Science.gov

Sample records for direct colorimetric detection

  1. Polymeric assay film for direct colorimetric detection

    DOEpatents

    Charych, Deborah; Nagy, Jon; Spevak, Wayne

    2002-01-01

    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  2. Polymeric assay film for direct colorimetric detection

    DOEpatents

    Charych, Deborah; Nagy, Jon; Spevak, Wayne

    1999-01-01

    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  3. Sol-gel matrices for direct colorimetric detection of analytes

    DOEpatents

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  4. Sol-Gel Matrices For Direct Colorimetric Detection Of Analytes

    DOEpatents

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2002-11-26

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  5. Direct visualization of lead corona and its nanomolar colorimetric detection using anisotropic gold nanoparticles.

    PubMed

    Dwivedi, Charu; Chaudhary, Abhishek; Gupta, Abhishek; Nandi, Chayan K

    2015-03-11

    The study presents dithiothreitol (DTT) functionalized anisotropic gold nanoparticles (GNP) based colorimetric sensor for detection of toxic lead ions in water. Our results demonstrate the selectivity and sensitivity of the developed sensor over various heavy metal ions with detection limit of ∼9 nM. The mechanism of sensing is explained on the basis of unique corona formation around the DTT functionalized anisotropic GNP.

  6. Direct visualization of lead corona and its nanomolar colorimetric detection using anisotropic gold nanoparticles.

    PubMed

    Dwivedi, Charu; Chaudhary, Abhishek; Gupta, Abhishek; Nandi, Chayan K

    2015-03-11

    The study presents dithiothreitol (DTT) functionalized anisotropic gold nanoparticles (GNP) based colorimetric sensor for detection of toxic lead ions in water. Our results demonstrate the selectivity and sensitivity of the developed sensor over various heavy metal ions with detection limit of ∼9 nM. The mechanism of sensing is explained on the basis of unique corona formation around the DTT functionalized anisotropic GNP. PMID:25719820

  7. Emergency First Responders' Experience with Colorimetric Detection Methods

    SciTech Connect

    Sandra L. Fox; Keith A. Daum; Carla J. Miller; Marnie M. Cortez

    2007-10-01

    Nationwide, first responders from state and federal support teams respond to hazardous materials incidents, industrial chemical spills, and potential weapons of mass destruction (WMD) attacks. Although first responders have sophisticated chemical, biological, radiological, and explosive detectors available for assessment of the incident scene, simple colorimetric detectors have a role in response actions. The large number of colorimetric chemical detection methods available on the market can make the selection of the proper methods difficult. Although each detector has unique aspects to provide qualitative or quantitative data about the unknown chemicals present, not all detectors provide consistent, accurate, and reliable results. Included here, in a consumer-report-style format, we provide “boots on the ground” information directly from first responders about how well colorimetric chemical detection methods meet their needs in the field and how they procure these methods.

  8. Gum kondagogu reduced/stabilized silver nanoparticles as direct colorimetric sensor for the sensitive detection of Hg²⁺ in aqueous system.

    PubMed

    Rastogi, Lori; Sashidhar, R B; Karunasagar, D; Arunachalam, J

    2014-01-01

    A highly sensitive and selective method is reported for the colorimetric detection of Hg(2+) in aqueous system by using label free silver nanoparticles (Ag NPs). Ag NPs used in this method were synthesized by gum kondagogu (GK) which acted as both reducing and stabilizing agent. The average size of the GK-Ag NPs was found to be 5.0 ± 2.8 nm as revealed by transmission electron microscope (TEM) analysis and the nanoparticles were stable at various pH conditions (pH 4-11) and salt concentrations (5-100 mM). The GK reduced/stabilized Ag NPs (GK-Ag NPs) were directly used for the selective colorimetric reaction with Hg(2+) without any further modification. The bright yellow colour of Ag NPs was found to fade in a concentration dependent manner with the added Hg(+) ions. The fading response was directly correlated with increasing concentration of Hg(2+). More importantly, this response was found to be highly selective for Hg(2+) as the absorption spectra were found to be unaffected by the presence of other ions like; Na(+), K(+), Mg(2+), Ca(2+), Cu(2+), Ni(2+), Co(2+), As(3+), Fe(2+), Cd(2+), etc. The metal sensing mechanism is explained based on the turbidometric and X-ray diffraction (XRD) analysis of GK-Ag NPs with Hg(2+). The proposed method was successfully applied for the determination of Hg(2+) in various ground water samples. The reported method can be effectively used for the quantification of total Hg(2+) in samples, wherein the organic mercury is first oxidized to inorganic form by ultraviolet (UV) irradiation. The limit of quantification for Hg(2+) using the proposed method was as low as 4.9 × 10(-8) mol L(-1) (50 nM). The proposed method has potential application for on-field qualitative detection of Hg(2+) in aqueous environmental samples.

  9. Colorimetric detection of mercury species based on functionalized gold nanoparticles.

    PubMed

    Chen, Ling; Li, Jinhua; Chen, Lingxin

    2014-09-24

    The speciation analysis of heavy metal pollutants is very important because different species induce different toxicological effects. Nanomaterial-assisted optical sensors have achieved rapid developments, displaying wide applications to heavy metal ions but few to metal speciation analysis. In this work, a novel colorimetric nanosensor strategy for mercury speciation was proposed for the first time, based on the analyte-induced aggregation of gold nanoparticles (Au NPs) with the assistance of a thiol-containing ligand of diethyldithiocarbamate (DDTC). Upon the addition of mercury species, because Hg-DDTC was more stable than Cu-DDTC, a place-displacement between Hg species and Cu(2+) would occur, and thereby the functionalized Au NPs would aggregate, resulting in a color change. Moreover, by virtue of the masking effect of ethylenediaminetetraacetic acid (EDTA), the nanosensor could readily discriminate organic mercury and inorganic mercury (Hg(2+)), and it is thus anticipated to shed some light on the colorimetric sensing of organic mercury. So, a direct, simple colorimetric assay for selective determination of Hg species was obtained, presenting high detectability, such as up to 10 nM for Hg(2+) and 15 nM for methylmercury. Meanwhile, the strategy offered excellent selectivity toward mercury species against other metal ions. The simple, rapid, and sensitive label-free colorimetric sensor for the determination of Hg species provided an attractive alternative to conventional methods, which usually involve sophisticated instruments, complicated processes, and long periods of time. More importantly, by using mercury as a model, an excellent nanomaterial-based optical sensing platform can be developed for speciation analysis of trace heavy metals, which can lead to nanomaterials stability change through smart functionalization and reasonable interactions.

  10. A colorimetric sensor array for detection of triacetone triperoxide vapor.

    PubMed

    Lin, Hengwei; Suslick, Kenneth S

    2010-11-10

    Triacetone triperoxide (TATP), one of the most dangerous primary explosives, has emerged as an explosive of choice for terrorists in recent years. Owing to the lack of UV absorbance, fluorescence, or facile ionization, TATP is extremely difficult to detect directly. Techniques that are able to detect generally require expensive instrumentation, need extensive sample preparation, or cannot detect TATP in the gas phase. Here we report a simple and highly sensitive colorimetric sensor for the detection of TATP vapor with semiquantitative analysis from 50 ppb to 10 ppm. By using a solid acid catalyst to pretreat a gas stream, we have discovered that a colorimetric sensor array of redox sensitive dyes can detect even very low levels of TATP vapor from its acid decomposition products (e.g., H(2)O(2)) with limits of detection (LOD) below 2 ppb (i.e., <0.02% of its saturation vapor pressure). Common potential interferences (e.g., humidity, personal hygiene products, perfume, laundry supplies, volatile organic compounds, etc.) do not generate an array response, and the array can also differentiate TATP from other chemical oxidants (e.g., hydrogen peroxide, bleach, tert-butylhydroperoxide, peracetic acid).

  11. A colorimetric sensor array for detection of triacetone triperoxide vapor.

    PubMed

    Lin, Hengwei; Suslick, Kenneth S

    2010-11-10

    Triacetone triperoxide (TATP), one of the most dangerous primary explosives, has emerged as an explosive of choice for terrorists in recent years. Owing to the lack of UV absorbance, fluorescence, or facile ionization, TATP is extremely difficult to detect directly. Techniques that are able to detect generally require expensive instrumentation, need extensive sample preparation, or cannot detect TATP in the gas phase. Here we report a simple and highly sensitive colorimetric sensor for the detection of TATP vapor with semiquantitative analysis from 50 ppb to 10 ppm. By using a solid acid catalyst to pretreat a gas stream, we have discovered that a colorimetric sensor array of redox sensitive dyes can detect even very low levels of TATP vapor from its acid decomposition products (e.g., H(2)O(2)) with limits of detection (LOD) below 2 ppb (i.e., <0.02% of its saturation vapor pressure). Common potential interferences (e.g., humidity, personal hygiene products, perfume, laundry supplies, volatile organic compounds, etc.) do not generate an array response, and the array can also differentiate TATP from other chemical oxidants (e.g., hydrogen peroxide, bleach, tert-butylhydroperoxide, peracetic acid). PMID:20949933

  12. Colorimetric aptasensor using unmodified gold nanoparticles for homogeneous multiplex detection.

    PubMed

    Niu, Shucao; Lv, Zhenzhen; Liu, Jinchuan; Bai, Wenhui; Yang, Shuming; Chen, Ailiang

    2014-01-01

    Colorimetric aptasensors using unmodified gold nanoparticles (AuNPs) have attracted much attention because of their low cost, simplicity, and practicality, and they have been developed for various targets in the past several years. However, previous research has focused on developing single-target assays. Here, we report the development of a homogeneous multiplex aptasensor by using more than one class of aptamers to stabilize AuNPs. Using sulfadimethoxine (SDM), kanamycin (KAN) and adenosine (ADE) as example targets, a KAN aptamer (750 nM), an SDM aptamer (250 nM) and an ADE aptamer (500 nM) were mixed at a 1∶1∶1 volume ratio and adsorbed directly onto the surface of unmodified AuNPs by electrostatic interaction. Upon the addition of any of the three targets, the conformation of the corresponding aptamer changed from a random coil structure to a rigid folded structure, which could not adsorb and stabilize AuNPs. The AuNPs aggregated in a specific reaction buffer (20 mM Tris-HCl containing 20 mM NaCl and 5 mM KCl), which led to a color change from red to purple/blue. These results demonstrate that the multiplex colorimetric aptasensor detected three targets simultaneously while maintaining the same sensitivity as a single-target aptasensor for each individual target. The multiplex aptasensor could be extended to other aptamers for various molecular detection events. Due to its simple design, easy operation, fast response, cost effectiveness and lack of need for sophisticated instrumentation, the proposed strategy provides a powerful tool to examine large numbers of samples to screen for a small number of potentially positive samples containing more than one analyte, which can be further validated using sophisticated instruments. PMID:25279730

  13. Colorimetric detection of mercury ions based on plasmonic nanoparticles.

    PubMed

    Du, Jianjun; Jiang, Lin; Shao, Qi; Liu, Xiaogang; Marks, Robert S; Ma, Jan; Chen, Xiaodong

    2013-05-27

    The development of rapid, specific, cost-effective, and robust tools in monitoring Hg(2+) levels in both environmental and biological samples is of utmost importance due to the severe mercury toxicity to humans. A number of techniques exist, but the colorimetric assay, which is reviewed herein, is shown to be a possible tool in monitoring the level of mercury. These assays allow transforming target sensing events into color changes, which have applicable potential for in-the-field application through naked-eye detection. Specifically, plasmonic nanoparticle-based colorimetric assay exhibits a much better propensity for identifying various targets in terms of sensitivity, solubility, and stability compared to commonly used organic chromophores. In this review, recent progress in the development of gold nanoparticle-based colorimetric assays for Hg(2+) is summarized, with a particular emphasis on examples of functionalized gold nanoparticle systems with oligonucleotides, oligopeptides, and functional molecules. Besides highlighting the current design principle for plasmonic nanoparticle-based colorimetric probes, the discussions on challenges and the prospect of next-generation probes for in-the-field applications are also presented.

  14. Colorimetric detection of uranium in water

    DOEpatents

    DeVol, Timothy A.; Hixon, Amy E.; DiPrete, David P.

    2012-03-13

    Disclosed are methods, materials and systems that can be used to determine qualitatively or quantitatively the level of uranium contamination in water samples. Beneficially, disclosed systems are relatively simple and cost-effective. For example, disclosed systems can be utilized by consumers having little or no training in chemical analysis techniques. Methods generally include a concentration step and a complexation step. Uranium concentration can be carried out according to an extraction chromatographic process and complexation can chemically bind uranium with a detectable substance such that the formed substance is visually detectable. Methods can detect uranium contamination down to levels even below the MCL as established by the EPA.

  15. Colorimetric Detection of Bacteria Using Litmus Test.

    PubMed

    Tram, Kha; Manochehry, Sepehr; Feng, Qian; Chang, Dingran; Salena, Bruno J; Li, Yingfu

    2016-01-01

    There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test.

  16. Colorimetric Detection of Bacteria Using Litmus Test.

    PubMed

    Tram, Kha; Manochehry, Sepehr; Feng, Qian; Chang, Dingran; Salena, Bruno J; Li, Yingfu

    2016-01-01

    There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test. PMID:27685457

  17. Colorimetric Detection and Identification of Natural and Artificial Sweeteners

    PubMed Central

    Musto, Christopher J.; Lim, Sung H.; Suslick, Kenneth S.

    2009-01-01

    A disposable, low-cost colorimetric sensor array has been created by pin-printing onto a hydrophilic membrane 16 chemically responsive nanoporous pigments made from indicators immobilized in an organically modified silane (ormosil). The array has been used to detect and identify 14 different natural and artificial sweeteners at millimolar concentrations as well as commonly used individual serving sweetener packets. The array has shown excellent reproducibility and long shelf-life and has been optimized to work in the biological pH regime. PMID:20337402

  18. Method for colorimetric detection of double-stranded nucleic acid using leuco triphenylmethane dyes.

    PubMed

    Miyamoto, Shigehiko; Sano, Sotaro; Takahashi, Koji; Jikihara, Takaaki

    2015-03-15

    Because loop-mediated isothermal amplification (LAMP) can amplify substantial amounts of DNA under isothermal conditions, its applications for simple genetic testing have attracted considerable attention. A positive LAMP reaction is indicated by the turbidity caused by by-products or by the color change after adding a metallochromic indicator to the reaction solution, but these methods have certain limitations. Leuco crystal violet (LCV), a colorless dye obtained after sodium sulfite treatment of crystal violet (CV), was used as a new colorimetric method for detecting LAMP. LCV is reconverted into CV through contact with double-stranded DNA (dsDNA). Therefore, the positive reaction of LAMP is indicated by color change from colorless to violet. The assay is sensitive enough to detect LAMP products, with a detection limit of 7.1 ng/μl for dsDNA. It is also highly selective to dsDNA, and interference with single-stranded DNA and deoxynucleotide triphosphates (dNTPs) is not observed. LCV facilitates direct colorimetric detection of the main product rather than a by-product of the LAMP reaction; therefore, this method can be used under various reaction conditions such as those with added pyrophosphatase in solution. This colorimetric LAMP detection method using LCV is useful for point-of-care genetic testing given its simplicity. PMID:25575759

  19. A gold nanoparticle-based colorimetric probe for rapid detection of 1-hydroxypyrene in urine.

    PubMed

    Hu, Yaqi; Du, Chunyan; Li, Yunchao; Fan, Louzhen; Li, Xiaohong

    2015-07-01

    Direct and rapid detection of 1-hydroxypyrene (1-OHP) is of great importance owing to its high carcinogenicity, teratogenicity and toxicity. In this study, a simple colorimetric assay for rapid determination of 1-OHP is reported, which is based on non-crosslinking aggregation of gold nanoparticles (Au NPs) induced by 1-OHP in the presence of formic acid (FA). Initially, Au NPs were synthesized with citrate as the capping agent and exhibited red color. Subsequently, the addition of FA did not cause aggregation of Au NPs, but a proton transfer process occurred from FA to carboxylic anions on the surface of Au NPs with a decreased zeta potential. The subsequent addition of 1-OHP resulted in a further decreased zeta potential and an intensely hydrophobic environment, which led to a strong and rapid non-crosslinking aggregation of Au NPs within 5 min with the color changing from red to violet blue. Based on this principle, sensitive and selective detection of 1-OHP was achieved. The detection limit was 3.3 nM. Finally, the colorimetric assay was successfully applied to detect 1-OHP in a urine sample. This strategy provides new insights into developing colorimetric methods for on-site and real-time detection of polycyclic aromatic hydrocarbons. PMID:25988203

  20. Colorimetric paper bioassay for the detection of phenolic compounds.

    PubMed

    Alkasir, Ramiz S J; Ornatska, Maryna; Andreescu, Silvana

    2012-11-20

    A new type of paper based bioassay for the colorimetric detection of phenolic compounds including phenol, bisphenol A, catechol and cresols is reported. The sensor is based on a layer-by-layer (LbL) assembly approach formed by alternatively depositing layers of chitosan and alginate polyelectrolytes onto filter paper and physically entrapping the tyrosinase enzyme in between these layers. The sensor response is quantified as a color change resulting from the specific binding of the enzymatically generated quinone to the multilayers of immobilized chitosan on the paper. The color change can be quantified with the naked eye but a digitalized picture can also be used to provide more sensitive comparison to a calibrated color scheme. The sensor was optimized with respect to the number of layers, pH, enzyme, chitosan and alginate amounts. The colorimetric response was concentration dependent, with a detection limit of 0.86 (±0.1) μg/L for each of the phenolic compounds tested. The response time required for the sensor to reach steady-state color varied between 6 and 17 min depending on the phenolic substrate. The sensor showed excellent storage stability at room temperature for several months (92% residual activity after 260 days storage) and demonstrated good functionality in real environmental samples. A procedure to mass-produce the bioactive sensors by inkjet printing the LbL layers of polyelectrolyte and enzyme on paper is demonstrated. PMID:23113670

  1. Hybrid nanosensor for colorimetric and ultrasensitive detection of nuclease contaminations

    NASA Astrophysics Data System (ADS)

    Cecere, Paola; Valentini, Paola; Pompa, Pier Paolo

    2016-04-01

    Nucleases are ubiquitous enzymes that degrade DNA or RNA, thus they can prejudice the good outcome of molecular biology experiments involving nucleic acids. We propose a colorimetric test for the naked-eye detection of nuclease contaminations. The system uses an hybrid nanosensor, based on gold nanoparticles functionalized with DNA probes. Our assay is rapid, instrument-free, simple and low-cost. Moreover, it reaches sensitivity equal or better than those of commercial kits, and presents a lot of advantageous aspects. Therefore, it is very competitive, with a real market potential. This test will be relevant in routine process monitoring in scientific laboratories, and in quality control in clinical laboratories and industrial processes, allowing the simultaneous detection of nucleases with different substrate specificities and large-scale screening.

  2. Detection of biological thiols based on a colorimetric method*

    PubMed Central

    Xu, Yuan-yuan; Sun, Yang-yang; Zhang, Yu-juan; Lu, Chen-he; Miao, Jin-feng

    2016-01-01

    Biological thiols (biothiols), an important kind of functional biomolecules, such as cysteine (Cys) and glutathione (GSH), play vital roles in maintaining the stability of the intracellular environment. In past decades, studies have demonstrated that metabolic disorder of biothiols is related to many serious disease processes and will lead to extreme damage in human and numerous animals. We carried out a series of experiments to detect biothiols in biosamples, including bovine plasma and cell lysates of seven different cell lines based on a simple colorimetric method. In a typical test, the color of the test solution could gradually change from blue to colorless after the addition of biothiols. Based on the color change displayed, experimental results reveal that the percentage of biothiols in the embryonic fibroblast cell line is significantly higher than those in the other six cell lines, which provides the basis for the following biothiols-related study. PMID:27704750

  3. Double-stem Hairpin Probe and Ultrasensitive Colorimetric Detection of Cancer-related Nucleic Acids.

    PubMed

    Xu, Jianguo; Li, Hongling; Wu, Zai-Sheng; Qian, Jun; Xue, Chang; Jia, Lee

    2016-01-01

    The development of a versatile biosensing platform to screen specific DNA sequences is still an essential issue of molecular biology research and clinic diagnosis of genetic disease. In this work, we for the first time reported a double-stem hairpin probe (DHP) that was simultaneously engineered to incorporate a DNAzyme, DNAzyme's complementary fragment and nicking enzyme recognition site. The important aspect of this hairpin probe is that, although it is designed to have a long ds DNA fragment, no intermolecular interaction occurs, circumventing the sticky-end pairing-determined disadvantages encountered by classic molecular beacon. For the DHP-based colorimetric sensing system, as a model analyte, cancer-related DNA sequence can trigger a cascade polymerization/nicking cycle on only one oligonucleotide probe. This led to the dramatic accumulation of G-quadruplexes directly responsible for colorimetric signal conversion without any loss. As a result, the target DNA is capable of being detected to 1 fM (six to eight orders of magnitude lower than that of catalytic molecular beacons) and point mutations are distinguished by the naked eye. The described DHP as a-proof-of-concept would not only promote the design of colorimetric biosensors but also open a good way to promote the diagnosis and treatment of genetic diseases. PMID:26909108

  4. Double-stem Hairpin Probe and Ultrasensitive Colorimetric Detection of Cancer-related Nucleic Acids

    PubMed Central

    Xu, Jianguo; Li, Hongling; Wu, Zai-Sheng; Qian, Jun; Xue, Chang; Jia, Lee

    2016-01-01

    The development of a versatile biosensing platform to screen specific DNA sequences is still an essential issue of molecular biology research and clinic diagnosis of genetic disease. In this work, we for the first time reported a double-stem hairpin probe (DHP) that was simultaneously engineered to incorporate a DNAzyme, DNAzyme's complementary fragment and nicking enzyme recognition site. The important aspect of this hairpin probe is that, although it is designed to have a long ds DNA fragment, no intermolecular interaction occurs, circumventing the sticky-end pairing-determined disadvantages encountered by classic molecular beacon. For the DHP-based colorimetric sensing system, as a model analyte, cancer-related DNA sequence can trigger a cascade polymerization/nicking cycle on only one oligonucleotide probe. This led to the dramatic accumulation of G-quadruplexes directly responsible for colorimetric signal conversion without any loss. As a result, the target DNA is capable of being detected to 1 fM (six to eight orders of magnitude lower than that of catalytic molecular beacons) and point mutations are distinguished by the naked eye. The described DHP as a-proof-of-concept would not only promote the design of colorimetric biosensors but also open a good way to promote the diagnosis and treatment of genetic diseases. PMID:26909108

  5. Double-stem Hairpin Probe and Ultrasensitive Colorimetric Detection of Cancer-related Nucleic Acids.

    PubMed

    Xu, Jianguo; Li, Hongling; Wu, Zai-Sheng; Qian, Jun; Xue, Chang; Jia, Lee

    2016-01-01

    The development of a versatile biosensing platform to screen specific DNA sequences is still an essential issue of molecular biology research and clinic diagnosis of genetic disease. In this work, we for the first time reported a double-stem hairpin probe (DHP) that was simultaneously engineered to incorporate a DNAzyme, DNAzyme's complementary fragment and nicking enzyme recognition site. The important aspect of this hairpin probe is that, although it is designed to have a long ds DNA fragment, no intermolecular interaction occurs, circumventing the sticky-end pairing-determined disadvantages encountered by classic molecular beacon. For the DHP-based colorimetric sensing system, as a model analyte, cancer-related DNA sequence can trigger a cascade polymerization/nicking cycle on only one oligonucleotide probe. This led to the dramatic accumulation of G-quadruplexes directly responsible for colorimetric signal conversion without any loss. As a result, the target DNA is capable of being detected to 1 fM (six to eight orders of magnitude lower than that of catalytic molecular beacons) and point mutations are distinguished by the naked eye. The described DHP as a-proof-of-concept would not only promote the design of colorimetric biosensors but also open a good way to promote the diagnosis and treatment of genetic diseases.

  6. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  7. Highly Sensitive Colorimetric Detection of Ochratoxin A by a Label-Free Aptamer and Gold Nanoparticles

    PubMed Central

    Luan, Yunxia; Chen, Jiayi; Li, Cheng; Xie, Gang; Fu, Hailong; Ma, Zhihong; Lu, Anxiang

    2015-01-01

    A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OTA) was developed using a cationic polymer and gold nanoparticles (AuNPs). The OTA aptamer was used as a recognition element for the colorimetric detection of OTA based on the aggregation of AuNPs by the cationic polymer. By spectroscopic quantitative analysis, the colorimetric assay could detect OTA down to 0.009 ng/mL with high selectivity in the presence of other interfering toxins. This study offers a new alternative in visual detection methods that is rapid and sensitive for OTA detection. PMID:26690477

  8. Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin-producing Escherichia coli O157:H7 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for...

  9. A boron-dipyrromethene-based fluorescent probe for colorimetric and ratiometric detection of sulfite.

    PubMed

    Gu, Xianfeng; Liu, Chunhua; Zhu, Yi-Chun; Zhu, Yi-Zhun

    2011-11-23

    BODIPY-Le, a colorimetric and ratiometric fluorescent probe based on boron-dipyrromethene for selective detection sulfite ion, was investigated. Boron-dipyrromethene levulinyl ester (BODIPY-Le) is composed of an indole-based BODIPY dye and the levulinyl protective group, which could be easily and selectively deprotected by sulfites. As a result, the absorption and emission spectra show a dramatic red shift, and the development of a colorimetric and ratiometric fluorescent sulfite probe could be achieved. Besides, BODIPY-Le also exhibited prominent turn-on or turn-off type fluorogenic signaling toward sulfite ions once excited at 510 and 620 nm, respectively.

  10. Colorimetric Detection of Creatinine Based on Plasmonic Nanoparticles via Synergistic Coordination Chemistry.

    PubMed

    Du, Jianjun; Zhu, Bowen; Leow, Wan Ru; Chen, Shi; Sum, Tze Chien; Peng, Xiaojun; Chen, Xiaodong

    2015-09-01

    A simple and portable colorimetric assay for creatinine detection is fabricated based on the synergistic coordination of creatinine and uric acid with Hg(2+) on the surface of gold nanoparticles, which exhibits good selectivity and sensitivity. Point-of-care clinical creatinine monitoring can be supported for monitoring renal function and diagnosing corresponding renal diseases at home.

  11. Carbon nanotube-based labels for highly sensitive colorimetric and aggregation-based visual detection of nucleic acids

    NASA Astrophysics Data System (ADS)

    Lee, Ai Cheng; Ye, Jian-Shan; Ngin Tan, Swee; Poenar, Daniel P.; Sheu, Fwu-Shan; Kiat Heng, Chew; Meng Lim, Tit

    2007-11-01

    A novel carbon nanotube (CNT) derived label capable of dramatic signal amplification of nucleic acid detection and direct visual detection of target hybridization has been developed. Highly sensitive colorimetric detection of human acute lymphocytic leukemia (ALL) related oncogene sequences amplified by the novel CNT-based label was demonstrated. Atomic force microscope (AFM) images confirmed that a monolayer of horseradish peroxidase and detection probe molecules was immobilized along the carboxylated CNT carrier. The resulting CNT labels significantly enhanced the nucleic acid assay sensitivity by at least 1000 times compared to that of conventional labels used in enzyme-linked oligosorbent assay (ELOSA). An excellent detection limit of 1 × 10-12 M (60 × 10-18 mol in 60 µl) and a four-order wide dynamic range of target concentration were achieved. Hybridizations using these labels were coupled to a concentration-dependent formation of visible dark aggregates. Targets can thus be detected simply with visual inspection, eliminating the need for expensive and sophisticated detection systems. The approach holds promise for ultrasensitive and low cost visual inspection and colorimetric nucleic acid detection in point-of-care and early disease diagnostic application.

  12. A colorimetric sensor based on anodized aluminum oxide (AAO) substrate for the detection of nitroaromatics.

    SciTech Connect

    Liu, Y.; Wang, H. H.; Indacochea, J. E.; Wang, M. L.

    2011-12-15

    Simple and low cost colorimetric sensors for explosives detection were explored and developed. Anodized aluminum oxide (AAO) with large surface area through its porous structure and light background color was utilized as the substrate for colorimetric sensors. Fabricated thin AAO films with thickness less than {approx} 500 nm allowed us to observe interference colors which were used as the background color for colorimetric detection. AAO thin films with various thickness and pore-to-pore distance were prepared through anodizing aluminum foils at different voltages and times in dilute sulfuric acid. Various interference colors were observed on these samples due to their difference in structures. Accordingly, suitable anodization conditions that produce AAO samples with desired light background colors for optical applications were obtained. Thin film interference model was applied to analyze the UV-vis reflectance spectra and to estimate the thickness of the AAO membranes. We found that the thickness of produced AAO films increased linearly with anodization time in sulfuric acid. In addition, the growth rate was higher for AAO anodized using higher voltages. The thin film interference formulism was further validated with a well established layer by layer deposition technique. Coating poly(styrene sulfonate) sodium salt (PSS) and poly(allylamine hydrochloride) (PAH) layer by layer on AAO thin film consistently shifted its surface color toward red due to the increase in thickness. The red shift of UV-vis reflectance was correlated quantitatively to the number of layers been assembled. This sensitive red shift due to molecular attachment (increase in thickness) on AAO substrate was applied toward nitroaromatics detection. Aminopropyltrimethoxysilane (APTS) which can be attached onto AAO nanowells covalently through silanization and attract TNT molecules was coated and applied for TNT detection. UV-vis spectra of AAO with APTS shifted to the longer wavelength side due to

  13. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  14. Molecularly imprinted photonic hydrogels as colorimetric sensors for rapid and label-free detection of vanillin.

    PubMed

    Peng, Hailong; Wang, Shenqi; Zhang, Zhong; Xiong, Hua; Li, Jinhua; Chen, Lingxin; Li, Yanbin

    2012-02-29

    A novel colorimetric sensor for the rapid and label-free detection of vanillin, based on the combination of photonic crystal and molecular imprinting technique, was developed. The sensing platform of molecularly imprinted photonic hydrogel (MIPH) was prepared by a noncovalent and self-assembly approach using vanillin as a template molecule. Morphology characterization by scanning electron microscope (SEM) showed that the MIPH possessed a highly ordered three-dimensional (3D) macroporous structure with nanocavities. The vanillin recognition events of the created nonocavities could be directly transferred into readable optical signals through a change in Bragg diffraction of the ordered macropores array of MIPH. The Bragg diffraction peak shifted from 451 to 486 nm when the concentration of the vanillin was increased from 10⁻¹² to 10⁻³ mol L⁻¹ within 60 s, whereas there were no obvious peak shifts for methyl and ethyl vanillin, indicating that the MIPH had high selectivity and rapid response for vanillin. The adsorption results showed that the hierarchical porous structure and homogeneous layers were formed in the MIPH with higher adsorption capacity. The application of such a label-free sensor with high selectivity, high sensitivity, high stability, and easy operation might offer a potential method for rapid real-time detection of trace vanillin.

  15. Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection.

    PubMed

    Chen, Chaohui; Zou, Zhong; Chen, Lu; Ji, Xinghu; He, Zhike

    2016-10-28

    A colorimetric platform for influenza A virus detection was developed by using the high efficiency of enzymatic catalysis and the reduction of gold ions with hydrogen peroxide. Aptamer-functionalized magnetic microparticles were synthesized to capture the influenza A virus. This was followed by the binding of ConA-GOx-AuNPs to the H3N2 virus through the ConA-glycan interaction. The sandwich complex was subsequently dispersed in glucose solution to trigger an enzymatic reaction to produce hydrogen peroxide, which controlled the growth of gold nanoparticles and produced colored solutions. The determination of H3N2 concentration was realized by comparing the two differently colored gold nanoparticles. This method could detect the target virus as low as 11.16 μg ml(-1). Furthermore, it opens new opportunities for sensitive and colorimetric detection of viruses and proteins. PMID:27655150

  16. Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection.

    PubMed

    Chen, Chaohui; Zou, Zhong; Chen, Lu; Ji, Xinghu; He, Zhike

    2016-10-28

    A colorimetric platform for influenza A virus detection was developed by using the high efficiency of enzymatic catalysis and the reduction of gold ions with hydrogen peroxide. Aptamer-functionalized magnetic microparticles were synthesized to capture the influenza A virus. This was followed by the binding of ConA-GOx-AuNPs to the H3N2 virus through the ConA-glycan interaction. The sandwich complex was subsequently dispersed in glucose solution to trigger an enzymatic reaction to produce hydrogen peroxide, which controlled the growth of gold nanoparticles and produced colored solutions. The determination of H3N2 concentration was realized by comparing the two differently colored gold nanoparticles. This method could detect the target virus as low as 11.16 μg ml(-1). Furthermore, it opens new opportunities for sensitive and colorimetric detection of viruses and proteins.

  17. Colorimetric detection of hazardous gases using a remotely operated capturing and processing system.

    PubMed

    Montes-Robles, Roberto; Moragues, María Esperanza; Vivancos, José-Luis; Ibáñez, Javier; Fraile, Rubén; Martínez-Máñez, Ramón; García-Breijo, Eduardo

    2015-11-01

    This paper presents an electronic system for the automatic detection of hazardous gases. The proposed system implements colorimetric sensing algorithms, thus providing a low-cost solution to the problem of gas sensing. It is remotely operated and it performs the tasks of image capturing and processing, hence obtaining colour measurements in RGB (Red-Green-Blue) space that are subsequently sent to a remote operator via the internet. A prototype of the system has been built to test its performance. Specifically, experiments have been carried out aimed at the detection of CO, CO2, NO, NO2, SO2 and formaldehyde at diverse concentrations by using a chromogenic array composed by 13 active and 2 inert compounds. Statistical analyses of the results reveal a good performance of the electronic system and the feasibility of remote hazardous gas detection using colorimetric sensor arrays.

  18. Colorimetric detection of hazardous gases using a remotely operated capturing and processing system.

    PubMed

    Montes-Robles, Roberto; Moragues, María Esperanza; Vivancos, José-Luis; Ibáñez, Javier; Fraile, Rubén; Martínez-Máñez, Ramón; García-Breijo, Eduardo

    2015-11-01

    This paper presents an electronic system for the automatic detection of hazardous gases. The proposed system implements colorimetric sensing algorithms, thus providing a low-cost solution to the problem of gas sensing. It is remotely operated and it performs the tasks of image capturing and processing, hence obtaining colour measurements in RGB (Red-Green-Blue) space that are subsequently sent to a remote operator via the internet. A prototype of the system has been built to test its performance. Specifically, experiments have been carried out aimed at the detection of CO, CO2, NO, NO2, SO2 and formaldehyde at diverse concentrations by using a chromogenic array composed by 13 active and 2 inert compounds. Statistical analyses of the results reveal a good performance of the electronic system and the feasibility of remote hazardous gas detection using colorimetric sensor arrays. PMID:26434416

  19. Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection

    NASA Astrophysics Data System (ADS)

    Chen, Chaohui; Zou, Zhong; Chen, Lu; Ji, Xinghu; He, Zhike

    2016-10-01

    A colorimetric platform for influenza A virus detection was developed by using the high efficiency of enzymatic catalysis and the reduction of gold ions with hydrogen peroxide. Aptamer-functionalized magnetic microparticles were synthesized to capture the influenza A virus. This was followed by the binding of ConA-GOx-AuNPs to the H3N2 virus through the ConA-glycan interaction. The sandwich complex was subsequently dispersed in glucose solution to trigger an enzymatic reaction to produce hydrogen peroxide, which controlled the growth of gold nanoparticles and produced colored solutions. The determination of H3N2 concentration was realized by comparing the two differently colored gold nanoparticles. This method could detect the target virus as low as 11.16 μg ml-1. Furthermore, it opens new opportunities for sensitive and colorimetric detection of viruses and proteins.

  20. Colorimetric and ratiometric fluorescent detection of bisulfite by a new HBT-hemicyanine hybrid.

    PubMed

    Zhang, Haiyan; Huang, Zijun; Feng, Guoqiang

    2016-05-12

    A novel HBT-hemicyanine hybrid was prepared. This hybrid not only displays a large red-shifted (Δλ = 125 nm) emission compared to the well known ESIPT dye HBT, but also can be used as a new probe for rapid, colorimetric and ratiometric fluorescent detection of bisulfite with high selectivity and sensitivity in aqueous solution. The detection limit of this probe for HSO3(-) was calculated to be about 56 nM with a linear range of 0-25 μM. The potential application of this probe was exampled by detection of bisulfite in real food samples and living cells. Overall, this work not only provided a new ratiometric sensing platform, but also provided a new promising colorimetric and ratiometric fluorescent probe for bisulfite. PMID:27114225

  1. Colorimetric detection of Shewanella oneidensis based on immunomagnetic capture and bacterial intrinsic peroxidase activity

    NASA Astrophysics Data System (ADS)

    Wen, Junlin; Zhou, Shungui; Chen, Junhua

    2014-06-01

    Rapid detection and enumeration of target microorganisms is considered as a powerful tool for monitoring bioremediation process that typically involves cleaning up polluted environments with functional microbes. A novel colorimetric assay is presented based on immunomagnetic capture and bacterial intrinsic peroxidase activity for rapidly detecting Shewanella oneidensis, an important model organism for environmental bioremediation because of its remarkably diverse respiratory abilities. Analyte bacteria captured on the immunomagnetic beads provided a bacterial out-membrane peroxidase-amplified colorimetric readout of the immunorecognition event by oxidizing 3, 3', 5, 5'-tetramethylbenzidine (TMB) in the present of hydrogen peroxide. The high-efficiency of immunomagnetic capture and signal amplification of peroxidase activity offers an excellent detection performance with a wide dynamic range between 5.0 × 103 and 5.0 × 106 CFU/mL toward target cells. Furthermore, this method was demonstrated to be feasible in detecting S. oneidensis cells spiked in environmental samples. The proposed colorimetric assay shows promising environmental applications for rapid detection of target microorganisms.

  2. Colorimetric and fluorometric detection of neomycin based on conjugated polydiacetylene supramolecules.

    PubMed

    Zhou, Guodong; Wang, Fang; Wang, Huilin; Kambam, Srinivasulu; Chen, Xiaoqiang

    2013-06-13

    Utilizing the colorimetric and fluorogenic changes, a system based on polydiacetylenes (PDAs) is developed for the detection of neomycin. The PDA supramolecules polymerized from the mixed liposome composed of N-(3-hydroxyphenyl)pentacosa-10,12-diynamide (PCDA-AP) and pentacosa-10,12-diynoic acid (PCDA) at an optimized ratio of 1:9 display a unique colorimetric change (blue to red) and fluorescent enhancement in the presence of neomycin. The detection limit for neomycin is estimated to be 2.55 × 10(-7) M by the fluorogenic method. The optical changes induced by neomycin can be attributed to the disruption of the hydrogen bonding between phenol and carboxylic acid from PCDA-AP and PCDA.

  3. Digital analysis technique for uncertainty reduction in colorimetric arsenic detection method.

    PubMed

    Carro Perez, Magali E; Francisca, Franco M

    2013-01-01

    This article proposes an alternative to increase the reliability and reproducibility of a colorimetric method to measure arsenic (As) concentrations. The method of analysis developed incorporates a digital analysis technique to eliminate the operator dependence of results, and As concentrations are quantitatively determined from digital levels computed from photographs of the colorimetric reaction that emerges during the test. This technique allows the sensitivity of the detection to be increased at low concentration ranges, which is of fundamental importance for the detection of As given the current acceptable limit for drinking water. The results obtained show a very good correlation between As concentrations determined by means of analytical laboratory techniques and the method proposed in this research.

  4. A simple ratiometric and colorimetric chemosensor for the selective detection of fluoride in DMSO buffered solution

    NASA Astrophysics Data System (ADS)

    Niu, Hu; Shu, Qinghai; Jin, Shaohua; Li, Bingjun; Zhu, Jiaping; Li, Lijie; Chen, Shusen

    2016-01-01

    A derivative of squaramide (cyclobuta[b]quinoxaline-1, 2(3H, 8H)-dione) has been synthesized for the ratiometric and colorimetric sensing of F- in aqueous solution in competitive fashion. With F-, probe 1 showed a highly selective naked-eye detectable color change along with a characteristic UV-Vis absorbance over other tested ions, which probably originates from the deprotonation occurred between 1 and F-, as proved by the 1H NMR titration experiments and DFT calculations.

  5. A new rhodamine-based colorimetric chemosensor for naked-eye detection of Cu2 + in aqueous solution

    NASA Astrophysics Data System (ADS)

    Hu, Yang; Zhang, Jing; Lv, Yuan-Zheng; Huang, Xiao-Huan; Hu, Sheng-li

    2016-03-01

    A new colorimetric probe 1 based on rhodamine B lactam was developed for naked-eye detection of Cu2 +. The optical feature of 1 for Cu2 + was investigated by UV-vis absorption spectroscopy. Upon the addition of Cu2 +, the 1 displayed a distinct color change from colorless to pink, which can be directly detected by the naked eye. The stoichiometry of 1 to Cu2 + complex was found to be 1:1 and the naked-eye detection limit was determined as low as 2 μM. The results suggest that the probe 1 may provide a convenient method for visual detection of Cu2 + with high sensitivity.

  6. A new rhodamine-based colorimetric chemosensor for naked-eye detection of Cu(2+) in aqueous solution.

    PubMed

    Hu, Yang; Zhang, Jing; Lv, Yuan-Zheng; Huang, Xiao-Huan; Hu, Sheng-li

    2016-03-15

    A new colorimetric probe 1 based on rhodamine B lactam was developed for naked-eye detection of Cu(2+). The optical feature of 1 for Cu(2+) was investigated by UV-vis absorption spectroscopy. Upon the addition of Cu(2+), the 1 displayed a distinct color change from colorless to pink, which can be directly detected by the naked eye. The stoichiometry of 1 to Cu(2+) complex was found to be 1:1 and the naked-eye detection limit was determined as low as 2 μM. The results suggest that the probe 1 may provide a convenient method for visual detection of Cu(2+) with high sensitivity.

  7. An organic indicator functionalized graphene oxide nanocomposite-based colorimetric assay for the detection of sarcosine

    NASA Astrophysics Data System (ADS)

    Xue, Zhonghua; Yin, Bo; Wang, Hui; Li, Mengqian; Rao, Honghong; Liu, Xiuhui; Zhou, Xinbin; Lu, Xiaoquan

    2016-03-01

    Rapid detection of sarcosine is a key requirement for both diagnosis and treatment of disease. We report here a simple yet sensitive colorimetric nanocomposite platform for rapid detection of sarcosine in alkaline media. The approach exploited the benefits of a rapid color-producing reaction between an organic indicator, 1,2-naphthoquinone-4-sulphonic acid sodium salt (NQS), and the analyte of sarcosine species as well as the good catalytic ability of graphene oxide (GO) to the formation of highly colored products due to its good water dispersibility, extremely large surface area and facile surface modification. As a result, a NQS functionalized GO nanocomposite through π-π stacking has been demonstrated to be useful as a highly efficient catalyst system for the selective and sensitive colorimetric determination of sarcosine by providing a nanocomposite-amplified colorimetric response. Meanwhile, the strategy offered excellent selectivity toward sarcosine species against other amino acids as well as a satisfying detection limit of 0.73 μM. More importantly, by using an electrochemical method, a credible sensing mechanism of GO nanocomposite-based colorimetric platform for a special analyte determination can be easily verified and elucidated, which also provides an attractive alternative to conventional characterization strategies.Rapid detection of sarcosine is a key requirement for both diagnosis and treatment of disease. We report here a simple yet sensitive colorimetric nanocomposite platform for rapid detection of sarcosine in alkaline media. The approach exploited the benefits of a rapid color-producing reaction between an organic indicator, 1,2-naphthoquinone-4-sulphonic acid sodium salt (NQS), and the analyte of sarcosine species as well as the good catalytic ability of graphene oxide (GO) to the formation of highly colored products due to its good water dispersibility, extremely large surface area and facile surface modification. As a result, a NQS

  8. ``Red-to-blue'' colorimetric detection of cysteine via anti-etching of silver nanoprisms

    NASA Astrophysics Data System (ADS)

    Li, Yonglong; Li, Zihou; Gao, Yuexia; Gong, An; Zhang, Yujie; Hosmane, Narayan S.; Shen, Zheyu; Wu, Aiguo

    2014-08-01

    The reported strategies for cysteine (Cys) colorimetric detection based on noble metal nanomaterials include triggering aggregation, etching or fluorescence quenching of nanomaterials by Cys. In this study, we propose a new strategy for Cys colorimetric detection, i.e. anti-etching of silver nanoprisms (AgNPRs). In the absence of Cys, iodide ions (I-) could etch the corners and edges of AgNPRs and induce the morphology transition from nanoprism to nanodisk, which results in color change of the AgNPR dispersion from blue to red. In its presence, however, Cys can prevent the AgNPRs from I- attack. In that case, the color of the AgNPR dispersion containing I- and Cys remains blue. The mechanism is confirmed by using UV-vis spectra, TEM, DLS, Raman spectra and XPS spectra. According to the sensing effect of the Cys detection system, the concentration of I- incubated with AgNPRs, incubation time of AgNPRs and I-, and pH of AgNPR dispersions are optimized to 5.0 μM, 10 min, and pH 6.2, respectively. Under the optimized conditions, the proposed Cys detection system has excellent selectivity and high sensitivity. The limit of detection (LOD) of our Cys detection system is 25 nM by the naked eye, which is much better than the reported lowest LOD by eye-vision (100 nM), and 10 nM by UV-vis spectroscopy. The results of Cys detection in rabbit urine or plasma samples reinforce that our Cys detection system is applicable for rapid colorimetric detection of Cys in real body fluid samples.The reported strategies for cysteine (Cys) colorimetric detection based on noble metal nanomaterials include triggering aggregation, etching or fluorescence quenching of nanomaterials by Cys. In this study, we propose a new strategy for Cys colorimetric detection, i.e. anti-etching of silver nanoprisms (AgNPRs). In the absence of Cys, iodide ions (I-) could etch the corners and edges of AgNPRs and induce the morphology transition from nanoprism to nanodisk, which results in color change of the

  9. G-quadruplex-generating PCR for visual colorimetric detection of amplicons

    PubMed Central

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D.

    2013-01-01

    We have developed a self-reporting PCR system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNP). Amplification is performed using target-specific primers modified with a 5’-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point G-quadruplexes are forced to fold from PCR-generated duplex DNA and then used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  10. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  11. [Detection of viable metabolically active yeast cells using a colorimetric assay].

    PubMed

    Růzicka, F; Holá, V

    2008-02-01

    The increasing concern of yeasts able to form biofilm brings about the need for susceptibility testing of both planktonic and biofilm cells. Detection of viability or metabolic activity of yeast cells after exposure to antimicrobials plays a key role in the assessment of susceptibility testing results. Colorimetric assays based on the color change of the medium in the presence of metabolically active cells proved suitable for this purpose. In this study, the usability of a colorimetric assay with the resazurin redox indicator for monitoring the effect of yeast inoculum density on the reduction rate was tested. As correlation between the color change rate and inoculum density was observed, approximate quantification of viable cells was possible. The assay would be of relevance to antifungal susceptibility testing in both planktonic and biofilm yeasts.

  12. Label-Free Isothermal Amplification Assay for Specific and Highly Sensitive Colorimetric miRNA Detection

    PubMed Central

    2016-01-01

    We describe a new method for the detection of miRNA in biological samples. This technology is based on the isothermal nicking enzyme amplification reaction and subsequent hybridization of the amplification product with gold nanoparticles and magnetic microparticles (barcode system) to achieve naked-eye colorimetric detection. This platform was used to detect a specific miRNA (miRNA-10b) associated with breast cancer, and attomolar sensitivity was demonstrated. The assay was validated in cell culture lysates from breast cancer cells and in serum from a mouse model of breast cancer. PMID:27713932

  13. Visual detection of organophosphorus pesticides represented by mathamidophos using Au nanoparticles as colorimetric probe.

