct method to detect Vibrio cholerae in stool samples was developed by using a PCR procedure that did not require a DNA purification step. Dilution (1/100) of stool samples prevented inhibition of the reaction by contaminants, and two consecutive PCRs, the second one with a nested primer, achieved the desired sensitivity. Comparison of the results obtained from stool swab samples processed by the two-step PCR and by an enzyme-linked immunosorbent assay using GM1 as the capture molecule showed that the former is more sensitive and gave positive results even when V. cholerae was not culturable or dead. Images PMID:8051251

  13. Functional self-assembling bolaamphiphilic polydiacetylenes as colorimetric sensor scaffolds

    SciTech Connect

    Song, Jie; Cisar, Justin S.; Bertozzi, Carolyn R.


    Conjugated polymers capable of responding to external stimuli by changes in optical, electrical or electrochemical properties can be used for the construction of direct sensing devices. Polydiacetylene-based systems are attractive for sensing applications due to their colorimetric response to changes in the local environment. Here we present the design, preparation and characterization of self-assembling functional bolaamphiphilic polydiacetylenes (BPDAs) inspired by Nature's strategy for membrane stabilization. We show that by placing polar headgroups on both ends of the diacetylene lipids in a transmembranic fashion, and altering the chemical nature of the polar surface residues, the conjugated polymers can be engineered to display a range of radiation-, thermal- and pH-induced colorimetric responses. We observed dramatic nanoscopic morphological transformations accompanying charge-induced chromatic transitions, suggesting that both side chain disordering and main chain rearrangement play important roles in altering the effective conjugation lengths of the poly(ene-yne). These results establish the foundation for further development of BPDA-based colorimetric sensors.

  14. Optimetric system facilitates colorimetric and fluorometric measurements

    NASA Technical Reports Server (NTRS)

    Haley, F. C.


    Compact, unitary optimetric systems uses a single device for colorimetric, fluorometric and spectral absorption measurements. The basic element of the unitary systems is a test cell containing filter elements with uniquely fabricated lenses.

  15. Directional detection of dark matter in universal bound states


    Laha, Ranjan


    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angularmore » recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.« less

  16. Direct detection of the 229Th nuclear clock transition

    NASA Astrophysics Data System (ADS)

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B.; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E.; Trautmann, Norbert G.; Thirolf, Peter G.


    Today’s most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of 229Th (denoted 229mTh). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for 229mTh2+. More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard.

  17. Passive, Direct-Read Monitoring System for Selective Detection and Quantification of Hydrogen Chloride

    NASA Technical Reports Server (NTRS)

    Chapman, K. B.; Mihaylov, G. M.; Kirollos, K. S.


    Monitoring the exposure of an employee to hydrogen chloride or hydrochloric acid in the presence of other acids has been a challenge to the industrial hygiene community. The capability of a device to differentiate the levels of acid vapors would allow for more accurate determinations of exposure and therefore improved occupational health. In this work, a selective direct-read colorimetric badge system was validated for Short Term Exposure Limit (STEL) monitoring of hydrogen chloride. The passive colorimetric badge system consists of a direct reading badge and a color scale. The badge has a coated indicator layer with a diffusive resistance in the shape of an exclamation mark. An exclamation mark will appear if hydrogen chloride is present in the atmosphere at concentrations at or above 2.0 ppm. By using the color scale, the intensity of the color formed on the badge can be further quantified up to 25 ppm. The system was validated according to a protocol based on the NIOSH Protocol for the Evaluation of Passive Monitors. The badge was exposed to relative humidities ranging from 11% to 92%, temperatures ranging from 7 C to 400 C and air velocities ranging from 5 cm/sec to 170 cm/sec. All experiments were conducted in a laboratory vapor generation system. Hydrofluoric acid, nitric acid, sulfuric acid, chlorine, hydrogen sulfide and organic acids showed no effect on the performance of the hydrogen chloride monitoring system. The passive badge and color scale system exceeded the accuracy requirements as defined by NIOSH. At ambient conditions, the mean coefficient of variation was 10.86 and the mean bias was 1.3%. This data was presented previously at the American Industrial Hygiene Conference and Exposition in Toronto, Canada in June 1999.

  18. Development of a novel gamma probe for detecting radiation direction

    NASA Astrophysics Data System (ADS)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.


    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  19. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew


    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}−g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-til-tilde(p{sub R}). The entire family of conventional halo-independent g-tilde(v{sub min}) plots for all DM masses are directly found from the single h-tilde(p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde(p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde(v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  20. Halo-independent direct detection analyses without mass assumptions


    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; ...


    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR),more » the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.« less

  1. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew


    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  2. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew E-mail: E-mail:


    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}− g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-tilde (p{sub R}). The entire family of conventional halo-independent g-tilde (v{sub min}) plots for all DM masses are directly found from the single h-tilde (p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde (p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde (v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  3. Halo-independent direct detection analyses without mass assumptions

    NASA Astrophysics Data System (ADS)

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew


    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ-σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin-tilde g plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g(vmin) plots for all DM masses are directly found from the single tilde h(pR) plot through a simple rescaling of axes. By considering results in tilde h(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g(vmin) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  4. Using known QTLs to detect directional epistatic interactions.


    Slatkin, Montgomery; Kirkpatrick, Mark


    Epistasis plays important roles in evolution, for example in the evolution of recombination, but each of the current methods to study epistasis has limitations. Here, we propose a new strategy. If a quantitative trait locus (QTL) affecting a quantitative character has been identified, individuals who have the same genotype at that QTL can be regarded as comprising a subpopulation whose response to selection depends in part on interactions with other loci affecting the character. We define the marginal differences to be the differences in the average phenotypes of individuals with different genotypes of that QTL. We show that the response of the marginal differences to directional selection on the quantitative character depends on epistatic gene interactions. For a model with no interactions, the marginal differences do not differ on average from their starting values once linkage equilibrium has been re-established. If there is directional epistasis, meaning that interactions between the QTL and other loci tend to increase or decrease the character more than under an additive model, then the marginal differences will tend to increase or decrease accordingly when larger values of the character are selected for. We develop a likelihood ratio test for significant changes in the marginal differences and show that it has some power to detect directional epistasis for realistic sample sizes. We also show that epistatic interactions which affect the evolution of the marginal differences do not necessarily result in a substantial epistatic component of the genetic variance.

  5. Photoacoustic and Colorimetric Visualization of Latent Fingerprints.


    Song, Kai; Huang, Peng; Yi, Chenglin; Ning, Bo; Hu, Song; Nie, Liming; Chen, Xiaoyuan; Nie, Zhihong


    There is a high demand on a simple, rapid, accurate, user-friendly, cost-effective, and nondestructive universal method for latent fingerprint (LFP) detection. Herein, we describe a combination imaging strategy for LFP visualization with high resolution using poly(styrene-alt-maleic anhydride)-b-polystyrene (PSMA-b-PS) functionalized gold nanoparticles (GNPs). This general approach integrates the merits of both colorimetric imaging and photoacoustic imaging. In comparison with the previous methods, our strategy is single-step and does not require the signal amplification by silver staining. The PSMA-b-PS functionalized GNPs have good stability, tunable color, and high affinity for universal secretions (proteins/polypeptides/amino acids), which makes our approach general and flexible for visualizing LFPs on different substrates (presumably with different colors) and from different people. Moreover, the unique optical property of GNPs enables the photoacoustic imaging of GNPs-deposited LFPs with high resolution. This allows observation of level 3 hyperfine features of LFPs such as the pores and ridge contours by photoacoustic imaging. This technique can potentially be used to identify chemicals within LFP residues. We believe that this dual-modality imaging of LFPs will find widespread use in forensic investigations and medical diagnostics.

  6. Tropospheric Wind Profile Measurements with a Direct Detection Doppler Lidar

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce M.; Li, Steven X.; Korb, C. Laurence; Chen, Huailin; Mathur, Savyasachee


    Research has established the importance of global tropospheric wind measurements for large scale improvements in numerical weather prediction. In addition, global wind measurements provide data that are fundamental to the understanding and prediction of global climate change. These tasks are closely linked with the goals of the NASA Earth Science Enterprise and Global Climate Change programs. NASA Goddard has been actively involved in the development of direct detection Doppler lidar methods and technologies to meet the wind observing needs of the atmospheric science community. In this paper we describe a recently developed prototype wind lidar system using a direct detection Doppler technique for measuring wind profiles from the surface through the troposphere. This system uses a pulsed ND:YAG laser operating at 1064 nm as the transmitter. The laser pulse is directed to the atmosphere using a 40 cm diameter scan mirror. The portion of the laser energy backscattered from aerosols and molecules is collected by a 40 cm diameter telescope and coupled via fiber optics into the Doppler receiver. Single photon counting APD's are used to detect the atmospheric backscattered signal. The principle element of the receiver is a dual bandpass tunable Fabry Perot etalon which analyzes the Doppler shift of the incoming laser signal using the double edge technique. The double edge technique uses two high resolution optical filters having bandpasses offset relative to one another such that the 'edge' of the first filter's transmission function crosses that of the second at the half power point. The outgoing laser frequency is located approximately at the crossover point. Due to the opposite going slopes of the edges, a Doppler shift in the atmospheric backscattered laser frequency produces a positive change in signal for one filter and a negative change in the second filter. Taking the ratio of the two edge channel signals yields a result which is directly proportional to the

  7. Gold nanoparticles based colorimetric nanodiagnostics for cancer and infectious diseases

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Persano, Stefano; Cecere, Paola; Sabella, Stefania; Pompa, Pier Paolo


    Traditional in vitro diagnostics requires specialized laboratories and costly instrumentation, both for the amplification of nucleic acid targets (usually achieved by PCR) and for the assay readout, often based on fluorescence. We are developing hybrid nanomaterials-based sensors for the rapid and low-cost diagnosis of various disease biomarkers, for applications in portable platforms for diagnostics at the point-of-care. To this aim, we exploited the size and distancedependent optical properties of gold nanoparticles (AuNPs) to achieve colorimetric detection. Moreover, in order to avoid the complexity of thermal cycles associated to traditional PCR, the design of our systems includes signal amplification schemes, achieved by the use of enzymes (nucleases, helicase) or DNAzymes. Focused on instrument-free and sensitive detection, we carefully combined the intrinsic sensitivity by multivalency of functionalized AuNPs with isothermal and non-stringent enzyme-aided reaction conditions, controlled AuNPs aggregates, universal reporters and magnetic microparticles, the latter used both as a substrate and as a means for the colorimetric detection. We obtained simple and robust assays for the sensitive (pM range or better) naked-eye detection of cancer or infectious diseases (HPV, HCV) biomarkers, requiring no instrumentation except for a simple heating plate. Finally, we are also developing non-medical applications of these bio-nanosensors, such as in the development of on-field rapid tests for the detection of pollutants and other food and water contaminants.

  8. Consequences of statistical sense determination for WIMP directional detection

    NASA Astrophysics Data System (ADS)

    Green, Anne M.; Morgan, Ben


    We study the consequences of limited recoil sense reconstruction on the number of events required to reject isotropy and detect a WIMP signal using a directional detector. For a constant probability of determining the sense correctly, 3-d readout and zero background, we find that as the probability is decreased from 1.0 to 0.75 the number of events required increases by a factor of a few. As the probability is decreased further the number of events increases sharply, and isotropy can be rejected more easily by discarding the sense information and using axial statistics. This however requires an order of magnitude more events than vectorial data with perfect sense determination. We also consider energy dependent probabilities of correctly measuring the sense. Our main finding is that correctly determining the sense of the abundant, but less anisotropic, low energy recoils is most important.

  9. Direct-detection wind lidar operating with a multimode laser.


    Bruneau, Didier; Blouzon, Frédéric; Spatazza, Joseph; Montmessin, Franck; Pelon, Jacques; Faure, Benoît


    A direct-detection wind lidar that operates with a multimode laser has been developed and tested. The instrument exploits the light backscattered by particles using a Mach-Zehnder interferometer with an optical path difference matched to the free spectral range of the laser longitudinal modes. In addition to requiring no monomodal emission, the system requires no frequency locking between the interferometer and the laser. We report laboratory and atmospheric measurements that show that the lidar is capable of measuring the radial wind velocity with a systematic error lower than 1 ms(-1) and a random error lower than 2 ms(-1) for a signal-to-noise ratio of 100. The development is motivated by the possibility to probe wind with a compact system in planetary atmospheres.

  10. Light magnetic dark matter in direct detection searches

    NASA Astrophysics Data System (ADS)

    Del Nobile, Eugenio; Kouvaris, Chris; Panci, Paolo; Sannino, Francesco; Virkajärvi, Jussi


    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders.

  11. Directional eye fixation sensor using birefringence-based foveal detection

    NASA Astrophysics Data System (ADS)

    Gramatikov, Boris I.; Zalloum, Othman H. Y.; Wu, Yi Kai; Hunter, David G.; Guyton, David L.


    We recently developed and reported an eye fixation monitor that detects the fovea by its radial orientation of birefringent nerve fibers. The instrument used a four-quadrant photodetector and a normalized difference function to check for a best match between the detector quadrants and the arms of the bow-tie pattern of polarization states surrounding the fovea. This function had a maximum during central fixation but could not tell where the subject was looking relative to the center. We propose a linear transformation to obtain horizontal and vertical eye position coordinates from the four photodetector signals, followed by correction based on a priori calibration information. The method was verified on both a computer model and on human eyes. The major advantage of this new eye-tracking method is that it uses true information coming from the fovea, rather than reflections from other structures, to identify the direction of foveal gaze.

  12. Self-interacting dark matter without direct detection constraints

    NASA Astrophysics Data System (ADS)

    Zhang, Yue


    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  13. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    NASA Astrophysics Data System (ADS)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio


    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  14. Direct x-ray detection with conjugated polymer devices

    NASA Astrophysics Data System (ADS)

    Boroumand, F. A.; Zhu, M.; Dalton, A. B.; Keddie, J. L.; Sellin, P. J.; Gutierrez, J. J.


    The authors report the first direct detection of x-ray induced photocurrents in thick films (up to 20μm) of conjugated polymers. Schottky-based "sandwich" structures were fabricated from layers of either poly[1-methoxy-4-(2-ethylhexyloxy)-phenylenevinylene] (MEH-PPV) or poly(9,9-dioctylfluorene) (PFO) on indium tin oxide substrates using a top contact of aluminum. Good rectification was achieved from the Al-polymer contact, with a reverse bias leakage current density as low as 4nA/cm2 at an electric field strength of 25kV/cm. Irradiation with x-rays from a 50kV x-ray tube produced a linear increase in photocurrent over a dose rate range from 4to18mGy/s. The observed x-ray sensitivities of 240nC/mGy/cm3 for MEH-PPV and 480nC/mGy/cm3 for PFO structures are comparable to that reported for Si devices. A response time of <150ms to pulsed x-ray irradiation was measured with no evidence of long-lived current transients. Conjugated polymers offer the advantage of easy coatability over large areas and on curved surfaces. Their low average atomic number provides tissue-equivalent dosimetric response, with many potential applications including medical x-ray and synchrotron photon detection.

  15. Lenslet array to further suppress starlight for direct exoplanet detection

    NASA Astrophysics Data System (ADS)

    Gong, Qian; McElwain, Michael; Shiri, Ron


    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  16. Subcarrier multiplexing with dispersion reduction and direct detection


    Sargis, Paul D.; Haigh, Ronald E.; McCammon, Kent G.


    An SCM system for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream.

  17. Subcarrier multiplexing with dispersion reduction and direct detection


    Sargis, P.D.; Haigh, R.E.; McCammon, K.G.


    An SCM system is disclosed for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream. 2 figs.

  18. Direct and Indirect Dark Matter Detection in Gauge Theories

    SciTech Connect

    Queiroz, Farinaldo


    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.


    SciTech Connect

    Ford, H. Alyson; Bregman, Joel N.