    PubMed

    Li, Hongkun; Guo, Jiajia; Ping, Hong; Liu, Lurui; Zhang, Minwei; Guan, Fengrui; Sun, Chunyan; Zhang, Qian

    2011-12-15

    With citrate-coated Au nanoparticles as colorimetric probe, a novel visual method for rapid assay of organophosphorus pesticides has been developed. The assay principle is based on catalytic hydrolysis of acetylthiocholine into thiocholine by acetylcholinesterase, which induces the aggregation of Au nanoparticles and the color change from claret-red to purple or even grey. The original plasmon absorption of Au nanoparticles at 522 nm decreases, and simultaneously, a new absorption band appears at 675 nm. The irreversible inhibition of organophosphorus pesticides on acetylcholinesterase prevents aggregation of Au nanoparticles. Under optimum conditions, the absorbance at 522 nm of Au nanoparticles is related linearly to the concentration of mathamidophos in the range of 0.02-1.42 μg/mL with a detection limit of 1.40 ng/mL. This colorimetric method has been successfully utilized to detect mathamidophos in vegetables with satisfactory results. The proposed colorimetric assay exhibits good reproducibility and accuracy, providing a simple and rapid method for the analysis of organophosphorus pesticides.

  14. Sensitive colorimetric detection of Listeria monocytogenes based on isothermal gene amplification and unmodified gold nanoparticles.

    PubMed

    Fu, Zhongyu; Zhou, Xiaoming; Xing, Da

    2013-12-15

    Listeria monocytogenes (L. monocytogenes), one of most problematic food-borne bacteria, is mainly transmitted through the food chain and may cause listeriosis. Therefore, the development of rapid and sensitive L. monocytogenes detection technique has become an urgent task. In this study, we proposed a method using hyperbranching rolling circle amplification (HRCA) combined with gold nanoparticle (GNP) based colorimetric strategy to offer an isothermal, highly sensitive and specific assay for the detection of L. monocytogenes. First, a linear padlock probe targeting a specific sequence in the hly gene was designed and followed with a ligation by Taq DNA ligase. After ligation, further amplification by HRCA with a thiolated primer and an unlabeled primer is performed. The resulting thiolated HRCA products were then captured onto GNP surface and made GNP more salt-tolerant. Detection of the bacteria can be achieved by a facilitated GNP based colorimetric testing using naked eyes. Through this approach, as low as 100 aM synthetic hly gene targets and about 75 copies of L. monocytogenes can be detected. The specificity is evaluated by distinguishing target L. monocytogenes from other bacteria. The artificial contaminated food samples were also detected for its potential applications in real food detection. This method described here is ideal for bacteria detection due to its simplicity and high sensitivity. PMID:23948710

  15. Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy.

    PubMed

    Wang, Kun; Fan, Daoqing; Liu, Yaqing; Wang, Erkang

    2015-11-15

    Simple, rapid, sensitive and specific detection of cancer cells is of great importance for early and accurate cancer diagnostics and therapy. By coupling nanotechnology and dual-aptamer target binding strategies, we developed a colorimetric assay for visually detecting cancer cells with high sensitivity and specificity. The nanotechnology including high catalytic activity of PtAuNP and magnetic separation & concentration plays a vital role on the signal amplification and improvement of detection sensitivity. The color change caused by small amount of target cancer cells (10 cells/mL) can be clearly distinguished by naked eyes. The dual-aptamer target binding strategy guarantees the detection specificity that large amount of non-cancer cells and different cancer cells (10(4) cells/mL) cannot cause obvious color change. A detection limit as low as 10 cells/mL with detection linear range from 10 to 10(5) cells/mL was reached according to the experimental detections in phosphate buffer solution as well as serum sample. The developed enzyme-free and cost effective colorimetric assay is simple and no need of instrument while still provides excellent sensitivity, specificity and repeatability, having potential application on point-of-care cancer diagnosis.

  16. Electrospun nanofiber based colorimetric probe for rapid detection of Fe2+ in water.

    PubMed

    Ondigo, D A; Tshentu, Z R; Torto, N

    2013-12-01

    An imidazole derivative, 2-(2'-pyridyl)imidazole (PIMH), was developed as a colorimetric probe for the qualitative analysis of Fe(2+) in aqueous solution. PIMH was then used to post-functionalize poly(vinylbenzyl chloride) (PVBC) nanofibers after electrospinning so as to afford a solid state colorimetric probe. Upon treatment with Fe(2+) the probe displayed a distinctive color change both in liquid and solid platforms. The linear dynamic range for the colorimetric determination of Fe(2+) was 0.0988-3.5 μg mL(-1). The ligand showed a high chromogenic selectivity for Fe(2+) over other cations with a detection limit of 0.102 μg mL(-1) in solution (lower than the WHO drinking water guideline limit of 2 mg L(-1)), and 2 μg mL(-1) in the solid state. The concentration of Fe(2+) in a certified reference material (Iron, Ferrous, 1072) was found to be 2.39±0.01 mg L(-1), which was comparable with the certified value of 2.44±0.12 mg L(-1). Application of the probe to real samples spiked with Fe(2+) achieved recoveries of over 97% confirming accuracy of the method and its potential for on-site monitoring. PMID:24267086

  17. Multi-colorimetric sensor array for detection of explosives in gas and liquid phase

    NASA Astrophysics Data System (ADS)

    Kostesha, N.; Alstrøm, T. S.; Johnsen, C.; Nielsen, K. A.; Jeppesen, J. O.; Larsen, J.; Boisen, A.; Jakobsen, M. H.

    2011-05-01

    In the framework of the research project "Xsense" at the Technical University of Denmark (DTU) we are developing a simple colorimetric sensor array which can be useful in detection of explosives like DNT, TATP, HMX, RDX and identification of reagents needed for making homemade explosives. The technology is based on an array of chemoselective compounds immobilized on a solid support. Upon exposure to the analyte in suspicion the colorimetric array changes color. Each chosen compound reacts chemo-selectively with analytes of interest. A change in a color signature indicates the presence of unknown explosives and volatile organic compounds (VOCs). We are working towards the selection of compounds that undergo color changes in the presence of explosives and VOCs, as well as the development of an immobilization method for the molecules. Digital imaging of the colorimetric array before and after exposure to the analytes creates a color difference map which gives a unique fingerprint for each explosive and VOCs. Such sensing technology can be used for screening relevant explosives in a complex background as well as to distinguish mixtures of volatile organic compounds distributed in gas and liquid phases. This sensor array is inexpensive, and can potentially be produced as single use disposable.

  18. Chloride accelerated Fenton chemistry for the ultrasensitive and selective colorimetric detection of copper.

    PubMed

    Shan, Zhi; Lu, Mingsheng; Wang, Li; MacDonald, Bruce; MacInnis, Judy; Mkandawire, Martin; Zhang, Xu; Oakes, Ken D

    2016-02-01

    A highly selective, ultrasensitive (visual and instrumental detection limits of 40 nM and 0.1 nM, respectively), environmentally-friendly, simple and rapid colorimetric sensor was developed for the detection of copper(II) in water. This sensor is based on a novel signal-amplification mechanism involving reactive halide species (RHSs) including chlorides or bromides, which accelerate copper Fenton reactions oxidizing the chromogenic substrate to develop colour. The results of this study expand our understanding of copper-based Fenton chemistry. PMID:26685747

  19. Iodide-Responsive Cu-Au Nanoparticle-Based Colorimetric Platform for Ultrasensitive Detection of Target Cancer Cells.

    PubMed

    Ye, Xiaosheng; Shi, Hui; He, Xiaoxiao; Wang, Kemin; He, Dinggeng; Yan, Lv'an; Xu, Fengzhou; Lei, Yanli; Tang, Jinlu; Yu, Yanru

    2015-07-21

    Colorimetric analysis is promising in developing facile, fast, and point-of-care cancer diagnosis techniques, but the existing colorimetric cancer cell assays remain problematic because of dissatisfactory sensitivity as well as complex probe design or synthesis. To solve the problem, we here present a novel colorimetric analytical strategy based on iodide-responsive Cu-Au nanoparticles (Cu-Au NPs) combined with the iodide-catalyzed H2O2-TMB (3,3,5,5-tetramethylbenzidine) reaction system. In this strategy, bimetallic Cu-Au NPs prepared with an irregular shape and a diameter of ∼15 nm could chemically absorb iodide, thus indirectly inducing colorimetric signal variation of the H2O2-TMB system. By further utilizing its property of easy biomolecule modification, a versatile colorimetric platform was constructed for detection of any target that could cause the change of Cu-Au NPs concentration via molecular recognition. As proof of concept, an analysis of human leukemia CCRF-CEM cells was performed using aptamer Sgc8c-modified Cu-Au NPs as the colorimetric probe. Results showed that Sgc8c-modified Cu-Au NPs successfully achieved a simple, label-free, cost-effective, visualized, selective, and ultrasensitive detection of cancer cells with a linear range from 50 to 500 cells/mL and a detection limit of 5 cells in 100 μL of binding buffer. Moreover, feasibility was demonstrated for cancer cell analysis in diluted serum samples. The iodide-responsive Cu-Au NP-based colorimetric strategy might not only afford a new design pattern for developing cancer cell assays but also greatly extend the application of the iodide-catalyzed colorimetric system.

  20. Cationic surfactant-based colorimetric detection of Plasmodium lactate dehydrogenase, a biomarker for malaria, using the specific DNA aptamer.

    PubMed

    Lee, Seonghwan; Manjunatha, D H; Jeon, Weejeong; Ban, Changill

    2014-01-01

    A simple, sensitive, and selective colorimetric biosensor for the detection of the malarial biomarkers Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum LDH (PfLDH) was demonstrated using the pL1 aptamer as the recognition element and gold nanoparticles (AuNPs) as probes. The proposed method is based on the aggregation of AuNPs using hexadecyltrimethylammonium bromide (CTAB). The AuNPs exhibited a sensitive color change from red to blue, which could be seen directly with the naked eye and was monitored using UV-visible absorption spectroscopy and transmission electron microscopy (TEM). The reaction conditions were optimized to obtain the maximum color intensity. PvLDH and PfLDH were discernible with a detection limit of 1.25 pM and 2.94 pM, respectively. The applicability of the proposed biosensor was also examined in commercially available human serum.

  1. A Rapid In Situ Colorimetric Assay for Cobalt Detection by the Naked Eye.

    PubMed

    Kang, Sung-Min; Jang, Sung-Chan; Kim, Gi Yong; Lee, Chang-Soo; Huh, Yun Suk; Roh, Changhyun

    2016-05-02

    A simple, rapid, and convenient colorimetric chemosensor of a specific target toward the end user is still required for on-site detection and real-time monitoring applications. In this study, we developed a rapid in situ colorimetric assay for cobalt detection using the naked eye. Interestingly, a yellow to light orange visual color transition was observed within 3 s when a Chrysoidine G (CG) chemosensor was exposed to cobalt. Surprisingly, the CG chemosensor had great selectivity toward cobalt without any interference of other metal ions. Under optimized conditions, a lower detection limit of 0.1 ppm via a spectrophotometer and a visual detection limit of 2 ppm with a linear range from 0.4 to 1 ppm (R² = 0.97) were determined. Moreover, the CG chemosensor is reversible and maintains its functionality after treatment with chelating agents. In conclusion, we show the superior capabilities of the CG chemosensor, which has the potential to provide extremely facile handling, high sensitivity, and a fast response time for applications of on-site detection to real-time cobalt monitoring for the general public.

  2. A Rapid In Situ Colorimetric Assay for Cobalt Detection by the Naked Eye

    PubMed Central

    Kang, Sung-Min; Jang, Sung-Chan; Kim, Gi Yong; Lee, Chang-Soo; Huh, Yun Suk; Roh, Changhyun

    2016-01-01

    A simple, rapid, and convenient colorimetric chemosensor of a specific target toward the end user is still required for on-site detection and real-time monitoring applications. In this study, we developed a rapid in situ colorimetric assay for cobalt detection using the naked eye. Interestingly, a yellow to light orange visual color transition was observed within 3 s when a Chrysoidine G (CG) chemosensor was exposed to cobalt. Surprisingly, the CG chemosensor had great selectivity toward cobalt without any interference of other metal ions. Under optimized conditions, a lower detection limit of 0.1 ppm via a spectrophotometer and a visual detection limit of 2 ppm with a linear range from 0.4 to 1 ppm (R2 = 0.97) were determined. Moreover, the CG chemosensor is reversible and maintains its functionality after treatment with chelating agents. In conclusion, we show the superior capabilities of the CG chemosensor, which has the potential to provide extremely facile handling, high sensitivity, and a fast response time for applications of on-site detection to real-time cobalt monitoring for the general public. PMID:27144568

  3. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection.

    PubMed

    Oh, Seung Jun; Park, Byung Hyun; Jung, Jae Hwan; Choi, Goro; Lee, Doh C; Kim, Do Hyun; Seo, Tae Seok

    2016-01-15

    We present a centrifugal microfluidic device which enables multiplex foodborne pathogen identification by loop-mediated isothermal amplification (LAMP) and colorimetric detection using Eriochrome Black T (EBT). Five identical structures were designed in the centrifugal microfluidic system to perform the genetic analysis of 25 pathogen samples in a high-throughput manner. The sequential loading and aliquoting of the LAMP cocktail, the primer mixtures, and the DNA sample solutions were accomplished by the optimized zigzag-shaped microchannels and RPM control. We targeted three kinds of pathogenic bacteria (Escherichia coli O157:H7, Salmonella typhimurium and Vibrio parahaemolyticus) and detected the amplicons of the LAMP reaction by the EBT-mediated colorimetric method. For the limit-of-detection (LOD) test, we carried out the LAMP reaction on a chip with serially diluted DNA templates of E. coli O157:H7, and could observe the color change with 380 copies. The used primer sets in the LAMP reaction were specific only to the genomic DNA of E. coli O157:H7, enabling the on-chip selective, sensitive, and high-throughput pathogen identification with the naked eyes. The entire process was completed in 60min. Since the proposed microsystem does not require any bulky and expensive instrumentation for end-point detection, our microdevice would be adequate for point-of-care (POC) testing with high simplicity and high speed, providing an advanced genetic analysis microsystem for foodborne pathogen detection.

  4. A Rapid In Situ Colorimetric Assay for Cobalt Detection by the Naked Eye.

    PubMed

    Kang, Sung-Min; Jang, Sung-Chan; Kim, Gi Yong; Lee, Chang-Soo; Huh, Yun Suk; Roh, Changhyun

    2016-01-01

    A simple, rapid, and convenient colorimetric chemosensor of a specific target toward the end user is still required for on-site detection and real-time monitoring applications. In this study, we developed a rapid in situ colorimetric assay for cobalt detection using the naked eye. Interestingly, a yellow to light orange visual color transition was observed within 3 s when a Chrysoidine G (CG) chemosensor was exposed to cobalt. Surprisingly, the CG chemosensor had great selectivity toward cobalt without any interference of other metal ions. Under optimized conditions, a lower detection limit of 0.1 ppm via a spectrophotometer and a visual detection limit of 2 ppm with a linear range from 0.4 to 1 ppm (R² = 0.97) were determined. Moreover, the CG chemosensor is reversible and maintains its functionality after treatment with chelating agents. In conclusion, we show the superior capabilities of the CG chemosensor, which has the potential to provide extremely facile handling, high sensitivity, and a fast response time for applications of on-site detection to real-time cobalt monitoring for the general public. PMID:27144568

  5. Direct colorimetric determination of formaldehyde in textile fabrics and other materials

    SciTech Connect

    Chrastil, J.; Reinhardt, R.M.

    1986-11-01

    A colorimetric method for direct determination of formaldehyde in textile fabrics and other materials is described. Color development and breaking formaldehyde bonds of the analyzed material occur simultaneously in the same reaction mixture without destruction of the material. The method is based on the color reaction of formaldehyde with indole-3-acetic acid or tryptophan. Common inorganic salts, higher aliphatic aldehydes, carbohydrates, amino acids (except tryptophan), and many other organic compounds do not react and do not interfere with the color reaction. Some interferences have been exhibited by acetaldehyde and glyoxal. The method was simple, accurate, and relatively insensitive to the reaction conditions. Only very small amounts of material are needed, and the reaction proceeds at room temperature. Different kinds of polymeric materials have been analyzed successfully (cotton, wool, plastics, collagen, wood, and furs). Most of the dyed fabrics or other materials could be analyzed in the same manner because under the reaction conditions the dyes were not extracted in the reaction mixture.

  6. Direct Quantification of Carotenoids in Low Fat Baby Foods Via Laser Photoacoustics and Colorimetric Index *

    NASA Astrophysics Data System (ADS)

    Dóka, O.; Ajtony, Zs.; Bicanic, D.; Valinger, D.; Végvári, Gy.

    2014-12-01

    Carotenoids are important antioxidants found in various foods including those for nutrition of infants. In this investigation, the total carotenoid content (TCC) of nine different commercially available baby foods was quantified using colorimetric index * obtained via reflectance colorimetry (RC) and by laser photoacoustic spectroscopy (LPAS) at 473 nm. The latter requires a minimum of sample preparation and only a one time calibration step which enables practically direct quantification of TCC. Results were verified versus UV-Vis spectrophotometry (SP) as the reference technique. It was shown that RC and LPAS (at 473 nm) provide satisfactory results for *, = 0.9925 and = 0.9972, respectively. Other color indices do not show a correlation with TCC. When determining the TCC in baby foods containing tomatoes, it is necessary to select a different analytical wavelength to compensate for the effect of lycopene's presence in the test samples.

  7. Highly sensitive colorimetric sensor for Hg(2+) detection based on cationic polymer/DNA interaction.

    PubMed

    Zhu, Yingyue; Cai, Yilin; Zhu, Yibo; Zheng, Lixue; Ding, Jianying; Quan, Ying; Wang, Limei; Qi, Bin

    2015-07-15

    The detection of ultralow concentrations of mercury is a currently significant challenge. Here, a novel strategy is proposed: the colorimetric detection of Hg(2+) based on the aggregation of gold nanoparticles (AuNPs) driven by a cationic polymer. In this three-component system, DNA combines electrostatically with phthalic diglycol diacrylate (PDDA) in a solution of AuNPs. In the presence of Hg(2+), thymine (T)-Hg(2+)-T induced hairpin turns are formed in the DNA strands, which then do not interact with PDDA, enabling the freed PDDA to subsequently facilitate aggregation of the AuNPs. Thus, according to the change in color from wine-red to blue-purple upon AuNPs aggregation, a colorimetric sensor is established to detect Hg(2+). Under optimal conditions, the color change is clearly seen with the naked eye. A linear range of 0.25-500nM was obtained by absorption spectroscopy with a detection limit of approximately 0.15nM. Additionally, the proposed method shows high selectivity toward Hg(2+) in the presence of other heavy metal ions. Real sample analysis was evaluated with the use of lake water and the results suggest good potential for practical application.

  8. A G-quadruplex DNAzyme-based colorimetric method for facile detection of Alicyclobacillus acidoterrestris.

    PubMed

    Liu, Tao; Zhang, Xiao; Zhu, Wenxin; Liu, Wei; Zhang, Daohong; Wang, Jianlong

    2014-09-01

    The rapid and sensitive detection of Alicyclobacillus acidoterrestris (AA) has become very important due to the frequent occurrence of fruit juice spoilage by AA. In the present study, using guaiacol, both as the metabolic product of AA related to its concentration and as a green colorimetric substrate of G-quadruplex DNAzyme, a novel G-quadruplex DNAzyme-based colorimetric method for a rapid detection of AA has been developed for the first time. Under optimal conditions, AA has been successfully detected in the concentration range of 10(2)-10(5) cfu mL(-1) with a detection limit of 85 cfu mL(-1). The recoveries ranging from 71.8% to 115.7% with relative standard deviation from 1.2% to 6.6% in spiked apple and orange juice samples were obtained. Results demonstrate that the sensitivity and precision of the developed method is comparable with most other analytical methods and is prominently rapid than them. We believe that the work provides a novel and effective approach and is beneficial for monitoring and reducing the risk of AA contaminations during the process of fruit juice production.

  9. Paper-based vapor detection of hydrogen peroxide: colorimetric sensing with tunable interface.

    PubMed

    Xu, Miao; Bunes, Benjamin R; Zang, Ling

    2011-03-01

    Vapor detection of hydrogen peroxide still remains challenging for conventional sensing techniques, though such vapor detection implies important applications in various practical areas, including locating IEDs. We report herein a new colorimetric sensor system that can detect hydrogen peroxide vapor down to parts per billion level. The sensory materials are based on the cellulose microfibril network of paper towels, which provide a tunable interface for modification with Ti(IV) oxo complexes for binding and reacting with H(2)O(2). The Ti(IV)-peroxide bond thus formed turns the complex from colorless to bright yellow with an absorption maximum around 400 nm. Such complexation-induced color change is exclusively selective for hydrogen peroxide, with no color change observed in the presence of water, oxygen, common organic reagents or other chelating reagents. This paper-based sensor material is disposable and one-time use, representing a cheap, simple approach to detect peroxide vapors. The reported sensor system also proves the technical feasibility of developing enhanced colorimetric sensing using nanofibril materials that will provide plenty of room to enlarge the surface area (by shrinking the fiber size), so as to enhance the surface interaction with gas phase. PMID:21355618

  10. Selective and sensitive colorimetric detection of stringent alarmone ppGpp with Fenton-like reagent.

    PubMed

    Zheng, Lin Ling; Huang, Cheng Zhi

    2014-12-01

    Stringent alarmone, namely, guanosine 3'-diphosphate-5'-diphosphate (ppGpp), is a global regulator that plays a critical role in the survival, growth, metabolism, and many other vital processes of microorganisms. Because of its structural similarity to normal nucleotides, it is also a challenge for the selective and sensitive detection of ppGpp nowadays. Herein, we developed a colorimetric method for the selective detection of ppGpp by inhibiting the redox reaction between Fenton-like reagent (composed of Fe(3+) and H2O2) with 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS). Owing to the strong coordination affinity between ppGpp and Fe(3+), the chromogenic reaction between ABTS and Fenton-like reagent, occurred in aqueous medium at 37 °C and resulted in a bluish-green solution, which was inhibited with the addition of ppGpp. This phenomenon forms the basis for the colorimetric detection of ppGpp, with a detection limit of 0.19 μM and good selectivity for ppGpp over other nucleotides and anions. Furthermore, the results could be visualized by the naked eye, and the sensitivity of the naked-eye observation could even be further improved with the aid of the introduction of a background color.

  11. Highly sensitive colorimetric sensor for Hg(2+) detection based on cationic polymer/DNA interaction.

    PubMed

    Zhu, Yingyue; Cai, Yilin; Zhu, Yibo; Zheng, Lixue; Ding, Jianying; Quan, Ying; Wang, Limei; Qi, Bin

    2015-07-15

    The detection of ultralow concentrations of mercury is a currently significant challenge. Here, a novel strategy is proposed: the colorimetric detection of Hg(2+) based on the aggregation of gold nanoparticles (AuNPs) driven by a cationic polymer. In this three-component system, DNA combines electrostatically with phthalic diglycol diacrylate (PDDA) in a solution of AuNPs. In the presence of Hg(2+), thymine (T)-Hg(2+)-T induced hairpin turns are formed in the DNA strands, which then do not interact with PDDA, enabling the freed PDDA to subsequently facilitate aggregation of the AuNPs. Thus, according to the change in color from wine-red to blue-purple upon AuNPs aggregation, a colorimetric sensor is established to detect Hg(2+). Under optimal conditions, the color change is clearly seen with the naked eye. A linear range of 0.25-500nM was obtained by absorption spectroscopy with a detection limit of approximately 0.15nM. Additionally, the proposed method shows high selectivity toward Hg(2+) in the presence of other heavy metal ions. Real sample analysis was evaluated with the use of lake water and the results suggest good potential for practical application. PMID:25727033

  12. Colorimetric and fluorescence detection of G-quadruplex nucleic acids with a coumarin-benzothiazole probe.

    PubMed

    Yan, Jin-wu; Tian, Yi-guang; Tan, Jia-heng; Huang, Zhi-shu

    2015-11-01

    A colorimetric and red-emitting fluorescent dual probe for G-quadruplexes was devised with a conjugated coumarin-benzothiazole scaffold. Its significant and distinct changes in both color and fluorescence enable the label-free and visual detection of G-quadruplex structures. In addition, this probe gives a distinct strong emission response to the nucleoli in fixed cells imaging, which might be attributed to the interaction between the probe and rDNA G-quadruplex based on the chromatin immunoprecipitation assay. All these results suggest its promising application prospects in the G-quadruplex research field.

  13. Nucleic acid-coupled colorimetric analyte detectors

    DOEpatents

    Charych, Deborah H.; Jonas, Ulrich

    2001-01-01

    The present invention relates to methods and compositions for the direct detection of analytes and membrane conformational changes through the detection of color changes in biopolymeric materials. In particular, the present invention provide for the direct colorimetric detection of analytes using nucleic acid ligands at surfaces of polydiacetylene liposomes and related molecular layer systems.

  14. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. PMID:21530479

  15. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food.

  16. Simple colorimetric detection of doxycycline and oxytetracycline using unmodified gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Li, Jie; Fan, Shumin; Li, Zhigang; Xie, Yuanzhe; Wang, Rui; Ge, Baoyu; Wu, Jing; Wang, Ruiyong

    2014-08-01

    The interaction between tetracycline antibiotics and gold nanoparticles was studied. With citrate-coated gold nanoparticles as colorimetric probe, a simple and rapid detection method for doxycycline and oxytetracycline has been developed. This method relies on the distance-dependent optical properties of gold nanoparticles. In weakly acidic buffer medium, doxycycline and oxytetracycline could rapidly induce the aggregation of gold nanoparticles, resulting in red-to-blue (or purple) colour change. The experimental parameters were optimized with regard to pH, the concentration of the gold nanoparticles and the reaction time. Under optimal experimental conditions, the linear range of the colorimetric sensor for doxycycline/oxytetracycline was 0.06-0.66 and 0.59-8.85 μg mL-1, respectively. The corresponding limit of detection for doxycycline and oxytetracycline was 0.0086 and 0.0838 μg mL-1, respectively. This assay was sensitive, selective, simple and readily used to detect tetracycline antibiotics in food products.

  17. DNAzyme molecular beacon probes for target-induced signal-amplifying colorimetric detection of nucleic acids.

    PubMed

    Fu, Rongzhan; Li, Taihua; Lee, Soo Suk; Park, Hyun Gyu

    2011-01-15

    A novel DNAzyme molecular beacon (DNAzymeMB) strategy was developed for target-induced signal-amplifying colorimetric detection of target nucleic acids. The DNAzymeMB, which exhibits peroxidase activity in its free hairpin structure, was engineered to form a catalytically inactive hybrid through hybridization with a blocker DNA. The presence of target DNA leads to dissociation of the DNAzymeMB from the inactive hybrid through hybridization with the blocker DNA. This process results in recovery of the catalytically active DNAzymeMB, which can catalyze a colorimetric reaction that signals the presence of the target DNA. In addition, a primer was rationally designed to anneal to the blocker DNA of the blocker/target DNA duplex and displace the bound target DNA during the extension reaction. The released target DNA triggers the next cycle involving hybridization with blocker DNA, DNAzymeMB dissociation, primer extension, and target displacement. This unique amplifying strategy leads to the generation of multiple numbers of active DNAzymeMB molecules from a single target molecule and gives a detection limit down to 1 pM, a value that is nearly 3 or 5 orders of magnitude lower than those of previously reported DNAzyme molecular beacon-based DNA detection methods.

  18. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food. PMID:27612649

  19. Fully automated and colorimetric foodborne pathogen detection on an integrated centrifugal microfluidic device.

    PubMed

    Oh, Seung Jun; Park, Byung Hyun; Choi, Goro; Seo, Ji Hyun; Jung, Jae Hwan; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-05-21

    This work describes fully automated and colorimetric foodborne pathogen detection on an integrated centrifugal microfluidic device, which is called a lab-on-a-disc. All the processes for molecular diagnostics including DNA extraction and purification, DNA amplification and amplicon detection were integrated on a single disc. Silica microbeads incorporated in the disc enabled extraction and purification of bacterial genomic DNA from bacteria-contaminated milk samples. We targeted four kinds of foodborne pathogens (Escherichia coli O157:H7, Salmonella typhimurium, Vibrio parahaemolyticus and Listeria monocytogenes) and performed loop-mediated isothermal amplification (LAMP) to amplify the specific genes of the targets. Colorimetric detection mediated by a metal indicator confirmed the results of the LAMP reactions with the colour change of the LAMP mixtures from purple to sky blue. The whole process was conducted in an automated manner using the lab-on-a-disc and a miniaturized rotary instrument equipped with three heating blocks. We demonstrated that a milk sample contaminated with foodborne pathogens can be automatically analysed on the centrifugal disc even at the 10 bacterial cell level in 65 min. The simplicity and portability of the proposed microdevice would provide an advanced platform for point-of-care diagnostics of foodborne pathogens, where prompt confirmation of food quality is needed. PMID:27112702

  20. Colorimetric detection of clinical DNA samples using an intercalator-conjugated polydiacetylene sensor.

    PubMed

    Jung, Yun Kyung; Park, Hyun Gyu

    2015-10-15

    We herein developed a novel colorimetric polydiacetylene (PDA) sensor for very convenient detection of clinical DNA samples based on the interaction between an intercalator and dsDNA. We modified the terminal carboxyl group of a diacetylene monomer (10,12-pentacosadiynoic acid; PCDA) with the intercalator 9-aminoacridine (9AA) and prepared 9AA-modified PDA liposomes containing PCDA-9AA/PCDA/phospholipid (1,2-dimyristoyl-rac-glycero-3-phosphocholine) at a molar ratio of 1.5:6.5:2.0. The PDA sensor underwent an obvious color transition from blue to red in the presence of dsDNA molecules that were PCR-amplified from genomic DNA due to the insertion of the 9AA head group of PDA into the dsDNA. DNA concentrations as low as 20 nM and relatively small molecules (around 100 base pairs) could be detected by the sensor within 1h without DNA electrophoresis. This novel colorimetric method is simple, does not require any instrument, and is therefore appropriate for POCT or portable molecular diagnostic kit. PMID:25978440

  1. Gold nanoparticle aggregation-based colorimetric assay for β-casein detection in bovine milk samples.

    PubMed

    Li, Y S; Zhou, Y; Meng, X Y; Zhang, Y Y; Song, F; Lu, S Y; Ren, H L; Hu, P; Liu, Z S; Zhang, J H

    2014-11-01

    Traditional Kjeldahl method, used for quality evaluation of bovine milk, has intrinsic defects of time-consuming sample preparation and two analyses to determine the difference between non-protein nitrogen content and total protein nitrogen content. Herein, based upon antibody functionalized gold nanoparticles (AuNPs), we described a colorimetric method for β-casein (β-CN) detection in bovine milk samples. The linear dynamic range and the LOD were 0.08-250 μg mL(-1), and 0.03 μg mL(-1) respectively. In addition, the real content of β-CN in bovine milk was measured by using the developed assay. The results are closely correlated with those from Kjeldahl method. The advantages of β-CN triggered AuNP aggregation-based colorimetric assay are simple signal generation, the high sensitivity and specificity as well as no need of complicated sample preparation, which make it for on-site detection of β-CN in bovine milk samples.

  2. Colorimetric Detection of Cadmium Ions Using DL-Mercaptosuccinic Acid-Modified Gold Nanoparticles.

    PubMed

    Chen, Na; Chen, Jun; Yang, Jing-Hua; Bai, Lian-Yang; Zhang, Yu-Ping

    2016-01-01

    A colorimetric assay has been developed for detection of Cd²⁺ utilizing DL-mercaptosuccinic acid-modified gold nanoparticles (MSA-AuNPs). The method showed good selectivity for Cd²⁺ over other metal ions. As a result, the linear relationships (r > 0.9606) between concentration 0.07 mM and 0.20 mM for cadmium ion were obtained. The detection limit was as low as 0.07 mM by the naked eye. The effect of pH on the aggregation was optimized. The MSA-AuNPs probe could be used to detect Cd²⁺ in an aqueous solution based on the aggregation-induced color change of MSA-AuNPs. PMID:27398533

  3. Novel pyridyl based azo-derivative for the selective and colorimetric detection of nickel(II)

    NASA Astrophysics Data System (ADS)

    Biswas, Sujan; Acharyya, Samik; Sarkar, Deblina; Gharami, Saswati; Mondal, Tapan Kumar

    2016-04-01

    A highly sensitive and selective pyridyl based colorimetric chemosensor (H2L) for the efficient detection of Ni2 + has been reported. The synthesized chemosensor H2L is highly efficient in detecting Ni2 + even in the presence of other metal ions that commonly co-exist with Ni2 +. H2L also shows distinct color change from green to deep red visible under naked eye due to specific binding with Ni2 +. This color change is due to formation of a new band at 510 nm upon gradual addition of Ni2 +. The association constant has been found to be 1.27 × 105 M- 1 with limit of detection (LOD) of 8.3 × 10- 7 M. Electronic structure of the H2L-Ni2 + complex and sensing mechanism have been interpreted theoretically by DFT and TDDFT calculations.

  4. Nanomolar colorimetric quantitative detection of Fe3 + and PPi with high selectivity

    NASA Astrophysics Data System (ADS)

    Li, Zhanxian; Li, Haixia; Shi, Caixia; Yu, Mingming; Wei, Liuhe; Ni, Zhonghai

    2016-04-01

    A novel rhodamine and 8-hydroxyquinoline-based derivative was synthesized, which is shown to act as a colorimetric chemosensor for Fe3 + in aqueous solution with high selectivity over various environmentally and biologically relevant metal ions and anions with a distinct color change from colorless to pink in very fast response time (< 1 min). Fe3 + can be detected quantitatively in the concentration range from 6.7 to 16 μM and the detection limit (LOD) on UV-vis response of the sensor can be as low as 15 nM. The 'in situ' prepared Fe3 + complex (1 ṡ Fe) showed high selectivity toward PPi against many common anions, and sensitivity (the LOD can be as low as 71 nM). In addition, both the chemosensor and the 'in situ' prepared Fe3 + complex are reusable for the detection of Fe3 + and PPi respectively.

  5. Colorimetric detection of urine glucose based ZnFe2O4 magnetic nanoparticles.

    PubMed

    Su, Li; Feng, Jie; Zhou, Ximin; Ren, Cuiling; Li, Honghong; Chen, Xingguo

    2012-07-01

    In this paper, we discovered that ZnFe(2)O(4) magnetic nanoparticles (MNPs) possess intrinsic peroxidase-like activity. ZnFe(2)O(4) MNPs exhibit several advantages such as high catalytic efficiency, good stability, monodispersion, and rapid separation over other peroxidase nanomimetics and horseradish peroxidase (HRP). ZnFe(2)O(4) MNPs were used as a colorimetric biosensor for the detection of urine glucose. This method is simple, inexpensive, highly sensitive, and selective for glucose detection using glucose oxidase (GOx) and ZnFe(2)O(4) MNPs with a linear range from 1.25 × 10(-6) to 1.875 × 10(-5) mol L(-1) with a detection limit of 3.0 × 10(-7) mol L(-1). The color change observable by the naked eyes based on the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) is the principle for the sensing of urine glucose level. PMID:22702236

  6. Antibody modified gold nanoparticles for fast and selective, colorimetric T7 bacteriophage detection.

    PubMed

    Lesniewski, Adam; Los, Marcin; Jonsson-Niedziółka, Martin; Krajewska, Anna; Szot, Katarzyna; Los, Joanna M; Niedziolka-Jonsson, Joanna

    2014-04-16

    Herein, we report a colorimetric immunosensor for T7 bacteriophage based on gold nanoparticles modified with covalently bonded anti-T7 antibodies. The new immunosensor allows for a fast, simple, and selective detection of T7 virus. T7 virions form immunological complexes with the antibody modified gold nanoparticles which causes them to aggregate. The aggregation can be observed with the naked eye as a color change from red to purple, as well as with a UV-vis spectrophotometer. The aggregate formation was confirmed with SEM imaging. Sensor selectivity against the M13 bacteriophage was demonstrated. The limit of detection (LOD) is 1.08 × 10(10) PFU/mL (18 pM) T7. The new method was compared with a traditional plaque test. In contrast to biological tests the colorimetric method allows for detection of all T7 phages, not only those biologically active. This includes phage ghosts and fragments of virions. T7 virus has been chosen as a model organism for adenoviruses. The described method has several advantages over the traditional ones. It is much faster than a standard plaque test. It is more robust since no bacteria-virus interactions are utilized in the detection process. Since antibodies are available for a large variety of pathogenic viruses, the described concept is very flexible and can be adapted to detect many different viruses, not only bacteriophages. Contrary to the classical immunoassays, it is a one-step detection method, and no additional amplification, e.g., enzymatic, is needed to read the result.

  7. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  8. New function of exonuclease and highly sensitive label-free colorimetric DNA detection.

    PubMed

    Li, Hongbo; Wang, Suqin; Wu, Zaisheng; Xu, Jianguo; Shen, Guoli; Yu, Ruqin

    2016-03-15

    Enzymatic manipulation and modulation of nucleic acids are a central part of cellular function, protection, and reproduction, while rapid and accurate detection of ultralow amount of nucleic acids remains a major challenge in molecular biology research and clinic diagnosis of genetic diseases. Herein, we reported that exonuclease III can degrade the G-quadruplex structure, indicating the new exonuclease's function. Basing on the function of exonuclease III, a novel G-quadruplex-hemin DNAzyme-based colorimetric detection of tumor suppressor gene p53 was successfully developed. Although only one oligonucleotide probe was involved, the sensing strategy could suppress the optical background and achieve an efficient G-quadruplex-hemin DNAzyme-based signal amplification. Specifically, a label-free functional nucleic acid probe (called THzyme probe) was designed via introducing target DNA probe-contained hairpin structure into G-quadruplex DNAzyme. Even if this probe can fold into G-quadruplex structure in the presence of hemin very different from the double-stranded DNA, it is easily degraded by exonuclease III. Thus, no change in UV-vis absorption intensity is detected in the absence of target DNA. However, the hybridization of target DNA can protect the integrity and catalytic activity of THzyme probe, producing the DNAzyme-amplified colorimetric signal. As a result, the p53 gene was able to be detected down to 1.0 pM (final concentration in the signal-generating solution: 50.0 fM) and mismatched target DNAs were easily distinguished. It is expected that this simple sensing methodology for DNA detection can find its utility in point-of-care applications. PMID:26519729

  9. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  10. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  11. Beetroot-pigment-derived colorimetric sensor for detection of calcium dipicolinate in bacterial spores.

    PubMed

    Gonçalves, Letícia Christina Pires; Da Silva, Sandra Maria; DeRose, Paul C; Ando, Rômulo Augusto; Bastos, Erick Leite

    2013-01-01

    In this proof-of-concept study, we describe the use of the main red beet pigment betanin for the quantification of calcium dipicolinate in bacterial spores, including Bacillus anthracis. In the presence of europium(III) ions, betanin is converted to a water-soluble, non-luminescent orange 1∶1 complex with a stability constant of 1.4 × 10(5) L mol(-1). The addition of calcium dipicolinate, largely found in bacterial spores, changes the color of the aqueous solution of [Eu(Bn)(+)] from orange to magenta. The limit of detection (LOD) of calcium dipicolinate is around 2.0 × 10(-6) mol L(-1) and the LOD determined for both spores, B. cereus and B. anthracis, is (1.1 ± 0.3)× 10(6) spores mL(-1). This simple, green, fast and low cost colorimetric assay was selective for calcium dipicolinate when compared to several analogous compounds. The importance of this work relies on the potential use of betalains, raw natural pigments, as colorimetric sensors for biological applications. PMID:24019934

  12. Nylon 6-Gold Nanoparticle Composite Fibers for Colorimetric Detection of Urinary 1-Hydroxypyrene

    NASA Astrophysics Data System (ADS)

    Ifegwu, O. Clinton; Anyakora, C.; Torto, N.

    2015-05-01

    A one-step in situ synthesis of nylon 6 nanofibers filled with gold nanoparticles for the colorimetric probe of 1-hydroxypyrene, a biomarker associated with the largest class of cancer-causing chemical compounds polycyclic aromatic hydrocarbons (PAHs) is proposed in this study. The gold nanoparticles (AuNPs) were successfully embedded on the surface of the nylon 6 fibers where the gold particles were chemisorbed onto the amide groups in the nylon 6 backbones. By electrospinning the nylon 6/gold nanocomposite, the gold nanoparticles were uniformly dispersed on the polymer fibers to give a photostable reddish white fiber which turned purple/blue when brought in contact with a standard solution of the biomarker. The TEM revealed the formation of spherical AuNPs with an average diameter of 8 nm well arrayed within the nanofibers, but no significant change in the morphology of the nanofibers was observed. The thermal properties of the composite fibers were greatly improved compared to the electrospun nylon 6 fiber. The developed method described herein is simple, effective, requires no post-treatments, and is highly sensitive (100 ng/ml) hence the nanocomposite fibers can be employed as a test strip for the colorimetric detection of 1-hydroxypyrene in human urine or other diagnostic probe biosensors.

  13. Detecting Optic Atrophy in Multiple Sclerosis Patients Using New Colorimetric Analysis Software: From Idea to Application.

    PubMed

    Bambo, Maria Pilar; Garcia-Martin, Elena; Perez-Olivan, Susana; Larrosa-Povés, José Manuel; Polo-Llorens, Vicente; Gonzalez-De la Rosa, Manuel

    2016-01-01

    Neuro-ophthalmologists typically observe a temporal pallor of the optic disc in patients with multiple sclerosis. Here, we describe the emergence of an idea to quantify these optic disc color changes in multiple sclerosis patients. We recruited 12 multiple sclerosis patients with previous optic neuritis attack and obtained photographs of their optic discs. The Laguna ONhE, a new colorimetric software using hemoglobin as the reference pigment in the papilla, was used for the analysis. The papilla of these multiple sclerosis patients showed greater pallor, especially in the temporal sector. The software detected the pallor and assigned hemoglobin percentages below normal reference values. Measurements of optic disc hemoglobin levels obtained with the Laguna ONhE software program had good ability to detect optic atrophy and, consequently, axonal loss in multiple sclerosis patients. This new technology is easy to implement in routine clinical practice.

  14. Simple and Sensitive Paper-Based Device Coupling Electrochemical Sample Pretreatment and Colorimetric Detection.

    PubMed

    Silva, Thalita G; de Araujo, William R; Muñoz, Rodrigo A A; Richter, Eduardo M; Santana, Mário H P; Coltro, Wendell K T; Paixão, Thiago R L C

    2016-05-17

    We report the development of a simple, portable, low-cost, high-throughput visual colorimetric paper-based analytical device for the detection of procaine in seized cocaine samples. The interference of most common cutting agents found in cocaine samples was verified, and a novel electrochemical approach was used for sample pretreatment in order to increase the selectivity. Under the optimized experimental conditions, a linear analytical curve was obtained for procaine concentrations ranging from 5 to 60 μmol L(-1), with a detection limit of 0.9 μmol L(-1). The accuracy of the proposed method was evaluated using seized cocaine samples and an addition and recovery protocol.

  15. New colorimetric screening assays for the directed evolution of fungal laccases to improve the conversion of plant biomass

    PubMed Central

    2013-01-01

    Background Fungal laccases are multicopper oxidases with huge applicability in different sectors. Here, we describe the development of a set of high-throughput colorimetric assays for screening laccase libraries in directed evolution studies. Results Firstly, we designed three colorimetric assays based on the oxidation of sinapic acid, acetosyringone and syringaldehyde with λmax of 512, 520 and 370 nm, respectively. These syringyl-type phenolic compounds are released during the degradation of lignocellulose and can act as laccase redox mediators. The oxidation of the three compounds by low and high-redox potential laccases evolved in Saccharomyces cerevisiae produced quantifiable and linear responses, with detection limits around 1 mU/mL and CV values below 16%. The phenolic substrates were also suitable for pre-screening mutant libraries on solid phase format. Intense colored-halos were developed around the yeast colonies secreting laccase. Furthermore, the oxidation of violuric acid to its iminoxyl radical (λmax of 515 nm and CV below 15%) was devised as reporter assay for laccase redox potential during the screening of mutant libraries from high-redox potential laccases. Finally, we developed three dye-decolorizing assays based on the enzymatic oxidation of Methyl Orange (470 nm), Evans Blue (605 nm) and Remazol Brilliant Blue (640 nm) giving up to 40% decolorization yields and CV values below 18%. The assays were reliable for direct measurement of laccase activity or to indirectly explore the oxidation of mediators that do not render colored products (but promote dye decolorization). Every single assay reported in this work was tested by exploring mutant libraries created by error prone PCR of fungal laccases secreted by yeast. Conclusions The high-throughput screening methods reported in this work could be useful for engineering laccases for different purposes. The assays based on the oxidation of syringyl-compounds might be valuable tools for

  16. A smart phone-based robust correction algorithm for the colorimetric detection of Urinary Tract Infection.

    PubMed

    Karlsen, Haakon; Tao Dong

    2015-08-01

    This paper presents the preliminary work of developing a smart phone based application for colorimetric detection of Urinary Tract Infection. The purpose is to make a smart phone function as a practical point-of-care device for nurses or medical personnel without access to strip readers. The main challenge is the constancy of camera color perception across different illuminations and devices, which is the first step towards a practical solution without additional equipment. A reported black and white reference correction and a comprehensive color image normalization have been utilized in this work. Comprehensive color image normalization appears to be quite effective at correcting the difference in perceived color due to different illumination, and is therefore a candidate for inclusion in the further work. PMID:26736494

  17. Colorimetric Detection of Plasmodium vivax in Urine Using MSP10 Oligonucleotides and Gold Nanoparticles

    PubMed Central

    Alnasser, Yossef; Ferradas, Cusi; Clark, Taryn; Calderon, Maritza; Gurbillon, Alejandro; Gamboa, Dionicia; McKakpo, Uri S.; Quakyi, Isabella A.; Bosompem, Kwabena M.; Sullivan, David J.; Vinetz, Joseph M.; Gilman, Robert H.

    2016-01-01

    Plasmodium vivax is the most prevalent cause of human malaria in the world and can lead to severe disease with high potential for relapse. Its genetic and geographic diversities make it challenging to control. P. vivax is understudied and to achieve control of malaria in endemic areas, a rapid, accurate, and simple diagnostic tool is necessary. In this pilot study, we found that a colorimetric system using AuNPs and MSP10 DNA detection in urine can provide fast, easy, and inexpensive identification of P. vivax. The test exhibited promising sensitivity (84%), high specificity (97%), and only mild cross-reactivity with P. falciparum (21%). It is simple to use, with a visible color change that negates the need for a spectrometer, making it suitable for use in austere conditions. Using urine eliminates the need for finger-prick, increasing both the safety profile and patient acceptance of this model. PMID:27706158

  18. A DNA-gold nanoparticle-based colorimetric competition assay for the detection of cysteine.

    PubMed

    Lee, Jae-Seung; Ulmann, Pirmin A; Han, Min Su; Mirkin, Chad A

    2008-02-01

    We report the development of a highly sensitive and selective colorimetric detection method for cysteine based upon oligonucleotide-functionalized gold nanoparticle probes that contain strategically placed thymidine-thymidine (T-T) mismatches complexed with Hg2+. This assay relies upon the distance-dependent optical properties of gold nanoparticles, the sharp melting transition of oligonucleotide-linked nanoparticle aggregates, and the very selective coordination of Hg2+ with cysteine. The concentration of cysteine can be determined by monitoring with the naked eye or a UV-vis spectrometer the temperature at which the purple-to-red color change associated with aggregate dissociation takes place. This assay does not utilize organic cosolvents, enzymatic reactions, light-sensitive dye molecules, lengthy protocols, or sophisticated instrumentation thereby overcoming some of the limitations of more conventional methods.