    Small amounts of star formation in elliptical galaxies are suggested by several results: surprisingly young ages from optical line indices, cooling X-ray gas, and mid-infrared dust emission. Such star formation has previously been difficult to directly detect, but using ultraviolet Hubble Space Telescope Wide Field Camera 3 imaging, we have identified individual young stars and star clusters in four nearby ellipticals. Ongoing star formation is detected in all galaxies, including three ellipticals that have previously exhibited potential signposts of star-forming conditions (NGC 4636, NGC 4697, and NGC 4374), as well as the typical ''red and dead'' NGC 3379. The current star formation in our closest targets, where we are most complete, is between 2.0 and 9.8 Multiplication-Sign 10{sup -5} M{sub Sun} yr{sup -1}. The star formation history was roughly constant from 0.5 to 1.5 Gyr (at (3-5) Multiplication-Sign 10{sup -4} M{sub Sun} yr{sup -1}), but decreased by a factor of several in the past 0.3 Gyr. Most star clusters have a mass between 10{sup 2} and 10{sup 4} M{sub Sun }. The specific star formation rates of {approx}10{sup -16} yr{sup -1} (at the present day) or {approx}10{sup -14} yr{sup -1} (when averaging over the past Gyr) imply that a fraction 10{sup -8} of the stellar mass is younger than 100 Myr and 10{sup -5} is younger than 1 Gyr, quantifying the level of frosting of recent star formation over the otherwise passive stellar population. There is no obvious correlation between either the presence or spatial distribution of postulated star formation indicators and the star formation we detect.

  20. Magnetic Bead-Based Colorimetric Immunoassay for Aflatoxin B1 Using Gold Nanoparticles

    PubMed Central

    Wang, Xu; Niessner, Reinhard; Knopp, Dietmar


    A competitive colorimetric immunoassay for the detection of aflatoxin B1 (AFB) has been established using biofunctionalized magnetic beads (MBs) and gold nanoparticles (GNPs). Aflatoxin B1-bovine serum albumin conjugates (AFB-BSA) modified MBs were employed as capture probe, which could specifically bind with GNP-labeled anti-AFB antibodies through immunoreaction, while such specific binding was competitively inhibited by the addition of AFB. After magnetic separation, the supernatant solution containing unbound GNPs was directly tested by UV-Vis spectroscopy. The absorption intensity was directly proportional to the AFB concentration. The influence of GNP size, incubation time and pH was investigated in detail. After optimization, the developed method could detect AFB in a linear range from 20 to 800 ng/L, with the limit of detection at 12 ng/L. The recoveries for spiked maize samples ranged from 92.8% to 122.0%. The proposed immunoassay provides a promising approach for simple, rapid, specific and cost-effective detection of toxins in the field of food safety. PMID:25405511

  1. Direct detection of brown dwarf companions of nearby stars

    NASA Astrophysics Data System (ADS)

    Oppenheimer, Ben R.

    This thesis presents the first direct detection of a substellar companion of a star other than the Sun. This object, a brown dwarf called Gliese 229B, presented a unique opportunity to characterize low-temperature brown dwarfs for the first time. The discovery and initial spectrum of Gliese 229B show that the object must be substellar based on its intrinsic luminosity of 6.4×10-6Lsolar and its cool surface temperature, 900 K. Detailed study of Gliese 229B includes extensive photometric measurements from 0.5 to 12 μm, high signal-to-noise ratio spectroscopy from 0.84 to 5.0 μm and the detection of 0'' t; yr-1 of orbital motion. These results are presented in Chapters 2 and 3. A detailed review of brown dwarf science leads to a complete and scientifically meaningful definition of the classes ``planet'' and ``brown dwarf''' in Chapter 1. After the discovery of Gliese 229B, which was found in a survey for companions of young stars, we began an extensive search for brown dwarf companions in orbit about all known stars within 8 pc of the Sun and with δ > -35°. The search includes optical coronagraphic and infrared direct imaging of these stars, conducted on the Palomar 60' and 200' telescopes respectively. The search was designed to find companions of each star without color bias. While the search revealed no other brown dwarf companions of these stars, it did uncover 6 new stellar companions. The sensitivity limits of the survey permit the detection of brown dwarfs up to four magnitudes fainter than Gliese 229B around 90% of the stars. The sensitivity is, however, not uniform spatially or from star to star. This limits our ability to make strong statements about the prevalence of brown dwarf companions of nearby stars. The survey does have sensitivity to all stellar companions between 3 and 30' from the survey stars, however. Chapter 5 describes related work on very low-mass stars in the Pleiades star cluster. This optical spectroscopy involved trying to find a

  2. Quantitative colorimetric measurement of cellulose degradation under microbial culture conditions.


    Haft, Rembrandt J F; Gardner, Jeffrey G; Keating, David H


    We have developed a simple, rapid, quantitative colorimetric assay to measure cellulose degradation based on the absorbance shift of Congo red dye bound to soluble cellulose. We term this assay "Congo Red Analysis of Cellulose Concentration," or "CRACC." CRACC can be performed directly in culture media, including rich and defined media containing monosaccharides or disaccharides (such as glucose and cellobiose). We show example experiments from our laboratory that demonstrate the utility of CRACC in probing enzyme kinetics, quantifying cellulase secretion, and assessing the physiology of cellulolytic organisms. CRACC complements existing methods to assay cellulose degradation, and we discuss its utility for a variety of applications.

  3. Complementarity of direct dark matter detection and indirect detection through gamma rays

    SciTech Connect

    Bergstroem, Lars; Bringmann, Torsten; Edsjoe, Joakim


    We show, by using an extensive sample of viable supersymmetric models as templates, that indirect detection of dark matter through gamma rays may have a large potential for identifying the nature of dark matter. This is, in particular, true also for models that give too weak dark matter-nucleon scattering cross sections to be probed by present and planned direct detection experiments. Also models with a mass scale too high to be accessible at CERN's LHC accelerator may show up in next-generation imaging Cherenkov telescope arrays. Based on our findings, we therefore suggest to view indirect searches as genuine particle physics experiments, complementing other strategies to probe so far unknown regions in the parameter space of e.g. supersymmetric models, and propose a new approach that would make use of telescopes dedicated for dark matter searches. As a concrete example for the potential of such an approach, we consider an array of imaging air Cherenkov telescopes, the Dark Matter Array (DMA), and show that such an experiment could extend present-day limits by several orders of magnitude, reaching a large class of models that would remain undetected in both direct detection experiments and searches at the LHC. In addition, in a sizable part of the parameter space, signals from more than one type of dark matter detection experiment would be possible, something that may eventually be necessary in order to identify the dark matter candidate.

  4. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability


    Appelquist, T.; Berkowitz, E.; Brower, R. C.; ...


    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using themore » background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.« less

  5. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    SciTech Connect

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X. Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.


    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  6. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.


    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O


    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  7. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X.-Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.; Lattice Strong Dynamics LSD Collaboration


    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory—"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N ) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1 /mB6 , suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.


    SciTech Connect

    Brown, Robert A.; Soummer, Remi


    We report on new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list and stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission and its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization) and an estimate of the occurrence rate of planets ({eta}). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, and we prove the accuracy of this new approach. Our methods provide tools to define a mission for a particular science goal; for example, a mission can be defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built and how successive observations can be selected. Our approach also provides other critical mission attributes, such as the number of stars expected to be searched and the probability of zero discoveries. Because these attributes depend strongly on the mission scale (telescope diameter, observing capabilities and constraints, mission lifetime, etc.), our methods are directly applicable to the design of such future missions and provide guidance to the mission and instrument design based on scientific performance. We illustrate our new methods with practical calculations and exploratory design reference missions for the James Webb Space Telescope (JWST) operating with a distant starshade to reduce scattered and diffracted starlight on the focal plane. We estimate that five habitable Earth-mass planets would be discovered and characterized with spectroscopy, with a probability of zero discoveries of 0.004, assuming a small fraction of JWST observing time (7%), {eta} = 0.3, and 70 observing visits, limited by starshade

  9. A direction detective asymmetrical twin-core fiber curving sensor

    NASA Astrophysics Data System (ADS)

    An, Maowei; Geng, Tao; Yang, Wenlei; Zeng, Hongyi; Li, Jian


    Long period fiber gratings (LPFGs), which can couple the core mode to the forward propagating cladding modes of a fiber and have the advantage of small additional loss, no backward reflection, small size, which is widely used in optical fiber sensors and optical communication systems. LPFG has different fabricating methods, in order to write gratings on the twin-core at the same time effectively, we specially choose electric heating fused taper system to fabricate asymmetric dual-core long period fiber grating, because this kind of method can guarantee the similarity of gratings on the twin cores and obtain good geometric parameters of LPFG, such as cycle, cone waist. Then we use bending test platform to conduct bending test for each of the core of twin-core asymmetric long period fiber grating. Experiments show that: the sensitivity of asymmetrical twin-core long period fiber grating's central core under bending is -5.47nm·m, while the sensitivity of asymmetric twin-core long period fiber grating partial core changed with the relative position of screw micrometer. The sensitivity at 0°, 30°, 90° direction is -4.22nm·m, -9.84nm·m, -11.44nm·m respectively. The experiment results strongly demonstrate the properties of rim sensing of asymmetrical twin-core fiber gratings which provides the possibility of simultaneously measuring the bending magnitude and direction and solving the problem of cross sensing when multi-parameter measuring. In other words, we can detect temperature and bend at the same time by this sensor. As our knowledge, it is the first time simultaneously measuring bend and temperature using this structure of fiber sensors.

  10. Comparison of colorimetric and membrane introduction mass spectrometry techniques for chloramine analysis.


    Lee, Wontae; Westerhoff, Paul; Yang, Xin; Shang, Chii


    Three methods for the determination of chloramines in water were compared using pH-buffered nanopure water and natural organic matter (NOM) solutions. We investigated whether the N,N-diethyl-p-phenylenediamine (DPD) colorimetric method and/or an adapted indophenol method (Hach MonochlorF) are suitable for determining the concentration of monochloramine in drinking water. Membrane introduction mass spectrometry (MIMS) was used as a reference analysis method to determine the different chloramine species in water. All methods measured monochloramine accurately in Nanopure water, but the DPD colorimetric method measured higher residuals (inorganic and organic chloramines) than MonochlorF or MIMS when in the presence of NOM due to organic chloramines. The indophenol method (MonochlorF) accurately detected only monochloramine and not other chloramine forms. Overall, the monochloramine concentration measured by MonochlorF was comparable with the MIMS results. A combined chlorine residual approach by the DPD colorimetric method does not differentiate between monochloramine and organic chloramines. Therefore, DPD colorimetric methods can overestimate disinfection efficacy in chloraminated water systems because of interference from organic chloramines that have no or poor bactericidal ability. Compared with the DPD colorimetric method, MonochlorF is a better choice for chloraminated water systems.

  11. A novel colorimetric method for field arsenic speciation analysis.


    Hu, Shan; Lu, Jinsuo; Jing, Chuanyong


    Accurate on-site determination of arsenic (As) concentration as well as its speciation presents a great environmental challenge especially to developing countries. To meet the need of routine field monitoring, we developed a rapid colorimetric method with a wide dynamic detection range and high precision. The novel application of KMnO4 and CH4N2S as effective As(III) oxidant and As(V) reductant, respectively, in the formation of molybdenum blue complexes enabled the differentiation of As(III) and As(V). The detection limit of the method was 8 microg/L with a linear range (R2 = 0.998) of four orders of magnitude in total As concentrations. The As speciation in groundwater samples determined with the colorimetric method in the field were consistent with the results using the high performance liquid chromatography atomic fluorescence spectrometry, as evidenced by a linear correlation in paired analysis with a slope of 0.9990-0.9997 (p < 0.0001, n = 28). The recovery of 96%-116% for total As, 85%-122% for As(III), and 88%-127% for As(V) were achieved for groundwater samples with a total As concentration range 100-800 microg/L. The colorimetric result showed that 3.61 g/L As(III) existed as the only As species in a real industrial wastewater, which was in good agreement with the HPLC-AFS result of 3.56 g/L As(III). No interference with the color development was observed in the presence of sulfate, phosphate, silicate, humic acid, and heavy metals from complex water matrix. This accurate, sensitive, and easy-to-use method is especially suitable for field As determination.

  12. Reactive Arrays of Colorimetric Sensors for Metabolite and Steroid Identification

    PubMed Central

    Batres, Gary; Jones, Talia; Johnke, Hannah; Wilson, Mark; Holmes, Andrea E.; Sikich, Sharmin


    The work described herein examines a rapid mix-and-measure method called DETECHIP suitable for screening of steroids and metabolites. The addition of steroids and metabolites to reactive arrays of colorimetric sensors generated characteristic color “fingerprints” that were used to identify the analyte. A color analysis tool was used to identify the analyte pool that now includes biologically relevant analytes. The mix-and-measure arrays allowed the detection of disease metabolites, orotic acid and argininosuccinic acid; and the steroids androsterone, 1,4-androstadiene, testosterone, stanozolol, and estrone. The steroid 1,4-androstadiene was also detected by this method while dissolved in synthetic urine. Some of the steroids, such as androstadiene, stanozolol, and androsterone were co-dissolved with (2-hydroxypropyl)-β-cyclodextrin in order to increase solubility in aqueous buffered solutions. The colorimetric arrays do not intend to eliminate ELISA or mass spectroscopy based screening, but to possibly provide an alternative analytical detection method for steroids and metabolites. PMID:25019034

  13. Colorimetric sensing of malathion using palladium-gold bimetallic nanozyme.


    Singh, Shefali; Tripathi, Pranav; Kumar, Nitin; Nara, Seema


    In this work, a simple, sensitive and selective label free colorimetric assay using palladium-gold nanorod as nanozyme is reported for malathion detection. Study investigates the peroxidase potential of the nanozyme on colorimetric substrates and explores the effect of selected organophosphates on their enzyme mimetic activity. Palladium-gold nanozyme shows excellent peroxidase mimetic activity with O-phenylenediamine in the presence of hydrogen peroxide. Its Kinetic parameters Km and kcat are better than horseradish peroxidase which makes it a superior enzyme. Nanozyme is stable over a broad temperature range (4-70°C) and shows high peroxidase activity from 2 to 6pH. The peroxidase activity of nanozyme is selectively quenched with increasing concentration of malathion and is the principle of developed assay. Assay has a lowest detection limit of 60ng/ml and shows no cross-reaction with other analogous organophosphates or metal salts. Validation on tap water samples spiked with different concentrations of malathion shows good recovery in the range of 80-106%. Assay also displays good intra and inter-assay precision which lie in the range of 2.7-6.1% and 3.2-5.9% respectively. This study demonstrated the catalytic potential of palladium-gold nanorods, which can be employed as nanozyme for developing highly sensitive detection methods.

  14. Spectrophotometric and colorimetric determination of protein concentration.


    Simonian, Michael H; Smith, John A


    This unit describes spectrophotometric and colorimetric methods for measuring the concentration of a sample protein in solution. Absorbance measurement at 280 nm is used to calculate protein concentration by comparison with a standard curve or published absorptivity values for that protein. An alternate protocol uses absorbance at 205 nm to calculate the protein concentration. Both methods can be used to quantitate total protein in crude lysates and purified or partially purified protein. Use of a spectrofluorometer or a filter fluorometer to measure the intrinsic fluorescence emission of a sample solution is also described. The measurement is compared with the emissions from standard solutions to determine the concentration of purified protein. The Bradford colorimetric method, based upon binding of the dye Coomassie brilliant blue to an unknown protein, is also presented, as is the Lowry method, which measures colorimetric reaction of tyrosyl residues in an unknown.

  15. Direct detection of exothermic dark matter with light mediator

    SciTech Connect

    Geng, Chao-Qiang; Huang, Da; Lee, Chun-Hao; Wang, Qing


    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  16. Detection of biological threats. A challenge for directed molecular evolution.