  19. Colorimetric Detection of an Airborne Remote Photocatalytic Reaction Using a Stratified Ag Nanoparticle Sheet.

    PubMed

    Degawa, Ryo; Wang, Pangpang; Tanaka, Daisuke; Park, Susie; Sakai, Nobuyuki; Tatsuma, Tetsu; Okamoto, Koichi; Tamada, Kaoru

    2016-08-16

    Photocatalysts are practically used for decomposition of harmful and fouling organic compounds. Among the photocatalytic reactions, remote oxidation via airborne species is a relatively slow process, so that a sensitive technique for its detection has been awaiting. Here, we investigated an airborne remote photocatalytic reaction of a TiO2 photocatalyst modified with Pt nanoparticles as co-catalysts via the color change caused by a decomposition of a multilayered silver nanoparticle sheet. The silver nanoparticle sheet fabricated by the Langmuir-Schaefer method on a gold substrate exhibits a unique multicolor depending upon the number of layers. The color originates from multiple light trapping in the stratified sheets that has a metamaterial characteristic along with an intra- and interlayer coupling of localized surface plasmon resonance (LSPR). The stepwise decomposition of the sheets was confirmed by the colorimetric data, which exhibited not only a monotonic decrease but also a maximized absorption of light when the film thickness reached the optimal thickness for light trapping or when the oxidation of the Ag core started. Scanning electron microscopy (SEM), atomic force microscopy (AFM), X-ray photoelectron spectroscopy (XPS), and surface plasmon resonance (SPR) spectroscopy data provided a complete view of the decomposition process of this inorganic-organic nanocomposite film, and simulation by the transfer-matrix method explained a simultaneous plasmonic response rationally. The influence of the humidity and gas flow rate on the airborne remote photocatalytic reaction kinetics was examined by this colorimetric detection method, and it suggests that H2O in air plays an essential role in the reaction. PMID:27445001

  20. Bio-functionalized silver nanoparticles: a novel colorimetric probe for cysteine detection.

    PubMed

    Borase, Hemant P; Patil, Chandrashekhar D; Salunkhe, Rahul B; Suryawanshi, Rahul K; Kim, Beom S; Bapat, Vishwas A; Patil, Satish V

    2015-04-01

    Chemical interactions between nanoparticles and biomolecules are vital for applying nanoparticles in medicine and life science. Development of sensitive, rapid, low-cost, and eco-friendly sensors for the detection of molecules acting as disease indicator is need of an hour. In the present investigation, a green trend for silver nanoparticle synthesis was followed using leaf extract of Calotropis procera. Silver nanoparticles exhibited surface plasmon absorption peak at 421 nm, spherical shape with average size of 10 nm, and zeta potential of -22.4 mV. The as-synthesized silver nanoparticles were used for selective and sensitive detection of cysteine. Cysteine induces aggregation in stable silver nanoparticles owing to selective and strong interaction of -SH group of cysteine with silver nanoparticle surface. Cysteine-induced silver nanoparticle aggregation can be observed visually by change in color of silver nanoparticles from yellow to pink. Cysteine concentration was estimated colorimetrically by measuring absorption at surface plasmon wavelength. Limit of detection for cysteine using silver nanoparticles is ultralow, i.e., 100 nM. The mechanistic insight into cysteine detection by silver nanoparticles was investigated using FT-IR, TEM, DLS, and TLC analysis. Proposed method can be applied for the detection of cysteine in blood plasma and may give rise to a new insight into development of eco-friendly fabricated nanodiagnostic device in future.

  1. Colorimetric-based detection of TNT explosives using functionalized silica nanoparticles.

    PubMed

    Idros, Noorhayati; Ho, Man Yi; Pivnenko, Mike; Qasim, Malik M; Xu, Hua; Gu, Zhongze; Chu, Daping

    2015-01-01

    This proof-of-concept study proposes a novel sensing mechanism for selective and label-free detection of 2,4,6-trinitrotoluene (TNT). It is realized by surface chemistry functionalization of silica nanoparticles (NPs) with 3-aminopropyl-triethoxysilane (APTES). The primary amine anchored to the surface of the silica nanoparticles (SiO2-NH2) acts as a capturing probe for TNT target binding to form Meisenheimer amine-TNT complexes. A colorimetric change of the self-assembled (SAM) NP samples from the initial green of a SiO2-NH2 nanoparticle film towards red was observed after successful attachment of TNT, which was confirmed as a result of the increased separation between the nanoparticles. The shift in the peak wavelength of the reflected light normal to the film surface and the associated change of the peak width were measured, and a merit function taking into account their combined effect was proposed for the detection of TNT concentrations from 10-12 to 10-4 molar. The selectivity of our sensing approach is confirmed by using TNT-bound nanoparticles incubated in AptamerX, with 2,4-dinitrotoluene (DNT) and toluene used as control and baseline, respectively. Our results show the repeatable systematic color change with the TNT concentration and the possibility to develop a robust, easy-to-use, and low-cost TNT detection method for performing a sensitive, reliable, and semi-quantitative detection in a wide detection range. PMID:26046595

  2. Fenton reaction-based colorimetric immunoassay for sensitive detection of brevetoxin B.

    PubMed

    Lai, Wenqiang; Wei, Qiaohua; Zhuang, Junyang; Lu, Minghua; Tang, Dianping

    2016-06-15

    We designed a new colorimetric immunoassay for sensitive monitoring of brevetoxin B (BTB) using enzyme-controlled Fenton reaction with a high-resolution 3,3',5,5'-tetramethylbenzidine (TMB)-based visual colored system. Upon addition of hydrogen peroxide (H2O2), the equivalent iron(II) could be first converted into iron(III) and free hydroxyl radical (•OH) via the classical Fenton reaction. Then the as-produced iron(III) and •OH could cause a perceptible change from colorless to blue with the increasing H2O2 concentration in the presence of TMB. Based on Fenton reaction-triggered visual colored system, a novel competitive-type colorimetric enzyme immunoassay was developed for the quantitative screening of target BTB on the bovine serum albumin-BTB-modified magnetic bead using glucose oxidase/anti-BTB antibody-labeled gold nanoparticle as the signal-transduction tag. Upon target BTB introduction, the analyte competed with the conjugated BTB on the magnetic bead for anti-BTB antibody on gold nanoparticle. The carried glucose oxidase with the gold nanoparticle could implement the oxidation of glucose to produce H2O2, and the generated H2O2 promoted the above-mentioned Fenton reaction for color development. Under the optimal conditions, the absorbance decreased with the increasing target BTB in the range from 0.1 to 150 ng kg(-1) with a low detection limit (LOD) of 0.076 ng kg(-1). The LOD was 500-fold lower than that of commercialized Abraxis BTB ELISA kit. Non-specific adsorption was not observed. The precision, reproducibility and specificity were acceptable. Finally, the method accuracy was also validated for monitoring spiked seafood samples, giving results well matched with the referenced brevetoxin ELISA kit. PMID:26851583

  3. Ultrasensitive, colorimetric detection of microRNAs based on isothermal exponential amplification reaction-assisted gold nanoparticle amplification.

    PubMed

    Li, Ru-Dong; Yin, Bin-Cheng; Ye, Bang-Ce

    2016-12-15

    MicroRNAs (miRNAs) play important roles in a wide range of biological processes, and their aberrant expressions are linked to a large number of human diseases and disorders. In this work, we developed a colorimetric method for rapid, ultrasensitive miRNA detection via isothermal exponential amplification reaction (EXPAR)-assisted gold nanoparticle (AuNP) amplification. The sensing probe designed with a tandem phosphorothioate modification in the backbone of the polyadenines at the 5' terminus was employed to directly assemble onto the surface of AuNP with high adsorption affinity. The recognition domain at the 3' terminus of the sensing probe hybridizes with target miRNAs to trigger EXPAR with exponential signal amplification. With the amplification reaction with the action of DNA polymerase, the sensing probe gradually detaches from the AuNP, resulting in the aggregation of bare AuNPs in the high-salt reaction environment due to lack of DNA protection. The presence of AuNP aggregation is conveniently measured by UV-vis spectroscopy. Our proposed method could provide a linear detection range from 50fM to 10nM with a detection limit of ∼46fM within 60min, and also discriminate a single-nucleotide difference between homologous miRNAs. PMID:27498329

  4. Gold nanoparticle-based colorimetric aptasensor for rapid detection of six organophosphorous pesticides.

    PubMed

    Bai, Wenhui; Zhu, Chao; Liu, Jinchuan; Yan, Mengmeng; Yang, Shuming; Chen, Ailiang

    2015-10-01

    Fast immunoassay-based screening methods are unavailable for most small-molecule pesticides because of a lack of immunogenicity and the difficulty in obtaining antibodies by animal immunization. Aptamers are single-stranded DNA molecules selected through an in vitro process, which can bind to any target including nonimmunogenic small molecules with high affinity and specificity. Although various aptamer-based sensing methods have been developed for antibiotics, microorganisms, heavy metal ions, and biotoxins, there are few reports on aptamer-based methods for quick detection of organophosphorous pesticides. The gold (Au) nanoparticle (AuNP) colorimetric assay is a widely utilized rapid detection method because of properties such as easy operation and visualized results. In the present study, organophosphorous pesticide aptamers were adsorbed on the surface of AuNPs to stabilize the AuNP solution against high concentrations of salt to prevent AuNP aggregation. After the addition of targets, the aptamers binding to the targets are detached from the AuNPs, resulting in aggregation of AuNPs and a color change from red to purple-blue. The proposed method can detect 6 organophosphorous pesticides with good recoveries from 72% to 135% in environmental river water samples. The present study provides a new way for simple, rapid, and multiplex detection of organophosphorous pesticides.

  5. Colorimetric Assay for the Detection of Typical Biomarkers for Periodontitis Using a Magnetic Nanoparticle Biosensor.

    PubMed

    Wignarajah, Shayalini; Suaifan, Ghadeer A R Y; Bizzarro, Sergio; Bikker, Floris J; Kaman, Wendy E; Zourob, Mohammed

    2015-12-15

    Periodontitis is a chronic disease which affects at least 10% of the population. If untreated, periodontitis can lead to teeth loss. Unfortunately, current diagnostic tests are limited in their sensitivity and specificity. In this study, a novel multiplex hand-held colorimetric diagnostic biosensor, using two typical inflammatory salivary biomarkers, Human Neutrophil Elastase (HNE) and Cathepsin-G, was constructed as proof of concept to potentially detect periodontitis. The biosensing method was based on the measurement of proteolytic activity using specific proteases probes. These probes consist of specific proteases substrates covalently bound to a magnetic bead from one end and to the gold sensor surface by the other end. When intact, this renders the golden sensor black. Upon proteolysis, the cleaved magnetic beads will be attracted by an external magnet revealing the golden color of the sensor surface observable by the naked eye. The biosensor was capable of specific and quantitative detection of HNE and Cathepsin-G in solution and in spiked saliva samples with a lower detection limit of 1 pg/mL and 100 fg/mL for HNE and Cathepsin-G, respectively. Examination of periodontitis patients' sample and a healthy control showed the potential of the multiplex biosensor to detect the presence of HNE and Cathepsin-G activity in situ. This approach is anticipated to be a useful biochip array amenable to low-cost point-of-care devices.

  6. Ultrasensitive electrospun fluorescent nanofibrous membrane for rapid visual colorimetric detection of H2O2.

    PubMed

    Senthamizhan, Anitha; Balusamy, Brabu; Aytac, Zeynep; Uyar, Tamer

    2016-02-01

    We report herein a flexible fluorescent nanofibrous membrane (FNFM) prepared by decorating the gold nanocluster (AuNC) on electrospun polysulfone nanofibrous membrane for rapid visual colorimetric detection of H2O2. The provision of AuNC coupled to NFM has proven to be advantageous for facile and quick visualization of the obtained results, permitting instant, selective, and on-site detection. We strongly suggest that the fast response time is ascribed to the enhanced probabilities of interaction with AuNC located at the surface of NF. It has been observed that the color change from red to blue is dependent on the concentration, which is exclusively selective for hydrogen peroxide. The detection limit has been found to be 500 nM using confocal laser scanning microscope (CLSM), visually recognizable with good accuracy and stability. A systematic comparison was performed between the sensing performance of FNFM and AuNC solution. The underlying sensing mechanism is demonstrated using UV spectra, transmission electron microscopy (TEM), and X-ray photoelectron spectroscopy (XPS). The corresponding disappearance of the characteristic emissions of gold nanoclusters and the emergence of a localized surface plasmon resonance (LSPR) band, stressing this unique characteristic of gold nanoparticles. Hence, it is evident that the conversion of nanoparticles from nanoclusters has taken place in the presence of H2O2. Our work here has paved a new path for the detection of bioanalytes, highlighting the merits of rapid readout, sensitivity, and user-friendliness.

  7. A novel colorimetric triple-helix molecular switch aptasensor for ultrasensitive detection of tetracycline.

    PubMed

    Ramezani, Mohammad; Mohammad Danesh, Noor; Lavaee, Parirokh; Abnous, Khalil; Mohammad Taghdisi, Seyed

    2015-08-15

    Detection methods of antibiotic residues in blood serum and animal derived foods are of great interest. In this study a colorimetric aptasensor was designed for sensitive, selective and fast detection of tetracycline based on triple-helix molecular switch (THMS) and gold nanoparticles (AuNPs). As a biosensor, THMS shows distinct advantages including high stability, sensitivity and preserving the selectivity and affinity of the original aptamer. In the absence of tetracycline, THMS is stable, leading to the aggregation of AuNPs by salt and an obvious color change from red to blue. In the presence of tetracycline, aptamer binds to its target, signal transduction probe (STP) leaves the THMS and adsorbs on the surface of AuNPs. So the well-dispersed AuNPs remain stable against salt-induced aggregation with a red color. The presented aptasensor showed high selectivity toward tetracyclines with a limit of detection as low as 266 pM for tetracycline. The designed aptasensor was successfully applied to detect tetracycline in serum and milk.

  8. Ultrasensitive electrospun fluorescent nanofibrous membrane for rapid visual colorimetric detection of H2O2.

    PubMed

    Senthamizhan, Anitha; Balusamy, Brabu; Aytac, Zeynep; Uyar, Tamer

    2016-02-01

    We report herein a flexible fluorescent nanofibrous membrane (FNFM) prepared by decorating the gold nanocluster (AuNC) on electrospun polysulfone nanofibrous membrane for rapid visual colorimetric detection of H2O2. The provision of AuNC coupled to NFM has proven to be advantageous for facile and quick visualization of the obtained results, permitting instant, selective, and on-site detection. We strongly suggest that the fast response time is ascribed to the enhanced probabilities of interaction with AuNC located at the surface of NF. It has been observed that the color change from red to blue is dependent on the concentration, which is exclusively selective for hydrogen peroxide. The detection limit has been found to be 500 nM using confocal laser scanning microscope (CLSM), visually recognizable with good accuracy and stability. A systematic comparison was performed between the sensing performance of FNFM and AuNC solution. The underlying sensing mechanism is demonstrated using UV spectra, transmission electron microscopy (TEM), and X-ray photoelectron spectroscopy (XPS). The corresponding disappearance of the characteristic emissions of gold nanoclusters and the emergence of a localized surface plasmon resonance (LSPR) band, stressing this unique characteristic of gold nanoparticles. Hence, it is evident that the conversion of nanoparticles from nanoclusters has taken place in the presence of H2O2. Our work here has paved a new path for the detection of bioanalytes, highlighting the merits of rapid readout, sensitivity, and user-friendliness. PMID:26637215

  9. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    PubMed

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. PMID:27543841

  10. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    PubMed

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria.

  11. Colorimetric Detection of Some Highly Hydrophobic Flavonoids Using Polydiacetylene Liposomes Containing Pentacosa-10,12-diynoyl Succinoglycan Monomers

    PubMed Central

    Yun, Deokgyu; Jeong, Daham; Cho, Eunae; Jung, Seunho

    2015-01-01

    Flavonoids are a group of plant secondary metabolites including polyphenolic molecules, and they are well known for antioxidant, anti-allergic, anti-inflammatory and anti-viral propertied. In general, flavonoids are detected with various non-colorimetric detection methods such as column liquid chromatography, thin-layer chromatography, and electrochemical analysis. For the first time, we developed a straightforward colorimetric detection system allowing recognition of some highly hydrophobic flavonoids such as alpha-naphthoflavone and beta-naphthoflavone, visually using 10,12-pentacosadiynoic acid (PCDA) derivatized with succinoglycan monomers isolated from Sinorhizobium meliloti. Besides changes in visible spectrum, we also demonstrate fluorescence changes using our detection system in the presence of those flavonoids. The succinoglycan monomers attached to PCDA molecules may function as an unstructured molecular capturer for some highly hydrophobic flavonoids by hydrophobic interactions, and transmit their molecular interactions as a color change throughout the PCDA liposome. PMID:26600071

  12. Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

    PubMed Central

    Bisha, Bledar; Adkins, Jaclyn A.; Jokerst, Jana C.; Chandler, Jeffrey C.; Pérez-Méndez, Alma; Coleman, Shannon M.; Sbodio, Adrian O.; Suslow, Trevor V.; Danyluk, Michelle D.; Henry, Charles S.; Goodridge, Lawrence D.

    2014-01-01

    This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (µPADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the µPAD. Alternatively, digital images of the reacted µPADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24 hr), justifying its use as an initial screening method for the microbiological quality of agricultural water. PMID:24962090

  13. Colorimetric paper-based detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes of agricultural water.

    PubMed

    Bisha, Bledar; Adkins, Jaclyn A; Jokerst, Jana C; Chandler, Jeffrey C; Pérez-Méndez, Alma; Coleman, Shannon M; Sbodio, Adrian O; Suslow, Trevor V; Danyluk, Michelle D; Henry, Charles S; Goodridge, Lawrence D

    2014-01-01

    This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (µPADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the µPAD. Alternatively, digital images of the reacted µPADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24 hr), justifying its use as an initial screening method for the microbiological quality of agricultural water. PMID:24962090

  14. Colorimetric paper-based detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes of agricultural water.

    PubMed

    Bisha, Bledar; Adkins, Jaclyn A; Jokerst, Jana C; Chandler, Jeffrey C; Pérez-Méndez, Alma; Coleman, Shannon M; Sbodio, Adrian O; Suslow, Trevor V; Danyluk, Michelle D; Henry, Charles S; Goodridge, Lawrence D

    2014-01-01

    This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (µPADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the µPAD. Alternatively, digital images of the reacted µPADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24 hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

  15. Field-deployable colorimetric biosensor system for the rapid detection of pathogenic organisms

    NASA Astrophysics Data System (ADS)

    Duy, Janice

    The rapid identification of pathogenic organisms is necessary for recognizing and managing human and environmental health risks. Numerous detection schemes are available, but most are difficult to employ in non-laboratory settings due to their need for bulky, specialized equipment, multiple reagents, or highly trained personnel. To address this problem, a rapid, field-compatible biosensor system based on the colorimetric detection of nucleic acid hybrids was developed. Peptide nucleic acid (PNA) probes were used to capture ribosomal RNA sequences from environmental samples. Non-target nucleic acids, including single-base mismatches flanked by adenines and uracils, were removed with a micrococcal nuclease digestion step. Matched PNA-RNA hybrids remained intact and were indicated by the cyanine dye DiSC2(5). PNA-containing duplexes function as templates for the aggregation of DiSC2(5), visualized as a change in solution color from blue to purple. This transition can be measured as an increase in the solution absorbance at 540 nm (dye aggregate) at the expense of the dye monomer peak at 650 nm. These concomitant spectral changes were used to calculate a "hybridization signal" using the ratio A aggregate/Amonomer ≈ A540/A650. Testing with pathogenic environmental samples was accomplished using two model organisms: the harmful algal bloom-causing dinoflagellate Alexandrium species, and the potato wart disease-causing fungus Synchytrium endobioticum. In both cases, the colorimetric approach was able to distinguish the targets with sensitivities rivaling those of established techniques, but with the advantages of decreased hands-on time and cost. Assay fieldability was tested with a portable colorimeter designed to quantify the dye-indicated hybridization signal and assembled from commercially available components. Side-by-side testing revealed no difference in the sensing performance of the colorimeter compared to a laboratory spectrophotometer (Pearson's r=0

  16. Recent progress in fluorescent and colorimetric chemosensors for detection of precious metal ions (silver, gold and platinum ions).

    PubMed

    Zhang, Jun Feng; Zhou, Ying; Yoon, Juyoung; Kim, Jong Seung

    2011-07-01

    Due to the wide range of applications and biological significance, the development of optical probes for silver, gold and platinum ions has been an active research area in the past few years. This tutorial review focuses on the recent contributions concerning the fluorescent or colorimetric sensors for these metal ions, and is organized according to their structural classifications (for Ag(+) detection) and unique mechanisms between the sensors and metal ions (for Au(3+) and Pt(2+) detection).

  17. Colorimetric detection of gene transcript by target-induced three-way junction formation.

    PubMed

    Wang, Xuchu; Liu, Weiwei; Yin, Binbin; Yu, Pan; Duan, Xiuzhi; Liao, Zhaoping; Liu, Chunhua; Sang, Yiwen; Zhang, Gong; Chen, Yuhua; Tao, Zhihua

    2016-09-01

    Gene transcript often varies by alternative splicing, which plays different biological role that results in diversity of gene expression. Therefore, a simple and accurate identification of targeted transcript variant is of prime importance to achieve a precise molecular diagnosis. In this work, we presented a three-way junction based system where two split G-quadruplex forming sequences were coupled into two probes. Only upon the introduction of target gene transcript that offering a specific recognizable splicing site did the two probes assembled into three way junction conformation in a devised process, thus providing a functional G-quadruplex conformation that greatly enhanced hemin peroxidation. A notable resolution for gene splicing site detection was achieved. The detection limitation by colorimetric assay was 0.063μM, and this system has been proved to discriminate even in a single base false level around splicing site (about 3 times of single mismatched analyte to gain an equal signal by perfect analyte ). Furthermore, recoveries of 78.1%, 88.1%, 104.6% were obtained with 0.75μM, 0.25μM, 0.083μM of target, respectively, showing a capacity to further exploit a simple equipped device for gene transcript detection. PMID:27343570

  18. Detection of Salmonella by using the colorimetric DNA/rRNA sandwich hybridization in microtiter wells.

    PubMed

    Namimatsu, T; Tsuna, M; Imai, Y; Futo, S; Mitsuse, S; Sakano, T; Sato, S

    2000-06-01

    A rapid and readily available DNA probe kit was developed for the detection of Salmonella spp. This kit utilized the colorimetric DNA/rRNA sandwich hybridization method in microtiter wells. Within 3 hr Salmonella spp. in selective enrichment broth cultures were detected by the DNA probe kit. The kit effectively identified all of 187 strains of Salmonella tested and yielded no false-positive reactions in the examination of 674 pure cultures of non-salmonellae. The DNA probe kit could detect 10(5) cfu/ml in pure culture. A total of 379 naturally contaminated samples (raw chicken meat, liquid egg, animal feeds, poultry feces and frozen foods) were tested, both by the standard culture method and the DNA probe kit. The 169 of these samples were culture positive and 210 were culture negative. The sensitivity of the DNA probe kit was 98.2% (166/169) and the specificity was 99.5% (209/210). These results show that the DNA probe kit is a useful tool to examine a large number of various samples for contamination by Salmonella spp. in food and livestock industry. PMID:10907688

  19. A colorimetric sandwich-type assay for sensitive thrombin detection based on enzyme-linked aptamer assay.

    PubMed

    Park, Jun Hee; Cho, Yea Seul; Kang, Sungmuk; Lee, Eun Jeong; Lee, Gwan-Ho; Hah, Sang Soo

    2014-10-01

    A colorimetric sandwich-type assay based on enzyme-linked aptamer assay has been developed for the fast and sensitive detection of as low as 25 fM of thrombin with high linearity. Aptamer-immobilized glass was used to capture the target analyte, whereas a second aptamer, functionalized with horseradish peroxidase (HRP), was employed for the conventional 3,5,3',5'-tetramethylbenzidine (TMB)-based colorimetric detection. Without the troublesome antibody requirement of the conventional enzyme-linked immunosorbent assay (ELISA), as low as 25 fM of thrombin could be rapidly and reproducibly detected. This assay has superior, or at least equal, recovery and accuracy to that of conventional antibody-based ELISA.

  20. Folic acid functionalized silver nanoparticles with sensitivity and selectivity colorimetric and fluorescent detection for Hg2+ and efficient catalysis

    NASA Astrophysics Data System (ADS)

    Su, Dongyue; Yang, Xin; Xia, Qingdong; Zhang, Qi; Chai, Fang; Wang, Chungang; Qu, Fengyu

    2014-09-01

    In this research, folic acid functionalized silver nanoparticles (FA-AgNPs) were selected as a colorimetric and a ‘turn on’ fluorescent sensor for detecting Hg2+. After being added into Hg2+, AgNPs can emit stable fluorescence at 440 nm when the excitation wavelength is selected at 275 nm. The absorbance and fluorescence of the FA-AgNPs could reflect the concentration of the Hg2+ ions. Thus, we developed a simple, sensitive analytical method to detect Hg2+ based on the colorimetric and fluorescence enhancement of FA-AgNPs. The sensor exhibits two linear response ranges between absorbance and fluorescence intensity with Hg2+ concentration, respectively. Meanwhile, a detection limit of 1 nM is estimated based on the linear relationship between responses with a concentration of Hg2+. The high specificity of Hg2+ with FA-AgNPs interactions provided the excellent selectivity towards detecting Hg2+ over other metal ions (Pb2+, Mg2+, Zn2+, Ni2+, Cu2+, Co2+, Ca2+, Mn2+, Fe2+, Cd2+, Ba2+, Cr6+ and Cr3+). This will provide a simple, effective and multifunctional colorimetric and fluorescent sensor for on-site and real-time Hg2+ ion detection. The proposed method can be applied to the analysis of trace Hg2+ in lake water. Additionally, the FA-AgNPs can be used as efficient catalyst for the reduction of 4-nitrophenol and potassium hexacyanoferrate (III).

  1. Probing phosphatase activity using redox active nanoparticles: a novel colorimetric approach for the detection of enzyme activity.

    PubMed

    Hayat, Akhtar; Gonca Bulbul; Andreescu, Silvana

    2014-06-15

    A new colorimetric assay for the detection of alkaline phosphatase (ALP) activity is reported based on the surface reactivity and optical properties of redox active nanoparticles of cerium oxide, or nanoceria. The method takes advantage of nanoceria color changes after interaction with products of the ALP catalyzed reaction, resulting in charge transfer complexes with very strong absorption characteristics. The developed assay is easy-to-use, robust and cost effective and does not involve labeled reagents, secondary enzymes or soluble dyes. Hydrolytic products of more stable substrates (catechol monophosphate, ascorbic 2-phosphate and hydroquinone diphosphate) that could previously not be used in ALP assays can be conveniently colorimetrically detected with this assay. A detection limit of 0.04 U/L ALP with a linear range up to 2U/L was obtained with ascorbic 2-phosphate substrate. The proposed assay can eliminate multistep procedures and minimize problems associated with the poor stability of substrates and enzyme labels of conventional ALP assays. The assay has been adapted to a paper platform and has demonstrated functionality for ALP detection in human serum. This sensing concept can find wide applications as a general approach for improving sensitivity and simplifying detection schemes of colorimetric bioassays, e.g. enzyme, gene, immuno and aptamer assays and related affinity sensing methods. PMID:24531308

  2. Colorimetric detection of pathogenic bacteria using platinum-coated magnetic nanoparticle clusters and magnetophoretic chromatography.

    PubMed

    Kwon, Donghoon; Lee, Sanghee; Ahn, Myung Mo; Kang, In Seok; Park, Ki-Hwan; Jeon, Sangmin

    2015-07-01

    A colorimetric method that uses platinum-coated magnetic nanoparticle clusters (Pt/MNCs) and magnetophoretic chromatography is developed to detect pathogenic bacteria. Half-fragments of monoclonal Escherichia coli O157:H7 (EC) antibodies were functionalized to Pt/MNCs and used to capture E. coli bacteria in milk. After magnetic separation of free Pt/MNCs and Pt/MNC-EC complexes from the milk, a precision pipette was used to imbibe the E. coli-containing solution, then a viscous polyethylene glycol solution. Due to difference in viscosities, the solutions separate into two liquid layers inside the pipette tip. The Pt/MNC-EC complexes were separated from the free Pt/MNCs by applying an external magnetic field, then added to a tetramethylbenzidine (TMB) solution. Catalytic oxidation of TMB by Pt produced color changes of the solution, which enabled identification of the presence of 10 cfu mL(-1) E. coli bacteria with the naked eye. The total assay time including separation, binding and detection was 30 min.

  3. An Amidochlorin-Based Colorimetric Fluorescent Probe for Selective Cu(2+) Detection.

    PubMed

    Li, Wenting; Zhu, Guohua; Li, Jinghua; Wang, Zhiqiang; Jin, Yingxue

    2016-01-01

    The design and synthesis of selective and sensitive chemosensors for the quantification of environmentally and biologically important ionic species has attracted widespread attention. Amidochlorin p6 (ACP); an effective colorimetric and fluorescent probe for copper ions (Cu(2+)) in aqueous solution derived from methyl pheophorbide-a (MPa) was designed and synthesized. A remarkable color change from pale yellow to blue was easily observed by the naked eye upon addition of Cu(2+); and a fluorescence quenching was also determined. The research of fluorescent quenching of ACP-Cu(2+) complexation showed the detection limit was 7.5 × 10(-8) mol/L; which suggested that ACP can act as a high sensitive probe for Cu(2+) and can be used to quantitatively detect low levels of Cu(2+) in aqueous solution. In aqueous solution the probe exhibits excellent selectivity and sensitivity toward Cu(2+) ions over other metal ions (M = Zn(2+); Ni(2+); Ba(2+); Ag⁺; Co(2+); Na⁺; K⁺; Mg(2+); Cd(2+); Pb(2+); Mn(2+); Fe(3+); and Ca(2+)). The obvious change from pale yellow to blue upon the addition of Cu(2+) could make it a suitable "naked eye" indicator for Cu(2+). PMID:26797591

  4. Colorimetric detection of DNA damage by using hemin-graphene nanocomposites

    NASA Astrophysics Data System (ADS)

    Wei, W.; Zhang, D. M.; Yin, L. H.; Pu, Y. P.; Liu, S. Q.

    2013-04-01

    A colorimetric method for detection of DNA damage was developed by using hemin-graphene nanosheets (H-GNs). H-GNs were skillfully synthesized by adsorping of hemin on graphene through π-π interactions. The as-prepared H-GNs possessed both the ability of graphene to differentiate the damage DNA from intact DNA and the catalytic action of hemin. The damaged DNA made H-GNs coagulated to different degrees from the intact DNA because there were different amount of negative charge exposed on their surface, which made a great impact on the solubility of H-GNs. As a result, the corresponding centrifugal supernatant of H-GNs solution showed different color in the presence of 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2, which could be discriminated by naked eyes or by ultraviolet (UV)-visible spectrometer. Based on this, the damaged effects of styrene oxide (SO), NaAsO2 and UV radiation on DNA were studied. Results showed that SO exerted most serious damage effect on DNA although all of them damaged DNA seriously. The new method for detection of DNA damage showed good prospect in the evaluation of genotoxicity of new compounds, the maximum limit of pesticide residue, food additives, and so on, which is important in the fields of food science, pharmaceutical science and pesticide science.

  5. Screening and development of DNA aptamers as capture probes for colorimetric detection of patulin.

    PubMed

    Wu, Shijia; Duan, Nuo; Zhang, Weixiao; Zhao, Sen; Wang, Zhouping

    2016-09-01

    Patulin (PAT) is a kind of mycotoxin that has serious harmful impacts on both food quality and human health. A high-affinity ssDNA aptamer that specifically binds to patulin was generated using systemic evolution of ligands by exponential enrichment (SELEX) assisted by graphene oxide (GO). After 15 rounds of positive and negative selection, a highly enriched ssDNA pool was sequenced and the representative sequences were subjected to binding assays to evaluate their affinity and specificity. Of the eight aptamer candidates tested, the sequence PAT-11 bound to patulin with high affinity and excellent selectivity with a dissociation constant (Kd) of 21.83 ± 5.022 nM. The selected aptamer, PAT-11, was subsequently used as a recognition element to develop a detection method for patulin based on an enzyme-chromogenic substrate system. The colorimetric aptasensor exhibited a linear range from 50 to 2500 pg mL(-1), and the limit of detection was found to be 48 pg mL(-1). The results indicated that GO-SELEX technology was appropriate for the screening of aptamers against small-molecule toxins, offering a promising application for aptamer-based biosensors. PMID:27318239

  6. Colorimetric sensor array for detection and identification of organophosphorus and carbamate pesticides.

    PubMed

    Qian, Sihua; Lin, Hengwei

    2015-01-01

    Due to relatively low persistence and high effectiveness for insect and pest eradication, organophosphates (OPs) and carbamates are the two major classes of pesticides that broadly used in agriculture. Hence, the sensitive and selective detection of OPs and carbamates is highly significant. In this current study, a colorimetric sensor array comprising five inexpensive and commercially available thiocholine and H2O2 sensitive indicators for the simultaneous detection and identification of OPs and carbamates is developed. The sensing mechanism of this array is based on the irreversible inhibition capability of OPs and carbamates to the activity of acetylcholinesterase (AChE), preventing production of thiocholine and H2O2 from S-acetylthiocholine and acetylcholine and thus resulting in decreased or no color reactions to thiocholine and H2O2 sensitive indicators. Through recognition patterns and standard statistical methods (i.e., hierarchical clustering analysis and principal component analysis), the as-developed array demonstrates not only discrimination of OPs and carbamates from other kinds of pesticides but, more interestingly, identification of them exactly from each other. Moreover, this array is experimentally confirmed to have high selectivity and sensitivity, good anti-interference capability, and potential applications in real samples for OPs and carbamates.

  7. Colorimetric sensor array for detection and identification of organophosphorus and carbamate pesticides.

    PubMed

    Qian, Sihua; Lin, Hengwei

    2015-01-01

    Due to relatively low persistence and high effectiveness for insect and pest eradication, organophosphates (OPs) and carbamates are the two major classes of pesticides that broadly used in agriculture. Hence, the sensitive and selective detection of OPs and carbamates is highly significant. In this current study, a colorimetric sensor array comprising five inexpensive and commercially available thiocholine and H2O2 sensitive indicators for the simultaneous detection and identification of OPs and carbamates is developed. The sensing mechanism of this array is based on the irreversible inhibition capability of OPs and carbamates to the activity of acetylcholinesterase (AChE), preventing production of thiocholine and H2O2 from S-acetylthiocholine and acetylcholine and thus resulting in decreased or no color reactions to thiocholine and H2O2 sensitive indicators. Through recognition patterns and standard statistical methods (i.e., hierarchical clustering analysis and principal component analysis), the as-developed array demonstrates not only discrimination of OPs and carbamates from other kinds of pesticides but, more interestingly, identification of them exactly from each other. Moreover, this array is experimentally confirmed to have high selectivity and sensitivity, good anti-interference capability, and potential applications in real samples for OPs and carbamates. PMID:25913282

  8. Ultrasensitive label-free amplified colorimetric detection of p53 based on G-quadruplex MBzymes.

    PubMed

    Li, Hongbo; Wu, Zaisheng; Qiu, Liping; Liu, Jinwen; Wang, Cui; Shen, Guoli; Yu, Ruqin

    2013-12-15

    A novel label-free DNAzyme molecular beacon (MBzyme) strategy was for the first time developed for colorimetric amplification detection of target nucleic acids. The MBzyme, which is designed to contain peroxidase-mimicking DNAzyme that is locked by a common hairpin, was engineered to form a catalytically active MBzyme through hybridizing with the target p53 DNA. The MBzyme is a multifunctional label-free probe that can act as the target recognition element, catalytic DNAzyme and the primer of polymerization. The target p53 DNA hybridization can induce the isothermal circular strand-displacement polymerization even without any chemical modification and other DNA sequences. This unique amplifying strategy leads to the generation of multiple numbers of active MBzyme molecules even if one hybridization event occurs, achieving a dynamic range of seven orders of magnitude and giving a detection limit down to 25 fM which is 3-5 orders of magnitude lower than those of related literature reports. These achievements might be helpful in the design of highly efficient enhancers for G-quadruplex-hemin DNAzymes to be applied on the fundamental research, biotechnology, and biomedical diagnosis.

  9. Colorimetric-Based Detection of TNT Explosives Using Functionalized Silica Nanoparticles

    PubMed Central

    Idros, Noorhayati; Ho, Man Yi; Pivnenko, Mike; Qasim, Malik M.; Xu, Hua; Gu, Zhongze; Chu, Daping

    2015-01-01

    This proof-of-concept study proposes a novel sensing mechanism for selective and label-free detection of 2,4,6-trinitrotoluene (TNT). It is realized by surface chemistry functionalization of silica nanoparticles (NPs) with 3-aminopropyl-triethoxysilane (APTES). The primary amine anchored to the surface of the silica nanoparticles (SiO2-NH2) acts as a capturing probe for TNT target binding to form Meisenheimer amine–TNT complexes. A colorimetric change of the self-assembled (SAM) NP samples from the initial green of a SiO2-NH2 nanoparticle film towards red was observed after successful attachment of TNT, which was confirmed as a result of the increased separation between the nanoparticles. The shift in the peak wavelength of the reflected light normal to the film surface (λpeak) and the associated change of the peak width were measured, and a merit function taking into account their combined effect was proposed for the detection of TNT concentrations from 10−12 to 10−4 molar. The selectivity of our sensing approach is confirmed by using TNT-bound nanoparticles incubated in AptamerX, with 2,4-dinitrotoluene (DNT) and toluene used as control and baseline, respectively. Our results show the repeatable systematic color change with the TNT concentration and the possibility to develop a robust, easy-to-use, and low-cost TNT detection method for performing a sensitive, reliable, and semi-quantitative detection in a wide detection range. PMID:26046595

  10. Colorimetric sensor array allows fast detection and simultaneous identification of sepsis-causing bacteria in spiked blood culture.

    PubMed

    Lim, Sung H; Mix, Samantha; Xu, Zeyu; Taba, Brian; Budvytiene, Indre; Berliner, Anders N; Queralto, Nuria; Churi, Yair S; Huang, Richard S; Eiden, Michael; Martino, Raymond A; Rhodes, Paul; Banaei, Niaz

    2014-02-01

    Sepsis is a medical emergency demanding early diagnosis and tailored antimicrobial therapy. Every hour of delay in initiating effective therapy measurably increases patient mortality. Blood culture is currently the reference standard for detecting bloodstream infection, a multistep process which may take one to several days. Here, we report a novel paradigm for earlier detection and the simultaneous identification of pathogens in spiked blood cultures by means of a metabolomic "fingerprint" of the volatile mixture outgassed by the organisms. The colorimetric sensor array provided significantly faster detection of positive blood cultures than a conventional blood culture system (12.1 h versus 14.9 h, P < 0.001) while allowing for the identification of 18 bacterial species with 91.9% overall accuracy within 2 h of growth detection. The colorimetric sensor array also allowed for discrimination between unrelated strains of methicillin-resistant Staphylococcus aureus, indicating that the metabolomic fingerprint has the potential to track nosocomial transmissions. Altogether, the colorimetric sensor array is a promising tool that offers a new paradigm for diagnosing bloodstream infections.

  11. Colorimetric detection of influenza A virus using antibody-functionalized gold nanoparticles.

    PubMed

    Liu, Yuanjian; Zhang, Linqun; Wei, Wei; Zhao, Hongyu; Zhou, Zhenxian; Zhang, Yuanjian; Liu, Songqin

    2015-06-21

    Early and accurate diagnosis is considered the key issue to prevent the further spread of viruses and facilitate influenza therapy. Herein, we report a colorimetric immunosensor for influenza A virus (IAV) based on gold nanoparticles (AuNPs) modified with monoclonal anti-hemagglutinin antibody (mAb). The immunosensor allows for a fast, simple, and selective detection of IAV. In this assay, influenza-specific antibodies are conjugated to AuNPs to create mAb-AuNP probes. Since IAV has multiple recognition sites for probes on the surface, the mAb-AuNP probes can be specifically arranged on the virus surface due to their very specific antigen recognition. In this case, this aggregation of the mAb-AuNP probes produces a red shift in the absorption spectrum due to plasmon coupling between adjacent AuNPs, and it can be detected with the naked eye as a color change from red to purple and quantified with the absorption spectral measurements. The aggregate formation is also confirmed with transmission electron microscopy (TEM) imaging and dynamic light scattering (DLS). Under the optimal conditions, the present immunoassay can sensitively measure H3N2 IAV (A/Brisbane/10/2007) with a detection limit of 7.8 hemagglutination units (HAU). This proposed immunosensor revealed high specificity, accuracy, and good stability. Notably, it is a single-step detection using AuNP probes and UV-vis spectrophotometer for readout, and no additional amplification, e.g., enzymatic, is needed to read the result. This assay depends on an ordered AuNP structure covering the virus surface and can be applied to any virus pathogen by incorporating the appropriate pathogen-specific antibody. PMID:25899840

  12. Colorimetric detection of influenza A virus using antibody-functionalized gold nanoparticles.

    PubMed

    Liu, Yuanjian; Zhang, Linqun; Wei, Wei; Zhao, Hongyu; Zhou, Zhenxian; Zhang, Yuanjian; Liu, Songqin

    2015-06-21

    Early and accurate diagnosis is considered the key issue to prevent the further spread of viruses and facilitate influenza therapy. Herein, we report a colorimetric immunosensor for influenza A virus (IAV) based on gold nanoparticles (AuNPs) modified with monoclonal anti-hemagglutinin antibody (mAb). The immunosensor allows for a fast, simple, and selective detection of IAV. In this assay, influenza-specific antibodies are conjugated to AuNPs to create mAb-AuNP probes. Since IAV has multiple recognition sites for probes on the surface, the mAb-AuNP probes can be specifically arranged on the virus surface due to their very specific antigen recognition. In this case, this aggregation of the mAb-AuNP probes produces a red shift in the absorption spectrum due to plasmon coupling between adjacent AuNPs, and it can be detected with the naked eye as a color change from red to purple and quantified with the absorption spectral measurements. The aggregate formation is also confirmed with transmission electron microscopy (TEM) imaging and dynamic light scattering (DLS). Under the optimal conditions, the present immunoassay can sensitively measure H3N2 IAV (A/Brisbane/10/2007) with a detection limit of 7.8 hemagglutination units (HAU). This proposed immunosensor revealed high specificity, accuracy, and good stability. Notably, it is a single-step detection using AuNP probes and UV-vis spectrophotometer for readout, and no additional amplification, e.g., enzymatic, is needed to read the result. This assay depends on an ordered AuNP structure covering the virus surface and can be applied to any virus pathogen by incorporating the appropriate pathogen-specific antibody.

  13. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  14. Gold nanoparticles mediated colorimetric assay for HIV-Tat protein detection

    NASA Astrophysics Data System (ADS)

    Hashwan, Saeed S. Ba; Ruslinda, A. Rahim; Fatin, M. F.; Gopinath, Subash C. B.; Thivina, V.; Tony, V. C. S.; Arshad, M. K. Md.; Hashim, U.

    2016-07-01

    Gold-nanoparticle (AuNP) based colorimetric assays have been formulated for different biomolecular interactions. With this assay the probe such as antibody immobilized on the Au surface and in the presence of appropriate binding partner (antigen), will interact with each other on the Au surface. By following this strategy, herein we formulated a detection system with two anti-HIV-Tat antibodies, Mono (McAb) - and polyclonal (PcAb) by immobilizing them independently with different AuNPs. Under this condition, these two antibodies are under dispersed condition, and in the presence of HIV-Tat antigen, these molecules will be connected and forms the aggregation of AuNPs. This strategy yield rapid results, can be monitored by the spectral changes in UV-Vis spectrophotometry. Experiments were performed with two different methods using two anti-HIV-Tats monoclonal and one Polyclonal antibody against the antigen HIV-Tat. Between these methods conjugation of HIV-Tat and McAb on the AuNP followed by addition of PcAb yielded better results.

  15. Colorimetric Sensor for Label Free Detection of Porcine PCR Product (ID: 18)

    NASA Astrophysics Data System (ADS)

    Ali, M. E.; Hashim, U.; Bari, M. F.; Dhahi, Th. S.

    2011-05-01

    This report described the use of 40±5 nm in diameter citrate-coated gold nanoparticles (GNPs) as colorimetric sensor to visually detect the presence of a 17-base swine specific conserved sequence and nucleotide mismatch in the mixed PCR products of pig, deer and shad cytochrome b genes. The size of these PCR amplicons was 109 base-pair and was amplified with a pair of common primers. Colloidal GNPs changed color from pinkish- red to purple-gray in 2 mM PBS buffer by losing its characteristic surface plasmon resonance peak at 530 nm and gaining new features between 620 and 800 nm in the absorption spectrum indicating strong aggregation. The particles were stabilized against salt induced aggregation, retained spectral features and characteristic color upon adsorption of single-stranded DNA. The PCR products without any additional processing were hybridized with a 17-nucleotide swine probe prior to exposure to GNPs. At a critical annealing temperature (55° C) that differentiated between the match and mismatch pairing, the probe was hybridized with the pig PCR product and dehybridized from the deer's and shad's. The interaction of dehybridized probe to GNPs prevented them from salt-induced aggregation, retaining their characteristic red color. The assay did not need any surface modification chemistry or labeling steps. The results were determined visually and validated by absorption spectroscopy. The entire assay (hybridization plus visual detection) was performed in less than 10 min. The assay obviated the need of complex RFLP, sequencing or blotting to differentiate the same size PCR products. We find the application of the assay for species assignment in food analysis, mismatch detection in genetic screening and homology study among closely related species.

  16. Intelligent DNA machine for the ultrasensitive colorimetric detection of nucleic acids.

    PubMed

    Xu, Jianguo; Qian, Jun; Li, Hongling; Wu, Zai-Sheng; Shen, Weiyu; Jia, Lee

    2016-01-15

    As DNA is employed to serve as a smart building block, an increasing interest has been devoted to the development of different DNA-based machines for the specific purpose, for example, the exploration of inter- or intramolecular interaction. In the current contribution, we developed an intelligent DNA machine and its operation can be designed to execute the ultrasensitive colorimetric detection of target nucleic acids. The DNA machine consists of a hairpin probe (HP) and an assistant template (AT). Using p53 gene as the target model to trigger the molecular machine operation, cyclic nucleic acid strand displacement polymerization (CNDP) was specifically induced, leading to the DNAzyme mediated catalytic reaction for signal readout. Specifically, with the help of polymerase and nickase, one target molecule was able to drive DNA nano-mechanical devices one-by-one through the hybridization/polymerization displacement cycles, and every initiated machine continued to operate, causing the dramatic accumulation of G-quadruplex-contained products. The G-quadruplex structure after binding to hemin could act as a horseradish peroxidase (HRP)-mimicking DNAzyme and catalyzed the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) by H2O2. As a result, an enhanced color change could be detected because of the generation of oxidation product ABTS•(+). In this way, the DNA machine has no any signal loss and enables the quantitative measurement of p53 DNA with a detection limit of 10fM, indicating great promise for unique application in biomedical research and early clinical diagnosis.

  17. A novel colorimetric assay for rapid detection of cysteine and Hg²⁺ based on gold clusters.

    PubMed

    Wang, Yi-Wei; Tang, Shurong; Yang, Huang-Hao; Song, Hongbo

    2016-01-01

    Inhibition and recovery of the catalytic activity of bovine serum albumin-capped gold nanoclusters (BSA-AuNCs) is observed for the first time by introduction of cysteine and Hg(2+). The prepared BSA-AuNCs possess highly intrinsic peroxidase-like activity. It can catalyze the oxidation of 3, 3, 5, 5-tetramethylbenzidine by H2O2 to produce a blue colored product. Based on this phenomenon, a new colorimetric assay for rapid, selective and sensitive detection of cysteine and Hg(2+) in aqueous solution has been demonstrated. The interaction process between target molecule and BSA-AuNCs is very fast, so that the whole test can be completed within ten minutes. Moreover, the fabricated colorimetric sensor is simple and cost-effective, without the need of nucleic acid based recognition element and complicated washing, separation and labeling process, thus holds great promise for routine analysis of cysteine and Hg(2+) in real samples. PMID:26695236

  18. A novel colorimetric assay for rapid detection of cysteine and Hg²⁺ based on gold clusters.

    PubMed

    Wang, Yi-Wei; Tang, Shurong; Yang, Huang-Hao; Song, Hongbo

    2016-01-01

    Inhibition and recovery of the catalytic activity of bovine serum albumin-capped gold nanoclusters (BSA-AuNCs) is observed for the first time by introduction of cysteine and Hg(2+). The prepared BSA-AuNCs possess highly intrinsic peroxidase-like activity. It can catalyze the oxidation of 3, 3, 5, 5-tetramethylbenzidine by H2O2 to produce a blue colored product. Based on this phenomenon, a new colorimetric assay for rapid, selective and sensitive detection of cysteine and Hg(2+) in aqueous solution has been demonstrated. The interaction process between target molecule and BSA-AuNCs is very fast, so that the whole test can be completed within ten minutes. Moreover, the fabricated colorimetric sensor is simple and cost-effective, without the need of nucleic acid based recognition element and complicated washing, separation and labeling process, thus holds great promise for routine analysis of cysteine and Hg(2+) in real samples.