    Petrenko, Valery A; Sorokulova, Iryna B


    The probe technique originated from early attempts of Anton van Leeuwenhoek to contrast microorganisms under the microscope using plant juices, successful staining of tubercle bacilli with synthetic dyes by Paul Ehrlich and discovery of a stain for differentiation of gram-positive and gram-negative bacteria by Hans Christian Gram. The technique relies on the principle that pathogens have unique structural features, which can be recognized by specifically labeled organic molecules. A hundred years of extensive screening efforts led to discovery of a limited assortment of organic probes that are used for identification and differentiation of bacteria. A new challenge--continuous monitoring of biological threats--requires long lasting molecular probes capable of tight specific binding of pathogens in unfavorable conditions. To respond to the challenge, probe technology is being revolutionized by utilizing methods of combinatorial chemistry, phage display and directed molecular evolution. This review describes how molecular evolution methods are applied for development of peptide, antibody and phage probes, and summarizes the author's own data on development of landscape phage probes against Salmonella typhimurium. The performance of the probes in detection of Salmonella is illustrated by a precipitation test, enzyme-linked immunosorbent assay (ELISA), fluorescence-activated cell sorting (FACS) and fluorescent, optical and electron microscopy.

  17. SUSY under siege from direct and indirect WIMP detection experiments

    NASA Astrophysics Data System (ADS)

    Baer, Howard; Barger, Vernon; Serce, Hasan


    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC), BayesFits (BF) and Fittino (FO) collaborations, nonthermal wino dark matter (NThW) and finally mixed axion-Higgsino dark matter from SUSY with radiatively driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV Higgsino parameter space from BF group are ruled out. The 100-300 GeV Higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections from ton-scale noble liquid detectors should discover or rule out WIMPs from the remaining parameter space of these surviving models.

  18. The effective field theory of dark matter direct detection

    SciTech Connect

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming


    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  19. Direct detection of light ''Ge-phobic'' exothermic dark matter

    SciTech Connect

    Gelmini, Graciela B.; Georgescu, Andreea; Huh, Ji-Haeng E-mail:


    We present comparisons of direct dark matter (DM) detection data for light WIMPs with exothermic scattering with nuclei (exoDM), both assuming the Standard Halo Model (SHM) and in a halo model–independent manner. Exothermic interactions favor light targets, thus reducing the importance of upper limits derived from xenon targets, the most restrictive of which is at present the LUX limit. In our SHM analysis the CDMS-II-Si and CoGeNT regions become allowed by these bounds, however the recent SuperCDMS limit rejects both regions for exoDM with isospin-conserving couplings. An isospin-violating coupling of the exoDM, in particular one with a neutron to proton coupling ratio of -0.8 (which we call ''Ge-phobic''), maximally reduces the DM coupling to germanium and allows the CDMS-II-Si region to become compatible with all bounds. This is also clearly shown in our halo-independent analysis.

  20. Direct detection of light anapole and magnetic dipole DM

    SciTech Connect

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo E-mail: E-mail:


    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section.

  1. Enabling Technologies for Direct Detection Optical Phase Modulation Formats

    NASA Astrophysics Data System (ADS)

    Xu, Xian

    Phase modulation formats are believed to be one of the key enabling techniques for next generation high speed long haul fiber-optic communication systems due to the following main advantages: (1) with a balanced detection, a better receiver sensitivity over conventional intensity modulation formats, e.g., a ˜3-dB sensitivity improvement using differential phase shift keying (DPSK) and a ˜1.3-dB sensitivity improvement using differential quadrature phase shift keying (DQPSK); (2) excellent robustness against fiber nonlinearities; (3) high spectrum efficiency when using multilevel phase modulation formats, such as DQPSK. As the information is encoded in the phase of the optical field, the phase modulation formats are sensitive to the phase-related impairments and the deterioration induced in the phase-intensity conversion. This consequently creates new challenging issues. The research objective of this thesis is to depict some of the challenging issues and provide possible solutions. The first challenge is the cross-phase modulation (XPM) penalty for the phase modulated channels co-propagating with the intensity modulated channels. The penalty comes from the pattern dependent intensity fluctuations of the neighboring intensity modulated channels being converted into phase noise in the phase modulation channels. We propose a model to theoretically analyze the XPM penalty dependence on the walk off effect. From this model, we suggest that using fibers with large local dispersion or intentionally introducing some residual dispersion per span would help mitigate the XPM penalty. The second challenge is the polarization dependent frequency shift (PDf) induced penalty during the phase-intensity conversion. The direct detection DPSK is usually demodulated in a Mach-Zehnder delay interferometer (DI). The polarization dependence of DI introduces a PDf causing a frequency offset between the laser's frequency and the transmissivity peak of DI, degrading the demodulated DPSK

  2. Evaluation of the Spectral Response of Functionalized Silk Inverse Opals as Colorimetric Immunosensors.


    Burke, Kelly A; Brenckle, Mark A; Kaplan, David L; Omenetto, Fiorenzo G


    Regenerated silk fibroin is a high molecular weight protein obtained by purifying the cocoons of the domesticated silkworm, Bombyx mori. This report exploits the aqueous processing and tunable β sheet secondary structure of regenerated silk to produce nanostructures (i.e., inverse opals) that can be used as colorimetric immunosensors. Such sensors would enable direct detection of antigens by changes in reflectance spectra induced by binding events within the nanostructure. Silk inverse opals were prepared by solution casting and annealing in a humidified atmosphere to render the silk insoluble. Next, antigen sensing capabilities were imparted to silk through a three step synthesis: coupling of avidin to silk surfaces, coupling of biotin to antibodies, and lastly antibody attachment to silk through avidin-biotin interactions. Varying the antibody enables detection of different antigens, as demonstrated using different protein antigens: antibodies, red fluorescent protein, and the beta subunit of cholera toxin. Antigen binding to sensors induces a red shift in the opal reflectance spectra, while sensors not exposed to antigen showed either no shift or a slight blue shift. This work constitutes a first step for the design of biopolymer-based optical systems that could directly detect antigens using commercially available reagents and environmentally friendly chemistries.

  3. Sensitiveness of the colorimetric estimation of titanium

    USGS Publications Warehouse

    Wells, R.C.


    The accuracy of the colorimetric estimation of titanium is practically constant over concentrations ranging from the strongest down to those containing about 1.5 mg. TiO2 in 100 cc. The change in concentration required to produce a perceptible difference in intensity between two solutions, at favorable concentrations, was found to be about 6.5 per cent, which does not differ much from the results of others with chromium and copper solutions. With suitable precautions, such as comparing by substitution and taking the mean of several settings or of the two perceptibly different extremes, the accuracy of the colorimetric comparisons appears to be about 2 per cent.

  4. Colorimetric determination of o-phenylenediamine in water samples based on the formation of silver nanoparticles as a colorimetric probe

    NASA Astrophysics Data System (ADS)

    Li, Nan; Gu, Yu; Gao, Mengmeng; Wang, Zilu; Xiao, Deli; Li, Yun; Lin, Rui; He, Hua


    A simple, rapid and cost-effective method for visual colorimetric detection of o-phenylenediamine (OPD) based on the formation of silver nanoparticles (AgNPs) has been developed in this paper. Silver ions can be reduced to AgNPs by OPD in a few minutes, causing changes in absorption spectra and color of the reaction system. Therefore, colorimetric detection of OPD could be realized by a UV-vis spectrophotometer or even the naked eye. Results showed that the absorption intensity of AgNPs at 416 nm exhibited a good linear correlation (R2 = 0.998) with OPD concentration in the range from 10-6 to 8 × 10-5 mol L-1 and the detection limit (3 σ/S) was calculated to be 1.61 × 10-7 mol L-1. Furthermore, as low as 4 × 10-6 mol L-1 OPD can be visualized by the naked eye without the requirement of any complicated or expensive instruments. This proposed method has been successfully applied to determine OPD in water samples, and may provide an innovative platform in the development of sensors for guiding environmental monitoring in the future.

  5. Direct detection of Helicobacter pylori resistance to macrolides by a polymerase chain reaction/DNA enzyme immunoassay in gastric biopsy specimens

    PubMed Central

    Marais, A; Monteiro, L; Occhialini, A; Pina, M; Lamouliatte, H; Megraud, F


    BACKGROUND—The increasing use of macrolides especially in the treatment of Helicobacter pylori infection has led to an increase in resistant strains. The resistance of H pylori to macrolides, especially clarithromycin, is one of the major causes of eradication failure. In H pylori, clarithromycin resistance is due to point mutations localised in domain V of 23S rRNA. 
AIM—To develop a molecular technique based on amplification of a relevant fragment of the 23S rRNA and colorimetric hybridisation in liquid phase to detect directly in biopsy specimens the type of mutation associated with resistance of H pylori to clarithromycin. 
METHODS—Gastric biopsy samples from 61 patients were submitted to this test. The results were compared with standard methods (determination of minimal inhibition concentration, polymerase chain reaction/restriction fragment length polymorphism, and/or DNA sequencing) in order to evaluate the test and to define the cut off values, specificity, and sensitivity. 
RESULTS—The 14 biopsy samples in which H pylori was not detected did not give a positive result in any assay, and the 14 samples harbouring strains susceptible to clarithromycin gave a positive result with the wild type probe as expected. The 33 biopsy specimens containing resistant strains always gave a positive signal with one of the probes detecting resistant organisms, but in eight cases they also reacted with the wild type probe, indicating that a mixture of resistant and susceptible organisms was present. 
CONCLUSION—The importance of this new assay is that it allows the detection of multiple genotypes corresponding to either heterogeneous genotypes or mixed infections. Moreover, it allows in a single step not only the detection of H pylori but also the determination of its susceptibility to clarithromycin directly in biopsy specimens without the need for culture. 

 Keywords: Helicobacter pylori; resistance; clarithromycin; macrolide; polymerase chain

  6. Bed bug detection: Current technologies and future directions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study evaluates current technologies used to detect bed bug infestations, and presents new information regarding the underlying chemical basis of canines scent detection. The manuscript also reports new and future devices that may play a part in bed bug detection in the future....

  7. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M. E-mail: E-mail:


    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either 'heavy' or 'light' mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  8. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M.


    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  9. Paper-based tuberculosis diagnostic devices with colorimetric gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Tsai, Tsung-Ting; Shen, Shu-Wei; Cheng, Chao-Min; Chen, Chien-Fu


    A colorimetric sensing strategy employing gold nanoparticles and a paper assay platform has been developed for tuberculosis diagnosis. Unmodified gold nanoparticles and single-stranded detection oligonucleotides are used to achieve rapid diagnosis without complicated and time-consuming thiolated or other surface-modified probe preparation processes. To eliminate the use of sophisticated equipment for data analysis, the color variance for multiple detection results was simultaneously collected and concentrated on cellulose paper with the data readout transmitted for cloud computing via a smartphone. The results show that the 2.6 nM tuberculosis mycobacterium target sequences extracted from patients can easily be detected, and the turnaround time after the human DNA is extracted from clinical samples was approximately 1 h.

  10. A colorimetric assay for cytokinin oxidase.


    Libreros-Minotta, C A; Tipton, P A


    A simple and rapid colorimetric assay for cytokinin oxidase is described. The assay is based on the formation of a Schiff base between the enzymatic reaction product 3-methyl-2-butenal and p-aminophenol. The assay is effective in the submicromolar concentration range and can be used in crude plant extracts as well as in more highly purified preparations.

  11. Visualizing Capsaicinoids: Colorimetric Analysis of Chili Peppers

    ERIC Educational Resources Information Center

    Thompson, Robert Q.; Chu, Christopher; Gent, Robin; Gould, Alexandra P.; Rios, Laura; Vertigan, Theresa M.


    A colorimetric method for total capsaicinoids in chili pepper ("Capsicum") fruit is described. The placental material of the pepper, containing 90% of the capsaicinoids, was physically separated from the colored materials in the pericarp and extracted twice with methanol, capturing 85% of the remaining capsaicinoids. The extract, evaporated and…

  12. PDM-16QAM vector signal generation and detection based on intensity modulation and direct detection

    NASA Astrophysics Data System (ADS)

    Chen, Long; Yu, Jianjun; Li, Xinying


    We experimentally demonstrate a novel and simple method to generate and detect high speed polarization-division-multiplexing 16-ary quadrature-amplitude-modulation (PDM-16QAM) vector signal enabled by Mach-Zehnder modulator-based (MZM-based) optical-carrier-suppression (OCS) intensity modulation and direct detection. Due to the adoption of OCS intensity modulation, carrier beating can be avoided at the receiver, and thus polarization de-multiplexing can be implemented by digital-signal-processing-based (DSP-based) cascaded multi-modulus algorithm (CMMA) equalization instead of a polarization tracking system. The change of both amplitude and phase information due to the adoption of OCS modulation can be equalized by DSP-based amplitude and phase precoding at the transmitter. Up to 64-Gb/s PDM-16QAM vector signal is generated and detected after 2-km single-mode fiber-28 (SMF-28) or 20-km large-effective-area fiber (LEAF) transmission with a bit-error-ratio (BER) less than the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3.

  13. Enhancement of Colorimetric Response of Enzymatic Reactions by Thermally Evaporated Plasmonic Thin Films: Application to Glial Fibrillary Acidic Protein.


    Abel, Biebele; Kabir, Tabassum S; Odukoya, Babatunde; Mohammed, Muzaffer; Aslan, Kadir


    We report the enhancement of the colorimetric response of horseradish peroxidase (HRP) and alkaline phosphatase (AP) in bioassays by thermally evaporated silver, gold, copper and nickel thin films. In this regard, a model bioassay based on biotin-avidin interactions was employed. Biotin groups and enzymes were introduced to all surfaces using a biotinylated linker molecule and avidin, respectively. The colorimetric response of HRP in the model bioassay carried out on the plasmonic thin films were up to 4.4-fold larger as compared to control samples (i.e., no plasmonic thin films), where the largest enhancement of colorimetric response was observed on silver thin films. The colorimetric response of AP on plasmonic thin films was found to be similar to those observed on control samples, which was attributed to the loss of enzymes from the surface during the bioassay steps. The extent of enzymes immobilized on to plasmonic thin films was found to affect the colorimetric response of the model bioassay. These findings allowed us to demonstrate the use of silver thin films for the detection of glial fibrillary acidic protein (GFAP), where the colorimetric response of the standard bioassays for GFAP was enhanced up to 67% as compared to bioassays on glass slides.

  14. Enhancement of Colorimetric Response of Enzymatic Reactions by Thermally Evaporated Plasmonic Thin Films: Application to Glial Fibrillary Acidic Protein

    PubMed Central

    Abel, Biebele; Kabir, Tabassum S.; Odukoya, Babatunde; Mohammed, Muzaffer; Aslan, Kadir


    We report the enhancement of the colorimetric response of horseradish peroxidase (HRP) and alkaline phosphatase (AP) in bioassays by thermally evaporated silver, gold, copper and nickel thin films. In this regard, a model bioassay based on biotin-avidin interactions was employed. Biotin groups and enzymes were introduced to all surfaces using a biotinylated linker molecule and avidin, respectively. The colorimetric response of HRP in the model bioassay carried out on the plasmonic thin films were up to 4.4-fold larger as compared to control samples (i.e., no plasmonic thin films), where the largest enhancement of colorimetric response was observed on silver thin films. The colorimetric response of AP on plasmonic thin films was found to be similar to those observed on control samples, which was attributed to the loss of enzymes from the surface during the bioassay steps. The extent of enzymes immobilized on to plasmonic thin films was found to affect the colorimetric response of the model bioassay. These findings allowed us to demonstrate the use of silver thin films for the detection of glial fibrillary acidic protein (GFAP), where the colorimetric response of the standard bioassays for GFAP was enhanced up to 67% as compared to bioassays on glass slides. PMID:25663850

  15. A colorimetric strategy based on a water-soluble conjugated polymer for sensing pH-driven conformational conversion of DNA i-motif structure.


    Wang, Lihua; Liu, Xingfen; Yang, Qing; Fan, Quli; Song, Shiping; Fan, Chunhai; Huang, Wei


    Using a water-soluble conjugated polymer (CP) as a sensing probe, we developed a rapid colorimetric detection strategy for pH-driven conformational conversion of DNA i-motif structure. Two sensing configurations were designed: one used CP only to detect the conversion between i-motif and random-coiled state of a C-rich single-strand DNA, the other used CP and a complementary single-strand DNA to investigate the conversion of duplex to i-motif equilibrium. All the conversions would lead to color change observed directly with naked eyes within a few minutes. The limitation of detection (LOD) is as low as 40 nM. More importantly, reversible conformational conversions by adjusting the pH of the system could also be detected.