  19. Dual-channel detection of Cu(2+) and F(-) with a simple Schiff-based colorimetric and fluorescent sensor.

    PubMed

    Na, Yu Jeong; Choi, Ye Won; Yun, Jin Yeong; Park, Kyung-Min; Chang, Pahn-Shick; Kim, Cheal

    2015-02-01

    A simple and easily synthesized colorimetric and fluorescent receptor 1, based on 4-diethylaminosalicylaldehyde moieties as a binding and signaling unit, has been synthesized and characterized. The receptor 1 has a selective colorimetric sensing ability for copper (II) ion by changing color from colorless to yellow in aqueous solution, and could be utilized to monitor Cu(II) over a wide pH range of 4-11. In addition, the detection limit (12μM) of 1 for Cu(2+) is much lower than that (30μM) recommended by WHO in drinking water, and its copper complex could be reversible simply through treatment with a proper reagent such as EDTA. Moreover, receptor 1 exhibited both a color change from colorless to yellow and fluorescence enhancement with a red shift upon addition to F(-) in DMSO. The recognition mechanism was attributed to the intermolecular proton transfer between the hydroxyl group of the receptor and the fluoride. PMID:25459728

  20. Dual-responsive immunosensor that combines colorimetric recognition and electrochemical response for ultrasensitive detection of cancer biomarkers.

    PubMed

    Hong, Wooyoung; Lee, Sooyeon; Cho, Youngnam

    2016-12-15

    We developed a nanoroughened, biotin-doped polypyrrole immunosensor for the detection of tumor markers through dual-signal (electrochemical and colorimetric) channels, electrochemical and colorimetric, that demonstrates remarkable analytical performance. A rapid, one-step electric field-mediated method was employed to fabricate the immunosensor with nanoscale roughness by simply modulating the applied electrical potential. We demonstrated the successful detection of three tumor markers (CA125, CEA, and PSA) via the double enzymatic signal amplifications in the presence of a target antigen, ultimately leading to desired diagnostic accuracy and reliability. The addition of multiple horseradish peroxidase (HRP)- and antibody-labeled nanoparticles greatly amplified the signal and simplified the measurement of cancer biomarker proteins by sequentially magnifying electrochemical and colorimetric signals in a single platform. The two parallel assays performed using the proposed immunosensor have yielded highly consistent and reproducible results. Additionally, for the analysis of plasma samples in a clinical setting, the values obtained with our immunosensor were validated by correlating the results with those of a standard radioimmunoassay (RIA), which obtained very similar clinically valid responses. PMID:27497199

  1. Colorimetric detection of DNA by modulation of thrombin activity on gold nanoparticles.

    PubMed

    Jian, Jyun-Wei; Huang, Chih-Ching

    2011-02-18

    A colorimetric, non-cross-linking aggregation-based gold-nanoparticle (AuNP) probe has been developed for the detection of DNA and the analysis of single-nucleotide polymorphism (SNP). The probe acts by modulating the enzyme activity of thrombin relative to fibrinogen. A thrombin-binding aptamer with a 29-base-long oligonucleotide (TBA(29)) assembled on the nanoparticles (TBA(29)-AuNPs) through sandwich DNA hybridization was found to possess ultra-high anticoagulant potency. The enzyme inhibition of thrombin was determined by thrombin-induced aggregation of fibrinogen-functionalized 56 nm AuNPs (Fib-AuNPs). The potency of the inhibition of TBA(29)-AuNPs relative to thrombin--and thus the degree of aggregation of the Fib-AuNPs--is highly dependent on the concentration of perfectly matched DNA (DNA(pm)). Under optimal conditions [Tris-HCl (20 mM, pH 7.4), KCl (5 mM), MgCl(2) (1 mM), CaCl(2) (1 mM), NaCl (150 mM), thrombin (10 pM), and TBA(29)-AuNPs (20 pM)], the new TBA(29)-AuNP/Fib-AuNP probe shows linear sensitivity to DNA(pm) in the concentration range 20-500 pM with a correlation coefficient of 0.96. The limit of detection for DNA(pm) was experimentally determined to be 12 pM, based on a signal-to-noise ratio (S/N) of 3. The new probe was successfully applied to the analysis of an SNP that is responsible for sickle cell anemia. Relative to conventional molecular-beacon-based probes, the new probe offers the advantages of higher sensitivity and selectivity towards DNA and lower cost, showing its great potential for practical studies of SNPs.

  2. Simple, field portable colorimetric detection device for organic peroxides and hydrogen peroxide

    SciTech Connect

    Pagoria, Philip F.; Mitchell, Alexander R.; Whipple, Richard E.; Carman, M. Leslie; Reynolds, John G.; Nunes, Peter; Shields, Sharon J.

    2010-11-09

    A simple and effective system for the colorimetric determination of organic peroxides and hydrogen peroxide. A peroxide pen utilizing a swipe material attached to a polyethylene tube contains two crushable vials. The two crushable vials contain a colorimetric reagent separated into dry ingredients and liquid ingredients. After swiping a suspected substance or surface the vials are broken, the reagent is mixed thoroughly and the reagent is allowed to wick into the swipe material. The presence of organic peroxides or hydrogen peroxide is confirmed by a deep blue color.

  3. Direct examination of the dietary preference of the copepod calanus helgolandicus using the colorimetric approach

    NASA Astrophysics Data System (ADS)

    Kang, Hyung-Ku; Poulet, Serge; Ju, Se-Jong

    2007-09-01

    The food selectivity of tethered females of the copepod Calanus helgolandicus was examined by using the colorimetric approach. First, feeding behavior of the copepod did not show any differences between the red-color stained with neutral red and non-stained diets using the diatom Coscinodiscus curvatulus. Then, the copepods were fed a mixtures of two diets, the diatom C. curvatulus, stained with neutral red, and the dinoflagellate Gymnodinium sanguineum for 14~60 minutes of feeding duration. The foregut colors of females were examined using a stereo-microscope and a video monitor. The foreguts of animals fed with a high density of diatoms in mixed diets showed a dark red color, whereas those fed with a high density of dinoflagellate in mixed diets were a dark yellow. The results suggest that this species of copepod may not selectively feed either one of the diets used for this study. Their feeding activity may be more likely related to the density of available prey in their environment. Therefore, this quick and easy colorimetric approach could provide very useful information, like the pre-screening procedure before designing and conducting the time-consuming and complex feeding experiments to understand the feeding ecology of copepods.

  4. Synthetic multivalent DNAzymes for enhanced hydrogen peroxide catalysis and sensitive colorimetric glucose detection.

    PubMed

    Yang, Deng-Kai; Kuo, Chia-Jung; Chen, Lin-Chi

    2015-01-26

    A peroxidase-mimic DNAzyme is a G-quadruplex (G4) DNA-hemin complex, in which the G4-DNA resembles an apoenzyme, and hemin is the cofactor for hydrogen peroxide (H2O2) catalysis. Twenty-one-mer CatG4 is a well-proven G4-DNA as well as a hemin-binding aptamer for constituting a DNAzyme. This work studied if a multivalent DNAzyme with accelerated catalysis could be constructed using a multimeric CatG4 with hemin. We compared CatG4 monomer, dimer, trimer, and tetramer, which were prepared by custom oligo synthesis, for G4 structure formation. According to circular dichroism (CD) analysis, we found that a CatG4 multimer exhibited more active G4 conformation than the sum effect of equal-number CatG4 monomers. However, the DNAzyme kinetics was not improved monotonically along with the subunit number of a multimeric CatG4. It was the trivalent DNAzyme, trimeric CatG4:hemin, resulting in the rapidest H2O2 catalysis instead of a tetravalent one. We discovered that the trivalent DNAzyme's highest catalytic rate was correlated to its most stable hemin-binding G4 structure, evidenced by CD melting temperature analysis. Finally, a trivalent DNAzyme-based colorimetric glucose assay with a detection limit as low as 10 μM was demonstrated, and this assay did not need adenosine 5'-tri-phosphate disodium salt hydrate (ATP) as a DNAzyme boosting agent. PMID:25542363

  5. Label-free detection of specific DNA sequence-telomere using unmodified gold nanoparticles as colorimetric probes

    NASA Astrophysics Data System (ADS)

    Qi, Yingying; Li, Li; Li, Baoxin

    2009-09-01

    A simple and sensitive label-free colorimetric detection of telomere DNA has been developed. It was based on the color change of gold nanoparticles (AuNPs) due to DNA hybridization. UV-vis spectra and transmission electron microscopy (TEM) were used to investigate the change of AuNPs. Under the optimized conditions, the linear range for determination of telomere DNA was 5.7 × 10 -13 to 4.5 × 10 -6 mol/L. The detection limit (3 σ) of this method has decreased to pico-molar level.

  6. High sensitive and label-free colorimetric DNA detection based on nicking endonuclease-assisted activation of DNAzymes.

    PubMed

    Li, Juan; Yao, Qiu-Hong; Fu, Hua-E; Zhang, Xiao-Long; Yang, Huang-Hao

    2011-07-15

    Horseradish peroxidase mimicking DNAzyme (HRP-DNAzyme) attracts growing interest as an amplifying label for biorecognition and biosensing events, especially for DNA detection. However, in the traditional designs, one target molecule can only generate one HRP-DNAzyme, which limits the signal enhancement and thus its sensitivity. In this article, we propose an amplified and label-free colorimetric DNA detection strategy based on nicking endonuclease (NEase)-assisted activation of HRP-DNAzymes (NEAA-DNAzymes). This new strategy relies on the hairpin-DNAzyme probe and NEase-assisted target recycling. In the hairpin-DNAzyme probe, the HRP-DNAzyme sequence is protected in a "caged" inactive structure, whereas the loop region includes the target complementary sequence. Upon hybridization with target, the beacon is opened, resulting in the activation of the HRP-DNAzyme. Meanwhile, upon formation of the duplex, the NEase recognizes a specific nucleotide sequence and cleaves the hairpin-DNAzyme probe into two fragments. After nicking, the fragments of the hairpin-DNAzyme probe spontaneously dissociate from the target DNA. Amplification is accomplished by another hairpin-DNAzyme probe hybridizing to the released intact target to continue the strand-scission cycle, which results in activation of numerous DNAzymes. The activated HRP-DNAzymes generate colorimetric or chemiluminescence readout signals, thus providing the amplified detection of DNA. The detection limit of the colorimetric method is 10 pmol/L, which are three orders of magnitude lower than that without NEase. In addition, the detection limit of the chemiluminescence method is 0.2 pmol/L. Meanwhile, this strategy also exhibits high discrimination ability even against single-base mismatch.

  7. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline

    NASA Astrophysics Data System (ADS)

    He, Yi; Peng, Rufang

    2014-11-01

    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl4 with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (˜25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  8. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline.

    PubMed

    He, Yi; Peng, Rufang

    2014-11-14

    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl₄ with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (∼25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  9. Aptamer-based colorimetric detection of proteins using a branched DNA cascade amplification strategy and unmodified gold nanoparticles.

    PubMed

    Chang, Chia-Chen; Chen, Chen-Yu; Chuang, Tsung-Liang; Wu, Tzu-Heng; Wei, Shu-Chen; Liao, Hongen; Lin, Chii-Wann

    2016-04-15

    A branched DNA amplification strategy was employed to design a colorimetric aptameric biosensor using unmodified gold nanoparticles (AuNPs). First, a programmed DNA dendritic nanostructure was formed using two double-stranded substrate DNAs and two single-stranded auxiliary DNAs as assembly components via a target-assisted cascade amplification reaction, and it was then captured by DNA sensing probe-stabilized AuNPs. The release of sensing probes from AuNPs led to the formation of unstable AuNPs, promoting salt-induced aggregation. By integrating the signal amplification capacity of the branched DNA cascade reaction and unmodified AuNPs as a sensing indicator, this amplified colorimetric sensing strategy allows protein detection with high sensitivity (at the femtomole level) and selectivity. The limit of detection of this approach for VEGF was lower than those of other aptamer-based detection methods. Moreover, this assay provides modification-free and enzyme-free protein detection without sophisticated instrumentation and might be generally applicable to the detection of other protein targets in the future.

  10. A colorimetric detection of acrylamide in potato chips based on nucleophile-initiated thiol-ene Michael addition.

    PubMed

    Hu, Qinqin; Fu, Yingchun; Xu, Xiahong; Qiao, Zhaohui; Wang, Ronghui; Zhang, Ying; Li, Yanbin

    2016-02-01

    Acrylamide (AA), a neurotoxin and a potential carcinogen, has been found in various thermally processed foods such as potato chips, biscuits, and coffee. Simple, cost-effective, and sensitive methods for the rapid detection of AA are needed to ensure food safety. Herein, a novel colorimetric method was proposed for the visual detection of AA based on a nucleophile-initiated thiol-ene Michael addition reaction. Gold nanoparticles (AuNPs) were aggregated by glutathione (GSH) because of a ligand-replacement, accompanied by a color change from red to purple. In the presence of AA, after the thiol-ene Michael addition reaction between GSH and AA with the catalysis of a nucleophile, the sulfhydryl group of GSH was consumed by AA, which hindered the subsequent ligand-replacement and the aggregation of AuNPs. Therefore, the concentration of AA could be determined by the visible color change caused by dispersion/aggregation of AuNPs. This new method showed high sensitivity with a linear range from 0.1 μmol L(-1) to 80 μmol L(-1) and a detection limit of 28.6 nmol L(-1), and especially revealed better selectivity than the fluorescence sensing method reported previously. Moreover, this new method was used to detect AA in potato chips with a satisfactory result in comparison with the standard methods based on chromatography, which indicated that the colorimetric method can be expanded for the rapid detection of AA in thermally processed foods. PMID:26699696

  11. Optimizing Colorimetric Assay Based on V2O5 Nanozymes for Sensitive Detection of H2O2 and Glucose

    PubMed Central

    Sun, Jiaheng; Li, Chunyan; Qi, Yanfei; Guo, Shuanli; Liang, Xue

    2016-01-01

    Nanozyme-based chemical sensing is a rapidly emerging field of research. Herein, a simple colorimetric assay for the detection of hydrogen peroxide and glucose based on the peroxidase-like activity of V2O5 nanozymes has been established. In this assay, the effects of pH, substrate, nanozyme concentrations and buffer solution have been investigated. It was found that compared with 3,3′,5,5′-tetramethylbenzidine (TMB), the enzyme substrate o-phenylenediamine (OPD) seriously interfered with the H2O2 detection. Under the optimal reaction conditions, the resulting sensor displayed a good response to H2O2 with a linear range of 1 to 500 μM, and a detection limit of 1 μM at a signal-to-noise ratio of 3. A linear correlation was established between absorbance intensity and concentration of glucose from 10 to 2000 μM, with a detection limit of 10 μM. The current work presents a simple, cheap, more convenient, sensitive, and easy handling colorimetric assay. PMID:27110794

  12. Study on a colorimetric sensor with color switching: Naked-eye detection for Cu(II) ion

    NASA Astrophysics Data System (ADS)

    Gao, Yang; Ma, Wenzhong

    2012-12-01

    In this paper, we synthesize and report a Cu(II)-sensing probe of N'1,N'2-bis(4-(diethylamino)-2-hydroxybenzylidene)oxalohydrazide (BDHO) with two detection channels. Its colorimetric and fluorescence spectrophotometric responses towards Cu(II) ion are fully investigated. It is found that the absorption and emission spectra of BDHO are both sensitive towards Cu(II) ion with high sensitivity as well as excellent selectivity. In addition, the recognition of BDHO towards Cu(II) ion is also very quick and can be accomplished within less than 1 min. The actual sensing performance of BDHO towards Cu(II) ion is also tentatively explored.

  13. Highly-sensitive colorimetric detection of H2O2 based on the Pt@Te nanorods

    NASA Astrophysics Data System (ADS)

    Wan, Li-Juan; Huang, Xing-Jiu; Liu, Jin-Huai; Zhang, Zhong-Xiang; Hou, Shi-Li; Liu, Wei-Jing

    2015-05-01

    Te nanorods (NRs) were prepared from TeO2 in the presence of hydrazine hydrate without using any surfactants under ambient conditions. Te NRs were then used as sacrificial templates to prepare Pt@Te NRs by spontaneous redox galvanic replacement between Te and Pt ions. The as-synthesized Pt@Te NRs exhibit a strong catalytic activity for the colorimetric detection of H2O2 using 2, 2‧-azino-bis (3-ethylbenzo-thiazoline-6-sulfonic acid) diammonium salt (ABTS) as an indicator.

  14. Gold nanoparticles for the colorimetric and fluorescent detection of ions and small organic molecules

    NASA Astrophysics Data System (ADS)

    Liu, Dingbin; Wang, Zhuo; Jiang, Xingyu

    2011-04-01

    In recent years, gold nanoparticles (AuNPs) have drawn considerable research attention in the fields of catalysis, drug delivery, imaging, diagnostics, therapy and biosensors due to their unique optical and electronic properties. In this review, we summarized recent advances in the development of AuNP-based colorimetric and fluorescent assays for ions including cations (such as Hg2+, Cu2+, Pb2+, As3+, Ca2+, Al3+, etc) and anions (such as NO2-, CN-, PF6-, F-, I-, oxoanions), and small organic molecules (such as cysteine, homocysteine, trinitrotoluene, melamine and cocaine, ATP, glucose, dopamine and so forth). Many of these species adversely affect human health and the environment. Moreover, we paid particular attention to AuNP-based colorimetric and fluorescent assays in practical applications.

  15. Multiplexed Colorimetric Solid-Phase Extraction

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.

    2009-01-01

    Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).

  16. Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing

    2015-02-01

    A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

  17. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators.

    PubMed

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-14

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples. PMID:27119550

  18. Facile colorimetric method for simple and rapid detection of endotoxin based on counterion-mediated gold nanorods aggregation.

    PubMed

    Wang, Yashan; Zhang, Daohong; Liu, Wei; Zhang, Xiao; Yu, Shaoxuan; Liu, Tao; Zhang, Wentao; Zhu, Wenxin; Wang, Jianlong

    2014-05-15

    Existence of endotoxin in food and injection products indicates bacterial contaminations and therefore poses threat to human health. Herein, a simple and rapid colorimetric method for the effective detection of endotoxin in food and injections based on counterion-mediated gold nanorods aggregation is first proposed. By taking advantage of the color change of unmodified gold nanorods resulted from endotoxin mediated gold nanorods aggregation, endotoxin could be detected in the concentration range of 0.01-0.6 μM. Further, we studied the performance of gold nanorods with different aspect ratios (2.7 and 3.3) in determination of endotoxin and found that gold nanorods with higher aspect ratio (AR) showed superiority in the sensing sensitivity of endotoxin. A good specificity for endotoxin, a detection limit of 0.0084 μM and recoveries ranging from 84% to 109% in spiked food and injection samples are obtained with the colorimetric method. Results demonstrate that the present method provides a novel and effective approach for on-site screening of endotoxin in common products, which is beneficial for monitoring and reducing the risk of bacterial contaminations in food and injections production.

  19. Colorimetric Nucleic Acid Testing Assay for RNA Virus Detection Based on Circle-to-Circle Amplification of Padlock Probes▿

    PubMed Central

    Ke, Rongqin; Zorzet, Anna; Göransson, Jenny; Lindegren, Gunnel; Sharifi-Mood, Batool; Chinikar, Sadegh; Mardani, Masoud; Mirazimi, Ali; Nilsson, Mats

    2011-01-01

    We developed a molecular diagnostic method for detection of RNA virus based on padlock probes and colorimetric readout. The feasibility of our approach was demonstrated by using detection of Crimean-Congo hemorrhagic fever (CCHF) virus as a model. Compared with conventional PCR-based methods, our approach does not require advanced equipment, involves easier assay design, and has a sensitivity of 103 viral copies/ml. By using a cocktail of padlock probes, synthetic templates representing different viral strain variants could be detected. We analyzed 34 CCHF patient samples, and all patients were correctly diagnosed when the results were compared to those of the current real-time PCR method. This is the first time that highly specific padlock probes have been applied to detection of a highly variable target sequence typical of RNA viruses. PMID:21956984

  20. Virgin silver nanoparticles as colorimetric nanoprobe for simultaneous detection of iodide and bromide ion in aqueous medium.

    PubMed

    Bothra, Shilpa; Kumar, Rajender; Pati, Ranjan K; Kuwar, Anil; Choi, Heung-Jin; Sahoo, Suban K

    2015-01-01

    A simple colorimetric nanoprobe based on virgin silver nanoparticles (AgNPs) was developed for the selective detection of iodide and bromide ions via aggregation and anti-aggregation mechanism. With addition of I(-) ions, virgin AgNPs, in presence of Fe(3+), showed perceptible color change from yellow to colorless along with disappearance of surface plasmon resonance (SPR) band of AgNPs at 400 nm. But in presence of Cr(3+), AgNPs turned yellow upon addition of I(-)and Br(-) anions. The developed virgin AgNPs probe showed high specificity and selectivity with the detection limits down to 0.32 μM and 1.32 μM for I(-) ions via two different mechanistic routes. Also, the designed probe detects Br(-) with a detection limit down to 1.67 μM. PMID:25950637

  1. A novel colorimetric method for the detection of Escherichia coli using cytochrome c peroxidase-encoding bacteriophage.

    PubMed

    Hoang, Hoang A; Abe, Michiharu; Nakasaki, Kiyohiko

    2014-03-01

    A new rapid and simple method was developed for the detection of Escherichia coli by constructing a recombinant T4 phage carrying the cytochrome c peroxidase gene derived from Saccharomyces cerevisiae (T4ccp) using which, the colorimetric detection of E. coli K12 was examined. The oxidation activity toward the chromogenic substrate cytochrome c was demonstrated by the cytochrome c peroxidase (CCP) produced from the T4ccp genome. The color change caused by the oxidation of the substrate could be visually perceived. The possibility of interference in the detection by the coexistence of other bacteria was assessed using Pseudomonas aeruginosa as a nontarget bacterium, and it was confirmed that the coexistence of P. aeruginosa caused no interference in the detection of E. coli K12.

  2. A Sensitive, Colorimetric, High-Throughput Loop-Mediated Isothermal Amplification Assay for the Detection of Plasmodium knowlesi.

    PubMed

    Britton, Sumudu; Cheng, Qin; Grigg, Matthew J; William, Timothy; Anstey, Nicholas M; McCarthy, James S

    2016-07-01

    The simian parasite Plasmodium knowlesi is now the commonest cause of malaria in Malaysia and can rapidly cause severe and fatal malaria. However, microscopic misdiagnosis of Plasmodium species is common, rapid antigen detection tests remain insufficiently sensitive and confirmation of P. knowlesi requires polymerase chain reaction (PCR). Thus available point-of-care diagnostic tests are inadequate. This study reports the development of a simple, sensitive, colorimetric, high-throughput loop-mediated isothermal amplification assay (HtLAMP) diagnostic test using novel primers for the detection of P. knowlesi. This assay is able to detect 0.2 parasites/μL, and compared with PCR has a sensitivity of 96% for the detection of P. knowlesi, making it a potentially field-applicable point-of-care diagnostic tool.

  3. Enhanced Colorimetric Immunoassay Accompanying with Enzyme Cascade Amplification Strategy for Ultrasensitive Detection of Low-Abundance Protein

    PubMed Central

    Gao, Zhuangqiang; Hou, Li; Xu, Mingdi; Tang, Dianping

    2014-01-01

    Methods based on enzyme labels have been developed for colorimetric immunoassays, but most involve poor sensitivity and are unsuitable for routine use. Herein, we design an enhanced colorimetric immunoassay for prostate-specific antigen (PSA) coupling with an enzyme-cascade-amplification strategy (ECAS-CIA). In the presence of target PSA, the labeled alkaline phosphatase on secondary antibody catalyzes the formation of palladium nanostructures, which catalyze 3,3′,5,5′-tetramethylbenzidine-H2O2 system to produce the colored products, thus resulting in the signal cascade amplification. Results indicated that the ECAS-CIA presents good responses toward PSA, and allows detection of PSA at a concentration as low as 0.05 ng mL−1. Intra- and inter-assay coefficients of variation are below 9.5% and 10.7%, respectively. Additionally, the methodology is validated for analysis of clinical serum specimens with consistent results obtained by PSA ELISA kit. Importantly, the ECAS-CIA opens a new horizon for protein diagnostics and biosecurity. PMID:24509941

  4. A colorimetric biosensor for detection of attomolar microRNA with a functional nucleic acid-based amplification machine.

    PubMed

    Li, Dandan; Cheng, Wei; Yan, Yurong; Zhang, Ye; Yin, Yibing; Ju, Huangxian; Ding, Shijia

    2016-01-01

    A functional nucleic acid-based amplification machine was designed for simple and label-free ultrasensitive colorimetric biosensing of microRNA (miRNA). The amplification machine was composed of a complex of trigger template and C-rich DNA modified molecular beacon (MB) and G-rich DNA (GDNA) as the probe, polymerase and nicking enzyme, and a dumbbell-shaped amplification template. The presence of target miRNA triggered MB mediated strand displacement to cyclically release nicking triggers, which led to a toehold initiated rolling circle amplification to produce large amounts of GDNAs. The formed GDNAs could stack with hemin to form G-quadruplex/hemin DNAzyme, a well-known horseradish peroxidase (HRP) mimic, for catalyzing a colorimetric reaction. The modified MB improved the stringent target recognition and reduced background signal. The proposed sensing strategy showed very high sensitivity and selectivity with a wide dynamic range from 10 aM to 1.0 nM, and enabled successful visual analysis of trace amount of miRNA in real sample by the naked eye. This rapid and highly efficient signal amplification strategy provided a simple and sensitive platform for miRNA detection. It would be a versatile and powerful tool for clinical molecular diagnostics.

  5. A Simple and Green Route for Room-Temperature Synthesis of Gold Nanoparticles and Selective Colorimetric Detection of Cysteine.

    PubMed

    Bagci, Pelin Onsekizoglu; Wang, Yi-Cheng; Gunasekaran, Sundaram

    2015-09-01

    Gold nanoparticles (AuNPs) were synthesized at room temperature following a simple, rapid, and green route using fresh-squeezed apple juice as a reducing reagent. The optimal AuNPs, based on the particle color, stability, and color change suitable for colorimetric detection of cysteine (Cys), are synthesized using 5 mL of 10% apple juice, 1 mL of 10 mM gold precursor solution, and 1 mL of 0.1 M NaOH. Under this set of parameters, the AuNPs are synthesized within 30 min at room temperature. The average size (11.1 ± 3.2 nm) and ζ potential (-36.5 mV) of the AuNPs synthesized were similar to those of AuNPs prepared via the conventional citrate-reduction method. In the presence of Cys, unlike with any other amino acid, the AuNPs aggregated, possibly due to the gold-sulfur covalent interaction, yielding red-to-purple color change of the sample solution. The red-shift of the localized surface plasmon resonance peak of the AuNPs responsible for the color change was recorded by UV-vis spectrometer. The effect of other potential interferents such as glucose, ascorbic acid, K(+) , Na(+) , Ca(2+) , Zn(2+) , Ag(+) , Ni(2+) , Cu(2+) , Co(2+) , and Hg(2+) were also examined. The results show that AuNPs can be used to selectively detect and measure Cys with a linear dependency in the range of 2 to 100 μM and a limit of detection (signal-to-noise ratio > 3) of 50 nM. The results suggest that the green-synthesized AuNPs are useful for simple, rapid, and sensitive colorimetric detection of Cys, which is an essential amino acid in food and biological systems.

  6. Colorimetric detection of fluoride ions by anthraimidazoledione based sensors in the presence of Cu(ii) ions.

    PubMed

    Sarkar, Amrita; Bhattacharyya, Sudipta; Mukherjee, Arindam

    2016-01-21

    Anthraquinone based anion receptors have gained importance due to their colorimetric response on sensing a specific anion and the possibility of tuning this property by varying the conjugated moiety (the donor) to the diamine. In this work, we have synthesized and characterized four anthraimidazoledione compounds having 2,5-dihydroxy benzene, 4-(bis(2-chloroethyl)amino)benzene, imidazole and 4-methylthiazole moieties respectively (1-4). All of them were probed for their potential as anion sensors to study the effect of changes in the hydrogen bond donor-acceptor. The p-hydroquinone bound anthraimidazoledione (1) and thioimidazole bound anthraimidazoledione (4) were able to detect both F(-) and CN(-) in the presence of other anions Cl(-), Br(-), I(-), H2PO4(-), OAc(-), NO3(-)and ClO4(-). Both 1 and 4 could not differentiate F(-) from CN(-) and provided a similar response to both. The 1H NMR studies of 1 and 4 with F(-) showed the formation of [HF2](-) at 16.3 ppm and the 19F NMR showed a sharp peak at -145 ppm in both cases. However, although there may be NMR evidence of [HF2](-) formation F(-) may not be detected colorimetrically if the CT band remains almost unchanged, as found for 3. The results emphasize that the change of a hetero atom in the donor moiety of an anthraimidazoledione may render a large difference in sensitivity. In the case of 4 selective detection of F(-) was possible in the presence of 0.5 equivalent of Cu2+ with the exhibition of a distinct green colour with a Δλ shift of ca. 50 nm in contrast to CN(-) which showed orange colouration with a Δλ shift of only 15 nm. In the presence of Cu2+ the F(-) detection limit was 0.038(5) ppm (below the WHO specified level) at a receptor concentration of 25 μM. PMID:26659520

  7. Hydroxamate-based colorimetric method for direct screening of transglutaminase-producing bacteria.

    PubMed

    Bourneow, Chaiwut; Benjakul, Soottawat; H-Kittikun, Aran

    2012-05-01

    Microbial transglutaminase (MTGase) is a commercial enzyme that has been applied to many protein containing foods to improve their textural property. The screening of MTGase-producing microorganisms from various sources might lead to the discovery of a new MTGase with different characteristics. This report demonstrates the use of a direct detection method for MTGase-producing bacteria grown on an agar plate by filter paper disc (FPD) assay. The principle of the assay is the formation of a red burgundy color by the hydroxamate-ferric complex. The color developed intensity was linearly correlated by the concentration of hydroxamic acid in the range of 0.1-0.8 μM and was visually scored at 4 levels: 0, 1, 2 and 3. Streptoverticillium mobaraense DSM 40847, a positive MTGase-producer, was chosen for the verification and improving of the proposed method. The colonies grown on the nutrient agar plate at 37°C for 24 h were covered with FPDs and 30 μl of substrates (CBZ-Gln-Gly and hydroxylamine). After incubation, 10 μl of the ferric-TCA-HCl solution was placed on the FPD. The optimal time taken to catalyze the formation of CBZ-Gln-Gly-hydroxamic acid by the MTGase and the time taken for the hydroxamate-ferric complex to form color were 180 and 60 min, respectively. Using this assay, 30 of 189 colonies isolated from wastewater and floating-floc samples showed MTGase-positive colonies which were well correlated to the quantitative screening of MTGase activity (R(2) = 0.9758). The results revealed that the FPD assay could be used for the qualitative screening of MTGase-producing bacteria.

  8. Naked-eye sensitive detection of alkaline phosphatase (ALP) and pyrophosphate (PPi) based on a horseradish peroxidase catalytic colorimetric system with Cu(ii).

    PubMed

    Shi, Dongmin; Sun, Yue; Lin, Lin; Shi, Chunjun; Wang, Guangfeng; Zhang, Xiaojun

    2016-10-01

    In this paper, a novel colorimetric method for the detection of alkaline phosphatase (ALP) and pyrophosphate (PPi) was designed based on a Cu(2+)-horseradish peroxidase (HRP)-3,3',5,5'-tetra-methylbenzidine (TMB)-H2O2 system. In the presence of ALP, l-ascorbic acid-2-phosphate (AAP) could be hydrolyzed to ascorbic acid which could reduce Cu(2+) to Cu(+) to inhibit the enzymatic activity of HRP in the colorimetric system. The change in absorbance was found to be proportional to the ALP concentration with a linear detection range and a limit of detection of 5.4 mU mL(-1). In the presence of PPi, because Cu(2+) was chelated by PPi, the conversion of Cu(ii) by AA was effectively inhibited. The color of the HRP-TMB-H2O2 system with Cu(2+) showed blue. The HRP-TMB-H2O2 system with the Cu(2+) colorimetric system could also detect PPi with a satisfying result. In summary, this method possesses sensitivity, reproducibility, and cost-effectiveness without labelling and separation and the use of a colorimetric method is more in line with the requirements of on-site detection and green chemistry. PMID:27412643

  9. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators

    NASA Astrophysics Data System (ADS)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-01

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples.An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the

  10. [Colorimetric detection of human influenza A H1N1 virus by reverse transcription loop mediated isothermal amplification].

    PubMed

    Nie, Kai; Wang, Da-Yan; Qin, Meng; Gao, Rong-Bao; Wang, Miao; Zou, Shu-Mei; Han, Feng; Zhao, Xiang; Li, Xi-Yan; Shu, Yue-Long; Ma, Xue-Jun

    2010-03-01

    A simple, rapid and sensitive colorimetric Reverse Transcription Loop Mediated Isothermal Amplification (RT-LAMP) method was established to detect human influenza A H1N1 virus. The method employed a set of six specially designed primers that recognized eight distinct sequences of the HA gene for amplification of nucleic acid under isothermal conditions at 65 degrees C for one and half hour. The amplification process of RT-LAMP was monitored by the addition of HNB (Hydroxy naphthol blue) dye prior to amplification. A positive reaction was indicated by a color change from violet to sky blue and confirmed by agarose electrophoresis. The specificity of the RT-LAMP assay was validated by cross-reaction with different swine and human influenza virus including human seasonal influenza A /H1N1 A /H3N2, influenza B and swine A /H1N1. The sensitivity of this assay was evaluated by serial dilutions of RNA molecules from in vitro transcription of human influenza A H1N1 HA gene. The assay was further evaluated with 30 clinical specimens with suspected pandemic influenza A H1N1 virus infection in parallel with RT-PCR detection and 26 clinical specimens with seasonal influenza virus infection. Our results showed that the RT-LAMP was able to achieve a sensitivity of 60 RNA copies with high specificity, and detection rate was comparable to that of the RT-PCR with the clinical samples of pandemic influenza A H1N1 infection. The RT-LAMP reaction with HNB could also be measured at 650nm in a microplate reader for quantitative analysis. Thus, we concluded that this colorimetric RT-LAMP assay had potential for the rapid screening of the human influenza A H1N1 virus infection in National influenza monitoring network laboratories and sentinel hospitals of provincial and municipal region in China.

  11. Architecture based on the integration of intermolecular G-quadruplex structure with sticky-end pairing and colorimetric detection of DNA hybridization

    NASA Astrophysics Data System (ADS)

    Li, Hongbo; Wu, Zai-Sheng; Shen, Zhifa; Shen, Guoli; Yu, Ruqin

    2014-01-01

    An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA with a linear range of more than two orders of magnitude and a detection limit of 0.2 nM, suggesting a considerably improved analytical performance. And more to the point, the discrimination of single-base mismatched target DNAs can be easily conducted via visual observation. The successful development of the present colorimetric system, especially the GISA-based aggregation mechanism of GNPs is different from traditional approaches, and offers a critical insight into the dependence of the GNP aggregation on the structural properties of oligonucleotides, opening a good way to design colorimetric sensing probes and DNA nanostructure. An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA

  12. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    PubMed Central

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  13. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    PubMed

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  14. Microgel coating of magnetic nanoparticles via bienzyme-mediated free-radical polymerization for colorimetric detection of glucose.

    PubMed

    Wu, Qing; Wang, Xia; Liao, Chuanan; Wei, Qingcong; Wang, Qigang

    2015-10-28

    This study describes a new strategy for the fabrication of magnetic core-shell microgels by free-radical polymerization triggered by the cascade reaction of glucose oxidase (GOx) and horseradish peroxidase (HRP). The mild polymerization around the interface of the magnetic nanoparticles permits the mild coating of the microgel layer with excellent characteristics for various applications in biocatalysis and medical diagnostics, as well as in clinical fields. The immobilized bienzyme within the microgel has a largely retained activity relative to the non-immobilized one. The confining effect of the microgel and the well designed distance between the two enzymes can benefit the diffusion of intermediates to the HRP active site. The final microgels can be incontestably employed as sensitive biosensors for colorimetric glucose detection. PMID:26412343

  15. Colorimetric detection of sulfide based on target-induced shielding against the peroxidase-like activity of gold nanoparticles.

    PubMed

    Deng, Hao-Hua; Weng, Shao-Huang; Huang, Shuang-Lu; Zhang, Ling-Na; Liu, Ai-Lin; Lin, Xin-Hua; Chen, Wei

    2014-12-10

    Colorimetric recognition and sensing of sulfide with high sensitivity was proposed based on target-induced shielding against the peroxidase-like activity of bare gold nanoparticles. Significant features of the new assay system are its simplicity and cost-effectiveness. The recognition of sulfide by bare gold nanoparticles can be fulfilled in a few seconds and the assay can be accomplished in about 10 min. Furthermore, the new assay system does not require surface modification of GNPs to obtain the specificity for sulfide, and a salt-induced aggregation step is not needed. The detection limit of this method for sulfide was 80 nM. These features make this sensor a potentially powerful tool for the quantitative determination of sulfide in water samples. PMID:25441901

  16. The catalytic activity of Ag2S-montmorillonites as peroxidase mimetic toward colorimetric detection of H2O2.

    PubMed

    Liu, Qingyun; Jiang, Yanling; Zhang, Leyou; Zhou, Xinpei; Lv, Xintian; Ding, Yanyuan; Sun, Lifang; Chen, Pengpeng; Yin, Hailiang

    2016-08-01

    Nanocomposites based on silver sulfide (Ag2S) and Ca-montmorillonite (Ca(2+)-MMT) were synthesized by a simple hydrothermal method. The nanocomposites were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM) and Fourier transform infrared spectra (FTIR). The as-prepared Ag2S-MMT nanocomposites were firstly demonstrated to possess intrinsic peroxidase-like activity and could rapidly catalytically oxidize the substrate 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2 to produce a blue product which can be seen by the naked eye in only one minute. The experimental results revealed that the Ag2S-MMT nanocomposites exhibit higher thermal durance. Based on the TMB-H2O2 catalyzed color reaction, the Ag2S-MMT nanocomposites were exploited as a new type of biosensor for detection and estimation of H2O2 through a simple, cheap and selective colorimetric method. PMID:27157733

  17. Microgel coating of magnetic nanoparticles via bienzyme-mediated free-radical polymerization for colorimetric detection of glucose

    NASA Astrophysics Data System (ADS)

    Wu, Qing; Wang, Xia; Liao, Chuanan; Wei, Qingcong; Wang, Qigang

    2015-10-01

    This study describes a new strategy for the fabrication of magnetic core-shell microgels by free-radical polymerization triggered by the cascade reaction of glucose oxidase (GOx) and horseradish peroxidase (HRP). The mild polymerization around the interface of the magnetic nanoparticles permits the mild coating of the microgel layer with excellent characteristics for various applications in biocatalysis and medical diagnostics, as well as in clinical fields. The immobilized bienzyme within the microgel has a largely retained activity relative to the non-immobilized one. The confining effect of the microgel and the well designed distance between the two enzymes can benefit the diffusion of intermediates to the HRP active site. The final microgels can be incontestably employed as sensitive biosensors for colorimetric glucose detection.This study describes a new strategy for the fabrication of magnetic core-shell microgels by free-radical polymerization triggered by the cascade reaction of glucose oxidase (GOx) and horseradish peroxidase (HRP). The mild polymerization around the interface of the magnetic nanoparticles permits the mild coating of the microgel layer with excellent characteristics for various applications in biocatalysis and medical diagnostics, as well as in clinical fields. The immobilized bienzyme within the microgel has a largely retained activity relative to the non-immobilized one. The confining effect of the microgel and the well designed distance between the two enzymes can benefit the diffusion of intermediates to the HRP active site. The final microgels can be incontestably employed as sensitive biosensors for colorimetric glucose detection. Electronic supplementary information (ESI) available: Experimental details and ESI figures. See DOI: 10.1039/c5nr05716g

  18. Iodine-Mediated Etching of Gold Nanorods for Plasmonic ELISA Based on Colorimetric Detection of Alkaline Phosphatase.

    PubMed

    Zhang, Zhiyang; Chen, Zhaopeng; Wang, Shasha; Cheng, Fangbin; Chen, Lingxin

    2015-12-23

    Here, we propose a plasmonic enzyme-linked immunosorbent assay (ELISA) based on highly sensitive colorimetric detection of alkaline phosphatase (ALP), which is achieved by iodine-mediated etching of gold nanorods (AuNRs). Once the sandwich-type immunocomplex is formed, the ALP bound on the polystyrene microwells will hydrolyze ascorbic acid 2-phosphate into ascorbic acid. Subsequently, iodate is reduced to iodine, a moderate oxidant, which etches AuNRs from rod to sphere in shape. The shape change of AuNRs leads to a blue-shift of longitudinal localized surface plasmon resonance. As a result, the solution of AuNRs changes from blue to red. Benefiting from the highly sensitive detection of ALP, the proposed plasmonic ELISA has achieved an ultralow detection limit (100 pg/mL) for human immunoglobulin G (IgG). Importantly, the visual detection limit (3.0 ng/mL) allows the rapid differential diagnosis with the naked eye. The further detection of human IgG in fetal bovine serum indicates its applicability to the determination of low abundance protein in complex biological samples.

  19. Evaluation of Colorimetric Methods Using Nicotinamide for Rapid Detection of Pyrazinamide Resistance in Mycobacterium tuberculosis▿

    PubMed Central

    Mirabal, Niuris C.; Yzquierdo, Sergio L.; Lemus, Dihadenys; Madruga, Mariela; Milián, Yoslaine; Echemendía, Miguel; Takiff, Howard; Martin, Anandi; Van der Stuyf, Patrick; Palomino, Juan Carlos; Montoro, Ernesto

    2010-01-01

    The direct detection of pyrazinamide resistance in Mycobacterium tuberculosis is sufficiently difficult that many laboratories do not attempt it. Most pyrazinamide resistance is caused by mutations that inactivate the pyrazinamidase enzyme needed to convert the prodrug pyrazinamide to its active form. We evaluated two newer and simpler methods to assess pyrazinamidase activity, the nitrate reductase and malachite green microtube assays, using nicotinamide in place of pyrazinamide. A total of 102 strains were tested by these methods and the results compared with those obtained by the classic Wayne assay. Mutations in the pncA gene were identified by sequencing the pncA genes from all isolates in which pyrazinamide resistance was detected by any of the three methods. Both the nitrate reductase and malachite green microtube assays showed sensitivities of 93.75% and specificities of 97.67%. Mutations in the pncA gene were found in 14 of 16 strains that were pyrazinamide resistant and in 1 of 4 strains that were sensitive by the Wayne assay. Both of these simple methods, used with nicotinamide, are promising and inexpensive alternatives for the rapid detection of pyrazinamide resistance in limited-resource countries. PMID:20554826

  20. Detection of measles, mumps and rubella viruses by immuno-colorimetric assay and its application in focus reduction neutralization tests.

    PubMed

    Vaidya, Sunil R; Kumbhar, Neelakshi S; Bhide, Vandana S

    2014-12-01

    Measles, mumps and rubella are vaccine-preventable diseases; however limited epidemiological data are available from low-income or developing countries. Thus, it is important to investigate the transmission of these viruses in different geographical regions. In this context, a cell culture-based rapid and reliable immuno-colorimetric assay (ICA) was established and its utility studied. Twenty-three measles, six mumps and six rubella virus isolates and three vaccine strains were studied. Detection by ICA was compared with plaque and RT-PCR assays. In addition, ICA was used to detect viruses in throat swabs (n = 24) collected from patients with suspected measles or mumps. Similarly, ICA was used in a focus reduction neutralization test (FRNT) and the results compared with those obtained by a commercial IgG enzyme immuno assay. Measles and mumps virus were detected 2 days post-infection in Vero or Vero-human signaling lymphocytic activation molecule cells, whereas rubella virus was detected 3 days post-infection in Vero cells. The blue stained viral foci were visible by the naked eye or through a magnifying glass. In conclusion, ICA was successfully used on 35 virus isolates, three vaccine strains and clinical specimens collected from suspected cases of measles and mumps. Furthermore, an application of ICA in a neutralization test (i.e., FRNT) was documented; this may be useful for sero-epidemiological, cross-neutralization and pre/post-vaccine studies.

  1. Detection of measles, mumps and rubella viruses by immuno-colorimetric assay and its application in focus reduction neutralization tests.

    PubMed

    Vaidya, Sunil R; Kumbhar, Neelakshi S; Bhide, Vandana S

    2014-12-01

    Measles, mumps and rubella are vaccine-preventable diseases; however limited epidemiological data are available from low-income or developing countries. Thus, it is important to investigate the transmission of these viruses in different geographical regions. In this context, a cell culture-based rapid and reliable immuno-colorimetric assay (ICA) was established and its utility studied. Twenty-three measles, six mumps and six rubella virus isolates and three vaccine strains were studied. Detection by ICA was compared with plaque and RT-PCR assays. In addition, ICA was used to detect viruses in throat swabs (n = 24) collected from patients with suspected measles or mumps. Similarly, ICA was used in a focus reduction neutralization test (FRNT) and the results compared with those obtained by a commercial IgG enzyme immuno assay. Measles and mumps virus were detected 2 days post-infection in Vero or Vero-human signaling lymphocytic activation molecule cells, whereas rubella virus was detected 3 days post-infection in Vero cells. The blue stained viral foci were visible by the naked eye or through a magnifying glass. In conclusion, ICA was successfully used on 35 virus isolates, three vaccine strains and clinical specimens collected from suspected cases of measles and mumps. Furthermore, an application of ICA in a neutralization test (i.e., FRNT) was documented; this may be useful for sero-epidemiological, cross-neutralization and pre/post-vaccine studies. PMID:25244651

  2. Novel cellulose polyampholyte-gold nanoparticle-based colorimetric competition assay for the detection of cysteine and mercury(II).

    PubMed

    You, Jun; Hu, Haoze; Zhou, Jinping; Zhang, Lina; Zhang, Yaping; Kondo, Tetsuo

    2013-04-23

    We provide a highly sensitive and selective assay to detect cysteine (Cys) and Hg(2+) in aqueous solutions using Au nanoparticles (NPs) stabilized by carboxylethyl quaternized cellulose (CEQC). This method is based on the thiophilicity of Hg(2+) and Au NPs as well as the unique optical properties of CEQC-stabilized Au NPs. CEQC chains are good stabilizing agents for Au NPs even in a high-salt solution. The addition of Cys results in the aggregation of CEQC-stabilized Au NPs, which induces the visible color change and obvious redshift in UV-visible absorption spectra. On the other hand, Hg(2+) is more apt to interact with thiols than Au NPs; thus, it can remove the Cys and trigger Au NP aggregate redispersion again. By taking advantage of this mechanism, a novel off-on colorimetric sensor has been established for Cys and Hg(2+) detection. This new assay could selectively detect Cys and Hg(2+) with the detection limits as low as 20 and 40 nM in aqueous solutions, respectively.

  3. Colorimetric detection of lagomorphs' calicivirus genomic sequences by polymerase chain reaction incorporating digoxigenin dUTP.

    PubMed

    Psikal, I; Smíd, B; Kubalíková, R; Valícek, L; Rodák, L; Kosinová, E

    1997-06-30

    A method of reverse transcription followed by polymerase chain reaction (RT-PCR) has been implemented for the demonstration of the rabbit haemorrhagic disease virus (RHDV) genome in organ suspensions, leukocytes and excretions of infected rabbits. RT-PCR has been tested with 10 RHDV strains isolated at various geographic sites and times using a pair of primers coming from the gene region coding for the capsid protein VP60. The same primers were effective in the amplification of 4 of 5 European brown hare syndrome (EBHS) virus isolates. Non-radioactive labelling of PCR products with digoxigenin during the amplification and a system of colorimetric assessment of hybridization reactions between a biotin-labelled RHDV capture probe and the chains of labelled amplicons (PCR ELISA) were used for specific analyses of nucleic acid synthesis. The sensitivity of the alternative procedure of analysis of the dig-labelled PCR products with PCR ELISA was two logs10 higher than that of conventional electrophoresis in agarose gel stained with ethidium bromide. The results of the hybridization reactions, carried out under various stringency conditions, have confirmed the presumption that the genomic similarity between the amplified and the probed areas of the capsid protein VP60 gene was not uniform within all the tested caliciviruses. A higher degree of heterogeneity was observed between the isolates of EBHSV and RHDV.