  16. Comparison of IPDA lidar receiver sensitivity for coherent detection and for direct detection using sine-wave and pulsed modulation.


    Sun, Xiaoli; Abshire, James B


    We use theoretical models to compare the receiver signal to noise ratio (SNR) vs. average rate of detected signal photons for an integrated path differential absorption (IPDA) lidar using coherent detection with continuous wave (CW) lasers and direct detection with sine-wave and pulse modulations. The results show the coherent IPDA lidar has high receiver gain and narrow bandwidth to overcome the effects of detector circuit noise and background light, but the actual receiver performance can be limited by the coherent mixing efficiency, speckle and other factors. For direct detection, using sine-wave modulation allows the use of a low peak power laser transmitter and synchronous detection. The pulse modulation technique requires higher laser peak powers but is more efficient than sine-wave modulation in terms of average detected signal photon rate required to achieve a given receiver SNR. We also conducted experiments for the direct detection cases and the results agreed well with theory.

  17. Interface engineering catalytic graphene for smart colorimetric biosensing.


    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Quan, Xie


    Herein a hybrid catalyst consisting of "naked" Au-NPs in situ grown on graphene sheets is engineered, which exhibits a synergetic effect in mimicking peroxidase at its interface, although free Au-NPs or graphene alone has very little activity. What is more, one of the unique features of our synergetic catalyst is that its interface can be reversibly switched from "inactive" to "active" upon treatment with different ssDNA species in solution, thus providing a powerful and versatile basis for designing graphene/DNA-based label-free colorimetric biosensors. Compared with other signal transduction modes in traditional graphene/aptamer-based systems, our novel signaling strategy not only avoids any labeling or modification procedures but also reduces the background signal due to the "off-on" switching mode during the sensing. Furthermore, this facile and general approach can be applicable to the other extended graphene/aptamer-based systems for colorimetric detection of a wide range of analytes. We envision that the tunable graphene-based smart interface could find potential applications in the development of biocatalysis, bioassays, and smart material devices in the future.

  18. Bed bug detection: current technologies and future directions.


    Vaidyanathan, Rajeev; Feldlaufer, Mark F


    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use.

  19. Bed Bug Detection: Current Technologies and Future Directions

    PubMed Central

    Vaidyanathan, Rajeev; Feldlaufer, Mark F.


    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use. PMID:23553226

  20. A Wash-Free Homogeneous Colorimetric Immunoassay Method

    PubMed Central

    Liu, Huiqiao; Rong, Pengfei; Jia, Hongwei; Yang, Jie; Dong, Bo; Dong, Qiong; Yang, Cejun; Hu, Pengzhi; Wang, Wei; Liu, Haitao; Liu, Dingbin


    Rapid and convenient biosensing platforms could be beneficial to timely diagnosis and treatment of diseases in virtually any care settings. Sandwich immunoassays, the most commonly used methods for protein detection, often rely on expensive tags such as enzyme and tedious wash and incubation procedures operated by skilled labor. In this report, we revolutionized traditional sandwich immunoassays by providing a wash-free homogeneous colorimetric immunoassay method without requirement of any separation steps. The proposed strategy was realized by controlling the growth of gold nanoparticles (AuNPs) to mediate the interparticle spacing in the protein-AuNP oligomers. We have demonstrated the successful in vitro detection of cancer biomarker in serum samples from patients with high clinical sensitivity and specificity. PMID:26722373

  1. Detection of methicillin-resistant Staphylococcus aureus directly by loop-mediated isothermal amplification and direct cefoxitin disk diffusion tests.


    Metwally, L; Gomaa, N; Hassan, R


    We evaluated the utility of 2 methods for detection of methicillin-resistant Staphylococcus aureus (MRSA) directly from signal-positive blood culture bottles: loop-mediated isothermal amplification (LAMP) assay, and direct cefoxitin disk diffusion (DCDD) test using a 30 μg cefoxitin disk. In parallel, standard microbiological identification and oxacillin susceptibility testing with MecA PCR was performed. Of 60 blood cultures positive for Gram-positive cocci in clusters, LAMP (via detection of the FemA and MecA genes) showed 100% sensitivity and specificity for identification of MRSA/MSSA. When coagulase-negative staphylococci were tested, sensitivity for detection of methicillin resistance was 91.7% and specificity was 100%. DCDD along with direct tube coagulase assay detected only 80.6% of MRSA/MSSA. LAMP showed higher diagnostic accuracy although DCDD was more cost-effective and did not require additional reagents or supplies.

  2. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology.


    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik


    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1-0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology.

  3. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik


    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1–0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology. PMID:26272507

  4. Multilayer paper-based device for colorimetric and electrochemical quantification of metals.


    Rattanarat, Poomrat; Dungchai, Wijitar; Cate, David; Volckens, John; Chailapakul, Orawon; Henry, Charles S


    The release of metals and metal-containing compounds into the environment is a growing concern in developed and developing countries, as human exposure to metals is associated with adverse health effects in virtually every organ system. Unfortunately, quantifying metals in the environment is expensive; analysis costs using certified laboratories typically exceed $100/sample, making the routine analysis of toxic metals cost-prohibitive for applications such as occupational exposure or environmental protection. Here, we report on a simple, inexpensive technology with the potential to render toxic metals detection accessible for both the developing and developed world that combines colorimetric and electrochemical microfluidic paper-based analytical devices (mPAD) in a three-dimensional configuration. Unlike previous mPADs designed for measuring metals, the device reported here separates colorimetric detection on one layer from electrochemical detection on a different layer. Separate detection layers allows different chemistries to be applied to a single sample on the same device. To demonstrate the effectiveness of this approach, colorimetric detection is shown for Ni, Fe, Cu, and Cr and electrochemical detection for Pb and Cd. Detection limits as low as 0.12 μg (Cr) were achieved on the colorimetric layer while detection limits as low as 0.25 ng (Cd and Pb) were achieved on the electrochemical layer. Selectivity for the target analytes was demonstrated for common interferences. As an example of the device utility, particulate metals collected on air sampling filters were analyzed. Levels measured with the mPAD matched known values for the certified reference samples of collected particulate matter.

  5. Improving colorimetric assays through protein enzyme-assisted gold nanoparticle amplification.


    Xie, Xiaoji; Xu, Wei; Liu, Xiaogang


    The discovery of the DNA-mediated assembly of gold nanoparticles was a great moment in the history of science; this understanding and chemical control enabled the rational design of functional nanomaterials as novel probes in biodetection. In contrast with conventional probes such as organic dyes, gold nanoparticles exhibit high photostability and unique size-dependent optical properties. Because of their high extinction coefficients and strong distance dependent optical properties, these nanoparticles have emerged over the past decade as a promising platform for rapid, highly sensitive colorimetric assays that allow for the visual detection of low concentrations of metal ions, small molecules, and biomacromolecules. These discoveries have deepened our knowledge of biological phenomena and facilitated the development of many new diagnostic and therapeutic tools. Despite these many advances and continued research efforts, current nanoparticle-based colorimetric detection systems still suffer from several drawbacks, such as limited sensitivity and selectivity. This Account describes the recent development of colorimetric assays based on protein enzyme-assisted gold nanoparticle amplification. The benefits of such detection systems include significantly improved detection sensitivity and selectivity. First, we discuss the general design of enzyme-modified nanoparticle systems in colorimetric assays. We show that a quantitative understanding of the unique properties of different enzymes is paramount for effective biological assays. We then examine the assays for nucleic acid detection based on different types of enzymes, including endonucleases, ligases, and polymerases. For each of these assays, we identify the underlying principles that contribute to the enhanced detection capability of nanoparticle systems and illustrate them with selected examples. Furthermore, we demonstrate that the combination of gold nanoparticles and specific enzymes can probe enzyme dynamics

  6. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures

    PubMed Central

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G.


    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers. PMID:26424841

  7. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures.