  4. Colorimetric detection of in situ metal acetates and fluorides by a bipyridyl-linked Schiff base.

    PubMed

    Suganya, Sivalingam; Zo, Hye Jin; Park, Jong S; Velmathi, Sivan

    2014-12-01

    Here, we present a new bipyridyl moiety linked Schiff base (bipy-1) that is well characterized using spectroscopic techniques. Colorimetric and UV-vis titrations were used to study the photophysical properties of bipy-1 in the presence of various tetrabutyl ammonium salt of anions and metal salts containing different counter cations. bipy-1 showed selective recognition of dimethyl sulphoxide solution of tetrabutyl ammonium salt of F(-) ion accompanied with a UV-vis band at 529 nm and interesting binding of aqueous Co, Ni, and Cu acetates/fluorides, as confirmed by distinct color changes from fluorescent green to pink or orange and a strong band around 480-510 nm in the UV-vis spectrum. However, in the presence of Co, Ni, and Cu countercations, any form of metal acetate/fluorides was found to be able to respond to similar color changes from fluorescent green to pink or orange, showing a band around 480-510 nm. This type of output clearly indicates that the in situ formation of Co, Ni, and Cu acetates/fluorides also coordinates with bipyridyl nitrogen atoms.

  5. Colorimetric detection of in situ metal acetates and fluorides by a bipyridyl-linked Schiff base.

    PubMed

    Suganya, Sivalingam; Zo, Hye Jin; Park, Jong S; Velmathi, Sivan

    2014-12-01

    Here, we present a new bipyridyl moiety linked Schiff base (bipy-1) that is well characterized using spectroscopic techniques. Colorimetric and UV-vis titrations were used to study the photophysical properties of bipy-1 in the presence of various tetrabutyl ammonium salt of anions and metal salts containing different counter cations. bipy-1 showed selective recognition of dimethyl sulphoxide solution of tetrabutyl ammonium salt of F(-) ion accompanied with a UV-vis band at 529 nm and interesting binding of aqueous Co, Ni, and Cu acetates/fluorides, as confirmed by distinct color changes from fluorescent green to pink or orange and a strong band around 480-510 nm in the UV-vis spectrum. However, in the presence of Co, Ni, and Cu countercations, any form of metal acetate/fluorides was found to be able to respond to similar color changes from fluorescent green to pink or orange, showing a band around 480-510 nm. This type of output clearly indicates that the in situ formation of Co, Ni, and Cu acetates/fluorides also coordinates with bipyridyl nitrogen atoms. PMID:25319616

  6. Invader Assisted Enzyme-Linked Immunosorbent Assay for Colorimetric Detection of Disease Biomarkers Using Oligonucleotide Probe-Modified Gold Nanoparticles.

    PubMed

    Song, Qinxin; Qi, Xiemin; Jia, Huning; He, Liang; Kumar, Shalen; Pitman, Janet L; Zou, Bingjie; Zhou, Guohua

    2016-04-01

    We successfully developed an invader assisted ELISA assay (iaELISA) for sensitive detection of disease biomarkers. The method includes three key steps as follows; biotinylated detection antibody was at first used to capture targeted antigen by sandwich ELISA. The biotinylated oligonucleotide was then attached to detection antibody via streptavidin. Finally, the cascade invader reactions were employed to amplify the biotinylated oligonucleotide specific to the antigen so that detection of the antigen was transformed into signal amplification of the antigen-specific DNA. To achieve colorimetric detection, oligonucleotide probe and modified gold nanoparticles (AuNPs) were coupled with the invader assay. Utilization of the hairpin probes in the invader reaction brought about free AuNPs, resulting in the positive read-out (red color). On the other hand, aggregation of the AuNPs occurred when the hairpin probes were not utilized in the reaction. This method was successfully used to detect as low as 2.4 x 10(-11) g/mL of HBsAg by both naked eye and spectrophotometer. This sensitivity was about 100 times higher than that of conventional ELISA method. The method was also used to assay 16 serum specimens from HBV-infected patients and 8 serum specimens from HBV-negative donors and results were in good agreement with those obtained from the conventional ELISA. As the invader assay is sensitive to one base sequence, a good specificity was also obtained by detecting other antigens like hepatitis A virus (HAV) and BSA. The method has therefore much potential for ultrasensitive and cost-effective detection of targeted proteins that have clinical importance.

  7. Invader Assisted Enzyme-Linked Immunosorbent Assay for Colorimetric Detection of Disease Biomarkers Using Oligonucleotide Probe-Modified Gold Nanoparticles.

    PubMed

    Song, Qinxin; Qi, Xiemin; Jia, Huning; He, Liang; Kumar, Shalen; Pitman, Janet L; Zou, Bingjie; Zhou, Guohua

    2016-04-01

    We successfully developed an invader assisted ELISA assay (iaELISA) for sensitive detection of disease biomarkers. The method includes three key steps as follows; biotinylated detection antibody was at first used to capture targeted antigen by sandwich ELISA. The biotinylated oligonucleotide was then attached to detection antibody via streptavidin. Finally, the cascade invader reactions were employed to amplify the biotinylated oligonucleotide specific to the antigen so that detection of the antigen was transformed into signal amplification of the antigen-specific DNA. To achieve colorimetric detection, oligonucleotide probe and modified gold nanoparticles (AuNPs) were coupled with the invader assay. Utilization of the hairpin probes in the invader reaction brought about free AuNPs, resulting in the positive read-out (red color). On the other hand, aggregation of the AuNPs occurred when the hairpin probes were not utilized in the reaction. This method was successfully used to detect as low as 2.4 x 10(-11) g/mL of HBsAg by both naked eye and spectrophotometer. This sensitivity was about 100 times higher than that of conventional ELISA method. The method was also used to assay 16 serum specimens from HBV-infected patients and 8 serum specimens from HBV-negative donors and results were in good agreement with those obtained from the conventional ELISA. As the invader assay is sensitive to one base sequence, a good specificity was also obtained by detecting other antigens like hepatitis A virus (HAV) and BSA. The method has therefore much potential for ultrasensitive and cost-effective detection of targeted proteins that have clinical importance. PMID:27301208

  8. Highly efficient colorimetric detection of target cancer cells utilizing superior catalytic activity of graphene oxide-magnetic-platinum nanohybrids

    NASA Astrophysics Data System (ADS)

    Kim, Moon Il; Kim, Min Su; Woo, Min-Ah; Ye, Youngjin; Kang, Kyoung Suk; Lee, Jinwoo; Park, Hyun Gyu

    2014-01-01

    Enzyme-linked immunosorbent assays (ELISAs) have most widely been applied in immunoassays for several decades. However, several unavoidable limitations (e.g., instability caused by structural unfolding) of natural enzymes have hindered their widespread applications. Here, we describe a new nanohybrid consisting of Fe3O4 magnetic nanoparticles (MNPs) and platinum nanoparticles (Pt NPs), simultaneously immobilized on the surface of graphene oxide (GO). By synergistically integrating highly catalytically active Pt NPs and MNPs on GO whose frameworks possess high substrate affinity, the nanohybrid is able to achieve up to a 30-fold higher maximal reaction velocity (Vmax) compared to that of free GO for the colorimetric reaction of the peroxidase substrate, 3,3',5,5'-tetramethylbenzidine (TMB), and enable rapid detection of target cancer cells. Specifically, using this new assay system, clinically important breast cancer cells are detected in a 5 min time period at room temperature with high specificity and sensitivity. The remarkably high capability to catalyze oxidation reactions could allow the nanohybrid to replace conventional peroxidase-based immunoassay systems as part of new, rapid, robust and convenient assay systems which can be widely utilized for the identification of important target molecules.Enzyme-linked immunosorbent assays (ELISAs) have most widely been applied in immunoassays for several decades. However, several unavoidable limitations (e.g., instability caused by structural unfolding) of natural enzymes have hindered their widespread applications. Here, we describe a new nanohybrid consisting of Fe3O4 magnetic nanoparticles (MNPs) and platinum nanoparticles (Pt NPs), simultaneously immobilized on the surface of graphene oxide (GO). By synergistically integrating highly catalytically active Pt NPs and MNPs on GO whose frameworks possess high substrate affinity, the nanohybrid is able to achieve up to a 30-fold higher maximal reaction velocity (Vmax

  9. A sensitive and selective colorimetric method for detection of copper ions based on anti-aggregation of unmodified gold nanoparticles.

    PubMed

    Hormozi-Nezhad, M Reza; Abbasi-Moayed, Samira

    2014-11-01

    A highly sensitive and selective colorimetric method for detection of copper ions, based on anti-aggregation of D-penicillamine (D-PC) induced aggregated gold nanoparticles (AuNPs) was developed. Copper ions can hinder the aggregation of AuNPs induced by D-PC, through formation of mixed-valence complex with D-PC that is a selective copper chelator. In the presence of a fixed amount of D-PC, the aggregation of AuNPs decreases with increasing concentrations of Cu(2+) along with a color change from blue to red in AuNPs solution and an increase in the absorption ratio (A520/A650). Under the optimum experimental conditions (pH 7, [AuNPs] =3.0 nmol L(-1) and [NaCl]=25 mmol L(-1)), a linear calibration curve for Cu(2+) was obtained within the range of 0.05-1.85 µmol L(-1) with a limit of detection (3Sb) of 30 nmol L(-1). Excellent selectivity toward Cu(2+) was observed among various metal ions due to a specific complex formation between Cu(2+) and D-PC. The proposed method has been successfully applied for the detection of Cu(2+) in various real samples.

  10. A universal probe design for colorimetric detection of single-nucleotide variation with visible readout and high specificity.

    PubMed

    Chen, Xueping; Zhou, Dandan; Shen, Huawei; Chen, Hui; Feng, Wenli; Xie, Guoming

    2016-02-02

    Single-nucleotide variation (SNV) is a crucial biomarker for drug resistance-related detection in cancer and bacterial infection. However, the unintended binding of DNA probes limits the specificity of SNV detection, and the need for redesigned sequences compromise the universality of SNV assay. Herein, we demonstrated a universal and low-cost assay for the colorimetric discrimination of drug-resistance related point mutation. By the use of a universal DNA probe and a split G-quadruplex, the signal could be recognized by naked eye at room temperature. The DNA probe was used as a signal reporter which not only improved the universality, but also enabled high specificity of probe hybridization. This assay was successfully applied in the detection of cancer-related SNV in the epidermal growth factor receptor (EGFR) gene, kirsten rat sarcoma viral oncogene homologue (KRAS), and tuberculosis drug-resistance related point mutation in RNA polymerase beta subunit gene (rpoB) with high specificity and visible readout. This method was simple, rapid, high-throughput and effective, which was suitable for point-of-care applications.

  11. A universal probe design for colorimetric detection of single-nucleotide variation with visible readout and high specificity

    PubMed Central

    Chen, Xueping; Zhou, Dandan; Shen, Huawei; Chen, Hui; Feng, Wenli; Xie, Guoming

    2016-01-01

    Single-nucleotide variation (SNV) is a crucial biomarker for drug resistance-related detection in cancer and bacterial infection. However, the unintended binding of DNA probes limits the specificity of SNV detection, and the need for redesigned sequences compromise the universality of SNV assay. Herein, we demonstrated a universal and low-cost assay for the colorimetric discrimination of drug-resistance related point mutation. By the use of a universal DNA probe and a split G-quadruplex, the signal could be recognized by naked eye at room temperature. The DNA probe was used as a signal reporter which not only improved the universality, but also enabled high specificity of probe hybridization. This assay was successfully applied in the detection of cancer-related SNV in the epidermal growth factor receptor (EGFR) gene, kirsten rat sarcoma viral oncogene homologue (KRAS), and tuberculosis drug-resistance related point mutation in RNA polymerase beta subunit gene (rpoB) with high specificity and visible readout. This method was simple, rapid, high-throughput and effective, which was suitable for point-of-care applications. PMID:26830326

  12. Colorimetric sensor array with unmodified noble metal nanoparticles for naked-eye detection of proteins and bacteria.

    PubMed

    Li, Dongyang; Dong, Yanhua; Li, Bingyu; Wu, Yayan; Wang, Kai; Zhang, Sichun

    2015-11-21

    Herein we report a novel strategy for the detection and identification of proteins using unmodified noble metal nanoparticles. Five gold nanoparticles (AuNPs) and two silver nanoparticles (AgNPs) with different sizes were utilized as sensing elements to create a colorimetric sensor array. In the presence of proteins, the UV-vis absorbance of the noble metal nanoparticles changed due to the interactions between the protein and nanoparticles, producing distinct absorbance response patterns which can be visually detected by the naked eye. The color pattern of the array is a unique "fingerprints" for each protein sample, which can be differentiated by linear discriminant analysis (LDA). Ten different proteins at concentrations of 0.5, 5 and 50 μM have be successfully discriminated. Moreover, the array was also able to discriminate different bacteria at a concentration of 0.05 OD in 200 μL, as well as cancer cells at the level of 5000 cells in 200 μL. This work demonstrates that an unmodified noble metal nanoparticle-based protein detection array has potential for applications in medical diagnostics.

  13. Visual and highly sensitive detection of cancer cells by a colorimetric aptasensor based on cell-triggered cyclic enzymatic signal amplification.

    PubMed

    Zhang, Xianxia; Xiao, Kunyi; Cheng, Liwei; Chen, Hui; Liu, Baohong; Zhang, Song; Kong, Jilie

    2014-06-01

    Rapid and efficient detection of cancer cells at their earliest stages is one of the central challenges in cancer diagnostics. We developed a simple, cost-effective, and highly sensitive colorimetric method for visually detecting rare cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and linker DNAs stably coexist in solution, and the linker DNA assembles DNA-AuNPs, producing a purple solution. In the presence of target cells, the specific binding of HAPs to the target cells triggers a conformational switch that results in linker DNA hybridization and cleavage by nicking endonuclease-strand scission cycles. Consequently, the cleaved fragments of linker DNA can no longer assemble into DNA-AuNPs, resulting in a red color. UV-vis spectrometry and photograph analyses demonstrated that this CTCESA-based method exhibited selective and sensitive colorimetric responses to the presence of target CCRF-CEM cells, which could be detected by the naked eye. The linear response for CCRF-CEM cells in a concentration range from 10(2) to 10(4) cells was obtained with a detection limit of 40 cells, which is approximately 20 times lower than the detection limit of normal AuNP-based methods without amplification. Given the high specificity and sensitivity of CTCESA, this colorimetric method provides a sensitive, label-free, and cost-effective approach for early cancer diagnosis and point-to-care applications.

  14. Rapid and simple colorimetric detection of Escherichia coli O157:H7 in apple juice using a novel recombinant bacteriophage-based Method.

    PubMed

    Hoang, Hoang A; Dien, Le T

    2015-01-01

    In this study, a bacteriophage-based method for the colorimetric detection of E. coli O157:H7 in apple juice was investigated. Firstly, a gene encoding Cytochrome c Peroxidase (CCP) chromogenic enzyme was inserted into a wild type PP01 phage genome to construct the recombinant PP01ccp phage that was used in the production of the chromogenic enzyme through specific infection into E. coli O157:H7. The method was then examined in the colorimetric detection of E. coli O157:H7 in broth, and the appearance of E. coli O157:H7 in broth was confirmed by the color change after a few minutes of the enzyme assay. Secondly, the method was investigated in the colorimetric detection of E. coli O157:H7 in apple juice. A low E. coli O157:H7 concentration as 1 CFU mL(-1) was detected in 15 h that was in a shorter time than in previous bioluminescence phage-based methods. Moreover, the method is much simpler compared to other previous phage-based methods since it enables detection without the need for expensive apparatus.

  15. Colorimetric detection of Bi (III) in water and drug samples using pyridine-2,6-dicarboxylic acid modified silver nanoparticles.

    PubMed

    Mohammadi, Somayeh; Khayatian, Gholamreza

    2015-09-01

    A new selective, simple, fast and sensitive method is developed for sensing assay of Bi (III) using pyridine-2,6-dicarboxylic acid or dipicolinic acid (DPA) modified silver nanoparticles (DPA-AgNPs). Silver nanoparticles (AgNPs) were synthesized by reducing silver nitrate (AgNO3) with sodium borohydride (NaBH4) in the presence of DPA. Bismuth detection is based on color change of nanoparticle solution from yellow to red that is induced in the presence of Bi (III). Aggregation of DPA-AgNPs has been confirmed with UV-vis absorption spectra and transmission electron microscopy (TEM) images. Under the optimized conditions, a good linear relationship (correlation coefficient r=0.995) is obtained between the absorbance ratio (A525/A390) and the concentration of Bi (III) in the 0.40-8.00 μM range. This colorimetric probe allows Bi (III) to be rapidly quantified with a 0.01 μM limit of detection. The present method successfully applied to determine bismuth in real water and drug samples. Recoveries of water samples were in the range of 91.2-99.6%. PMID:25919329

  16. Colorimetric microtiter plate receptor-binding assay for the detection of freshwater and marine neurotoxins targeting the nicotinic acetylcholine receptors

    USGS Publications Warehouse

    Rubio, Fernando; Kamp, Lisa; Carpino, Justin; Faltin, Erin; Loftin, Keith A.; Molgó, Jordi; Aráoz, Rómulo

    2014-01-01

    Anatoxin-a and homoanatoxin-a, produced by cyanobacteria, are agonists of nicotinic acetylcholine receptors (nAChRs). Pinnatoxins, spirolides, and gymnodimines, produced by dinoflagellates, are antagonists of nAChRs. In this study we describe the development and validation of a competitive colorimetric, high throughput functional assay based on the mechanism of action of freshwater and marine toxins against nAChRs. Torpedo electrocyte membranes (rich in muscle-type nAChR) were immobilized and stabilized on the surface of 96-well microtiter plates. Biotinylated α-bungarotoxin (the tracer) and streptavidin-horseradish peroxidase (the detector) enabled the detection and quantitation of anatoxin-a in surface waters and cyclic imine toxins in shellfish extracts that were obtained from different locations across the US. The method compares favorably to LC/MS/MS and provides accurate results for anatoxin-a and cyclic imine toxins monitoring. Study of common constituents at the concentrations normally found in drinking and environmental waters, as well as the tolerance to pH, salt, solvents, organic and inorganic compounds did not significantly affect toxin detection. The assay allowed the simultaneous analysis of up to 25 samples within 3.5 h and it is well suited for on-site or laboratory monitoring of low levels of toxins in drinking, surface, and ground water as well as in shellfish extracts.

  17. Highly efficient colorimetric detection of target cancer cells utilizing superior catalytic activity of graphene oxide-magnetic-platinum nanohybrids.

    PubMed

    Kim, Moon Il; Kim, Min Su; Woo, Min-Ah; Ye, Youngjin; Kang, Kyoung Suk; Lee, Jinwoo; Park, Hyun Gyu

    2014-01-01

    Enzyme-linked immunosorbent assays (ELISAs) have most widely been applied in immunoassays for several decades. However, several unavoidable limitations (e.g., instability caused by structural unfolding) of natural enzymes have hindered their widespread applications. Here, we describe a new nanohybrid consisting of Fe₃O₄ magnetic nanoparticles (MNPs) and platinum nanoparticles (Pt NPs), simultaneously immobilized on the surface of graphene oxide (GO). By synergistically integrating highly catalytically active Pt NPs and MNPs on GO whose frameworks possess high substrate affinity, the nanohybrid is able to achieve up to a 30-fold higher maximal reaction velocity (V(max)) compared to that of free GO for the colorimetric reaction of the peroxidase substrate, 3,3',5,5'-tetramethylbenzidine (TMB), and enable rapid detection of target cancer cells. Specifically, using this new assay system, clinically important breast cancer cells are detected in a 5 min time period at room temperature with high specificity and sensitivity. The remarkably high capability to catalyze oxidation reactions could allow the nanohybrid to replace conventional peroxidase-based immunoassay systems as part of new, rapid, robust and convenient assay systems which can be widely utilized for the identification of important target molecules.

  18. A Cu@Au nanoparticle-based colorimetric competition assay for the detection of sulfide anion and cysteine.

    PubMed

    Zhang, Jia; Xu, Xiaowen; Yuan, Yue; Yang, Cheng; Yang, Xiurong

    2011-08-01

    As an extension of our previous work, which described the unique ability of the core/shell Cu@Au nanoparticle (NP) to selectively recognize iodide, (1) herein, we wish to report the development of an alternatively sensitive and selective colorimetric detection for sulfide anion and cysteine based upon the Cu@Au NP by a competition avenue. In the absence of sulfide anion or cysteine, iodide can induce an appreciable color change of the Cu@Au NP solution from purple to red by transforming the clusters of NP to single, nearly spherical, and larger ones. However, the transformation is severely interfered by the presence of sulfide or cysteine because of a higher binding strength of the S-Au bond than the I-Au one. As a result, the clear purple-to-red color change induced by iodide is affected as a correlation with the concentration of sulfide or cysteine. By taking advantage of this fact, we can detect a concentration of 3 μM for sulfide and 0.4 μM for cysteine with the naked eye or 0.3 μM (10 ppb) for sulfide and 50 nM (6 ppb) for cysteine aided by a UV/vis spectrometer. Given the detrimental effect of hydrogen sulfide and the biological importance of cysteine, the assay may become useful in the environment monitoring, water quality inspection and biomedical diagnosis as well.

  19. Microsystem-assisted synthesis of carbon dots with fluorescent and colorimetric properties for pH detection

    NASA Astrophysics Data System (ADS)

    Pedro, S. Gómez-De; Salinas-Castillo, A.; Ariza-Avidad, M.; Lapresta-Fernández, A.; Sánchez-González, C.; Martínez-Cisneros, C. S.; Puyol, M.; Capitan-Vallvey, L. F.; Alonso-Chamarro, J.

    2014-05-01

    The present paper describes the use of a microfluidic system to synthesize carbon dots (Cdots) and their use as optical pH sensors. The synthesis is based on the thermal decomposition of ascorbic acid in dimethyl sulfoxide. The proposed microsystem is composed of a fluidic and a thermal platform, which enable proper control of synthesis variables. Uniform and monodispersed 3.3 nm-sized Cdots have been synthesized, the optical characterization of which showed their down/upconversion luminescence and colorimetric properties. The obtained Cdots have been used for pH detection with down and upconverison fluorescent properties as excitation sources. The naked eye or a photographic digital camera has also been implemented as detection systems with the hue parameter showing a linear pH range from 3.5 to 10.2. On the other hand, experiments on the cytotoxicity and permeability of the Cdots on human embryonic kidney cells revealed their adsorption on cells without causing any impact on the cellular morphology.

  20. New turn-on fluorescent and colorimetric probe for cyanide detection based on BODIPY-salicylaldehyde and its application in cell imaging.

    PubMed

    Sukato, Rangsarit; Sangpetch, Nuanphan; Palaga, Tanapat; Jantra, Suthikorn; Vchirawongkwin, Viwat; Jongwohan, Chanantida; Sukwattanasinitt, Mongkol; Wacharasindhu, Sumrit

    2016-08-15

    Development of cyanide sensor is important as the anion is harmful to human health and the environment. Herein, a new colorimetric and fluorescent probe GSB based on boron dipyrrole-methene (BODIPY) containing salicylaldehyde group for cyanide detection has been reported. GSB undergoes exclusive colorimetric change from orange to colorless and exhibits selective fluorescence turn-on at 504nm upon the addition of cyanide. Other 13 anions give almost no interference under physiological condition. Detection limit of the new cyanide-sensing GSB is 0.88μM, which is below World Health Organization (WHO) recommended level in drinking water. A calculation by density functional theory (DFT) shows suppression of photoinduced electron transfer (PET) mechanism along with the interruption of π-conjugation between salicylaldehyde and BODIPY core by cyanide anion. Cell imaging studies demonstrated that GSB is compatible and capable of sensing cyanide anion in living cells. PMID:27136733

  1. Highly sensitive colorimetric detection of glucose in a serum based on DNA-embeded Au@Ag core-shell nanoparticles

    NASA Astrophysics Data System (ADS)

    Kang, Fei; Hou, Xiangshu; Xu, Kun

    2015-10-01

    Glucose is a key energy substance in diverse biology and closely related to the life activities of the organism. To develop a simple and sensitive method for glucose detection is extremely urgent but still remains a key challenge. Herein, we report a colorimetric glucose sensor in a homogeneous system based on DNA-embedded core-shell Au@Ag nanoparticles. In this assay, a glucose substrate was first catalytically oxidized by glucose oxidase to produce H2O2 which would further oxidize and gradually etch the outer silver shell of Au@Ag nanoparticles. Afterwards, the solution color changed from yellow to red and the surface plasmon resonance (SPR) band of Au@Ag nanoparticles declined and red-shifted from 430 to 516 nm. Compared with previous silver-based glucose colorimetric detection strategies, the distinctive SPR band change is superior to the color variation, which is critical to the high sensitivity of this assay. Benefiting from the outstanding optical property, robust stability and well-dispersion of the core-shell Au@AgNPs hybrid, this colorimetric assay obtained a detection limit of glucose as low as 10 nM, which is at least a 10-fold improvement over other AgNPs-based procedures. Moreover, this optical biosensor was successfully employed to the determination of glucose in fetal bovine serum.

  2. Microfluidic toner-based analytical devices: disposable, lightweight, and portable platforms for point-of-care diagnostics with colorimetric detection.

    PubMed

    Oliveira, Karoliny Almeida; de Souza, Fabrício Ribeiro; de Oliveira, Cristina Rodrigues; da Silveira, Lucimeire Antonelli; Coltro, Wendell Karlos Tomazelli

    2015-01-01

    This chapter describes the development of microfluidic toner-based analytical devices (μTADs) to perform clinical diagnostics using a scanner or cell-phone camera. μTADs have been produced in a platform composed of polyester and toner by the direct-printing technology (DPT) in a matter of minutes. This technology offers simplicity and versatility, and it does not require any sophisticated instrumentation. Toner-based devices integrate the current generation of disposable analytical devices along paper-based chips. The cost of one μTAD has been estimated to be lower than $0.10. In addition, these platforms are lightweight and portable thus enabling their use for point-of-care applications. In the last 5 years, great efforts have been dedicated to spread out the use of μTADs in bioassays. The current chapter reports the fabrication of printed microplates and integrated microfluidic toner-based devices for dengue diagnostics and rapid colorimetric assays with clinically relevant analytes including cholesterol, triglycerides, total proteins, and glucose. The use of μTADs associated with cell-phone camera may contribute to the health care, in special, to people housed in developing regions or with limited access to clinics and hospitals.

  3. Microfluidic toner-based analytical devices: disposable, lightweight, and portable platforms for point-of-care diagnostics with colorimetric detection.

    PubMed

    Oliveira, Karoliny Almeida; de Souza, Fabrício Ribeiro; de Oliveira, Cristina Rodrigues; da Silveira, Lucimeire Antonelli; Coltro, Wendell Karlos Tomazelli

    2015-01-01

    This chapter describes the development of microfluidic toner-based analytical devices (μTADs) to perform clinical diagnostics using a scanner or cell-phone camera. μTADs have been produced in a platform composed of polyester and toner by the direct-printing technology (DPT) in a matter of minutes. This technology offers simplicity and versatility, and it does not require any sophisticated instrumentation. Toner-based devices integrate the current generation of disposable analytical devices along paper-based chips. The cost of one μTAD has been estimated to be lower than $0.10. In addition, these platforms are lightweight and portable thus enabling their use for point-of-care applications. In the last 5 years, great efforts have been dedicated to spread out the use of μTADs in bioassays. The current chapter reports the fabrication of printed microplates and integrated microfluidic toner-based devices for dengue diagnostics and rapid colorimetric assays with clinically relevant analytes including cholesterol, triglycerides, total proteins, and glucose. The use of μTADs associated with cell-phone camera may contribute to the health care, in special, to people housed in developing regions or with limited access to clinics and hospitals. PMID:25626533

  4. Immunosorbent analysis of ricin contamination in milk using colorimetric, chemiluminescence, and electrochemiluminescence detection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analytical methodology to detect ricin in food matrices is important because of the potential use of foodborne ricin as a terrorist weapon. Monoclonal antibodies (mAbs) that bind ricin were used for both capture and detection in sandwich enzyme-linked immunosorbent assay (ELISA) and electrochemilumi...

  5. A SIMPLE COLORIMETRIC METHOD TO DETECT BIOLOGICAL EVIDENCE OF HUMAN EXPOSURE TO MICROCYSTINS

    EPA Science Inventory

    Toxic cyanobacteria are contaminants of surface waters worldwide. Microcystins are some of the most commonly detected toxins. Biological evidence of human exposure may be difficult to obtain due to limitations associated with cost, laboratory capacity, analytic support, and exp...

  6. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA

    NASA Astrophysics Data System (ADS)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum

    2016-05-01

    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system.

  7. Multiplexed colorimetric detection of Kaposi's sarcoma associated herpesvirus and Bartonella DNA using gold and silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Mancuso, Matthew; Jiang, Li; Cesarman, Ethel; Erickson, David

    2013-01-01

    Kaposi's sarcoma (KS) is an infectious cancer occurring most commonly in human immunodeficiency virus (HIV) positive patients and in endemic regions, such as Sub-Saharan Africa, where KS is among the top four most prevalent cancers. The cause of KS is the Kaposi's sarcoma-associated herpesvirus (KSHV, also called HHV-8), an oncogenic herpesvirus that while routinely diagnosed in developed nations, provides challenges to developing world medical providers and point-of-care detection. A major challenge in the diagnosis of KS is the existence of a number of other diseases with similar clinical presentation and histopathological features, requiring the detection of KSHV in a biopsy sample. In this work we develop an answer to this challenge by creating a multiplexed one-pot detection system for KSHV DNA and DNA from a frequently confounding disease, bacillary angiomatosis. Gold and silver nanoparticle aggregation reactions are tuned for each target and a multi-color change system is developed capable of detecting both targets down to levels between 1 nM and 2 nM. The system developed here could later be integrated with microfluidic sample processing to create a final device capable of solving the two major challenges in point-of-care KS detection.

  8. A Simple Colorimetric Chemosensor for Naked Eye Detection of Cyanide Ion.

    PubMed

    Gholamzadeh, Parisa; Mohammadi Ziarani, Ghodsi; Lashgari, Negar; Badiei, Alireza; Shayesteh, Alireza; Jafari, Maryam

    2016-09-01

    A simple cyanide chemosensor tetranitrile compound 1 was designed and synthesized via an efficient method in the presence of nanoporous SBA-Pr-NH2 as the catalyst. The chemosensor exhibited high selectivity and sensitivity for detecting CN¯ among different anions through a visual color change from light yellow to purple. The results confirmed that the chemosensor 1 causes the color of the solution to change depending on the concentration of CN¯. Linear changes of the optical properties of the sensor as a function of the concentrations of CN¯ was proved. The detection limit of 3.07 × 10(-7) M was calculated for CN¯. A simple paper test strip system for the rapid detection of CN¯ was developed. The TD-DFT calculations were carried out to understand the sensing mechanism. PMID:27448224

  9. A Simple Colorimetric Chemosensor for Naked Eye Detection of Cyanide Ion.

    PubMed

    Gholamzadeh, Parisa; Mohammadi Ziarani, Ghodsi; Lashgari, Negar; Badiei, Alireza; Shayesteh, Alireza; Jafari, Maryam

    2016-09-01

    A simple cyanide chemosensor tetranitrile compound 1 was designed and synthesized via an efficient method in the presence of nanoporous SBA-Pr-NH2 as the catalyst. The chemosensor exhibited high selectivity and sensitivity for detecting CN¯ among different anions through a visual color change from light yellow to purple. The results confirmed that the chemosensor 1 causes the color of the solution to change depending on the concentration of CN¯. Linear changes of the optical properties of the sensor as a function of the concentrations of CN¯ was proved. The detection limit of 3.07 × 10(-7) M was calculated for CN¯. A simple paper test strip system for the rapid detection of CN¯ was developed. The TD-DFT calculations were carried out to understand the sensing mechanism.

  10. DETECTION OF ESCHERICHIA COLI IN WATER USING A COLORIMETRIC GENE PROBE ASSAY

    EPA Science Inventory

    A commercially available DNA hydribization assay (Gene-trak , Framingham, MA. USA) was compared with the EC-MUG procedure for the detection of Escherichia coli in water. The gene probe gave positive responses for pure cultures of E. coli 0157:H7, E. fergusonii, Shigella sonnei, S...

  11. BODIPY based colorimetric fluorescent probe for selective thiophenol detection: theoretical and experimental studies.

    PubMed

    Kand, Dnyaneshwar; Mishra, Pratyush Kumar; Saha, Tanmoy; Lahiri, Mayurika; Talukdar, Pinaki

    2012-09-01

    A BODIPY-based selective thiophenol probe capable of discriminating aliphatic thiols is reported. The fluorescence off-on effect upon reaction with thiol is elucidated with theoretical calculations. The sensing of thiophenol is associated with a color change from red to yellow and 63-fold enhancement in green fluorescence. Application of the probe for selective thiophenol detection is demonstrated by live cell imaging.

  12. BODIPY based colorimetric fluorescent probe for selective thiophenol detection: theoretical and experimental studies.

    PubMed

    Kand, Dnyaneshwar; Mishra, Pratyush Kumar; Saha, Tanmoy; Lahiri, Mayurika; Talukdar, Pinaki

    2012-09-01

    A BODIPY-based selective thiophenol probe capable of discriminating aliphatic thiols is reported. The fluorescence off-on effect upon reaction with thiol is elucidated with theoretical calculations. The sensing of thiophenol is associated with a color change from red to yellow and 63-fold enhancement in green fluorescence. Application of the probe for selective thiophenol detection is demonstrated by live cell imaging. PMID:22751002

  13. Colorimetric detection of hydrogen peroxide and glucose using the magnetic mesoporous silica nanoparticles.

    PubMed

    Wang, Yonghong; Zhou, Bo; Wu, Shun; Wang, Kemin; He, Xiaoxiao

    2015-03-01

    In this work, we synthesized a type of magnetic mesoporous silica nanoparticle (denoted as Fe3O4@MSN) with Fe3O4 as the core and mesoporous silica the shell. The superparamagnetic Fe3O4-core provides high peroxidase-mimic activity and makes the artificial enzymatic system easily recyclable. Furthermore, Fe3O4 nanoparticles are encapsulated in MSN shells to hinder the aggregation and keep them stable even under harsh conditions. Meanwhile, small active molecules are allowed to diffuse in and out of the MSN shells. Based on these functional units, the Fe3O4@MSN as robust nanoreactors can catalyze a self-organized cascade reaction, which includes oxidation of glucose by oxygen to yield gluconic acid and H2O2, and the latter further oxidizes 3,3,5,5-tetramethylbenzidine (TMB) to produce a color change. The Fe3O4@MSN, whose catalytic efficiency was not strongly dependent on pH and temperature, was successfully used for the detection of glucose and showed excellent sensitivity with a detection limit of 0.4×10(-5) mol/L. Nevertheless, the assay is also highly selective toward the glucose detection. PMID:25618726

  14. Gold nanoflowers based colorimetric detection of Hg2+ and Pb2+ ions

    NASA Astrophysics Data System (ADS)

    Nalawade, Pradnya; Kapoor, Sudhir

    2013-12-01

    An optical detection method based on the interaction of gold nanoflowers with Hg2+ and Pb2+ has been described. After interaction, gold nanoflowers change the color from violet to wine red. The nanoflowers are capable of determining Hg2+ and Pb2+ over a dynamic range of 1.0 × 10-6 and 1.0 × 10-5 M, respectively. The response time of nanoflowers depends on the concentration of ions. The presence of both Hg2+ and Pb2+ ions in the mixture having Au nanoflowers induced color changes of the solution within several seconds even at 1.0 × 10-6 M. Common metal ions were chosen to investigate their interference in Hg2+ and Pb2+ detection, and the concentration of each metal ion studied was 1.0 × 10-5 M. Other metallic ions could not induce color change even at 1.0 × 10-5 M. The feasibility of our method to detect Hg2+ and Pb2+ ions at high concentration in real water samples was verified. Water samples were from our own laboratory and no pretreatment was made. As the particles are stable they can be used for more than 3 months without observing any major deviation.

  15. Polydiacetylene liposomes functionalized with sialic acid bind and colorimetrically detect influenza virus

    SciTech Connect

    Reichert, A.; Nagy, J.O.; Spevak, W.; Charych, D. )

    1995-01-18

    In this paper we have demonstrated that polymerized liposomes are biomolecular materials that provide a molecular recognition function (sialic acid) and a detection element (polydiacetylene backbone), all within a single supramolecular assembly. The binding event is transduced to a visible color change, readily seen with the naked eye and quantified by absorption spectroscopy. Specificity of the color change was demonstrated by competitive inhibition studies. In addition, nonspecific adsorption, if it occurs. does not appear to affect the color of the liposome solutions. 28 refs., 2 figs.

  16. Biofunctionalized silver nanoparticles as a novel colorimetric probe for melamine detection in raw milk.

    PubMed

    Borase, Hemant P; Patil, Chandrashekhar D; Salunkhe, Rahul B; Suryawanshi, Rahul K; Salunke, Bipinchandra K; Patil, Satish V

    2015-01-01

    Nanoparticles have emerged as a promising analytical tool for monitoring food adulteration and safety. In the present study, silver nanoparticles (AgNPs) were synthesized using leaves' extract of Jatropha gossypifolia. AgNPs revealed a characteristic surface plasmon resonance (SPR) peak at 419 nm and have spherical and grain shape with size range between 18 and 30 nm. A selective and rapid method of melamine detection in raw milk was developed with the use of these biofunctionalized AgNPs. The color change, deviation in SPR spectra, and change in the absorption ratio (A500 /A419 ) of AgNPs occurred after an AgNPs-melamine interaction. The detection limit for melamine up to 2 μM (252 ppb) was attained with this method, which is quite lower than safety level recommendations of regulatory bodies demonstrating sensitivity of the method. Dynamicx light scattering and transmission electron microscopy analyses exhibited an increase in hydrodynamic diameter and size of AgNPs after melamine interaction. Melamine sensing by AgNPs was investigated by different physicochemical and thermal analyses.

  17. Cell damage detection using Escherichia coli reporter plasmids: fluorescent and colorimetric assays.

    PubMed

    Padilla-Martínez, Felipe; Carrizosa-Villegas, Luz Adriana; Rangel-Serrano, Ángeles; Paramo-Pérez, Itzel; Mondragón-Jaimes, Verónica; Anaya-Velázquez, Fernando; Padilla-Vaca, Felipe; Franco, Bernardo

    2015-08-01

    Bacterial reporter assays are powerful tools used to study the effect of different compounds that affect the physiology of cellular processes. Most bacterial reporters are luciferase based and can be monitored in real time. In the present study we designed and implemented two sets of Escherichia coli bacterial reporter assays, using a multicopy plasmid system. Each reporter strain was constructed using either green fluorescent protein or β-galactosidase (LacZ) proteins. The designed reporter strains are capable of responding in a specific manner to molecules that either oxidative stress, or membrane, protein, or DNA damage. In order to respond to the desired stimulus, promoter sequences from E. coli were used. These sequences correspond to the promoter of the major catalase (KatG) activated with cellular oxidative damage, the promoter of the β-hydroxydecanoyl-ACP dehydrase (FabA) which is activated with membrane perturbation, the promoter of DNA recombinase (RecA) which is activated by DNA lesions. For protein misfolding, the promoter of the heat-shock responsive chaperon (DnaK) was used. Our constructs displayed activation to damage from specific stimuli, and low response to nonspecific stimuli was detected. Our results suggest that these types of bacterial reporter strains can be used in semiquantitative (fluorometric) and qualitative (β-galactosidase activity) studies of different xenobiotic substances and pollutants.

  18. A colorimetric sensor for the sequential detection of Cu(2+) and CN(-) in fully aqueous media: practical performance of Cu(2+).

    PubMed

    You, Ga Rim; Park, Gyeong Jin; Lee, Jae Jun; Kim, Cheal

    2015-05-21

    A new highly selective colorimetric chemosensor 1 (E)-9-(((5-mercapto-1,3,4-thiadiazol-2-yl)imino)methyl)-2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-8-ol was designed and synthesized for the sequential detection of Cu(2+) and CN(-). This sensor 1 exhibited an obvious color change from yellow to orange in the presence of Cu(2+) in a fully aqueous solution. The detection limit (0.9 μM) of 1 for Cu(2+) is far lower than the WHO limit (31.5 μM) for drinking water. In addition, the resulting Cu(2+)-2· 1 complex can be further used to detect toxic cyanide through a color change from orange to yellow, indicating the recovery of 1 from Cu(2+)-2·1. Importantly, chemosensor 1 could be used to detect and quantify Cu(2+) in water samples, and a colorimetric test strip of 1 for the detection of Cu(2+) could be useful for all practical purposes. PMID:25900000

  19. Colorimetric detection of platelet-derived growth factors through competitive interactions between proteins and functional gold nanoparticles.

    PubMed

    Lin, Tzu-En; Chen, Wei-His; Shiang, Yen-Chun; Huang, Chih-Ching; Chang, Huan-Tsung

    2011-11-15

    We have developed a colorimetric assay-using aptamer modified 13-nm gold nanoparticles (Apt-Au NPs) and fibrinogen adsorbed Au NPs (Fib-Au NPs, 56nm)-for the highly selective and sensitive detection of platelet-derived growth factors (PDGF). Apt-Au NPs and Fib-Au NPs act as recognition and reporting units, respectively. PDGF-binding-aptamer (Apt(PDGF)) and 29-base-long thrombin-binding-aptamer (Apt(thr29)) are conjugated with Au NPs to prepare functional Apt-Au NPs (Apt(PDGF)/Apt(thr29)-Au NPs) for specific interaction with PDGF and thrombin, respectively. Thrombin interacts with Fib-Au NPs in solutions to catalyze the formation of insoluble fibrillar fibrin-Au NPs agglutinates through the polymerization of the unconjugated and conjugated fibrinogen. The activity of thrombin is suppressed once it interacts with the Apt(PDGF)/Apt(thr29)-Au NPs. The suppression decreases due to steric effects through the specific interaction of PDGF with Apt(PDGF), occurring on the surfaces of Apt(PDGF)/Apt(thr29)-Au NPs. Under optimal conditions [Apt(PDGF)/Apt(thr29)-Au NPs (25pM), thrombin (400pM) and Fib-Au NPs (30pM)], the Apt(PDGF)/Apt(thr29)-Au NPs/Fib-Au NPs probe responds linearly to PDGF over the concentration range of 0.5-20nM with a correlation coefficient of 0.96. The limit of detection (LOD, signal-to-noise ratio=3) for each of the three PDGF isoforms is 0.3nM in the presence of bovine serum albumin at 100μM. When using the Apt(PDGF)/Apt(thr29)-Au NPs as selectors for the enrichment of PDGF and for the removal of interferences from cell media, the LOD for PDGF provided by this probe is 35pM. The present probe reveals that the concentration of PDGF in the three cell media is 230 (±20)pM, showing its advantages of simplicity, sensitivity, and specificity.

  20. Plasma dark matter direct detection

    SciTech Connect

    Clarke, J.D.; Foot, R. E-mail: rfoot@unimelb.edu.au

    2016-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken U(1)' gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed U(1)' neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless 'dark photon' (the U(1)' gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA annual modulation signal is due primarily to electron recoils (or even a combination of electron recoils and nuclear recoils). The importance of diurnal modulation (in addition to annual modulation) as a means of probing this kind of dark matter is also emphasised.

  1. A colorimetric sensor array for the detection of the date-rape drug γ-hydroxybutyric acid (GHB): a supramolecular approach.

    PubMed

    Baumes, Laurent A; Buaki Sogo, Mireia; Montes-Navajas, Pedro; Corma, Avelino; Garcia, Hermenegildo

    2010-04-19

    γ-Hydroxybutyric acid (GHB), a colourless, odourless and tasteless chemical, has become one of the most dangerous illicit drugs of abuse today. At low doses, this drug is a central nervous system depressant that reduces anxiety and produces euphoria and relaxation, sedating the recipient. There is an urgent need for simple, easy-to-use sensors for GHB in solution. Here, we present a colorimetric sensor array based on supramolecular host-guest complexes of fluorescent dyes with organic capsules (cucurbiturils) for the detection of GHB. PMID:20309968

  2. Structural, morphological and optical studies of l-cysteine modified silver nanoparticles and its application as a probe for the selective colorimetric detection of Hg(2+).

    PubMed

    Nidya, M; Umadevi, M; Rajkumar, Beulah J M

    2014-12-10

    We report an extensive study on the evolution of a highly facile, selective colorimetric probe for Hg(2+) detection using cysteine modified silver nanoparticles. The nanoparticles are stable in a basic medium and the Surface Enhanced Raman Spectrum (SERS) reveal that the cysteine is bound to the Ag surface through the thiolate moiety with the charged carboxylate group pointing outwards in a morphology that lends itself to sensor applications. In the presence of Hg(2+), the absorption peak is quenched resulting in a drastic colour change. The sensor displays high selectivity to Hg(2+) over other metallic ions. PMID:24950383

  3. [Fe(CN)6]4- decorated mesoporous gelatin thin films for colorimetric detection and as sorbents of heavy metal ions.

    PubMed

    Shi, Li; Huang, Hubiao; Sun, Luwei; Lu, Yanping; Du, Binyang; Mao, Yiyin; Li, Junwei; Ye, Zhizhen; Peng, Xinsheng

    2013-09-28

    [Fe(CN)6](4-) decorated mesoporous gelatin films, acting as colorimetric sensors and sorbents for heavy metal ions, were prepared by incorporating [Fe(CN)6](4-) ions into the mesoporous gelatin films through electrostatic interaction. Gelatin-Prussian blue (PB) and gelatin-PB analogue composite films were successfully synthesized by immersing the [Fe(CN)6](4-) decorated gelatin films into aqueous solutions of metal ions, such as Fe(3+), Cu(2+), Co(2+), Pb(2+) and Cd(2+) (all as nitrates). The in situ formation process of PB or its analogues in the films was investigated using quartz crystal microbalance (QCM) measurements. According to the different colors of the PB nanoparticles and its analogues, the [Fe(CN)6](4-) decorated mesoporous gelatin films demonstrated colorimetric sensor abilities for detecting the corresponding metal ions by the naked eye with sufficient sensitivity at 1 ppm level and a quite short response time of 5 minutes. Moreover, due to the [Fe(CN)6](4-) functionality and other functional groups of gelatin itself, this [Fe(CN)6](4-) decorated mesoporous gelatin film shows a tens times higher adsorption ability for heavy metal ions in water than that of activated carbon. Due to both the efficient detection and high adsorption ability for heavy metal ions, this film has wide potential applications for the detection and purification of heavy metal ions from polluted water.

  4. Modification-free and N-acetyl-L-cysteine-induced colorimetric response of AuNPs: A mechanistic study and sensitive Hg(2+) detection.

    PubMed

    Tang, Jie; Wu, Peng; Hou, Xiandeng; Xu, Kailai

    2016-10-01

    A facile yet sensitive and selective method was proposed for Hg(2+) detection based on N-acetyl-L-cysteine(NAC)-induced colorimetric response of AuNPs. The proposed method can be easily performed by introducing the premixing of NAC and Hg(2+) into as-prepared citrate-capped AuNPs solution. A combination of experimental and theoretical studies was applied to illustrate the mechanism of this AuNPs colorimetric system. The strong interaction of NAC and AuNPs through Au-S bond could lead to the aggregation of AuNPs, but the formation of NAC-Hg-NAC complex decreased the affinity between NAC and AuNPs and resulted in an anti-aggregation effect. Therefore, the color of the AuNPs solution would progress from purple to red with the increase of Hg(2+) concentration. The proposed method had a high sensitivity with a limit of detection of 9.9nM. Coexistent metal ions, including Cd(2+), Mn(2+), Al(3+), Ag(+), K(+), Mg(2+), Ca(2+), Cr(3+), Cu(2+), Fe(3+), Pb(2+), Ni(2+) and Zn(2+), did not interfere with the detection of Hg(2+). This method can be used to monitor Hg(2+) in tap water. PMID:27474283

  5. [Fe(CN)6]4- decorated mesoporous gelatin thin films for colorimetric detection and as sorbents of heavy metal ions.