    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G; Corso, Alejandra


    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers.

  8. Future Direct Spectroscopic Detection of Hot Jupiters with IGRINS

    NASA Astrophysics Data System (ADS)

    Gullikson, Kevin; Endl, Mike


    With about 700 confirmed extrasolar planets, it is time to move beyond discovery and towards characterization. Perhaps the most basic parameter of an extrasolar planet is its mass; however, this is very difficult to determine if the planet does not transit the star. The radial velocity technique, still the most fruitful method of discovering planets in the solar neighborhood, can only determine a minimum planet mass. We investigate a method using the near-future IGRINS near infrared spectrograph to detect the orbital motion of the planet itself. We simulate several observations of a star with an orbiting planet, and search for the spectral signature of the planet by cross-correlating against planet model spectra. A detection appears as a strong peak in the cross-correlation function, and gives the radial velocity of the planet at the time of observation. This, combined with the motion of the star from traditional radial velocity planet search programs, can determine the actual planet mass. We find that the IGRINS instrument can detect the spectral signature from large planets on very close orbits (so-called Hot Jupiters), and that the detections can provide tight constraints on the true planet mass.

  9. Rapid Detection and Identification of Respiratory Viruses by Direct Immunofluorescence

    PubMed Central

    D'Alessio, Donn; Williams, Stanley; Dick, Elliot C.


    The use of fluorescein-conjugated antiserum against respiratory syncytial (RS) and parainfluenza 1 and 3 viruses was compared with conventional techniques in the rapid detection of virus in tissue cultures inoculated with pharyngeal specimens known to contain these viruses. Twenty-three specimens were tested: 9 RS, 8 parainfluenza 1, and 6 parainfluenza 3. The fluorescent-antibody technique (FA) detected virus in 52% of the tissue cultures in 24 hr, and, by 72 hr, 22 of the 23 cultures were FA-positive whereas only 5 were positive by conventional techniques. Additionally, conjugated antisera were prepared against herpes simplex, influenza A2, and adenovirus type 5. All conjugates stained only the homologous virus and were 100- to 10,000-fold more sensitive than conventional techniques in detecting descending dilutions of virus inocula by 24 hr. With the procedures described, several antisera could be conjugated and ready for use within 24 hr. Serum fractionation was by ammonium sulfate precipitation, and with the procedure outlined virtually complete recovery of the globulin fraction and elimination of all of the albumin were accomplished. Images PMID:4098101

  10. Teleconnection Paths via Climate Network Direct Link Detection.


    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo


    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales.

  11. Three dimensional colorimetric assay assemblies

    SciTech Connect

    Charych, D.; Reichart, A.


    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  12. Three dimensional colorimetric assay assemblies


    Charych, Deborah; Reichart, Anke


    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  13. Additional sampling directions improve detection range of wireless radiofrequency probes

    PubMed Central

    Mada, Marius; Carpenter, T. Adrian; Sawiak, Stephen J.; Williams, Guy B.


    Purpose While MRI is enhancing our knowledge about the structure and function of the human brain, subject motion remains a problem in many clinical applications. Recently, the use of wireless radiofrequency markers with three one‐dimensional (1D) navigators for prospective correction was demonstrated. This method is restricted in the range of motion that can be corrected, however, because of limited information in the 1D readouts. Methods Here, the limitation of techniques for disambiguating marker locations was investigated. It was shown that including more sampling directions extends the tracking range for head rotations. The efficiency of trading readout resolution for speed was explored. Results Tracking of head rotations was demonstrated from −19.2 to 34.4°, −2.7 to 10.0°, and −60.9 to 70.9° in the x‐, y‐, and z‐directions, respectively. In the presence of excessive head motion, the deviation of marker estimates from SPM8 was reduced by 17.1% over existing three‐projection methods. This was achieved by using an additional seven directions, extending the time needed for readouts by a factor of 3.3. Much of this increase may be circumvented by reducing resolution, without compromising accuracy. Conclusion Including additional sampling directions extends the range in which markers can be used, for patients who move a lot. Magn Reson Med 76:913–918, 2016. © 2015 The Authors. Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:26418189

  14. Direct detection of a microlens in the Milky Way.


    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D


    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs.

  15. Highly selective colorimetric bacteria sensing based on protein-capped nanoparticles.


    Qiu, Suyan; Lin, Zhenyu; Zhou, Yaomin; Wang, Donggen; Yuan, Lijuan; Wei, Yihua; Dai, Tingcan; Luo, Linguang; Chen, Guonan


    A rapid and cost-effective colorimetric sensor has been developed for the detection of bacteria (Bacillus subtilis was selected as an example). The sensor was designed to rely on lysozyme-capped AuNPs with the advantages of effective amplification and high specificity. In the sensing system, lysozyme was able to bind strongly to Bacillus subtilis, which effectively induced a color change of the solution from light purple to purplish red. The lowest concentration of Bacillus subtilis detectable by the naked eye was 4.5 × 10(3) colony-forming units (CFU) mL(-1). Similar results were discernable from UV-Vis absorption measurements. A good specificity was observed through a statistical analysis method using the SPSS software (version 17.0). This simple colorimetric sensor may therefore be a rapid and specific method for a bacterial detection assay in complex samples.

  16. Br-PADAP embedded in cellulose acetate electrospun nanofibers: Colorimetric sensor strips for visual uranyl recognition.


    Hu, Lin; Yan, Xue-Wu; Li, Qi; Zhang, Xue-Ji; Shan, Dan


    In this work, a new visual colorimetric strip based on cellulose acetate nanofiber mats modified by 2-(5-Bromo-2-pyridylazo)-5-(diethylamino) phenol was successfully prepared via electrospinning technology. The prepared colorimetric strip showed high sensitivity towards UO2(2+) with the yellow-to-purple color change signal. Upon the optimal conditions of solution pH at 6.0 and response time for 80min, the detection limit for UO2(2+) can reach 50 ppb. Moreover, the strip also exhibited excellent anti-interference ability in the presence of other metal ions. In order to achieve the quantitative detection for UO2(2+), a color-differentiation map was established, which was prepared from converted H values. Finally, the strip was also used to detect UO2(2+) in the seawater and showed high sensitivity.

  17. Detection of nucleic acid sequences by invader-directed cleavage


    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  18. Direct detection of relic active and sterile neutrinos

    NASA Astrophysics Data System (ADS)

    Li, Yu-Feng


    Both active and sterile sub-eV neutrinos can form the cosmic neutrino background in the early Universe. We consider the beta-decaying (e.g., 3H) and EC-decaying (e.g., 163Ho) nuclei as the promising targets to capture relic neutrinos in the laboratory. We calculate the capture rates of relic electron neutrinos and antineutrinos against the corresponding beta decay or electron capture (EC) decay backgrounds in the (3+Ns) flavor mixing scheme, and discuss the future prospect in terms of the PTOLEMY project. We stress that such direct measurements of hot DM might not be hopeless in the long term.

  19. A prototype direct-detection CCD for protein crystallography.


    Green, Katherine S; Szebenyi, Doletha M E; Boggs, Kasey; Bredthauer, Richard; Tate, Mark W; Gruner, Sol M


    The fabrication and testing of a prototype deep-depletion direct-conversion X-ray CCD detector are described. The device is fabricated on 600 µm-thick high-resistivity silicon, with 24 × 24 µm pixels in a 4k × 4k pixel format. Calibration measurements and the results of initial protein crystallography experiments at the Cornell High Energy Synchrotron Source (CHESS) F1 beamline are described, as well as suggested improvements for future versions of the detector.

  20. Future directions for the early detection of colorectal cancer recurrence.


    Walker, Avery S; Johnson, Eric K; Maykel, Justin A; Stojadinovic, Alex; Nissan, Aviram; Brucher, Bjorn; Champagne, Bradley J; Steele, Scott R


    Surgical resection remains a mainstay of treatment and is highly effective for localized colorectal cancer. However, ~30-40% of patients develop recurrence following surgery and 40-50% of recurrences are apparent within the first few years after initial surgical resection. Several variables factor into the ultimate outcome of these patients, including the extent of disease, tumor biology, and patient co-morbidities. Additionally, the t