    PubMed

    Shi, Li; Huang, Hubiao; Sun, Luwei; Lu, Yanping; Du, Binyang; Mao, Yiyin; Li, Junwei; Ye, Zhizhen; Peng, Xinsheng

    2013-09-28

    [Fe(CN)6](4-) decorated mesoporous gelatin films, acting as colorimetric sensors and sorbents for heavy metal ions, were prepared by incorporating [Fe(CN)6](4-) ions into the mesoporous gelatin films through electrostatic interaction. Gelatin-Prussian blue (PB) and gelatin-PB analogue composite films were successfully synthesized by immersing the [Fe(CN)6](4-) decorated gelatin films into aqueous solutions of metal ions, such as Fe(3+), Cu(2+), Co(2+), Pb(2+) and Cd(2+) (all as nitrates). The in situ formation process of PB or its analogues in the films was investigated using quartz crystal microbalance (QCM) measurements. According to the different colors of the PB nanoparticles and its analogues, the [Fe(CN)6](4-) decorated mesoporous gelatin films demonstrated colorimetric sensor abilities for detecting the corresponding metal ions by the naked eye with sufficient sensitivity at 1 ppm level and a quite short response time of 5 minutes. Moreover, due to the [Fe(CN)6](4-) functionality and other functional groups of gelatin itself, this [Fe(CN)6](4-) decorated mesoporous gelatin film shows a tens times higher adsorption ability for heavy metal ions in water than that of activated carbon. Due to both the efficient detection and high adsorption ability for heavy metal ions, this film has wide potential applications for the detection and purification of heavy metal ions from polluted water. PMID:23887280

  6. MicroRNA-triggered, cascaded and catalytic self-assembly of functional ``DNAzyme ferris wheel'' nanostructures for highly sensitive colorimetric detection of cancer cells

    NASA Astrophysics Data System (ADS)

    Zhou, Wenjiao; Liang, Wenbin; Li, Xin; Chai, Yaqin; Yuan, Ruo; Xiang, Yun

    2015-05-01

    The construction of DNA nanostructures with various sizes and shapes has significantly advanced during the past three decades, yet the application of these DNA nanostructures for solving real problems is still in the early stage. On the basis of microRNA-triggered, catalytic self-assembly formation of the functional ``DNAzyme ferris wheel'' nanostructures, we show here a new signal amplification platform for highly sensitive, label-free and non-enzyme colorimetric detection of a small number of human prostate cancer cells. The microRNA (miR-141), which is catalytically recycled and reused, triggers isothermal self-assembly of a pre-designed, G-quadruplex sequence containing hairpin DNAs into ``DNAzyme ferris wheel''-like nanostructures (in association with hemin) with horseradish peroxidase mimicking activity. These DNAzyme nanostructures catalyze an intensified color transition of the probe solution for highly sensitive detection of miR-141 down to 0.5 pM with the naked eye, and the monitoring of as low as 283 human prostate cancer cells can also, theoretically, be achieved in a colorimetric approach. The work demonstrated here thus offers new opportunities for the construction of functional DNA nanostructures and for the application of these DNA nanostructures as an effective signal amplification means in the sensitive detection of nucleic acid biomarkers.

  7. A highly selective colorimetric and "turn-on" fluorimetric chemosensor for detecting CN- based on unsymmetrical azine derivatives in aqueous media

    NASA Astrophysics Data System (ADS)

    Sun, You; Hu, Jing-Han; Qi, Jing; Li, Jian-Bin

    2016-10-01

    A novel highly selective chemosensor S1 for cyanide based on unsymmetrical azine derivative was successfully designed and synthesized, which showed both colorimetric and fluorescence turn-on responses for cyanide ions in aqueous. This structurally simple chemosensor could detect CN- anion over other anions in aqueous solution DMSO/H2O (v/v = 3:2) undergo deprotonation reaction. Results showed that the chemosensor S1 exhibited 50 fold enhancement in fluorescence at 530 nm and showed an obvious change in color from colorless to yellow that could be detected by naked eye under the UV-lamp after the addition of CN- in aqueous solution. Moreover, the detection limit on fluorescence response of the sensor to CN- is down to 6.17 × 10- 8 M by titration method. Test strips based on S1 were obtain, which could be used as a convenient and efficient CN- test kit to detect CN- in aqueous solution.

  8. A highly selective colorimetric and "turn-on" fluorimetric chemosensor for detecting CN(-) based on unsymmetrical azine derivatives in aqueous media.

    PubMed

    Sun, You; Hu, Jing-Han; Qi, Jing; Li, Jian-Bin

    2016-10-01

    A novel highly selective chemosensor S1 for cyanide based on unsymmetrical azine derivative was successfully designed and synthesized, which showed both colorimetric and fluorescence turn-on responses for cyanide ions in aqueous. This structurally simple chemosensor could detect CN(-) anion over other anions in aqueous solution DMSO/H2O (v/v=3:2) undergo deprotonation reaction. Results showed that the chemosensor S1 exhibited 50 fold enhancement in fluorescence at 530nm and showed an obvious change in color from colorless to yellow that could be detected by naked eye under the UV-lamp after the addition of CN(-) in aqueous solution. Moreover, the detection limit on fluorescence response of the sensor to CN(-) is down to 6.17×10(-8)M by titration method. Test strips based on S1 were obtain, which could be used as a convenient and efficient CN(-) test kit to detect CN(-) in aqueous solution. PMID:27261890

  9. Surface-plasmon-based colorimetric detection of Cu(II) ions using label-free gold nanoparticles in aqueous thiosulfate systems

    NASA Astrophysics Data System (ADS)

    Tripathy, Suraj Kumar; Woo, Ju Yeon; Han, Chang-Soo

    2012-08-01

    We report colorimetric, label-free and non-aggregation-based gold nanoparticle (AuNP) probes for the highly selective detection of Cu(II) ions in aqueous environments. This detection scheme relies on the ability of Cu(II) ions to catalyze the leaching of gold at room temperature in the presence of thiosulfate species and ammonia. This simple and cost-effective probe provides rapid detection of Cu(II) ions at concentrations as low as 10 ppm. A similar detection method using AuNPs in ammonia-free thiosulfate solution is also viable at moderate reaction temperature (50 °C). The ammonia-free method also leads to marked damping and red-shifting of the surface plasmon resonance signal of the AuNP dispersion. The two methods clearly differ in the nature of the surface plasmon damping phenomenon, and their working mechanisms are plausibly explained based on the experimental investigations.

  10. A rapid molecular diagnosis of cutaneous leishmaniasis by colorimetric malachite green-loop-mediated isothermal amplification (LAMP) combined with an FTA card as a direct sampling tool.

    PubMed

    Nzelu, Chukwunonso O; Cáceres, Abraham G; Guerrero-Quincho, Silvia; Tineo-Villafuerte, Edwin; Rodriquez-Delfin, Luis; Mimori, Tatsuyuki; Uezato, Hiroshi; Katakura, Ken; Gomez, Eduardo A; Guevara, Angel G; Hashiguchi, Yoshihisa; Kato, Hirotomo

    2016-01-01

    Leishmaniasis remains one of the world's most neglected diseases, and early detection of the infectious agent, especially in developing countries, will require a simple and rapid test. In this study, we established a quick, one-step, single-tube, highly sensitive loop-mediated isothermal amplification (LAMP) assay for rapid detection of Leishmania DNA from tissue materials spotted on an FTA card. An FTA-LAMP with pre-added malachite green was performed at 64°C for 60min using a heating block and/or water bath and DNA amplification was detected immediately after incubation. The LAMP assay had high detection sensitivity down to a level of 0.01 parasites per μl. The field- and clinic-applicability of the colorimetric FTA-LAMP assay was demonstrated with 122 clinical samples collected from patients suspected of having cutaneous leishmaniasis in Peru, from which 71 positives were detected. The LAMP assay in combination with an FTA card described here is rapid and sensitive, as well as simple to perform, and has great potential usefulness for diagnosis and surveillance of leishmaniasis in endemic areas. PMID:26516109

  11. A rapid molecular diagnosis of cutaneous leishmaniasis by colorimetric malachite green-loop-mediated isothermal amplification (LAMP) combined with an FTA card as a direct sampling tool.

    PubMed

    Nzelu, Chukwunonso O; Cáceres, Abraham G; Guerrero-Quincho, Silvia; Tineo-Villafuerte, Edwin; Rodriquez-Delfin, Luis; Mimori, Tatsuyuki; Uezato, Hiroshi; Katakura, Ken; Gomez, Eduardo A; Guevara, Angel G; Hashiguchi, Yoshihisa; Kato, Hirotomo

    2016-01-01

    Leishmaniasis remains one of the world's most neglected diseases, and early detection of the infectious agent, especially in developing countries, will require a simple and rapid test. In this study, we established a quick, one-step, single-tube, highly sensitive loop-mediated isothermal amplification (LAMP) assay for rapid detection of Leishmania DNA from tissue materials spotted on an FTA card. An FTA-LAMP with pre-added malachite green was performed at 64°C for 60min using a heating block and/or water bath and DNA amplification was detected immediately after incubation. The LAMP assay had high detection sensitivity down to a level of 0.01 parasites per μl. The field- and clinic-applicability of the colorimetric FTA-LAMP assay was demonstrated with 122 clinical samples collected from patients suspected of having cutaneous leishmaniasis in Peru, from which 71 positives were detected. The LAMP assay in combination with an FTA card described here is rapid and sensitive, as well as simple to perform, and has great potential usefulness for diagnosis and surveillance of leishmaniasis in endemic areas.

  12. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    PubMed Central

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge

    2015-01-01

    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage. PMID:26559602

  13. Microfluidic Integration of a Cloth-Based Hybridization Array System (CHAS) for Rapid, Colorimetric Detection of Enterohemorrhagic Escherichia coli (EHEC) Using an Articulated, Centrifugal Platform.

    PubMed

    Geissler, Matthias; Clime, Liviu; Hoa, Xuyen D; Morton, Keith J; Hébert, Harold; Poncelet, Lucas; Mounier, Maxence; Deschênes, Mylène; Gauthier, Martine E; Huszczynski, George; Corneau, Nathalie; Blais, Burton W; Veres, Teodor

    2015-10-20

    We describe the translation of a cloth-based hybridization array system (CHAS), a colorimetric DNA detection method that is used by food inspection laboratories for colony screening of pathogenic agents, onto a microfluidic chip format. We also introduce an articulated centrifugal platform with a novel fluid manipulation concept based on changes in the orientation of the chip with respect to the centrifugal force field to time the passage of multiple components required for the process. The platform features two movable and motorized carriers that can be reoriented on demand between 0 and 360° during stage rotation. Articulation of the chip can be used to trigger on-the-fly fluid dispensing through independently addressable siphon structures or to relocate solutions against the centrifugal force field, making them newly accessible for downstream transfer. With the microfluidic CHAS, we achieved significant reduction in the size of the cloth substrate as well as the volume of reagents and wash solutions. Both the chip design and the operational protocol were optimized to perform the entire process in a reliable, fully automated fashion. A demonstration with PCR-amplified genomic DNA confirms on-chip detection and identification of Escherichia coli O157:H7 from colony isolates in a colorimetric multiplex assay using rfbO157, fliCH7, vt1, and vt2 genes. PMID:26416260

  14. A label-free colorimetric aptasensor for simple, sensitive and selective detection of Pt (II) based on platinum (II)-oligonucleotide coordination induced gold nanoparticles aggregation.

    PubMed

    Fan, Daoqing; Zhai, Qingfeng; Zhou, Weijun; Zhu, Xiaoqing; Wang, Erkang; Dong, Shaojun

    2016-11-15

    Herein, a gold nanoparticles (AuNPs) based label-free colorimetric aptasensor for simple, sensitive and selective detection of Pt (II) was constructed for the first time. Four bases (G-G mismatch) mismatched streptavidin aptamer (MSAA) was used to protect AuNPs from salt-induced aggregation and recognize Pt (II) specifically. Only in the presence of Pt (II), coordination occurs between G-G bases and Pt (II), leading to the activation of streptavidin aptamer. Streptavidin coated magnetic beads (MBs) were used as separation agent to separate Pt (II)-coordinated MSAA. The residual less amount of MSAA could not efficiently protect AuNPs anymore and aggregation of AuNPs will produce a colorimetric product. With the addition of Pt (II), a pale purple-to-blue color variation could be observed by the naked eye. A detection limit of 150nM and a linear range from 0.6μM to 12.5μM for Pt (II) could be achieved without any amplification. PMID:27281107

  15. Microfluidic Integration of a Cloth-Based Hybridization Array System (CHAS) for Rapid, Colorimetric Detection of Enterohemorrhagic Escherichia coli (EHEC) Using an Articulated, Centrifugal Platform.

    PubMed

    Geissler, Matthias; Clime, Liviu; Hoa, Xuyen D; Morton, Keith J; Hébert, Harold; Poncelet, Lucas; Mounier, Maxence; Deschênes, Mylène; Gauthier, Martine E; Huszczynski, George; Corneau, Nathalie; Blais, Burton W; Veres, Teodor

    2015-10-20

    We describe the translation of a cloth-based hybridization array system (CHAS), a colorimetric DNA detection method that is used by food inspection laboratories for colony screening of pathogenic agents, onto a microfluidic chip format. We also introduce an articulated centrifugal platform with a novel fluid manipulation concept based on changes in the orientation of the chip with respect to the centrifugal force field to time the passage of multiple components required for the process. The platform features two movable and motorized carriers that can be reoriented on demand between 0 and 360° during stage rotation. Articulation of the chip can be used to trigger on-the-fly fluid dispensing through independently addressable siphon structures or to relocate solutions against the centrifugal force field, making them newly accessible for downstream transfer. With the microfluidic CHAS, we achieved significant reduction in the size of the cloth substrate as well as the volume of reagents and wash solutions. Both the chip design and the operational protocol were optimized to perform the entire process in a reliable, fully automated fashion. A demonstration with PCR-amplified genomic DNA confirms on-chip detection and identification of Escherichia coli O157:H7 from colony isolates in a colorimetric multiplex assay using rfbO157, fliCH7, vt1, and vt2 genes.

  16. Colorimetric detection of anions in aqueous media using N-monosubstituted diaminomaleonitrile-based azo-azomethine receptors: Real-life applications

    NASA Astrophysics Data System (ADS)

    Khanmohammadi, Hamid; Rezaeian, Khatereh; Abdollahi, Alieh

    2015-03-01

    New N-monosubstituted diaminomaleonitrile-based azo-azomethine dyes have been synthesized in order to develop colorimetric sensors for detection of biologically important anions in aqueous media. Importantly, the reported sensor decorated with strong electron-withdrawing group can detect inorganic fluoride in water even at 0.037 ppm level, which is lower than WHO permissible level (below 1 ppm). Successfully, the prepared dyes were used for qualitative and quantitative detection of inorganic fluoride in toothpaste and mouthwash. The anion recognition mechanism was also investigated by detailed UV-Vis and 1H NMR experiments. The detailed 1H NMR experiments corroborated that anion recognition is based on the deprotonation phenomenon.

  17. Colorimetric detection of anions in aqueous media using N-monosubstituted diaminomaleonitrile-based azo-azomethine receptors: real-life applications.

    PubMed

    Khanmohammadi, Hamid; Rezaeian, Khatereh; Abdollahi, Alieh

    2015-03-15

    New N-monosubstituted diaminomaleonitrile-based azo-azomethine dyes have been synthesized in order to develop colorimetric sensors for detection of biologically important anions in aqueous media. Importantly, the reported sensor decorated with strong electron-withdrawing group can detect inorganic fluoride in water even at 0.037 ppm level, which is lower than WHO permissible level (below 1 ppm). Successfully, the prepared dyes were used for qualitative and quantitative detection of inorganic fluoride in toothpaste and mouthwash. The anion recognition mechanism was also investigated by detailed UV-Vis and (1)H NMR experiments. The detailed (1)H NMR experiments corroborated that anion recognition is based on the deprotonation phenomenon. PMID:25576937

  18. Simple, fast and selective detection of adenosine triphosphate at physiological pH using unmodified gold nanoparticles as colorimetric probes and metal ions as cross-linkers.

    PubMed

    Deng, Dehua; Xia, Ning; Li, Sujuan; Xu, Chunying; Sun, Ting; Pang, Huan; Liu, Lin

    2012-11-06

    We report a simple, fast and selective colorimetric assay of adenosine triphosphate (ATP) using unmodified gold nanoparticles (AuNPs) as probes and metal ions as cross-linkers. ATP can be assembled onto the surface of AuNPs through interaction between the electron-rich nitrogen atoms and the electron-deficient surface of AuNPs. Accordingly, Cu2+ ions induce a change in the color and UV/Vis absorbance of AuNPs by coordinating to the triphosphate groups and a ring nitrogen of ATP. A detection limit of 50 nM was achieved, which is comparable to or lower than that achievable by the currently used electrochemical, spectroscopic or chromatographic methods. The theoretical simplicity and high selectivity reported herein demonstrated that AuNPs-based colorimetric assay could be applied in a wide variety of fields by rationally designing the surface chemistry of AuNPs. In addition, our results indicate that ATP-modified AuNPs are less stable in Cu2+, Cd2+ or Zn2+-containing solutions due to the formation of the corresponding dimeric metal-ATP complexes.

  19. Multifunctional Oval Shape Gold Nanoparticle Based Selective Detection of Breast Cancer Cells Using Simple Colorimetric and Highly Sensitive Two-Photon Scattering Assay

    PubMed Central

    Lu, Wentong; Arumugam, Sri Ranjini; Senapati, Dulal; Singh, Anant K.; Arbneshi, Tahir; Yu, Sadia Afrin Khan Hongtao; Ray, Paresh Chandra

    2010-01-01

    Breast cancer is the most common cancer among women and it is the second leading cause of cancer deaths in women today. The key to the effective and ultimately successful treatment of diseases such as cancer is an early and accurate diagnosis. Driven by the need, in this article, we report for the first time a simple colorimetric and highly sensitive two-photon scattering assay for highly selective and sensitive detection of breast cancer SK-BR-3 cell lines in 100-cells/ml level using multifunctional (monoclonal anti-HER2/c-erb-2 antibody and S6 RNA aptamers conjugated) oval shape gold nanoparticle based nanoconjugate. When multifunctional oval shape gold nanoparticles were mixed with breast cancer SK-BR-3 cell line, a distinct color change occurs and two-photon scattering intensity increases by about 13 times. Experimental data with HaCaT non-cancerous cell line, as well as with MDA-MB-231 breast cancer cell line clearly demonstrated that our assay was highly sensitive to SK-BR-3 and it was able to distinguish from other breast cancer cell line which expresses low levels of HER-2. The mechanism of selectivity and assay’s response change, have been discussed. Our experimental results reported here open up a new possibility of rapid, easy and reliable diagnosis of cancer cell lines by monitoring the colorimetric change and measuring TPS intensity from multifunctional gold nanosystems. PMID:20155973

  20. Direct colorimetric biosensing of mercury(II) ion based on aggregation of poly-(γ-glutamic acid)-functionalized gold nanoparticles.

    PubMed

    Guan, Huanan; Liu, Xiaofei; Wang, Wei; Liang, Jinzhong

    2014-01-01

    A simple and sensitive method for colorimetric detection of mercury ion (Hg(2+)) has been developed by using a poly (γ-glutamic acid) functionalized gold nanoparticles (PGA-AuNPs) system. Electrostatic self-assembly technique was used to assemble negatively charged PGA on the surface of positively charged CTAB-capped AuNPs. With the increase of Hg(2+) concentration, the color of the solution would progress from light red to purple blue. The results showed that the absorbance ratio (A750/A580) was linear with the Hg(2+) concentration in the range of 0.01-10 μM and from 50 to 300 μM, with the correlation coefficients of 0.998 and 0.991, respectively. The reported probe is suitable for real-time detection of Hg(2+) in water with the limit of detection (LOD) of 1.9 nM obtained by UV-vis spectrum, and exhibits selectivity toward one order of magnitude over other metal ions. This approach was applied successfully to the determination of Hg(2+) in tap water and mineral water, and the recoveries were from 90% to 103% and from 103.53% to 113%, respectively. The proposed method is rapid, low-cost and free of complex equipment, making it possible to analyze Hg(2+) in various water samples. PMID:24291429

  1. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    PubMed Central

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao

    2016-01-01

    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays. PMID:27477392

  2. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    NASA Astrophysics Data System (ADS)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao

    2016-08-01

    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays.

  3. Highly selective colorimetric detection and estimation of Hg2+ at nano-molar concentration by silver nanoparticles in the presence of glutathione

    NASA Astrophysics Data System (ADS)

    Alam, Ayesha; Ravindran, Aswathy; Chandran, Preethy; Sudheer Khan, S.

    2015-02-01

    The present study investigated the colorimetric detection of mercury (Hg2+) ions by using silver nanoparticles (Ag NPs) in the presence of glutathione. The nanoparticles used in the study were synthesized biologically by using Polyalthia longifolia leaf extract. The synthesized nanoparticles were characterized by UV-visible spectrophotometer, transmission electron microscope, X-ray diffraction, particle size analyzer and zeta sizer. The particles were spherical in shape and it possesses the effective diameter of 5 nm. The zeta potential of the particles was determined to be -28.6 mV. Ag NPs-glutathione conjugates were able to detect Hg2+ in nanomolar level. Ag NPs-glutathione conjugates upon interaction with Hg2+ changes from yellowish brown to pale yellow and finally colorless. The study may be applied for the qualitative and quantitative estimation of mercury at very low concentration.

  4. Molecular recognition and colorimetric detection of cholera toxin by poly(diacetylene) liposomes incorporating G{sub m1} ganglioside

    SciTech Connect

    Pan, J.J.; Charych, D.

    1997-03-19

    Molecular recognition sites on cell membranes serve as the main communication channels between the inside of a cell and its surroundings. Upon receptor binding, cellular messages such as ion channel opening or activation of enzymes are triggered. In this report, we demonstrate that artificial cell membranes made from conjugated lipid polymers (poly(diacetylene)) can, on a simple level, mimic membrane processes of molecular recognition and signal transduction. The ganglioside GM1 was incorporated into poly(diacetylene) liposomes. Molecular recognition of cholera toxin at the interface of the liposome resulted in a change of the membrane color due to conformational charges in the conjugated (ene-yne) polymer backbone. The `colored liposomes` might be used as simple colorimetric sensors for drug screening or as new tools to study membrane-membrane or membrane-receptor interactions. 21 refs., 3 figs.

  5. Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

    PubMed

    Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

    2014-04-01

    The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field.

  6. Colorimetric detection of iron ions (III) based on the highly sensitive plasmonic response of the N-acetyl-L-cysteine-stabilized silver nanoparticles.

    PubMed

    Gao, Xiaohui; Lu, Yizhong; He, Shuijian; Li, Xiaokun; Chen, Wei

    2015-06-16

    We report here a facile colorimetric sensor based on the N-acetyl-L-cysteine (NALC)-stabilized Ag nanoparticles (NALC-Ag NPs) for detection of Fe(3+) ions in aqueous solution. The Ag NPs with an average diameter of 6.55±1.0 nm are successfully synthesized through a simple method using sodium borohydride as reducing agent and N-acetyl-L-cysteine as protecting ligand. The synthesized silver nanoparticles show a strong surface plasmon resonance (SPR) around 400 nm and the SPR intensity decreases with the increasing of Fe(3+) concentration in aqueous solution. Based on the linear relationship between SPR intensity and concentration of Fe(3+) ions, the as-synthesized water-soluble silver nanoparticles can be used for the sensitive and selective detection of Fe(3+) ions in water with a linear range from 80 nM to 80 μM and a detection limit of 80 nM. On the basis of the experimental results, a new detection mechanism of oxidation-reduction reaction between Ag NPs and Fe(3+) ions is proposed, which is different from previously reported mechanisms. Moreover, the NALC-Ag NPs could be applied to the detection of Fe(3+) ions in real environmental water samples. PMID:26002486

  7. Implementing a two-layer feed-forward catalytic DNA circuit for enzyme-free and colorimetric detection of nucleic acids.

    PubMed

    Ravan, Hadi

    2016-03-01

    In the present study, a highly sensitive and specific bio-sensing platform for enzyme-free and colorimetric detection of nucleic acids has been developed. The biosensor is composed of two DNA nanostructures and two fuel strands that construct the foundation of a feed-forward catalytic DNA circuit. Upon binding the target strand to a specific DNA nanostructure, the circuit is run in order that at the end a hemin-binding aptamer, with the ability to convert a colorless substrate into a colored substance is released. Based on this strategy, 4 pM of the target DNA can be easily detected in serum samples by naked eyes after only a two-hour incubation with the circuit; meanwhile, if the incubation time is extended to 3 h, the biosensor can detect 1 pM of the target DNA. Besides the elevated sensitivity, the circuit can truly discriminate a spurious target containing one nucleotide mismatch with high specificity. Overall, the enzyme-free catalytic DNA circuit can be used as a sensitive alternative method to enzyme-based biosensors for the specific and cost-effective detection of nucleic acids.

  8. Efficient ensemble system based on the copper binding motif for highly sensitive and selective detection of cyanide ions in 100% aqueous solutions by fluorescent and colorimetric changes.

    PubMed

    Jung, Kwan Ho; Lee, Keun-Hyeung

    2015-09-15

    A peptide-based ensemble for the detection of cyanide ions in 100% aqueous solutions was designed on the basis of the copper binding motif. 7-Nitro-2,1,3-benzoxadiazole-labeled tripeptide (NBD-SSH, NBD-SerSerHis) formed the ensemble with Cu(2+), leading to a change in the color of the solution from yellow to orange and a complete decrease of fluorescence emission. The ensemble (NBD-SSH-Cu(2+)) sensitively and selectively detected a low concentration of cyanide ions in 100% aqueous solutions by a colorimetric change as well as a fluorescent change. The addition of cyanide ions instantly removed Cu(2+) from the ensemble (NBD-SSH-Cu(2+)) in 100% aqueous solutions, resulting in a color change of the solution from orange to yellow and a "turn-on" fluorescent response. The detection limits for cyanide ions were lower than the maximum allowable level of cyanide ions in drinking water set by the World Health Organization. The peptide-based ensemble system is expected to be a potential and practical way for the detection of submicromolar concentrations of cyanide ions in 100% aqueous solutions.

  9. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    NASA Astrophysics Data System (ADS)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  10. Rapid colorimetric sensing of tetracycline antibiotics with in situ growth of gold nanoparticles.

    PubMed

    Shen, Li; Chen, Jing; Li, Na; He, Pingli; Li, Zhen

    2014-08-11

    A colorimetric assay utilizing the formation of gold nanoparticles was developed to detect tetracycline antibiotics in fluidic samples. Tetracycline antibiotics showed the capability of directly reducing aurate salts into atomic gold which form gold nanoparticles spontaneously under proper conditions. The resulted gold nanoparticles showed characteristic plasmon absorbance at 526 nm, which can be visualized by naked eyes or with a spectrophotometer. UV-vis absorbance of the resulted gold nanoparticles is correlated directly with the concentrations of tetracycline antibiotics in the solution, allowing for quantitative colorimetric detection of tetracycline antibiotics. Reaction conditions, such as pH, temperature, reaction time, and ionic strength were optimized. Sensitivity of the colorimetric assay can be enhanced by the addition of gold nanoparticle seeds, a LOD as low as 20 ng mL(-1) can be achieved with the help of seed particles. The colorimetric assay showed minimum interference from ethanol, methanol, urea, glucose, and other antibiotics such as sulfonamides, amino glycosides etc. Validity of the method was also evaluated on urine samples spiked with tetracycline antibiotics. The method provides a broad spectrum detection method for rapid and sensitive detection of reductive substances such as tetracycline antibiotics in liquid and biological samples. PMID:25066722

  11. Doped colorimetric assay liposomes

    DOEpatents

    Charych, Deborah; Stevens, Raymond C.

    2001-01-01

    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  12. Label-free colorimetric detection of biological thiols based on target-triggered inhibition of photoinduced formation of AuNPs

    NASA Astrophysics Data System (ADS)

    Lim Jung, Ye; Park, Jung Hun; Kim, Moon Il; Park, Hyun Gyu

    2016-02-01

    A label-free colorimetric method for the detection of biological thiols (biothiols) was developed. This method is based on prevention of the photoinduced reduction of auric ions (Au(III)) in the presence of amino acids (acting as a reducing agent) by biothiols; the photoinduced reduction is inhibited due to the strong interaction of the biothiols with Au(III). In this method, the sample was first incubated in an assay solution containing Au(III) and threonine; the sample solution was then exposed to 254 nm UV light. For samples without biothiols, this process led to the photoreduction of Au(III) followed by growth of gold nanoparticles accompanied by the visually detectable development of a red coloration typified by an absorption peak at ca 530 nm. Conversely, in the presence of biothiols, reduction of Au(III) to Au(0) was prevented by entrapment of Au(III) within the biothiols via the thiol group. The solution thus remained colorless even after UV irradiation, which was used as an indicator of the presence of biothiols. Using this strategy, biothiols were very conveniently analyzed by monitoring color changes of the samples with the naked eye or a UV-vis spectrometer. The strategy based on this interesting phenomenon exhibited high selectivity toward biothiols over common amino acids and was successfully employed for reliable quantification of biothiols present in human plasma, demonstrating its great potential for clinical applications.

  13. Enzyme-free and label-free ultra-sensitive colorimetric detection of Pb(2+) using molecular beacon and DNAzyme based amplification strategy.

    PubMed

    Yun, Wen; Cai, Dingzhou; Jiang, JiaoLai; Zhao, Pengxiang; Huang, Yu; Sang, Ge

    2016-06-15

    An enzyme-free and label-free colorimetric Pb(2+) sensor based on DNAzyme and molecular beacon (MB) has been developed and demonstrated by recycle using enzyme strand for signal amplification. The substrate strand DNA (S-DNA) of DNAzyme could be converted into MB structure with base pairs of stem part at the both ends. The MB could hybridize with enzyme strand DNA (E-DNA) to form DNAzyme, and be activated and cleaved in the presence of Pb(2+). The cleaved MB is much less stable, releasing from the DNAzyme as two product pieces. The product pieces of MB are flexible and could bind to unmodified AuNPs to effectively stabilize them against salt-induced aggregation. Then, the E-DNA is liberated to catalyze the next reaction and amplify the response signal. By taking advantage of repeated using of E-DNA, our proposed method exhibited high sensitive for Pb(2+) detection in a linear range from 0.05 to 5 nM with detection limit of 20 pM by UV-vis spectrometer. Moreover, this method was also used for determination of Pb(2+) in river water samples with satisfying results. Importantly, this strategy could reach high sensitivity without any modification and complex enzymatic or hairpins based amplification procedures. PMID:26836648

  14. 4-(8-Quinolyl)amino-7-nitro-2,1,3-benzoxadiazole as a new colorimetric probe for rapid and visual detection of Hg2+

    NASA Astrophysics Data System (ADS)

    Wang, Ke; Yang, Lixue; Zhao, Chuan; Ma, Huimin

    2013-03-01

    4-Amino-7-nitro-2,1,3-benzoxadiazole (ANBD) usually serves as a scaffold for developing fluorescent probes. In this paper, however, ANBD has been used as a chromogenic unit to design a new colorimetric probe, 4-(8-quinolyl)amino-7-nitro-2,1,3-benzoxadiazole (1), for rapid and visual detection of Hg2+. The reaction of 1 with Hg2+ in NaH2PO4-Na2HPO4 buffer (pH 7.0) containing 70% (v/v) acetonitrile forms a 1:1 complex, accompanying a red shift of the absorption maximum from 482 nm to 557 nm and a distinct color change from orange to violet. Moreover the color reaction exhibits a high selectivity and sensitivity to Hg2+ only, instead of other common metal ions. This behavior may be ascribed to the formation of a specific 1-Hg2+ complex, which is supported by 1H NMR titration experiments. The present study is not only a supplement to the detection method of Hg2+, but also a merit to the chemistry of 4-amino-7-nitro-2,1,3-benzoxadiazole.

  15. Enzyme-free and label-free ultra-sensitive colorimetric detection of Pb(2+) using molecular beacon and DNAzyme based amplification strategy.

    PubMed

    Yun, Wen; Cai, Dingzhou; Jiang, JiaoLai; Zhao, Pengxiang; Huang, Yu; Sang, Ge

    2016-06-15

    An enzyme-free and label-free colorimetric Pb(2+) sensor based on DNAzyme and molecular beacon (MB) has been developed and demonstrated by recycle using enzyme strand for signal amplification. The substrate strand DNA (S-DNA) of DNAzyme could be converted into MB structure with base pairs of stem part at the both ends. The MB could hybridize with enzyme strand DNA (E-DNA) to form DNAzyme, and be activated and cleaved in the presence of Pb(2+). The cleaved MB is much less stable, releasing from the DNAzyme as two product pieces. The product pieces of MB are flexible and could bind to unmodified AuNPs to effectively stabilize them against salt-induced aggregation. Then, the E-DNA is liberated to catalyze the next reaction and amplify the response signal. By taking advantage of repeated using of E-DNA, our proposed method exhibited high sensitive for Pb(2+) detection in a linear range from 0.05 to 5 nM with detection limit of 20 pM by UV-vis spectrometer. Moreover, this method was also used for determination of Pb(2+) in river water samples with satisfying results. Importantly, this strategy could reach high sensitivity without any modification and complex enzymatic or hairpins based amplification procedures.

  16. Synthesis, characterization and application of poly(acrylamide-co-methylenbisacrylamide) nanocomposite as a colorimetric chemosensor for visual detection of trace levels of Hg and Pb ions.

    PubMed

    Sedghi, Roya; Heidari, Bahareh; Behbahani, Mohammad

    2015-03-21

    In this study, a new colorimetric chemosensor based on TiO2/poly(acrylamide-co-methylenbisacrylamide) nanocomposites was designed for determination of mercury and lead ions at trace levels in environmental samples. The removal and preconcentration of lead and mercury ions on the sorbent was achieved due to sharing an electron pair of N and O groups of polymer chains with the mentioned heavy metal ions. The hydrogel sensor was designed by surface modification of a synthesized TiO2 nanoparticles using methacryloxypropyltrimethoxysilan (MAPTMS), which provided a reactive C=C bond that polymerized the acrylamide and methylenbisacrylamide. The sorbent was characterized using X-ray diffraction (XRD), thermogravimetric analysis (TGA), scanning electron microscope (SEM), EDS analysis and Fourier transform in frared (FT-IR) spectrometer. This nanostructured composite with polymer shell was developed as a sensitive and selective sorbent for adsorption of mercury and lead ions from aqueous solution at optimized condition. This method involves two-steps: (1) preconcentration of mercury and lead ions by the synthesized sorbent and (2) its selective monitoring of the target ions by complexation with dithizone (DZ). The color of the sorbent in the absence and presence of mercury and lead ions shifts from white to violet and red, respectively. The detection limit of the synthesized nanochemosensor for mercury and lead ions was 1 and 10 μg L(-1), respectively. The method was successfully applied for trace detection of mercury and lead ions in tap, river, and sea water samples. PMID:25497023

  17. Colorimetric detection of the flux of hydrogen peroxide released from living cells based on the high peroxidase-like catalytic performance of porous PtPd nanorods.

    PubMed

    Ge, Shenguang; Liu, Weiyan; Liu, Haiyun; Liu, Fang; Yu, Jinghua; Yan, Mei; Huang, Jiadong

    2015-09-15

    One-dimensional PtPd porous nanorods (PtPd PNRs) were successfully synthesized through a bromide-induced galvanic replacement reaction between Pd nanowires and K2PtCl6. The PtPd PNRs were porous and alloy-structured with Pt/Pd atomic ratio up to 1:1 which were demonstrated by spectroscopic methods. We had also proved that the nanorods could function as peroxidase mimetic for the detection of H2O2, with the detection limit of 8.6 nM and the linear range from 20 nM to 50 mM. The result demonstrated that PtPd PNRs exhibited much higher affinity to H2O2 over other peroxidase mimetics due to synergistically integrating highly catalytic activity of two metals. On the basis of the peroxidase-like activity, the PtPd PNRs were used as a signal transducer to develop a novel and simple colorimetric method for the study of the flux of H2O2 released from living cell. By using 3,3,5,5-tetramethylbenzidine as substrate, the H2O2 concentration could be distinguished by naked-eye observation without any instrumentation or complicated design. The method developed a new platform for a reliable collection of information on cellular reactive oxygen species release. And the nanomaterial could be used as a power tool for a wide range of potential applications in biotechnology and medicine.

  18. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  19. Median recoil direction as a WIMP directional detection signal

    SciTech Connect

    Green, Anne M.; Morgan, Ben

    2010-03-15

    Direct detection experiments have reached the sensitivity to detect dark matter weakly interacting massive particles (WIMPs). Demonstrating that a putative signal is due to WIMPs, and not backgrounds, is a major challenge, however. The direction dependence of the WIMP scattering rate provides a potential WIMP 'smoking gun'. If the WIMP distribution is predominantly smooth, the Galactic recoil distribution is peaked in the direction opposite to the direction of Solar motion. Previous studies have found that, for an ideal detector, of order 10 WIMP events would be sufficient to reject isotropy, and rule out an isotropic background. We examine how the median recoil direction could be used to confirm the WIMP origin of an anisotropic recoil signal. Specifically, we determine the number of events required to confirm the direction of solar motion as the median inverse recoil direction at 95% confidence. We find that for zero background 31 events are required, a factor of {approx}2 more than are required to simply reject isotropy. We also investigate the effect of a nonzero isotropic background. As the background rate is increased the number of events required increases, initially fairly gradually and then more rapidly, once the signal becomes subdominant. We also discuss the effect of features in the speed distribution at large speeds, as found in recent high resolution simulations, on the median recoil direction.

  20. Assessment of colorimetric amplification methods in a paper-based immunoassay for diagnosis of malaria.

    PubMed

    Lathwal, Shefali; Sikes, Hadley D

    2016-04-21

    Colorimetric detection methods that produce results readable by eye are important for diagnostic tests in resource-limited settings. In this work, we have compared three main types of colorimetric methods - enzymatic reactions, silver deposition catalyzed by gold nanoparticles, and polymerization-based amplification - in a paper-based immunoassay for detection of Plasmodium falciparum histidine-rich protein 2, a biomarker of malarial infection. We kept the binding events in the immunoassay constant in order to isolate the effect of the detection method on the outcome of the test. We have highlighted that the optimal readout time in a test can vary significantly - ranging from immediately after addition of a visualization agent to 25 minutes after addition of a visualization agent - depending on the colorimetric method being used, and accurate time keeping is essential to prevent false positives in methods where substantial color develops over time in negative tests. We have also shown that the choice of a colorimetric method impacts the calculated limit-of-detection, the ease of visual perception of the readout, and the total cost of the assay, and therefore directly impacts the feasibility and the ease-of-use of a test in field settings.

  1. Ni(II)NTA AuNPs as a low-resource malarial diagnostic platform for the rapid colorimetric detection of Plasmodium falciparum Histidine-Rich Protein-2.

    PubMed

    Gulka, Christopher P; Swartz, Joshua D; Wright, David W

    2015-04-01

    Diagnosing infectious diseases remains a challenge in the developing world where there is a lack of dependable electricity, running water, and skilled technicians. Although rapid immunochromatographic tests (RDTs) have been deployed to diagnose diseases such as malaria, the extreme climate conditions encountered in these regions compounded with the discrepancies in test manufacturing have yielded varying results, so that more innovative and robust technologies are sought. Devoid of antibodies and thermally sensitive materials, we present a robust, colorimetric diagnostic platform for the detection of a malarial biomarker, Plasmodium falciparum Histidine-Rich Protein 2 (PfHRP-II). The assay exploits the optical properties of gold nanoparticles, covalently coupling them to a Ni(II)NTA recognition element specific for PfHRP-II. In the presence of the recombinant malarial biomarker (rcHRP-II), the Ni(II)NTA AuNPs begin to crosslink and aggregate in as little as one minute, triggering a red-to-purple color change in solution. To increase assay sensitivity and platform stability suitable for low-resource regions, the Ni(II)NTA AuNPs were assembled with varying spacer ligands in a mixed monolayer presentation. When assembled with a negatively charged Peg4-thiol ligand, the Ni(II)NTA AuNPs demonstrate low nanomolar limits of rcHRP-II detection in physiological concentrations of human serum albumin and maintain excellent stability at 37°C when stored for four weeks. Detection of the malaria biomarker is also measured by capturing and processing images of aggregated gold nanoparticles with a smartphone camera. By utilizing a smartphone camera and image processing application, there is no significant difference in assay sensitivity and rcHRP-II limit of detection in comparison to a spectrophotometer, further making this diagnostic platform applicable for use in low-resource regions.

  2. Enhancing sensitivity and selectivity in a label-free colorimetric sensor for detection of iron(II) ions with luminescent molybdenum disulfide nanosheet-based peroxidase mimetics.

    PubMed

    Wang, Yong; Hu, Jie; Zhuang, Qianfen; Ni, Yongnian

    2016-06-15

    In the present study, we demonstrated that the luminescent molybdenum disulfide (MoS2) nanosheets, which were prepared hydrothermally by using sodium molybdate and thiourea as precursors, possessed peroxidase-like activity, and could catalyze the oxidation of peroxidase substrate o-phenylenediamine (OPD) in the presence of hydrogen peroxide (H2O2) to produce a yellow color reaction. Further addition of Fe(2+) into the nanosheets led to peroxidase mimetics with greatly enhanced catalytic activity. The observation was exploited to develop a label-free colorimetric nanozyme sensor for detection of Fe(2+). The fabricated MoS2/OPD/H2O2 sensor showed a wide linear range of 0.01-0.8 µM with a detection limit of 7 nM. Moreover, it was found that the MoS2/OPD/H2O2 sensor displayed enhanced sensitivity and selectivity toward Fe(2+) compared with the OPD/H2O2 sensor, suggesting that the MoS2 nanosheets could improve the performance of the Fe(2+) sensor. An advanced chemometrics algorithm, multivariate curve resolution by alternating least squares (MCR-ALS), was further applied to interpret the origin of enhancing sensitivity and selectivity in the Fe(2+) sensor with the MoS2 nanosheets. The time-dependent UV-vis spectral data of the studied systems were collected, and submitted to the MCR-ALS. The results showed that the increased sensitivity and selectivity of the MoS2/OPD/H2O2 sensor for Fe(2+) detection likely arose from its large reaction rate constant. Finally, the proposed MoS2/OPD/H2O2 sensor was successfully applied for detection of Fe(2+) in water samples.

  3. A simple cassette as point-of-care diagnostic device for naked-eye colorimetric bacteria detection.

    PubMed

    Safavieh, Mohammadali; Ahmed, Minhaz Uddin; Sokullu, Esen; Ng, Andy; Braescu, Liliana; Zourob, Mohammed

    2014-01-21

    Effective pathogen detection is necessary for treatment of infectious diseases. Point of care (POC) devices have tremendously improved the global human heath. However, design criteria for sample processing POC devices for pathogen detection in limited infrastructure are challenging and can make a significant contribution to global health by providing rapid and sensitive detection of bacteria in food, water, and patient samples. In this paper, we demonstrate a novel portable POC diagnostic device that is simple to assemble for genetic detection of bacterial pathogens by isothermal DNA amplification. The device is fabricated with very low production cost, using simple methods and easy-to-access materials on a flexible ribbon polyethylene substrate. We showed that the device is capable of detection of 30 CFU mL(-1) of E. coli and 200 CFU mL(-1) of S. aureus in less than 1 hour. Through numerical simulations, we estimated that the device can be extended to high-throughput detection simultaneously performing a minimum of 36 analyses. This robust and sensitive detection device can be assembled and operated by non-specialist personnel, particularly for multiple bacterial pathogen detections in low-resource settings.

  4. Disentangling Dark Matter Dynamics with Directional Detection

    SciTech Connect

    Lisanti, Mariangela; Wacker, Jay G.; /SLAC

    2009-12-16

    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a non-minimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  5. Disentangling dark matter dynamics with directional detection

    SciTech Connect

    Lisanti, Mariangela; Wacker, Jay G.

    2010-05-01

    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a nonminimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  6. Microgels for multiplex and direct fluorescence detection

    NASA Astrophysics Data System (ADS)

    Causa, Filippo; Aliberti, Anna; Cusano, Angela M.; Battista, Edmondo; Netti, Paolo A.

    2015-05-01

    Blood borne oligonucleotides fragments contain useful clinical information whose detection and monitoring represent the new frontier in liquid biopsy as they can transform the current diagnosis procedure. For instance, recent studies have identified a new class of circulating biomarkers such as s miRNAs, and demonstrated that changes in their concentration are closely associated with the development of cancer and other pathologies. However, direct detection of miRNAs in body fluids is particularly challenging and demands high sensitivity -concentration range between atto to femtomolarspecificity, and multiplexing Here we report on engineered multifunctional microgels and innovative probe design for a direct and multiplex detection of relevant clinical miRNAs in fluorescence by single particle assay. Polyethyleneglycol-based microgels have a coreshell architecture with two spectrally encoded fluorescent dyes for multiplex analyses and are endowed with fluorescent probes for miRNA detection. Encoding and detection fluorescence signals are distinguishable by not overlapping emission spectra. Tuneable fluorescence probe conjugation and corresponding emission confinement on single microgel allows for enhanced target detection. Such suspension array has indeed high selectivity and sensitivity with a detection limit of 10-15 M and a dynamic range from 10-9 to 10-15 M. We believe that sensitivity in the fM concentration range, signal background minimization, multiplexed capability and direct measurement of such microgels will translate into diagnostic benefits opening up new roots toward liquid biopsy in the context of point-of-care testing through an easy and fast detection of sensitive diagnostic biomarkers directly in serum.

  7. Hydrophilic-Hydrophobic Patterned Molecularly Imprinted Photonic Crystal Sensors for High-Sensitive Colorimetric Detection of Tetracycline.

    PubMed

    Hou, Jue; Zhang, Huacheng; Yang, Qiang; Li, Mingzhu; Jiang, Lei; Song, Yanlin

    2015-06-01

    A hydrophilic-hydrophobic patterned molecularly imprinted (MIP) photonic crystal (PC) sensor is fabricated for highly sensitive tetracycline detection. The relationship between the tetracycline concentration, its corresponding color of the sensor, and the diameter of MIP-PC dot is found using a fan-shaped color card. This work provides a new strategy to design the sensors with tunable detection ranges for practical applications.

  8. A FRET-based ratiometric fluorescent and colorimetric probe for the facile detection of organophosphonate nerve agent mimic DCP.

    PubMed

    Xuan, Weimin; Cao, Yanting; Zhou, Jiahong; Wang, Wei

    2013-11-18

    A FRET ratiometric fluorescent probe enabling a fast and highly sensitive response to OP nerve agent mimic DCP within 1 min and with as low as 0.17 ppm concentration detection limit has been developed. Moreover, the probe exhibits noticeable color changes under UV light and even with the naked eye. It is also demonstrated that it can detect both liquid and gas nerve agents.

  9. Hydrophilic-Hydrophobic Patterned Molecularly Imprinted Photonic Crystal Sensors for High-Sensitive Colorimetric Detection of Tetracycline.

    PubMed

    Hou, Jue; Zhang, Huacheng; Yang, Qiang; Li, Mingzhu; Jiang, Lei; Song, Yanlin

    2015-06-01

    A hydrophilic-hydrophobic patterned molecularly imprinted (MIP) photonic crystal (PC) sensor is fabricated for highly sensitive tetracycline detection. The relationship between the tetracycline concentration, its corresponding color of the sensor, and the diameter of MIP-PC dot is found using a fan-shaped color card. This work provides a new strategy to design the sensors with tunable detection ranges for practical applications. PMID:25649896

  10. Pd/V.sub.2O.sub.5 device for colorimetric H.sub.2 detection

    DOEpatents

    Liu, Ping; Tracy, C. Edwin; Pitts, J. Roland; Smith, II, R. Davis; Lee, Se-Hee

    2008-09-02

    A sensor structure for chemochromic optical detection of hydrogen gas over a wide response range, that exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas, comprising: a glass substrate (20); a vanadium oxide layer (21) coated on the glass substrate; and a palladium layer (22) coated on the vanadium oxide layer.

  11. Colorimetric and fluorometric discrimination of geometrical isomers (maleic acid vs fumaric acid) with real-time detection of maleic acid in solution and food additives.

    PubMed

    Samanta, Soham; Kar, Chirantan; Das, Gopal

    2015-09-01

    Heterobis imine Schiff base probe L is able to discriminate geometrical isomers (maleic acid vs fumaric acid) through sharp colorimetric as well as fluorogenic responses even conspicuous with the naked eye. Colorimetric as well as fluorogenic sensing of maleic acid among various carboxylic acids was also demonstrated in ethanol-buffer medium. Sensing behavior of L was corroborated by (1)H NMR spectra, mass spectrometry, and theoretical calculations. Subsequently sensing behavior of L was used to probe maleic acid in starch rich food samples.

  12. Colorimetric and fluorometric discrimination of geometrical isomers (maleic acid vs fumaric acid) with real-time detection of maleic acid in solution and food additives.

    PubMed

    Samanta, Soham; Kar, Chirantan; Das, Gopal

    2015-09-01

    Heterobis imine Schiff base probe L is able to discriminate geometrical isomers (maleic acid vs fumaric acid) through sharp colorimetric as well as fluorogenic responses even conspicuous with the naked eye. Colorimetric as well as fluorogenic sensing of maleic acid among various carboxylic acids was also demonstrated in ethanol-buffer medium. Sensing behavior of L was corroborated by (1)H NMR spectra, mass spectrometry, and theoretical calculations. Subsequently sensing behavior of L was used to probe maleic acid in starch rich food samples. PMID:26246182

  13. Colorimetric assessment of BCR-ABL1 transcripts in clinical samples via gold nanoprobes.

    PubMed

    Vinhas, Raquel; Correia, Cláudia; Ribeiro, Patricia; Lourenço, Alexandra; Botelho de Sousa, Aida; Fernandes, Alexandra R; Baptista, Pedro V

    2016-07-01

    Gold nanoparticles functionalized with thiolated oligonucleotides (Au-nanoprobes) have been used in a range of applications for the detection of bioanalytes of interest, from ions to proteins and DNA targets. These detection strategies are based on the unique optical properties of gold nanoparticles, in particular, the intense color that is subject to modulation by modification of the medium dieletric. Au-nanoprobes have been applied for the detection and characterization of specific DNA sequences of interest, namely pathogens and disease biomarkers. Nevertheless, despite its relevance, only a few reports exist on the detection of RNA targets. Among these strategies, the colorimetric detection of DNA has been proven to work for several different targets in controlled samples but demonstration in real clinical bioanalysis has been elusive. Here, we used a colorimetric method based on Au-nanoprobes for the direct detection of the e14a2 BCR-ABL fusion transcript in myeloid leukemia patient samples without the need for retro-transcription. Au-nanoprobes directly assessed total RNA from 38 clinical samples, and results were validated against reverse transcription-nested polymerase chain reaction (RT-nested PCR) and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The colorimetric Au-nanoprobe assay is a simple yet reliable strategy to scrutinize myeloid leukemia patients at diagnosis and evaluate progression, with obvious advantages in terms of time and cost, particularly in low- to medium-income countries where molecular screening is not routinely feasible. Graphical abstract Gold nanoprobe for colorimetric detection of BCR-ABL1 fusion transcripts originating from the Philadelphia chromosome. PMID:27225178

  14. High-frequency intracellular transposition of a defective mammalian provirus detected by an in situ colorimetric assay.

    PubMed Central

    Tchenio, T; Heidmann, T

    1992-01-01

    We devised an indicator gene for retrotransposition, nlsLacZRT, which contains the Escherichia coli lacZ gene fused to a nuclear location signal (nlsLacZ), engineered in such a way that the gene is expressed only if the structure in which it has been inserted transposes itself through an RNA intermediate. A cloned murine leukemia retrovirus with an ecotropic host range (Moloney murine leukemia virus), rendered defective by a large deletion encompassing the three viral gag, pol, and env open reading frames, was marked with this indicator gene and introduced by transfection into heterologous feline cells. No beta-galactosidase activity could be detected among the clonal cell population, unless the defective provirus was complemented in trans by the gag-pol gene products. Under these conditions, cell variants which disclosed an easily detectable nuclear blue coloration upon in situ 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside staining were observed. Fluorescence-activated cell sorting of the beta-galactosidase-positive cells, followed by Southern blot analysis, demonstrated an unambiguous correlation between nlsLacZRT activation and retrotransposition of the marked provirus. Transposition occurs at a high frequency (up to 10(-4) events per cell per generation), which is dependent on the level of expression of the gag-pol gene and is concomitant with the release of noninfectious retroviruslike particles which are the hallmarks, but not the intermediates, of the intracellular transposition process. Images PMID:1371167

  15. Continuous colorimetric screening assays for the detection of specific L- or D-α-amino acid transaminases in enzyme libraries.

    PubMed

    Heuson, Egon; Petit, Jean-Louis; Debard, Adrien; Job, Aurélie; Charmantray, Franck; de Berardinis, Véronique; Gefflaut, Thierry

    2016-01-01

    In the course of a project devoted to the stereoselective synthesis of non-proteinogenic α-amino acids using α-transaminases (α-TA), we report the design and optimization of generic high-throughput continuous assays for the screening of α-TA libraries. These assays are based on the use of L- or D-cysteine sulfinic acid (CSA) as irreversible amino donor and subsequent sulfite titration by colorimetry. The assays' quality was assessed under screening conditions. Hit selection thresholds were accurately determined for every couple of substrates and a library of 232 putative transaminases expressed in Escherichia coli host cells was screened. The reported high throughput screening assays proved very sensitive allowing the detection with high confidence of activities as low as 10 μU (i.e., 0.01 nmol substrate converted per min). The assays were also evidenced to be stereochemically discriminant since L-CSA and D-CSA allowed the exclusive detection of L-TA and D-TA, respectively. These generic assays thus allow testing the stereoselective conversion of a wide range of α-keto acids into α-amino acids of interest. As a proof of principle, the use of 2-oxo-4-phenylbutyric acid as acceptor substrate led to the identification of 54 new α-TA offering an access to valuable L- or D-homophenylalanine. PMID:26452497

  16. Continuous colorimetric screening assays for the detection of specific L- or D-α-amino acid transaminases in enzyme libraries.

    PubMed

    Heuson, Egon; Petit, Jean-Louis; Debard, Adrien; Job, Aurélie; Charmantray, Franck; de Berardinis, Véronique; Gefflaut, Thierry

    2016-01-01

    In the course of a project devoted to the stereoselective synthesis of non-proteinogenic α-amino acids using α-transaminases (α-TA), we report the design and optimization of generic high-throughput continuous assays for the screening of α-TA libraries. These assays are based on the use of L- or D-cysteine sulfinic acid (CSA) as irreversible amino donor and subsequent sulfite titration by colorimetry. The assays' quality was assessed under screening conditions. Hit selection thresholds were accurately determined for every couple of substrates and a library of 232 putative transaminases expressed in Escherichia coli host cells was screened. The reported high throughput screening assays proved very sensitive allowing the detection with high confidence of activities as low as 10 μU (i.e., 0.01 nmol substrate converted per min). The assays were also evidenced to be stereochemically discriminant since L-CSA and D-CSA allowed the exclusive detection of L-TA and D-TA, respectively. These generic assays thus allow testing the stereoselective conversion of a wide range of α-keto acids into α-amino acids of interest. As a proof of principle, the use of 2-oxo-4-phenylbutyric acid as acceptor substrate led to the identification of 54 new α-TA offering an access to valuable L- or D-homophenylalanine.

  17. Wind measurement via direct detection lidar

    NASA Astrophysics Data System (ADS)

    Afek, I.; Sela, N.; Narkiss, N.; Shamai, G.; Tsadka, S.

    2013-10-01

    Wind sensing Lidar is considered a promising technology for high quality wind measurements required for various applications such as hub height wind resource assessment, power curve measurements and advanced, real time, forward looking turbine control. Until recently, the only available Lidar technology was based on coherent Doppler shift detection, whose market acceptance has been slow primarily due to its exuberant price. Direct detection Lidar technology provides an alternative to remote sensing of wind by incorporating high precision measurement, a robust design and an affordable price tag.

  18. DIRECTIONAL DETECTION OF FISSION-SPECTRUM NEUTRONS.

    SciTech Connect

    VANIER,P.E.

    2007-05-04

    Conventional neutron detectors consisting of {sup 3}He tubes surrounded by a plastic moderator can be quite efficient in detecting fission spectrum neutrons, but do not indicate the direction of the incident radiation. We have developed a new directional detector based on double proton recoil in two separated planes of plastic scintillators. This method allows the spectrum of the neutrons to be measured by a combination of peak amplitude in the first plane and time of flight to the second plane. It also allows the determination of the angle of scattering in the first plane. If the planes are position-sensitive detectors, then the direction of the scattered neutron is known, and the direction of the incident neutron can be determined to lie on a cone of s fixed angle. The superposition of many such cones generates an image that indicates the presence of a localized source. Typical background neutron fluences from the interaction of cosmic rays with the atmosphere are low and fairly uniformly distributed in angle. Directional detection helps to locate a manmade source in the presence of natural background. Monte Carlo simulations are compared with experimental results.

  19. [Determination of trace mercury in wastewater by a flow injection analysis composed of immobilized ionic liquid enrichment and colorimetric detection].

    PubMed

    Zhang, Jun; Mao, Li-li; Yang, Gui-peng; Gao, Xian-chi; Tang, Xu-li

    2010-07-01

    Amberlite XAD-7 resin was modified by room temperature ionic liquid (1-hexyl-3-methylimidazolium hexafluorophosphate, [C6 mim]PF6) coating through a maceration method, gaining a new sort of hydrophobic adsorbent for the solid phase extraction mini-column. Trace inorganic mercury in wastewater samples was preconcentrated and determined by flow injection online mini-column sampling coupled with spectrophotometric determination. In acid medium, dithizone was employed as chelator with cetyltrimethylammonium bromide (CTMAB) to form a red neutral mercury-dithizone complex, which could be extracted quantificationally by solid phase extraction technique on the mini-column. Under the optimized conditions, the linearity and the detection limit of the proposed method were found to be 0.35 to 50.0 microg x L(-1) Hg2+ and 0.067 microg x L(-1) Hg2+, respectively. The enrichment factor of 25 times could be achieved with a 50 mL sampling volume and the developed procedure was successfully applied for the determination of mercury in the certified reference material (GSBZ50016-90) and the spiked dock wastewater samples with the recovery of 99%-103%. PMID:20828014

  20. Multicenter study of epidemiological cutoff values and detection of resistance in Candida spp. to anidulafungin, caspofungin, and micafungin using the Sensititre YeastOne colorimetric method.

    PubMed

    Espinel-Ingroff, A; Alvarez-Fernandez, M; Cantón, E; Carver, P L; Chen, S C-A; Eschenauer, G; Getsinger, D L; Gonzalez, G M; Govender, N P; Grancini, A; Hanson, K E; Kidd, S E; Klinker, K; Kubin, C J; Kus, J V; Lockhart, S R; Meletiadis, J; Morris, A J; Pelaez, T; Quindós, G; Rodriguez-Iglesias, M; Sánchez-Reus, F; Shoham, S; Wengenack, N L; Borrell Solé, N; Echeverria, J; Esperalba, J; Gómez-G de la Pedrosa, E; García García, I; Linares, M J; Marco, F; Merino, P; Pemán, J; Pérez Del Molino, L; Roselló Mayans, E; Rubio Calvo, C; Ruiz Pérez de Pipaon, M; Yagüe, G; Garcia-Effron, G; Guinea, J; Perlin, D S; Sanguinetti, M; Shields, R; Turnidge, J

    2015-11-01

    Neither breakpoints (BPs) nor epidemiological cutoff values (ECVs) have been established for Candida spp. with anidulafungin, caspofungin, and micafungin when using the Sensititre YeastOne (SYO) broth dilution colorimetric method. In addition, reference caspofungin MICs have so far proven to be unreliable. Candida species wild-type (WT) MIC distributions (for microorganisms in a species/drug combination with no detectable phenotypic resistance) were established for 6,007 Candida albicans, 186 C. dubliniensis, 3,188 C. glabrata complex, 119 C. guilliermondii, 493 C. krusei, 205 C. lusitaniae, 3,136 C. parapsilosis complex, and 1,016 C. tropicalis isolates. SYO MIC data gathered from 38 laboratories in Australia, Canada, Europe, Mexico, New Zealand, South Africa, and the United States were pooled to statistically define SYO ECVs. ECVs for anidulafungin, caspofungin, and micafungin encompassing ≥97.5% of the statistically modeled population were, respectively, 0.12, 0.25, and 0.06 μg/ml for C. albicans, 0.12, 0.25, and 0.03 μg/ml for C. glabrata complex, 4, 2, and 4 μg/ml for C. parapsilosis complex, 0.5, 0.25, and 0.06 μg/ml for C. tropicalis, 0.25, 1, and 0.25 μg/ml for C. krusei, 0.25, 1, and 0.12 μg/ml for C. lusitaniae, 4, 2, and 2 μg/ml for C. guilliermondii, and 0.25, 0.25, and 0.12 μg/ml for C. dubliniensis. Species-specific SYO ECVs for anidulafungin, caspofungin, and micafungin correctly classified 72 (88.9%), 74 (91.4%), 76 (93.8%), respectively, of 81 Candida isolates with identified fks mutations. SYO ECVs may aid in detecting non-WT isolates with reduced susceptibility to anidulafungin, micafungin, and especially caspofungin, since testing the susceptibilities of Candida spp. to caspofungin by reference methodologies is not recommended. PMID:26282428

  1. Multicenter Study of Epidemiological Cutoff Values and Detection of Resistance in Candida spp. to Anidulafungin, Caspofungin, and Micafungin Using the Sensititre YeastOne Colorimetric Method

    PubMed Central

    Alvarez-Fernandez, M.; Cantón, E.; Carver, P. L.; Chen, S. C.-A.; Eschenauer, G.; Getsinger, D. L.; Gonzalez, G. M.; Grancini, A.; Hanson, K. E.; Kidd, S. E.; Klinker, K.; Kubin, C. J.; Kus, J. V.; Lockhart, S. R.; Meletiadis, J.; Morris, A. J.; Pelaez, T.; Rodriguez-Iglesias, M.; Sánchez-Reus, F.; Shoham, S.; Wengenack, N. L.; Borrell Solé, N.; Echeverria, J.; Esperalba, J.; Gómez-G. de la Pedrosa, E.; García García, I.; Linares, M. J.; Marco, F.; Merino, P.; Pemán, J.; Pérez del Molino, L.; Roselló Mayans, E.; Rubio Calvo, C.; Ruiz Pérez de Pipaon, M.; Yagüe, G.; Garcia-Effron, G.; Perlin, D. S.; Sanguinetti, M.; Shields, R.; Turnidge, J.

    2015-01-01

    Neither breakpoints (BPs) nor epidemiological cutoff values (ECVs) have been established for Candida spp. with anidulafungin, caspofungin, and micafungin when using the Sensititre YeastOne (SYO) broth dilution colorimetric method. In addition, reference caspofungin MICs have so far proven to be unreliable. Candida species wild-type (WT) MIC distributions (for microorganisms in a species/drug combination with no detectable phenotypic resistance) were established for 6,007 Candida albicans, 186 C. dubliniensis, 3,188 C. glabrata complex, 119 C. guilliermondii, 493 C. krusei, 205 C. lusitaniae, 3,136 C. parapsilosis complex, and 1,016 C. tropicalis isolates. SYO MIC data gathered from 38 laboratories in Australia, Canada, Europe, Mexico, New Zealand, South Africa, and the United States were pooled to statistically define SYO ECVs. ECVs for anidulafungin, caspofungin, and micafungin encompassing ≥97.5% of the statistically modeled population were, respectively, 0.12, 0.25, and 0.06 μg/ml for C. albicans, 0.12, 0.25, and 0.03 μg/ml for C. glabrata complex, 4, 2, and 4 μg/ml for C. parapsilosis complex, 0.5, 0.25, and 0.06 μg/ml for C. tropicalis, 0.25, 1, and 0.25 μg/ml for C. krusei, 0.25, 1, and 0.12 μg/ml for C. lusitaniae, 4, 2, and 2 μg/ml for C. guilliermondii, and 0.25, 0.25, and 0.12 μg/ml for C. dubliniensis. Species-specific SYO ECVs for anidulafungin, caspofungin, and micafungin correctly classified 72 (88.9%), 74 (91.4%), 76 (93.8%), respectively, of 81 Candida isolates with identified fks mutations. SYO ECVs may aid in detecting non-WT isolates with reduced susceptibility to anidulafungin, micafungin, and especially caspofungin, since testing the susceptibilities of Candida spp. to caspofungin by reference methodologies is not recommended. PMID:26282428

  2. Aberration features in directional dark matter detection

    SciTech Connect

    Bozorgnia, Nassim; Gelmini, Graciela B.; Gondolo, Paolo E-mail: gelmini@physics.ucla.edu

    2012-08-01

    The motion of the Earth around the Sun causes an annual change in the magnitude and direction of the arrival velocity of dark matter particles on Earth, in a way analogous to aberration of stellar light. In directional detectors, aberration of weakly interacting massive particles (WIMPs) modulates the pattern of nuclear recoil directions in a way that depends on the orbital velocity of the Earth and the local galactic distribution of WIMP velocities. Knowing the former, WIMP aberration can give information on the latter, besides being a curious way of confirming the revolution of the Earth and the extraterrestrial provenance of WIMPs. While observing the full aberration pattern requires extremely large exposures, we claim that the annual variation of the mean recoil direction or of the event counts over specific solid angles may be detectable with moderately large exposures. For example, integrated counts over Galactic hemispheres separated by planes perpendicular to Earth's orbit would modulate annually, resulting in Galactic Hemisphere Annual Modulations (GHAM) with amplitudes larger than the usual non-directional annual modulation.

  3. Direct detection of dark matter axions with directional sensitivity

    SciTech Connect

    Irastorza, Igor G.; García, Juan A. E-mail: jagarpas@unizar.es

    2012-10-01

    We study the directional effect of the expected axion dark matter signal in a resonant cavity of an axion haloscope detector, for cavity geometries not satisfying the condition that the axion de Broglie wavelength λ{sub a} is sufficiently larger than the cavity dimensions L for a fully coherent conversion, i.e. λ{sub a}∼>2πL. We focus on long thin cavities immersed in dipole magnets and find, for appropriately chosen cavity lengths, an O(1) modulation of the signal with the cavity orientation with respect the momentum distribution of the relic axion background predicted by the isothermal sphere model for the galactic dark matter halo. This effect can be exploited to design directional axion dark matter detectors, providing an unmistakable signature of the extraterrestrial origin of a possible positive detection. Moreover, the precise shape of the modulation may give information of the galactic halo distribution and, for specific halo models, give extra sensitivity for higher axion masses.

  4. Multidimensional colorimetric sensor array for discrimination of proteins.

    PubMed

    Mao, Jinpeng; Lu, Yuexiang; Chang, Ning; Yang, Jiaoe; Zhang, Sichun; Liu, Yueying

    2016-12-15

    An extensible multidimensional colorimetric sensor array for the detection of protein is developed based on DNA functionalized gold nanoparticles (DNA-AuNPs) as receptors. In the presence of different proteins, the aggregation behavior of DNA-AuNPs was regulated by the high concentrations of salt and caused different color change; while DNA-AuNPs grew induced by the reduction of HAuCl4 and NH2OH as a reductant on the surface of nanoparticles exhibited different morphologies and color appearance for different proteins. The transducers based on AuNPs modified by specific and nonspecific DNA enables naked-eye discrimination of the target analytes. This extensible sensing platform with only two receptors could simultaneously discriminate ten native proteins and their thermally denatured conformations using hierarchical cluster analysis (HCA) at the concentration of 50nM with 100% accuracy. This opens up the possibility of the sensor array to investigate the different conformational changes of biomacromolecules, and it gives a new direction of developing multidimensional transduction principles based on plasmonic nanoparticle conjugates. Furthermore, the sensing system could discriminate proteins at the concentration of 500nM in the presence of 50% human urine, which indicated this sensor array has great potential ability in analyzing real biological fluids. In addition, the multidimensional colorimetric sensor array is suitable for analysis of target analytes in the resource-restricted regions because of rapid, simple, low cost, and in-field detection with the naked eye. PMID:27322936

  5. Discovering the enzyme mimetic activity of metal-organic framework (MOF) for label-free and colorimetric sensing of biomolecules.

    PubMed

    Wang, Ying; Zhu, Yingjing; Binyam, Atsebeha; Liu, Misha; Wu, Yinan; Li, Fengting

    2016-12-15

    A label-free sensing strategy based on the enzyme-mimicking activity of MOF was demonstrated for colorimetric detection of biomolecules. Firstly obvious blue color was observed due to the high efficiency of peroxidase-like catalytic activity of Fe-MIL-88A (an ion-based MOF material) toward 3,3',5,5'-tetramethylbenzidine (TMB). Then in the presence of target biomolecule and corresponding aptamer, the mimetic activity of Fe-MIL-88A can be strongly inhibited and used directly to realize the colorimetric detection. On the basis of the interesting findings, we designed a straightforward, label-free and sensitive colorimetric method for biomolecule detection by using the enzyme mimetic property of MOF coupling with molecular recognition element. Compared with the existed publications, our work breaks the routine way by setting up an inorganic-organic MOF-aptamer hybrid platform for colorimetric determination of biomolecules, expanding the targets scope from H2O2 or glucose to biomolecules. As a proof of concept, thrombin and thrombin aptamer was used as a model analyte. The limit of detection of 10nM can be achieved with naked eyes and ultrahigh selectivity of thrombin toward numerous interfering substances with 10-fold concentration was demonstrated significantly. Of note, the method was further applied for the detection of thrombin in human serum samples, showing the results in agreement with those values obtained in an immobilization buffer by the colorimetric method. This inorganic-organic MOF-aptamer sensing strategy may in principle be universally applicable for the detection of a range of environmental or biomedical molecules of interests. PMID:27419909

  6. Discovering the enzyme mimetic activity of metal-organic framework (MOF) for label-free and colorimetric sensing of biomolecules.

    PubMed

    Wang, Ying; Zhu, Yingjing; Binyam, Atsebeha; Liu, Misha; Wu, Yinan; Li, Fengting

    2016-12-15

    A label-free sensing strategy based on the enzyme-mimicking activity of MOF was demonstrated for colorimetric detection of biomolecules. Firstly obvious blue color was observed due to the high efficiency of peroxidase-like catalytic activity of Fe-MIL-88A (an ion-based MOF material) toward 3,3',5,5'-tetramethylbenzidine (TMB). Then in the presence of target biomolecule and corresponding aptamer, the mimetic activity of Fe-MIL-88A can be strongly inhibited and used directly to realize the colorimetric detection. On the basis of the interesting findings, we designed a straightforward, label-free and sensitive colorimetric method for biomolecule detection by using the enzyme mimetic property of MOF coupling with molecular recognition element. Compared with the existed publications, our work breaks the routine way by setting up an inorganic-organic MOF-aptamer hybrid platform for colorimetric determination of biomolecules, expanding the targets scope from H2O2 or glucose to biomolecules. As a proof of concept, thrombin and thrombin aptamer was used as a model analyte. The limit of detection of 10nM can be achieved with naked eyes and ultrahigh selectivity of thrombin toward numerous interfering substances with 10-fold concentration was demonstrated significantly. Of note, the method was further applied for the detection of thrombin in human serum samples, showing the results in agreement with those values obtained in an immobilization buffer by the colorimetric method. This inorganic-organic MOF-aptamer sensing strategy may in principle be universally applicable for the detection of a range of environmental or biomedical molecules of interests.

  7. The Earth's velocity for direct detection experiments

    NASA Astrophysics Data System (ADS)

    McCabe, Christopher

    2014-02-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has hitherto received little explicit discussion. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  8. Colorimetric elastase sensor with peptide conjugated cellulose nanocrystals is interfaced to dialysis membranes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clinical detection of human neutrophil elastase (HNE) as point of care biomarker or in situ colorimetric adjuvant to chronic wound dressings presents potential advantages in the management of chronic wounds. A colorimetric approach to the detection of HNE using cotton cellulose nanocrystals (CCN) i...

  9. Direct Detection of Soil-Bound Prions

    PubMed Central

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  10. A Colorimetric Enzyme-Linked Immunosorbent Assay (ELISA) Detection Platform for a Point-of-Care Dengue Detection System on a Lab-on-Compact-Disc.

    PubMed

    Thiha, Aung; Ibrahim, Fatimah

    2015-01-01

    The enzyme-linked Immunosorbent Assay (ELISA) is the gold standard clinical diagnostic tool for the detection and quantification of protein biomarkers. However, conventional ELISA tests have drawbacks in their requirement of time, expensive equipment and expertise for operation. Hence, for the purpose of rapid, high throughput screening and point-of-care diagnosis, researchers are miniaturizing sandwich ELISA procedures on Lab-on-a-Chip and Lab-on-Compact Disc (LOCD) platforms. This paper presents a novel integrated device to detect and interpret the ELISA test results on a LOCD platform. The system applies absorption spectrophotometry to measure the absorbance (optical density) of the sample using a monochromatic light source and optical sensor. The device performs automated analysis of the results and presents absorbance values and diagnostic test results via a graphical display or via Bluetooth to a smartphone platform which also acts as controller of the device. The efficacy of the device was evaluated by performing dengue antibody IgG ELISA on 64 hospitalized patients suspected of dengue. The results demonstrate high accuracy of the device, with 95% sensitivity and 100% specificity in detection when compared with gold standard commercial ELISA microplate readers. This sensor platform represents a significant step towards establishing ELISA as a rapid, inexpensive and automatic testing method for the purpose of point-of-care-testing (POCT) in resource-limited settings.

  11. A Colorimetric Enzyme-Linked Immunosorbent Assay (ELISA) Detection Platform for a Point-of-Care Dengue Detection System on a Lab-on-Compact-Disc

    PubMed Central

    Thiha, Aung; Ibrahim, Fatimah

    2015-01-01

    The enzyme-linked Immunosorbent Assay (ELISA) is the gold standard clinical diagnostic tool for the detection and quantification of protein biomarkers. However, conventional ELISA tests have drawbacks in their requirement of time, expensive equipment and expertise for operation. Hence, for the purpose of rapid, high throughput screening and point-of-care diagnosis, researchers are miniaturizing sandwich ELISA procedures on Lab-on-a-Chip and Lab-on-Compact Disc (LOCD) platforms. This paper presents a novel integrated device to detect and interpret the ELISA test results on a LOCD platform. The system applies absorption spectrophotometry to measure the absorbance (optical density) of the sample using a monochromatic light source and optical sensor. The device performs automated analysis of the results and presents absorbance values and diagnostic test results via a graphical display or via Bluetooth to a smartphone platform which also acts as controller of the device. The efficacy of the device was evaluated by performing dengue antibody IgG ELISA on 64 hospitalized patients suspected of dengue. The results demonstrate high accuracy of the device, with 95% sensitivity and 100% specificity in detection when compared with gold standard commercial ELISA microplate readers. This sensor platform represents a significant step towards establishing ELISA as a rapid, inexpensive and automatic testing method for the purpose of point-of-care-testing (POCT) in resource-limited settings. PMID:25993517

  12. Target-catalyzed autonomous assembly of dendrimer-like DNA nanostructures for enzyme-free and signal amplified colorimetric nucleic acids detection.

    PubMed

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Meng, Yan; Zhou, Cuisong; Long, Yuyin; Zheng, Baozhan; Du, Juan; Guo, Yong; Xiao, Dan

    2016-12-15

    Self-assembly of DNA nanostructures is of great importance in nanomedicine, nanotechnology and biosensing. Herein, a novel target-catalyzed autonomous assembly pathway for the formation of dendrimer-like DNA nanostructures that only employing target DNA and three hairpin DNA probes was proposed. We use the sticky-ended Y shape DNA (Y-DNA) as the assembly monomer and it was synthesized by the catalyzed hairpin assembly (CHA) instead of the DNA strand annealing method. The formed Y-DNA was equipped with three ssDNA sticky ends and two of them were predesigned to be complementary to the third one, then the dendrimer-like DNA nanostructures can be obtained via an autonomous assembly among these sticky-ended Y-DNAs. The resulting nanostructure has been successfully applied to develop an enzyme-free and signal amplified gold nanoparticle (AuNP)-based colorimetric nucleic acids assay. PMID:27498325

  13. Pt74Ag26 nanoparticle-decorated ultrathin MoS2 nanosheets as novel peroxidase mimics for highly selective colorimetric detection of H2O2 and glucose

    NASA Astrophysics Data System (ADS)

    Cai, Shuangfei; Han, Qiusen; Qi, Cui; Lian, Zheng; Jia, Xinghang; Yang, Rong; Wang, Chen

    2016-02-01

    To extend the functionalities of two-dimensional graphene-like layered compounds as versatile materials, the modification of transition metal dichalcogenide nanosheets such as MoS2 with metal nanoparticles is of great and widespread interest. However, few studies are available on the preparation of bimetallic nanoparticles supported on MoS2. Herein, a facile and efficient method to synthesize MoS2-PtAg nanohybrids by decorating ultrathin MoS2 nanosheets with octahedral Pt74Ag26 alloy nanoparticles has been reported. The as-prepared MoS2-Pt74Ag26 nanohybrids were investigated as novel peroxidase mimics to catalyze the oxidation of classical peroxidase substrate 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2, producing a blue colored reaction and exhibiting typical Michaelis-Menten kinetics. MoS2-Pt74Ag26 has a higher affinity for H2O2 than horseradish peroxidase (HRP) and a higher vmax value with TMB as the substrate than MoS2. The improved catalytic activity of hybrids for colorimetric reactions could be attributed to the synergistic effects of octahedral Pt74Ag26 nanoparticles and ultrathin MoS2 nanosheets as supports. Meanwhile, the generation of active oxygen species (&z.rad;OH) by H2O2 decomposition with MoS2-Pt74Ag26 was responsible for the oxidation of TMB. On the basis of these findings, a colorimetric method based on MoS2-Pt74Ag26 nanohybrids that is highly sensitive and selective was developed for glucose detection. Lower values of the limit of detection (LOD) were obtained, which is more sensitive than MoS2 nanosheets.To extend the functionalities of two-dimensional graphene-like layered compounds as versatile materials, the modification of transition metal dichalcogenide nanosheets such as MoS2 with metal nanoparticles is of great and widespread interest. However, few studies are available on the preparation of bimetallic nanoparticles supported on MoS2. Herein, a facile and efficient method to synthesize MoS2-PtAg nanohybrids by decorating

  14. Upconversion ratiometric fluorescence and colorimetric dual-readout assay for uric acid.

    PubMed

    Fang, Aijin; Wu, Qiongqiong; Lu, Qiujun; Chen, Hongyu; Li, Haitao; Liu, Meiling; Zhang, Youyu; Yao, Shouzhuo

    2016-12-15

    A new upconversion colorimetric and ratiometric fluorescence detection method for uric acid (UA) has been designed. Yb(3+), Er(3+) and Tm(3+) co-doped NaYF4 nanoparticles (UCNPs) was synthesized. The co-doped NaYF4 nanoparticles, emit upconversion fluorescence with four typical emission peaks centered at 490nm, 557nm, 670nm and 705nm under the 980nm near-infrared (NIR) irradiation. The ZnFe2O4 magnetic nanoparticles (MNPs) possessing excellent peroxidase-like activity was prepared and used to catalyze oxidation the coupling of N-ethyl-N-(3-sulfopropyl)-3-methylaniline sodium salt (TOPS) and 4-amino-antipyrine (4-AAP) in the presence of H2O2 to form purple products (compound 1) which has a characteristic absorption peak located at 550nm. The upconversion fluorescence at 557nm was quenched by the compound 1 while the upconversion emission at 705nm was essentially unchanged, the fluorescence ratio ((I557/I705)0/(I557/I705)) is positively proportional to UA concentration in existence of uricase. More importantly, colorimetric signal can be easily observed and applied to directly distinguish the concentration of UA by the naked eye. Under the optimized conditions, the linear range of colorimetric and ratiometric fluorescence sensing towards UA was 0.01-1mM, the detection limits were as low as 5.79μM and 2.86μM (S/N=3), respectively. The proposed method has been successfully applied to the analysis of UA in human serum. These results indicate that the colorimetric and ratiometric fluorescence dual-readout assay method has great potential for applications in physiological and pathological diagnosis. PMID:27471157

  15. Pt74Ag26 nanoparticle-decorated ultrathin MoS2 nanosheets as novel peroxidase mimics for highly selective colorimetric detection of H2O2 and glucose.

    PubMed

    Cai, Shuangfei; Han, Qiusen; Qi, Cui; Lian, Zheng; Jia, Xinghang; Yang, Rong; Wang, Chen

    2016-02-14

    To extend the functionalities of two-dimensional graphene-like layered compounds as versatile materials, the modification of transition metal dichalcogenide nanosheets such as MoS2 with metal nanoparticles is of great and widespread interest. However, few studies are available on the preparation of bimetallic nanoparticles supported on MoS2. Herein, a facile and efficient method to synthesize MoS2-PtAg nanohybrids by decorating ultrathin MoS2 nanosheets with octahedral Pt74Ag26 alloy nanoparticles has been reported. The as-prepared MoS2-Pt74Ag26 nanohybrids were investigated as novel peroxidase mimics to catalyze the oxidation of classical peroxidase substrate 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2, producing a blue colored reaction and exhibiting typical Michaelis-Menten kinetics. MoS2-Pt74Ag26 has a higher affinity for H2O2 than horseradish peroxidase (HRP) and a higher vmax value with TMB as the substrate than MoS2. The improved catalytic activity of hybrids for colorimetric reactions could be attributed to the synergistic effects of octahedral Pt74Ag26 nanoparticles and ultrathin MoS2 nanosheets as supports. Meanwhile, the generation of active oxygen species (˙OH) by H2O2 decomposition with MoS2-Pt74Ag26 was responsible for the oxidation of TMB. On the basis of these findings, a colorimetric method based on MoS2-Pt74Ag26 nanohybrids that is highly sensitive and selective was developed for glucose detection. Lower values of the limit of detection (LOD) were obtained, which is more sensitive than MoS2 nanosheets.

  16. Measurement of microbial activity in soil by colorimetric observation of in situ dye reduction: an approach to detection of extraterrestrial life

    PubMed Central

    Crawford, Ronald L; Paszczynski, Andrzej; Lang, Qingyong; Erwin, Daniel P; Allenbach, Lisa; Corti, Giancarlo; Anderson, Tony J; Cheng, I Francis; Wai, Chien; Barnes, Bruce; Wells, Richard; Assefi, Touraj; Mojarradi, Mohammad

    2002-01-01

    Background Detecting microbial life in extraterrestrial locations is a goal of space exploration because of ecological and health concerns about possible contamination of other planets with earthly organisms, and vice versa. Previously we suggested a method for life detection based on the fact that living entities require a continual input of energy accessed through coupled oxidations and reductions (an electron transport chain). We demonstrated using earthly soils that the identification of extracted components of electron transport chains is useful for remote detection of a chemical signature of life. The instrument package developed used supercritical carbon dioxide for soil extraction, followed by chromatography or electrophoresis to separate extracted compounds, with final detection by voltammetry and tandem mass-spectrometry. Results Here we used Earth-derived soils to develop a related life detection system based on direct observation of a biological redox signature. We measured the ability of soil microbial communities to reduce artificial electron acceptors. Living organisms in pure culture and those naturally found in soil were shown to reduce 2,3-dichlorophenol indophenol (DCIP) and the tetrazolium dye 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide inner salt (XTT). Uninoculated or sterilized controls did not reduce the dyes. A soil from Antarctica that was determined by chemical signature and DNA analysis to be sterile also did not reduce the dyes. Conclusion Observation of dye reduction, supplemented with extraction and identification of only a few specific signature redox-active biochemicals such as porphyrins or quinones, provides a simplified means to detect a signature of life in the soils of other planets or their moons. PMID:12150716

  17. Cost Effective Paper-Based Colorimetric Microfluidic Devices and Mobile Phone Camera Readers for the Classroom

    ERIC Educational Resources Information Center

    Koesdjojo, Myra T.; Pengpumkiat, Sumate; Wu, Yuanyuan; Boonloed, Anukul; Huynh, Daniel; Remcho, Thomas P.; Remcho, Vincent T.

    2015-01-01

    We have developed a simple and direct method to fabricate paper-based microfluidic devices that can be used for a wide range of colorimetric assay applications. With these devices, assays can be performed within minutes to allow for quantitative colorimetric analysis by use of a widely accessible iPhone camera and an RGB color reader application…

  18. Individual Colorimetric Observer Model

    PubMed Central

    Asano, Yuta; Fairchild, Mark D.; Blondé, Laurent

    2016-01-01

    This study proposes a vision model for individual colorimetric observers. The proposed model can be beneficial in many color-critical applications such as color grading and soft proofing to assess ranges of color matches instead of a single average match. We extended the CIE 2006 physiological observer by adding eight additional physiological parameters to model individual color-normal observers. These eight parameters control lens pigment density, macular pigment density, optical densities of L-, M-, and S-cone photopigments, and λmax shifts of L-, M-, and S-cone photopigments. By identifying the variability of each physiological parameter, the model can simulate color matching functions among color-normal populations using Monte Carlo simulation. The variabilities of the eight parameters were identified through two steps. In the first step, extensive reviews of past studies were performed for each of the eight physiological parameters. In the second step, the obtained variabilities were scaled to fit a color matching dataset. The model was validated using three different datasets: traditional color matching, applied color matching, and Rayleigh matches. PMID:26862905

  19. Systematic aspects of direct extrasolar planet detection

    NASA Technical Reports Server (NTRS)

    Brown, Robert A.

    1988-01-01

    Using the first optical observatory in space, the Hubble Space Telescope, images of possible extrasolar planets will have poor contrast against the background of diffracted and scattered starlight. The very long exposure time required to achieve an adequate signal-to-noise ratio will make their detection infeasible. For a future telescope, a 16-fold increase in either the smoothness of the collecting area of the optics would reduce the exposure time to a tolerable value, but the contrast would remain low and the required photometric precision high. In this situation, the feasibility of detection would be contingent on the careful identification and control of systematic errors.

  20. Colorimetric disposable paper coated with ZnO@ZnS core-shell nanoparticles for detection of copper ions in aqueous solutions.

    PubMed

    Sadollahkhani, Azar; Hatamie, Amir; Nur, Omer; Willander, Magnus; Zargar, Behrooz; Kazeminezhad, Iraj

    2014-10-22

    In this study, we have proposed a new nanoparticle-containing test paper sensor that could be used as an inexpensive, easy-to-use, portable, and highly selective sensor to detect Cu(2+) ions in aqueous solutions. This disposable paper sensor is based on ZnO@ZnS core-shell nanoparticles. The core-shell nanoparticles were synthesized using a chemical method and then they were used for coating the paper. The synthesis of the ZnO@ZnS core-shell nanoparticles was performed at a temperature as low as 60 °C, and so far this is the lowest temperature for the synthesis of such core-shell nanoparticles. The sensitivity of the paper sensor was investigated for different Cu(2+) ion concentrations in aqueous solutions and the results show a direct linear relation between the Cu(2+) ions concentration and the color intensity of the paper sensor with a visual detection limit as low as 15 μM (∼0.96 ppm). Testing the present paper sensor on real river turbulent water shows a maximum 5% relative error for determining the Cu(2+) ions concentration, which confirms that the presented paper sensor can successfully be used efficiently for detection in complex solutions with high selectivity. Photographs of the paper sensor taken using a regular digital camera were transferred to a computer and analyzed by ImageJ Photoshop software. This finding demonstrates the potential of the present disposable paper sensor for the development of a portable, accurate, and selective heavy metal detection technology. PMID:25275616

  1. Colorimetric disposable paper coated with ZnO@ZnS core-shell nanoparticles for detection of copper ions in aqueous solutions.

    PubMed

    Sadollahkhani, Azar; Hatamie, Amir; Nur, Omer; Willander, Magnus; Zargar, Behrooz; Kazeminezhad, Iraj

    2014-10-22

    In this study, we have proposed a new nanoparticle-containing test paper sensor that could be used as an inexpensive, easy-to-use, portable, and highly selective sensor to detect Cu(2+) ions in aqueous solutions. This disposable paper sensor is based on ZnO@ZnS core-shell nanoparticles. The core-shell nanoparticles were synthesized using a chemical method and then they were used for coating the paper. The synthesis of the ZnO@ZnS core-shell nanoparticles was performed at a temperature as low as 60 °C, and so far this is the lowest temperature for the synthesis of such core-shell nanoparticles. The sensitivity of the paper sensor was investigated for different Cu(2+) ion concentrations in aqueous solutions and the results show a direct linear relation between the Cu(2+) ions concentration and the color intensity of the paper sensor with a visual detection limit as low as 15 μM (∼0.96 ppm). Testing the present paper sensor on real river turbulent water shows a maximum 5% relative error for determining the Cu(2+) ions concentration, which confirms that the presented paper sensor can successfully be used efficiently for detection in complex solutions with high selectivity. Photographs of the paper sensor taken using a regular digital camera were transferred to a computer and analyzed by ImageJ Photoshop software. This finding demonstrates the potential of the present disposable paper sensor for the development of a portable, accurate, and selective heavy metal detection technology.

  2. Indirect detection of radiation sources through direct detection of radiolysis products

    DOEpatents

    Farmer, Joseph C.; Fischer, Larry E.; Felter, Thomas E.

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  3. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    PubMed Central

    2012-01-01

    Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without

  4. Ink-jet printed colorimetric gas sensors on plastic foil

    NASA Astrophysics Data System (ADS)

    Courbat, Jerome; Briand, Danick; de Rooij, Nico F.

    2010-08-01

    An all polymeric colorimetric gas sensor with its associated electronics for ammonia (NH3) detection targeting low-cost and low-power applications is presented. The gas sensitive layer was inkjet printed on a plastic foil. The use of the foil directly as optical waveguide simplified the fabrication, made the device more cost effective and compatible with large scale fabrication techniques, such as roll to roll processes. Concentrations of 500 ppb of NH3 in nitrogen with 50% of RH were measured with a power consumption of about 868 μW in an optical pulsed mode of operation. Such sensors foresee applications in the field of wireless systems, for environmental and safety monitoring. The fabrication of the planar sensor was based on low temperature processing. The waveguide was made of PEN or PET foil and covered with an ammonia sensitive layer deposited by inkjet printing, which offered a proper and localized deposition of the film. The influence of the substrate temperature and its surface pretreatment were investigated to achieve the optimum deposition parameters for the printed fluid. To improve the light coupling from the light source (LED) to the detectors (photodiodes), polymeric micro-mirrors were patterned in an epoxy resin. With the printing of the colorimetric film and additive patterning of polymeric micro-mirrors on plastic foil, a major step was achieved towards the implementation of full plastic selective gas sensors. The combination with printed OLED and PPD would further lead to an integrated all polymeric optical transducer on plastic foil fully compatible with printed electronics processes.

  5. A novel development of dithizone as a dual-analyte colorimetric chemosensor: detection and determination of cyanide and cobalt (II) ions in dimethyl sulfoxide/water media with biological applications.

    PubMed

    Tavallali, Hossein; Deilamy-Rad, Gohar; Parhami, Abolfath; Mousavi, Seyede Zahra

    2013-08-01

    The behavior of dithizone (DTZ), an easily available dye has been studied for the first time in chromogenic sensing of CN(-) as an anionic species and for Co(2+) as a cationic species in DMSO/H2O media. So employing DTZ an efficient colorimetric chemosensor was afforded with a chromogenic selectivity for Co(2+) over other cations with detection limit of 0.04 μmol L(-1). The complex of Co(2+) with DTZ also displayed ability to detect up to 0.43 μmol L(-1) CN(-) (K(+) salts) among other competing anions through a fast response time of less than 30s which is much lower than most recently reported chromogenic probes. The linear dynamic ranges for the determination of Co(2+) and CN(-) were 0.3-4.4 and 3.3-58.6 μmol L(-1) respectively. This method could have potential application in a variety of cases requiring rapid and accurate analysis of Co(2+) and CN(-) for human serum and water samples. PMID:23811160

  6. Colorimetric method for rapid determination of bacteriuria.

    PubMed

    Wallis, C; Melnick, J L; Longoria, C J

    1981-09-01

    An inexpensive, rapid, and simple colorimetric test for detection of bacteriuria is described. This test does not require bacterial growth and has the marked advantage of being able to quantify bacteria, even when the organisms are present in the urine of bacteriuric patients who are being treated with antibiotics. The test is carried out with 1 ml of urine, which is processed through a 10-mm-diameter filter than entraps the bacteria on its surface. Safranine dye is passed through the filter to stain the bacteria and the filter fibers. A decolorizer, which removes the dye from the filter fibers but not from the bacteria, is then passed through the filter. If there are greater than or equal to 10(5) colony-forming units of bacteria per ml in the sample, the 10-mm filter disk manifests a pink to red color. If there are less than 10(5)colony-forming units of bacteria per ml, the filter disk remains white or becomes slightly yellow. The entire procedure has been adapted to a semiautomated instrument and the time required per test is less than 1 min. The results obtained on the test card are a permanent record to be filled with the patient's chart. The bacteria can be quickly classified as gram positive or gram negative by selective staining of a second milliliter of urine on the filter. Of 441 urine specimens tested, 430 (98%) were correctly classified as containing more or less than 10(5) colony-forming units per ml. A total of 62 urine specimens were positive by bacterial plating (greater than or equal to 10(5) colony-forming units per ml), and 59 were positive by the colorimetric test. Eight false-positives (colorimetric test positive, plate counts less than 10(5)) were encountered in patients (bacteriuric) being prescribed antibiotics. Removal of the antibiotics from these urine specimens, with subsequent replating of the samples, indicated the presence of greater than or equal to 10(5) colony-forming units of bacteria per ml in three representative cases tested

  7. Magnetic colorimetric immunoassay for human interleukin-6 based on the oxidase activity of ceria spheres.

    PubMed

    Peng, Juan; Guan, Jufang; Yao, Huiqin; Jin, Xiaoyong

    2016-01-01

    A novel magnetic colorimetric immunoassay strategy was designed for sensitive detection of human interleukin-6 (IL-6) using ceria spheres as labels. Ceria spheres showed excellent oxidase activity, which can directly catalyze the oxidation of substrate o-phenylenediamine (OPD) to a stable yellow product, 2,3-diaminophenazine (oxOPD). The absorbance of oxOPD was recorded to reflect the level of IL-6. The relatively mild conditions made the immunoassay strategy more robust, reliable, and easy. A linear relationship between absorbance intensity and the logarithm of IL-6 concentrations was obtained in the range of 0.0001-10 ng mL(-1) with a detection limit of 0.04 pg mL(-1) (S/N = 3). The colorimetric immunoassay exhibited high sensitivity and specificity for the detection of IL-6. This immunoassay has been successfully applied in the detection of IL-6 in serum samples and can be readily extended toward the on-site monitoring of cancer biomarkers in serum samples. PMID:26416691

  8. A smartphone-based colorimetric reader for bioanalytical applications using the screen-based bottom illumination provided by gadgets.

    PubMed

    Vashist, Sandeep Kumar; van Oordt, Thomas; Schneider, E Marion; Zengerle, Roland; von Stetten, Felix; Luong, John H T

    2015-05-15

    A smartphone-based colorimetric reader (SBCR) was developed using a Samsung Galaxy SIII mini, a gadget (iPAD mini, iPAD4 or iPhone 5s), integrated with a custom-made dark hood and base holder assembly. The smartphone equipped with a back camera (5 megapixels resolution) was used for colorimetric imaging via the hood and base-holder assembly. A 96- or 24-well microtiter plate (MTP) was positioned on the gadget's screensaver that provides white light-based bottom illumination only in the specific regions corresponding to the bottom of MTP's wells. The pixel intensity of the captured images was determined by an image processing algorithm. The developed SBCR was evaluated and compared with a commercial MTP reader (MTPR) for three model assays: our recently developed human C-reactive protein sandwich enzyme-linked immunosorbent assay (ELISA), horseradish peroxidase direct ELISA, and bicinchoninic acid protein estimation assay. SBCR had the same precision, dynamic range, detection limit and sensitivity as MTPR for all three assays. With advanced microfabrication and data processing, SBCR will become more compact, lighter, inexpensive and enriched with more features. Therefore, SBCR with a remarkable computing power could be an ideal point-of-care (POC) colorimetric detection device for the next-generation of cost-effective POC diagnostics, immunoassays and diversified bioanalytical applications.

  9. A smartphone-based colorimetric reader for bioanalytical applications using the screen-based bottom illumination provided by gadgets.

    PubMed

    Vashist, Sandeep Kumar; van Oordt, Thomas; Schneider, E Marion; Zengerle, Roland; von Stetten, Felix; Luong, John H T

    2015-05-15

    A smartphone-based colorimetric reader (SBCR) was developed using a Samsung Galaxy SIII mini, a gadget (iPAD mini, iPAD4 or iPhone 5s), integrated with a custom-made dark hood and base holder assembly. The smartphone equipped with a back camera (5 megapixels resolution) was used for colorimetric imaging via the hood and base-holder assembly. A 96- or 24-well microtiter plate (MTP) was positioned on the gadget's screensaver that provides white light-based bottom illumination only in the specific regions corresponding to the bottom of MTP's wells. The pixel intensity of the captured images was determined by an image processing algorithm. The developed SBCR was evaluated and compared with a commercial MTP reader (MTPR) for three model assays: our recently developed human C-reactive protein sandwich enzyme-linked immunosorbent assay (ELISA), horseradish peroxidase direct ELISA, and bicinchoninic acid protein estimation assay. SBCR had the same precision, dynamic range, detection limit and sensitivity as MTPR for all three assays. With advanced microfabrication and data processing, SBCR will become more compact, lighter, inexpensive and enriched with more features. Therefore, SBCR with a remarkable computing power could be an ideal point-of-care (POC) colorimetric detection device for the next-generation of cost-effective POC diagnostics, immunoassays and diversified bioanalytical applications. PMID:25168283

  10. Photonic Crystal Structures with Tunable Structure Color as Colorimetric Sensors

    PubMed Central

    Wang, Hui; Zhang, Ke-Qin

    2013-01-01

    Colorimetric sensing, which transduces environmental changes into visible color changes, provides a simple yet powerful detection mechanism that is well-suited to the development of low-cost and low-power sensors. A new approach in colorimetric sensing exploits the structural color of photonic crystals (PCs) to create environmentally-influenced color-changeable materials. PCs are composed of periodic dielectrics or metallo-dielectric nanostructures that affect the propagation of electromagnetic waves (EM) by defining the allowed and forbidden photonic bands. Simultaneously, an amazing variety of naturally occurring biological systems exhibit iridescent color due to the presence of PC structures throughout multi-dimensional space. In particular, some kinds of the structural colors in living organisms can be reversibly changed in reaction to external stimuli. Based on the lessons learned from natural photonic structures, some specific examples of PCs-based colorimetric sensors are presented in detail to demonstrate their unprecedented potential in practical applications, such as the detections of temperature, pH, ionic species, solvents, vapor, humidity, pressure and biomolecules. The combination of the nanofabrication technique, useful design methodologies inspired by biological systems and colorimetric sensing will lead to substantial developments in low-cost, miniaturized and widely deployable optical sensors. PMID:23539027

  11. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Quintela, Irwin A.; de Los Reyes, Benildo G.; Lin, Chih-Sheng; Wu, Vivian C. H.

    2015-01-01

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g-1, requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide

  12. Directional complex-valued coherence attributes for discontinuous edge detection

    NASA Astrophysics Data System (ADS)

    Wang, Shangxu; Yuan, Sanyi; Yan, Binpeng; He, Yanxiao; Sun, Wenju

    2016-06-01

    We propose directional complex-valued coherence attributes through a simple calculation of the cross-correlation between neighboring complex seismic traces normalized by their corresponding envelope within a local time window along a certain spatial direction. For 3D seismic data with varying directional geological edges, the complex-valued coherence attributes along different spatial directions are distinct, and the coherence along a certain direction can highlight discontinuities at (or near) the perpendicular direction. These separate directional coherence attributes can assist in interpreting the dominant direction(s) of fault development, which is vital in determining sweet spots and locating hydrocarbon wells, and can facilitate the detection of weak or hidden geological edges. In addition, we obtain the minimum complex-valued coherence attribute by comparing all directional coherence volumes to describe the entire lineament and spatial extension direction of geological abnormalities (e.g., channels). In essence, the minimum coherence attribute can be regarded as the result of implementing multi-trace complex-valued coherence calculation along the direction perpendicular to the structural trend. An example of 3D synthetic data with a fault system and channel complex is employed to demonstrate the effectiveness of the directional and minimum complex-valued coherence attributes. The application on a real 3D seismic data of tight sandstone reservoir with faults, flexures and fractures, illustrates that the directional and minimum complex-valued coherence attributes can highlight subtle structures and the directional details of geological abnormalities, which are favorably consistent with the manually interpreted results.

  13. Simple and specific colorimetric detection of Staphylococcus using its volatile 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid in the liquid phase and head space of cultures.

    PubMed

    Saranya, Raju; Aarthi, Raju; Sankaran, Krishnan

    2015-05-01

    Spread of drug-resistant Staphylococcus spp. into communities pose danger demanding effective non-invasive and non-destructive tools for its early detection and surveillance. Characteristic volatile organic compounds (VOCs) produced by bacteria offer new diagnostic targets and novel approaches not exploited so far in infectious disease diagnostics. Our search for such characteristic VOC for Staphylococcus spp. led to the depiction of 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid (ATMAP), a moderately volatile compound detected both in the culture and headspace when the organism was grown in tryptone soya broth (TSB) medium. A simple and inexpensive colorimetric method (colour change from yellow to orange) using methyl red as the pH indicator provided an absolutely specific way for identifying Staphylococcus spp., The assay performed in liquid cultures (7-h growth in TSB) as well as in the headspace of plate cultures (grown for 10 h on TSA) was optimised in a 96-well plate and 12-well plate formats, respectively, employing a set of positive and negative strains. Only Staphylococcus spp. showed the distinct colour change from yellow to orange due to the production of the above VOC while in the case of other organisms, the reagent remained yellow. The method validated using known clinical and environmental strains (56 including Staphylococcus, Proteus, Pseudomonas, Klebsiella, Bacillus, Shigella and Escherichia coli) was found to be highly efficient showing 100% specificity and sensitivity. Such simple methods of bacterial pathogen identification are expected to form the next generation tools for the control of infectious diseases through early detection and surveillance of causative agents. PMID:25900191

  14. Simple and specific colorimetric detection of Staphylococcus using its volatile 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid in the liquid phase and head space of cultures.

    PubMed

    Saranya, Raju; Aarthi, Raju; Sankaran, Krishnan

    2015-05-01

    Spread of drug-resistant Staphylococcus spp. into communities pose danger demanding effective non-invasive and non-destructive tools for its early detection and surveillance. Characteristic volatile organic compounds (VOCs) produced by bacteria offer new diagnostic targets and novel approaches not exploited so far in infectious disease diagnostics. Our search for such characteristic VOC for Staphylococcus spp. led to the depiction of 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid (ATMAP), a moderately volatile compound detected both in the culture and headspace when the organism was grown in tryptone soya broth (TSB) medium. A simple and inexpensive colorimetric method (colour change from yellow to orange) using methyl red as the pH indicator provided an absolutely specific way for identifying Staphylococcus spp., The assay performed in liquid cultures (7-h growth in TSB) as well as in the headspace of plate cultures (grown for 10 h on TSA) was optimised in a 96-well plate and 12-well plate formats, respectively, employing a set of positive and negative strains. Only Staphylococcus spp. showed the distinct colour change from yellow to orange due to the production of the above VOC while in the case of other organisms, the reagent remained yellow. The method validated using known clinical and environmental strains (56 including Staphylococcus, Proteus, Pseudomonas, Klebsiella, Bacillus, Shigella and Escherichia coli) was found to be highly efficient showing 100% specificity and sensitivity. Such simple methods of bacterial pathogen identification are expected to form the next generation tools for the control of infectious diseases through early detection and surveillance of causative agents.

  15. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles.

    PubMed

    Quintela, Irwin A; de los Reyes, Benildo G; Lin, Chih-Sheng; Wu, Vivian C H

    2015-02-14

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; "Big Six" - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g(-1), requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains. PMID:25563863

  16. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles.

    PubMed

    Quintela, Irwin A; de los Reyes, Benildo G; Lin, Chih-Sheng; Wu, Vivian C H

    2015-02-14

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; "Big Six" - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g(-1), requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.

  17. Predictions of hydrodynamic simulations for direct dark matter detection

    NASA Astrophysics Data System (ADS)

    Bozorgnia, Nassim; Calore, Francesca; Schaller, Matthieu; Lovell, Mark; Bertone, Gianfranco; Frenk, Carlos S.; Crain, Robert A.; Navarro, Julio F.; Schaye, Joop; Theuns, Tom

    2016-05-01

    We study the effects of galaxy formation on dark matter direct detection using hydrodynamic simulations obtained from the “Evolution and Assembly of GaLaxies and their Environments” (EAGLE) and APOSTLE projects. We extract the local dark matter density and velocity distribution of the simulated Milky Way analogues, and use them directly to perform an analysis of current direct detection data. The local dark matter density of the Milky Way-like galaxies is 0.41–0.73 GeV/cm3, and a Maxwellian distribution (with best fit peak speed of 223–289 km/s) describes well the local dark matter speed distribution. We find that the consistency between the result of different direct detection experiments cannot be improved by using the dark matter distribution of the simulated haloes.

  18. Comparing readout strategies to directly detect dark matter

    NASA Astrophysics Data System (ADS)

    Billard, J.

    2015-01-01

    Over the past decades, several ideas and technologies have been developed to directly detect weakly interacting massive particles (WIMP) from the galactic halo. All these detection strategies share the common goal of discriminating a WIMP signal from the residual backgrounds. By directly detecting WIMPs, one can measure some or all of the observables associated to each nuclear recoil candidates, such as their energy and direction. In this study, we compare and examine the discovery potentials of each readout strategies from counting only (bubble chambers) to directional detectors (Time Projection Chambers) with 1d-, 2d-, and 3d-sensitivity. Using a profile likelihood analysis, we show that, in the case of a large and irreducible background contamination characterized by an energy distribution similar to the expected WIMP signal, directional information can improve the sensitivity of the experiment by several orders of magnitude. We also found that 1d directional detection is only less effective than a full 3d directional sensitivity by about a factor of 3, or 10 if we assume no sense recognition, still improving by a factor of 2 or more if only the energy of the events is being measured.

  19. An integrated direct loop-mediated isothermal amplification microdevice incorporated with an immunochromatographic strip for bacteria detection in human whole blood and milk without a sample preparation step.

    PubMed

    Lee, Dohwan; Kim, Yong Tae; Lee, Jee Won; Kim, Do Hyun; Seo, Tae Seok

    2016-05-15

    We have developed an integrated direct loop-mediated isothermal amplification (Direct LAMP) microdevice incorporated with an immunochromatographic strip (ICS) to identify bacteria contaminated in real samples. The Direct LAMP is a novel isothermal DNA amplification technique which does not require thermal cycling steps as well as any sample preparation steps such as cell lysis and DNA extraction for amplifying specific target genes. In addition, the resultant amplicons were colorimetrically detected on the ICS, thereby enabling the entire genetic analysis process to be simplified. The two functional units (Direct LAMP and ICS) were integrated on a single device without use of the tedious and complicated microvalve and tubing systems. The utilization of a slidable plate allows us to manipulate the fluidic control in the microchannels manually and the sequential operation of the Direct LAMP and ICS detection could be performed by switching the slidable plate to each functional unit. Thus, the combination of the direct isothermal amplification without any sample preparation and thermal cycling steps, the ICS based amplicon detection by naked eyes, and the slidable plate to eliminate the microvalves in the integrated microdevice would be an ideal platform for point-of-care DNA diaganotics. On the integrated Direct LAMP-ICS microdevice, we could analyze Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) contaminated in human whole blood or milk at a single-cell level within 1h.

  20. Molecular diagnosis of α-thalassemias by the colorimetric nanogold.

    PubMed

    Chomean, Sirinart; Wangmaung, Nantawan; Sritongkham, Pornpimol; Promptmas, Chamras; Mas-Oodi, Sumana; Tanyong, Dalina; Ittarat, Wanida

    2014-02-21

    A new application of gold nanoparticles (AuNPs) as a colorimetric method for gene detection of α-thalassemia 1 (SEA deletion) is reported here for the first time. This technique is based on color changes from salt-induced aggregation of un-hybridized nanogold probes after hybridization with the target DNA. Specific DNA probes were synthesized, thiol modified and conjugated on the surface of AuNPs. The target DNA was amplified and hybridized with the AuNPs-immobilized probe. Salt solution (NaCl) was added to induce aggregation of the un-hybridized nanogold probes. The color changes were visualized either by the naked eye or by UV-vis spectrophotometry at 520 nm. By this nanogold colorimetric method samples carrying normal α-globin genes could be successfully identified from samples carrying α-globin genes causing α-thalassemia 1 (SEA deletion), either as a carrier or disease form. Results demonstrated that the new colorimetric nanogold method is a definite gene diagnosis of α-thalassemia. It is accurate, simple, rapid, specific, sensitive, and cost effective. It is also a promising point-of-care testing (POCT) method for thalassemias and other genetic disorders. The new colorimetric nanogold is a method of choice for areas where access to sophisticated molecular diagnosis is limited.

  1. Ratiometric and colorimetric near-infrared sensors for multi-channel detection of cyanide ion and their application to measure β-glucosidase

    PubMed Central

    Xing, Panfei; Xu, Yongqian; Li, Hongjuan; Liu, Shuhui; Lu, Aiping; Sun, Shiguo

    2015-01-01

    A near-infrared sensor for cyanide ion (CN−) was developed via internal charge transfer (ICT). This sensor can selectively detect CN− either through dual-ratiometric fluorescence (logarithm of I414/I564 and I803/I564) or under various absorption (356 and 440 nm) and emission (414, 564 and 803 nm) channels. Especially, the proposed method can be employed to measure β-glucosidase by detecting CN− traces in commercial amygdalin samples. PMID:26549546

  2. Ratiometric and colorimetric near-infrared sensors for multi-channel detection of cyanide ion and their application to measure β-glucosidase.

    PubMed

    Xing, Panfei; Xu, Yongqian; Li, Hongjuan; Liu, Shuhui; Lu, Aiping; Sun, Shiguo

    2015-11-09

    A near-infrared sensor for cyanide ion (CN(-)) was developed via internal charge transfer (ICT). This sensor can selectively detect CN(-) either through dual-ratiometric fluorescence (logarithm of I414/I564 and I803/I564) or under various absorption (356 and 440 nm) and emission (414, 564 and 803 nm) channels. Especially, the proposed method can be employed to measure β-glucosidase by detecting CN(-) traces in commercial amygdalin samples.

  3. Colorimetric determination of melamine in milk using unmodified silver nanoparticles.

    PubMed

    Kumar, Naveen; Kumar, Harish; Mann, Bimlesh; Seth, Raman

    2016-03-01

    Melamine is nitrogen rich chemical compound used as an adulterant in dairy products by unscrupulous people to increase the apparent protein content. This incident prompted the researchers to develop simple methods for easy detection of melamine in food samples. In the present paper, we report a simple and sensitive colorimetric method for detection of melamine in milk based on silver nanoparticles. This method relies upon the principle that melamine causes the aggregation of silver nanoparticles, resulting in abrupt color change from yellow to red under optimized conditions. The concentration of melamine in adulterated sample can be quantitated by monitoring the absorption spectra of silver nanoparticles using ultraviolet-visible (UV-Vis) spectrometer. The present colorimetric method which utilizes silver nanoparticles of 35 nm can reliably detect melamine down to a concentration of 0.04 mg l(-1).

  4. Colorimetric determination of melamine in milk using unmodified silver nanoparticles.

    PubMed

    Kumar, Naveen; Kumar, Harish; Mann, Bimlesh; Seth, Raman

    2016-03-01

    Melamine is nitrogen rich chemical compound used as an adulterant in dairy products by unscrupulous people to increase the apparent protein content. This incident prompted the researchers to develop simple methods for easy detection of melamine in food samples. In the present paper, we report a simple and sensitive colorimetric method for detection of melamine in milk based on silver nanoparticles. This method relies upon the principle that melamine causes the aggregation of silver nanoparticles, resulting in abrupt color change from yellow to red under optimized conditions. The concentration of melamine in adulterated sample can be quantitated by monitoring the absorption spectra of silver nanoparticles using ultraviolet-visible (UV-Vis) spectrometer. The present colorimetric method which utilizes silver nanoparticles of 35 nm can reliably detect melamine down to a concentration of 0.04 mg l(-1). PMID:26654965

  5. Colorimetric determination of melamine in milk using unmodified silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Kumar, Naveen; Kumar, Harish; Mann, Bimlesh; Seth, Raman

    2016-03-01

    Melamine is nitrogen rich chemical compound used as an adulterant in dairy products by unscrupulous people to increase the apparent protein content. This incident prompted the researchers to develop simple methods for easy detection of melamine in food samples. In the present paper, we report a simple and sensitive colorimetric method for detection of melamine in milk based on silver nanoparticles. This method relies upon the principle that melamine causes the aggregation of silver nanoparticles, resulting in abrupt color change from yellow to red under optimized conditions. The concentration of melamine in adulterated sample can be quantitated by monitoring the absorption spectra of silver nanoparticles using ultraviolet-visible (UV-Vis) spectrometer. The present colorimetric method which utilizes silver nanoparticles of 35 nm can reliably detect melamine down to a concentration of 0.04 mg l- 1.

  6. Real-time colorimetric detection of DNA methylation of the PAX1 gene in cervical scrapings for cervical cancer screening with thiol-labeled PCR primers and gold nanoparticles

    PubMed Central

    Huang, Jin; Liou, Yu-Ligh; Kang, Ya-Nan; Tan, Zhi-Rong; Peng, Ming-Jing; Zhou, Hong-Hao

    2016-01-01

    Background DNA methylation can induce carcinogenesis by silencing key tumor suppressor genes. Analysis of aberrant methylation of tumor suppressor genes can be used as a prognostic and predictive biomarker for cancer. In this study, we propose a colorimetric method for the detection of DNA methylation of the paired box gene 1 (PAX1) gene in cervical scrapings obtained from 42 patients who underwent cervical colposcopic biopsy. Methods A thiolated methylation-specific polymerase chain reaction (MSP) primer was used to generate MSP products labeled with the thiol group at one end. After bisulfite conversion and MSP amplification, the unmodified gold nanoparticles (AuNPs) were placed in a reaction tube and NaCl was added to induce aggregation of bare AuNPs without generating polymerase chain reaction products. After salt addition, the color of AuNPs remained red in the methylated PAX1 gene samples because of binding to the MSP-amplified products. By contrast, the color of the AuNP colloid solution changed from red to blue in the non-methylated PAX1 gene samples because of aggregation of AuNPs in the absence of the MSP-amplified products. Furthermore, PAX1 methylation was quantitatively detected in cervical scrapings of patients with varied pathological degrees of cervical cancer. Conventional quantitative MSP (qMSP) was also performed for comparison. Results The two methods showed a significant correlation of the methylation frequency of the PAX1 gene in cervical scrapings with severity of cervical cancer (n=42, P<0.05). The results of the proposed method showed that the areas under the receiver operating characteristic curve (AUCs) of PAX1 were 0.833, 0.742, and 0.739 for the detection of cervical intraepithelial neoplasms grade 2 and worse lesions (CIN2+), cervical intraepithelial neoplasms grade 3 and worse lesions (CIN3+), and squamous cell carcinoma, respectively. The sensitivity and specificity for detecting CIN2+ lesions were 0.941 and 0.600, respectively, with

  7. Plasmonic Enzyme-Linked Immunosorbent Assay Using Nanospherical Brushes as a Catalase Container for Colorimetric Detection of Ultralow Concentrations of Listeria monocytogenes.

    PubMed

    Chen, Rui; Huang, Xiaolin; Xu, Hengyi; Xiong, Yonghua; Li, Yanbin

    2015-12-30

    Plasmonic enzyme-linked immunosorbent assay (pELISA) based on catalase (CAT)-mediated gold nanoparticle growth exhibits ultrahigh sensitivity for detecting disease-related biomarkers using sandwich formats. However, the limit of detection (LOD) of this strategy for Listeria monocytogenes is only around 10(3) CFU/mL, which considerably exceeds the amount of L. monocytogenes commonly present in food products (<100 CFU/g). Herein, we report an improved pELISA method for detection of L. monocytogenes at ultralow concentrations with the sandwich formats using silica nanoparticles carrying poly(acrylic acid) brushes as a "CAT container" to increase enzyme loading for enhancing the detection signal. Under optimal conditions, the proposed pELISA exhibits good specificity and excellent sensitivity for L. monocytogenes with a LOD of 8 × 10(1) CFU/mL in 0.01 M phosphate-buffered saline, via a reaction that can be discriminated by the naked eye. The LOD obtained by this method was 2 and 5 orders of magnitude lower than that of conventional CAT-based pELISA and horseradish peroxidase (HRP)-based conventional ELISA, respectively. Coupled with large-volume immunomagnetic separation, the LOD for L. monocytogenes-spiked lettuce samples reached 8 × 10(1) CFU/g. The improved pELISA also exhibited a great potential in detecting a single cell of L. monocytogenes in 100 μL of solution.

  8. Automated colorimetric screen for apyrase inhibitors.

    PubMed

    Windsor, J B; Thomas, C; Hurley, L; Roux, S J; Lloyd, A M

    2002-11-01

    Apyrases are enzymes that efficiently hydrolyze ATP and ADP and may operate both inside and outside the cell. Although apyrases are important to a variety of cellular mechanisms and uses in industry, there are no available apyrase-specific inhibitors. Colorimetric assays based on the Fiske-Subbarow method for measuring inorganic phosphate are able to detect the release of inorganic phosphate from ATP and other nucleotides. We found that this type of assay could be automated and used to screen for apyrase-inhibiting compounds by assaying for a reduction in released phosphate in the presence of potential inhibitors. The automation of this assay allowed for the successful screening of a commercially available compound library. Several low molecular weight compounds were identified that, when used at micromolar concentrations, effectively inhibited apyrase activity.

  9. Colorimetric detection of copper and chloride in DMSO/H₂O media using bromopyrogallol red as a chemosensor with analytical applications.

    PubMed

    Tavallali, Hossein; Deilamy Rad, Gohar; Parhami, Abolfath; Abbasiyan, Elham

    2012-11-01

    We report bromopyrogallol red (BPR) as an easily available dye for detection of copper and chloride with distinct visual color changes in DMSO/H(2)O (9:1 v/v). The chemosensor has a high chromogenic selectivity for Cu(2+) over other cations with detection limit of 0.07 μg mL(-1). The obtained complex of Cu(2+) with BPR displayed ability to detect Cl(-) up to 0.79 μg mL(-1) in DMSO/H(2)O (9:1v/v) media over a large number of other anions. The linear dynamic ranges for the determinations of Cu(2+) and Cl(-) were 0.53-14.60 and 6.00-36.00 μg mL(-1), respectively. This receptor was successfully applied for the determination of Cl(-) and Cu(2+) in water samples.

  10. Can the Existence of Dark Energy be Directly Detected?

    SciTech Connect

    Perl, Martin L.; /SLAC /KIPAC, Menlo Park

    2011-11-23

    The majority of astronomers and physicists accept the reality of dark energy and also believe that it can only be studied indirectly through observation of the motions of stars and galaxies. In this paper I open the experimental question of whether it is possible to directly detect dark energy through the presence of dark energy density. Two thirds of this paper outlines the major aspects of dark energy density as now comprehended by the astronomical and physics community. The final third summarizes various proposals for direct detection of dark energy density or its possible effects. At this time I do not have a fruitful answer to the question: Can the Existence of Dark Energy Be Directly Detected?

  11. Global limits and interference patterns in dark matter direct detection

    SciTech Connect

    Catena, Riccardo; Gondolo, Paolo

    2015-08-13

    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  12. Direct detection of classically undetectable dark matter through quantum decoherence

    NASA Astrophysics Data System (ADS)

    Riedel, C. Jess

    2013-12-01

    Although various pieces of indirect evidence about the nature of dark matter have been collected, its direct detection has eluded experimental searches despite extensive effort. If the mass of dark matter is below 1 MeV, it is essentially imperceptible to conventional detection methods because negligible energy is transferred to nuclei during collisions. Here I propose directly detecting dark matter through the quantum decoherence it causes rather than its classical effects, such as recoil or ionization. I show that quantum spatial superpositions are sensitive to low-mass dark matter that is inaccessible to classical techniques. This provides new independent motivation for matter interferometry with large masses, especially on spaceborne platforms. The apparent dark matter wind we experience as the Sun travels through the Milky Way ensures interferometers and related devices are directional detectors, and so are able to provide unmistakable evidence that decoherence has Galactic origins.

  13. Monolayer g-C3N4 Fluorescent Sensor for Sensitive and Selective Colorimetric Detection of Silver ion from Aqueous Samples.

    PubMed

    Cao, Yujuan; Wu, Wei; Wang, Song; Peng, Hong; Hu, Xiaogang; Yu, Ying

    2016-03-01

    Rapid and sensitive detection of heavy-metal ions in natural water environments worldwide is urgently needed because of their severe threats to human health. In the present work, monolayer graphite-like flake C3N4 (g-C3N4) materials were applied as a new fluorescent sensor for the detection of trace silver ion in aqueous solution. The thickness of synthesized g-C3N4 was 0.45 nm and obtained by exfoliating twice with ultrasonic. With the presence of ethylene diamine tetraacetic acid as a screening agent, the highly sensitive sensor reached a low detection limit of 52.3 nmol/L for silver (I) ion and there was no disturbance when silver (I) ion coexisted with other metal ions in water samples. Under the optimal conditions, the monolayer g-C3N4 was successfully used to detect trace silver (I) ion in different environmental water and drinking water samples.

  14. Monolayer g-C3N4 Fluorescent Sensor for Sensitive and Selective Colorimetric Detection of Silver ion from Aqueous Samples.

    PubMed

    Cao, Yujuan; Wu, Wei; Wang, Song; Peng, Hong; Hu, Xiaogang; Yu, Ying

    2016-03-01

    Rapid and sensitive detection of heavy-metal ions in natural water environments worldwide is urgently needed because of their severe threats to human health. In the present work, monolayer graphite-like flake C3N4 (g-C3N4) materials were applied as a new fluorescent sensor for the detection of trace silver ion in aqueous solution. The thickness of synthesized g-C3N4 was 0.45 nm and obtained by exfoliating twice with ultrasonic. With the presence of ethylene diamine tetraacetic acid as a screening agent, the highly sensitive sensor reached a low detection limit of 52.3 nmol/L for silver (I) ion and there was no disturbance when silver (I) ion coexisted with other metal ions in water samples. Under the optimal conditions, the monolayer g-C3N4 was successfully used to detect trace silver (I) ion in different environmental water and drinking water samples. PMID:26753758

  15. Directed dynamical influence is more detectable with noise

    PubMed Central

    Jiang, Jun-Jie; Huang, Zi-Gang; Huang, Liang; Liu, Huan; Lai, Ying-Cheng

    2016-01-01

    Successful identification of directed dynamical influence in complex systems is relevant to significant problems of current interest. Traditional methods based on Granger causality and transfer entropy have issues such as difficulty with nonlinearity and large data requirement. Recently a framework based on nonlinear dynamical analysis was proposed to overcome these difficulties. We find, surprisingly, that noise can counterintuitively enhance the detectability of directed dynamical influence. In fact, intentionally injecting a proper amount of asymmetric noise into the available time series has the unexpected benefit of dramatically increasing confidence in ascertaining the directed dynamical influence in the underlying system. This result is established based on both real data and model time series from nonlinear ecosystems. We develop a physical understanding of the beneficial role of noise in enhancing detection of directed dynamical influence. PMID:27066763

  16. Maximum patch method for directional dark matter detection

    SciTech Connect

    Henderson, Shawn; Monroe, Jocelyn; Fisher, Peter

    2008-07-01

    Present and planned dark matter detection experiments search for WIMP-induced nuclear recoils in poorly known background conditions. In this environment, the maximum gap statistical method provides a way of setting more sensitive cross section upper limits by incorporating known signal information. We give a recipe for the numerical calculation of upper limits for planned directional dark matter detection experiments, that will measure both recoil energy and angle, based on the gaps between events in two-dimensional phase space.

  17. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    PubMed Central

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  18. Field-stepped direct detection electron paramagnetic resonance

    NASA Astrophysics Data System (ADS)

    Yu, Zhelin; Liu, Tengzhi; Elajaili, Hanan; Rinard, George A.; Eaton, Sandra S.; Eaton, Gareth R.

    2015-09-01

    The widest scan that had been demonstrated previously for rapid scan EPR was a 155 G sinusoidal scan. As the scan width increases, the voltage requirement across the resonating capacitor and scan coils increases dramatically and the background signal induced by the rapidly changing field increases. An alternate approach is needed to achieve wider scans. A field-stepped direct detection EPR method that is based on rapid-scan technology is now reported, and scan widths up to 6200 G have been demonstrated. A linear scan frequency of 5.12 kHz was generated with the scan driver described previously. The field was stepped at intervals of 0.01 to 1 G, depending on the linewidths in the spectra. At each field data for triangular scans with widths up to 11.5 G were acquired. Data from the triangular scans were combined by matching DC offsets for overlapping regions of successive scans. This approach has the following advantages relative to CW, several of which are similar to the advantages of rapid scan. (i) In CW if the modulation amplitude is too large, the signal is broadened. In direct detection field modulation is not used. (ii) In CW the small modulation amplitude detects only a small fraction of the signal amplitude. In direct detection each scan detects a larger fraction of the signal, which improves the signal-to-noise ratio. (iii) If the scan rate is fast enough to cause rapid scan oscillations, the slow scan spectrum can be recovered by deconvolution after the combination of segments. (iv) The data are acquired with quadrature detection, which permits phase correction in the post processing. (v) In the direct detection method the signal typically is oversampled in the field direction. The number of points to be averaged, thereby improving the signal-to-noise ratio, is determined in post processing based on the desired field resolution. A degased lithium phthalocyanine sample was used to demonstrate that the linear deconvolution procedure can be employed with

  19. Field-stepped direct detection electron paramagnetic resonance.

    PubMed

    Yu, Zhelin; Liu, Tengzhi; Elajaili, Hanan; Rinard, George A; Eaton, Sandra S; Eaton, Gareth R

    2015-09-01

    The widest scan that had been demonstrated previously for rapid scan EPR was a 155G sinusoidal scan. As the scan width increases, the voltage requirement across the resonating capacitor and scan coils increases dramatically and the background signal induced by the rapidly changing field increases. An alternate approach is needed to achieve wider scans. A field-stepped direct detection EPR method that is based on rapid-scan technology is now reported, and scan widths up to 6200G have been demonstrated. A linear scan frequency of 5.12kHz was generated with the scan driver described previously. The field was stepped at intervals of 0.01 to 1G, depending on the linewidths in the spectra. At each field data for triangular scans with widths up to 11.5G were acquired. Data from the triangular scans were combined by matching DC offsets for overlapping regions of successive scans. This approach has the following advantages relative to CW, several of which are similar to the advantages of rapid scan. (i) In CW if the modulation amplitude is too large, the signal is broadened. In direct detection field modulation is not used. (ii) In CW the small modulation amplitude detects only a small fraction of the signal amplitude. In direct detection each scan detects a larger fraction of the signal, which improves the signal-to-noise ratio. (iii) If the scan rate is fast enough to cause rapid scan oscillations, the slow scan spectrum can be recovered by deconvolution after the combination of segments. (iv) The data are acquired with quadrature detection, which permits phase correction in the post processing. (v) In the direct detection method the signal typically is oversampled in the field direction. The number of points to be averaged, thereby improving the signal-to-noise ratio, is determined in post processing based on the desired field resolution. A degased lithium phthalocyanine sample was used to demonstrate that the linear deconvolution procedure can be employed with field

  20. Eco-friendly plasmonic sensors: using the photothermal effect to prepare metal nanoparticle-containing test papers for highly sensitive colorimetric detection.

    PubMed

    Tseng, Shao-Chin; Yu, Chen-Chieh; Wan, Dehui; Chen, Hsuen-Li; Wang, Lon Alex; Wu, Ming-Chung; Su, Wei-Fang; Han, Hsieh-Cheng; Chen, Li-Chyong

    2012-06-01

    Convenient, rapid, and accurate detection of chemical and biomolecules would be a great benefit to medical, pharmaceutical, and environmental sciences. Many chemical and biosensors based on metal nanoparticles (NPs) have been developed. However, as a result of the inconvenience and complexity of most of the current preparation techniques, surface plasmon-based test papers are not as common as, for example, litmus paper, which finds daily use. In this paper, we propose a convenient and practical technique, based on the photothermal effect, to fabricate the plasmonic test paper. This technique is superior to other reported methods for its rapid fabrication time (a few seconds), large-area throughput, selectivity in the positioning of the NPs, and the capability of preparing NP arrays in high density on various paper substrates. In addition to their low cost, portability, flexibility, and biodegradability, plasmonic test paper can be burned after detecting contagious biomolecules, making them safe and eco-friendly.

  1. Copper-incorporated SBA-15 with peroxidase-like activity and its application for colorimetric detection of glucose in human serum.

    PubMed

    Mu, Jianshuai; He, Yun; Wang, Yan

    2016-01-01

    The copper incorporated SBA-15 (Cu-SBA-15) materials with different amount of Cu in framework were synthesized, and the products were characterized by X-ray diffraction (XRD), Fourier-transform infrared spectroscopy (FT-IR), scanning electron microscope (SEM), transmission electron microscope (TEM) and N2 adsorption/desorption. The Cu contents incorporated into the framework of SBA-15 were measured by inductively coupling plasma atomic emission spectrometer (ICP-AES). Cu-SBA-15 samples were found to exhibit the peroxidase-like activity, similar to the natural peroxidase. The effect of various parameters such as the content of Cu incorporated, pH and temperature on the peroxidase-like activity was studied. Based on the peroxidase-like activity, the Cu-SBA-15 was applied to the determination of H2O2. The linear range for detecting H2O2 was from 0.8 to 60mM with a detection limit of 3.7 µM. Coupled with glucose oxidase, the Cu-SBA-15 was successfully used for the determination of glucose with the linear range of 2-80 mM and a detection limit of 5.4 µM. The determination of glucose in human serum showed high accuracy, good reproducibility, as well as high selectivity against uric acid, ascorbic acid, dopamine and glucose analogs including fructose, maltose and lactose.

  2. Rapid onsite detection of bacterial spores of biothreat importance by paper-based colorimetric method using erbium-pyrocatechol violet complex.

    PubMed

    Shivakiran, M S; Venkataramana, M; Lakshmana Rao, P V

    2016-01-01

    Dipicolinic acid (DPA) is an important chemical marker for the detection of bacterial spores. In this study, complexes of lanthanide series elements such as erbium, europium, neodymium, and terbium were prepared with pyrocatechol violet and effectively immobilized the pyrocatechol violet (PV)-metal complex on a filter paper using polyvinyl alcohol. These filter paper strips were employed for the onsite detection of bacterial spores. The test filter papers were evaluated quantitatively with different concentrations of DPA and spores of various bacteria. Among the four lanthanide ions, erbium displayed better sensitivity than the other ions. The limit of detection of this test for DPA was 60 μM and 5 × 10(6) spores. The effect of other non-spore-forming bacteria and interfering chemicals on the test strips was also evaluated. The non-spore-forming bacteria did not have considerable effect on the test strip whereas chemicals such as EDTA had significant effects on the test results. The present test is rapid and robust, capable of providing timely results for better judgement to save resources on unnecessary decontamination procedures during false alarms.

  3. Selective turn-off phosphorescent and colorimetric detection of mercury(II) in water by half-lantern platinum(II) complexes.

    PubMed

    Sicilia, Violeta; Borja, Pilar; Baya, Miguel; Casas, José M

    2015-04-21

    The platinum(ii) half-lantern dinuclear complexes [{Pt(bzq)(μ-C7H4NS2-κN,S)}2] () and [{Pt(bzq)(μ-C7H4NOS-κN,S)}2] () [bzq = benzo[h]quinolinate, C7H4NS2 = 2-mercaptobenzothiazolate, C7H4NOS = 2-mercaptobenzoxazolate] in solution of DMSO-H2O undergo a dramatic color change from yellowish-orange to purple and turn-off phosphorescence in the presence of a small amount of Hg(2+), being discernible by the naked-eye and by spectroscopic methods. Other metal ions as Ag(+), Li(+), Na(+), K(+), Ca(2+), Mg(2+), Ba(2+), Pb(2+), Cd(2+), Zn(2+) and Tl(+) were tested and, even in a big excess, showed no interference in the selective detection of Hg(2+) in water. Job's plot analysis indicated a 1 : 1 stoichiometry in the complexation mode of Hg(2+) by /. The phosphorescence quenching attributed to the formation of [/ : Hg(2+)] complexes showed binding constants of K = 1.13 × 10(5) M(-1) () and K = 1.99 × 10(4) M(-1) (). The limit of detection has been also evaluated. In addition, dried paper test strips impregnated in DMSO solutions of and can detect concentration of Hg(2+) in water as low as 1 × 10(-5) M for and 5 × 10(-5) M for , making these complexes good candidates to be used as real-time Hg(2+) detectors. The nature of the interaction of the Pt2 half-lantern complex with the Hg(2+) cation, has been investigated by theoretical calculations.

  4. Selective turn-off phosphorescent and colorimetric detection of mercury(II) in water by half-lantern platinum(II) complexes.

    PubMed

    Sicilia, Violeta; Borja, Pilar; Baya, Miguel; Casas, José M

    2015-04-21

    The platinum(ii) half-lantern dinuclear complexes [{Pt(bzq)(μ-C7H4NS2-κN,S)}2] () and [{Pt(bzq)(μ-C7H4NOS-κN,S)}2] () [bzq = benzo[h]quinolinate, C7H4NS2 = 2-mercaptobenzothiazolate, C7H4NOS = 2-mercaptobenzoxazolate] in solution of DMSO-H2O undergo a dramatic color change from yellowish-orange to purple and turn-off phosphorescence in the presence of a small amount of Hg(2+), being discernible by the naked-eye and by spectroscopic methods. Other metal ions as Ag(+), Li(+), Na(+), K(+), Ca(2+), Mg(2+), Ba(2+), Pb(2+), Cd(2+), Zn(2+) and Tl(+) were tested and, even in a big excess, showed no interference in the selective detection of Hg(2+) in water. Job's plot analysis indicated a 1 : 1 stoichiometry in the complexation mode of Hg(2+) by /. The phosphorescence quenching attributed to the formation of [/ : Hg(2+)] complexes showed binding constants of K = 1.13 × 10(5) M(-1) () and K = 1.99 × 10(4) M(-1) (). The limit of detection has been also evaluated. In addition, dried paper test strips impregnated in DMSO solutions of and can detect concentration of Hg(2+) in water as low as 1 × 10(-5) M for and 5 × 10(-5) M for , making these complexes good candidates to be used as real-time Hg(2+) detectors. The nature of the interaction of the Pt2 half-lantern complex with the Hg(2+) cation, has been investigated by theoretical calculations. PMID:25781389

  5. Analysis of the theoretical bias in dark matter direct detection

    SciTech Connect

    Catena, Riccardo

    2014-09-01

    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias.

  6. Comparison of direct and heterodyne detection optical intersatellite communication links

    NASA Technical Reports Server (NTRS)

    Chen, C. C.; Gardner, C. S.

    1987-01-01

    The performance of direct and heterodyne detection optical intersatellite communication links are evaluated and compared. It is shown that the performance of optical links is very sensitive to the pointing and tracking errors at the transmitter and receiver. In the presence of random pointing and tracking errors, optimal antenna gains exist that will minimize the required transmitter power. In addition to limiting the antenna gains, random pointing and tracking errors also impose a power penalty in the link budget. This power penalty is between 1.6 to 3 dB for a direct detection QPPM link, and 3 to 5 dB for a heterodyne QFSK system. For the heterodyne systems, the carrier phase noise presents another major factor of performance degradation that must be considered. In contrast, the loss due to synchronization error is small. The link budgets for direct and heterodyne detection systems are evaluated. It is shown that, for systems with large pointing and tracking errors, the link budget is dominated by the spatial tracking error, and the direct detection system shows a superior performance because it is less sensitive to the spatial tracking error. On the other hand, for systems with small pointing and tracking jitters, the antenna gains are in general limited by the launch cost, and suboptimal antenna gains are often used in practice. In which case, the heterodyne system has a slightly higher power margin because of higher receiver sensitivity.

  7. Channel simulation for direct-detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.

    1974-01-01

    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct-detection optical communication system. The system is capable of providing signal fading statistics which obey log-normal, beta, Rayleigh, Ricean, or chi-square density functions. Experimental tests of the performance of the channel simulator are presented.

  8. Channel simulation for direct detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.

    1974-01-01

    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct detection optical communication system. The system is capable of providing signal fading statistics which obey log normal, beta, Rayleigh, Ricean or chi-squared density functions. Experimental tests of the performance of the Channel Simulator are presented.

  9. Halo-Independent Comparison of Direct Dark Matter Detection Data

    DOE PAGESBeta

    Del Nobile, Eugenio

    2014-01-01

    We review the halo-independent formalism that allows comparing data from different direct dark matter detection experiments without making assumptions on the properties of the dark matter halo. We apply this method to spin-independent WIMP-nuclei interactions, for both isospin-conserving and isospin-violating couplings, and to WIMPs interacting through an anomalous magnetic moment.

  10. Colorimetric Solid-Phase Extractor

    NASA Technical Reports Server (NTRS)

    2003-01-01

    The heart of a colorimetric solid phase extractor (CSPE) test kit quickly measures the concentration of the biocides silver or iodine in astronauts' drinking water to determine whether concentrations are safe. When 10 milliliters (ml) of water is drawn through the disk, the disk will turn color (yellow in this picture for iodine) indicating the presence of the biocides. The device could someday be used to test water safety at reservoirs and water treatment plants on Earth. (photo credit: Microanalytical Instrumentation Center, Iowa State University).

  11. Detection of Laser Optic Defects Using Gradient Direction Matching

    SciTech Connect

    Chen, B Y; Kegelmeyer, L M; Liebman, J A; Salmon, J T; Tzeng, J; Paglieroni, D W

    2005-12-14

    That National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) will be the world's largest and most energetic laser. It has thousands of optics and depends heavily on the quality and performance of these optics. Over the past several years, we have developed the NIF Optics Inspection Analysis System that automatically finds defects in a specific optic by analyzing images taken of that optic. This paper describes a new and complementary approach for the automatic detection of defects based on detecting the diffraction ring patterns in downstream optic images caused by defects in upstream optics. Our approach applies a robust pattern matching algorithm for images called Gradient Direction Matching (GDM). GDM compares the gradient directions (the direction of flow from dark to light) of pixels in a test image to those of a specified model and identifies regions in the test image whose gradient directions are most in line with those of the specified model. For finding rings, we use luminance disk models whose pixels have gradient directions all pointing toward the center of the disk. After GDM identifies potential rings locations, we rank these rings by how well they fit the theoretical diffraction ring pattern equation. We perform false alarm mitigation by throwing out rings of low fit. A byproduct of this fitting procedure is an estimate of the size of the defect and its distance from the image plane. We demonstrate the potential effectiveness of this approach by showing examples of rings detected in real images of NIF optics.

  12. Direct Detection of Sub-GeV Dark Matter

    SciTech Connect

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer

    2012-03-20

    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  13. Simple colorimetric method determines uranium in tissue

    NASA Technical Reports Server (NTRS)

    Doran, D.; Frigerio, N. A.

    1967-01-01

    Simple colorimetric micromethod determines concentrations of uranium in tissue. The method involves dry ashing organic extraction, and colorimetric determination of uranyl ferrocyanide. This uranium determination technique could be used in agricultural research, tracer studies, testing of food products, or medical research.

  14. An antenna for directional detection of WISPy dark matter

    NASA Astrophysics Data System (ADS)

    Jaeckel, Joerg; Redondo, Javier

    2013-11-01

    It is an intriguing possibility that the cold dark matter of the Universe may consist of very light and very weakly interacting particles such as axion(-like particles) and hidden photons. This opens up (but also requires) new techniques for direct detection. One possibility is to use reflecting surfaces to facilitate the conversion of dark matter into photons, which can be concentrated in a detector with a suitable geometry. In this note we show that this technique also allows for directional detection and inference of the full vectorial velocity spectrum of the dark matter particles. We also note that the non-vanishing velocity of dark matter particles is relevant for the conception of (non-directional) discovery experiments and outline relevant features.

  15. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo

    2015-07-20

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  16. Reliable detection of directional couplings using rank statistics.

    PubMed

    Chicharro, Daniel; Andrzejak, Ralph G

    2009-08-01

    To detect directional couplings from time series various measures based on distances in reconstructed state spaces were introduced. These measures can, however, be biased by asymmetries in the dynamics' structure, noise color, or noise level, which are ubiquitous in experimental signals. Using theoretical reasoning and results from model systems we identify the various sources of bias and show that most of them can be eliminated by an appropriate normalization. We furthermore diminish the remaining biases by introducing a measure based on ranks of distances. This rank-based measure outperforms existing distance-based measures concerning both sensitivity and specificity for directional couplings. Therefore, our findings are relevant for a reliable detection of directional couplings from experimental signals.

  17. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo

    2015-07-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  18. Highly selective colorimetric detection and preconcentration of Bi(III) ions by dithizone complexes anchored onto mesoporous TiO2

    PubMed Central

    2014-01-01

    We successfully developed a single-step detection and removal unit for Bi(III) ions based on dithizone (DZ) anchored on mesoporous TiO2 with rapid colorometric response and high selectivity for the first time. [(DZ)3-Bi] complex is easily separated and collected by mesoporous TiO2 as adsorbent and preconcentrator without any color change of the produced complex onto the surface of mesoporous TiO2 (TiO2-[(DZ)3-Bi]) at different Bi(III) concentrations. This is because highly potent mesoporous TiO2 architecture provides proficient channeling or movement of Bi(III) ions for efficient binding of metal ion, and the simultaneous excellent adsorbing nature of mesoporous TiO2 provides an extra plane for the removal of metal ions. PMID:24502680

  19. A novel colorimetric and turn-on fluorescent chemosensor for iron(III) ion detection and its application to cellular imaging

    NASA Astrophysics Data System (ADS)

    Luo, Aoheng; Wang, Hongqing; Wang, Yuyuan; Huang, Qiao; Zhang, Qin

    2016-11-01

    A novel rhodamine-based dual probe Rh-2 for trivalent ferric ions (Fe3 +) was successfully designed and synthesized, which exhibited a highly sensitive and selective recognition towards Fe3 + with an enhanced fluorescence emission in methanol-water media (v/v = 7/3, pH = 7.2). The probe Rh-2 could be applied to the determination of Fe3 + with a linear range covering from 3.0 × 10- 7 to 1.4 × 10- 5 M and a detection limit of 1.24 × 10- 8 M. Meanwhile, the binding ratio of Rh-2 and Fe3 + was found to be 1:1. Most importantly, the fluorescence and color signal changes of the Rh-2 solution were specific to Fe3 + over other commonly coexistent metal ions. Moreover, the probe Rh-2 has been used to image Fe3 + in living cells with satisfying results.

  20. Portable paper-based device for quantitative colorimetric assays relying on light reflectance principle.

    PubMed

    Li, Bowei; Fu, Longwen; Zhang, Wei; Feng, Weiwei; Chen, Lingxin

    2014-04-01

    This paper presents a novel paper-based analytical device based on the colorimetric paper assays through its light reflectance. The device is portable, low cost (<20 dollars), and lightweight (only 176 g) that is available to assess the cost-effectiveness and appropriateness of the original health care or on-site detection information. Based on the light reflectance principle, the signal can be obtained directly, stably and user-friendly in our device. We demonstrated the utility and broad applicability of this technique with measurements of different biological and pollution target samples (BSA, glucose, Fe, and nitrite). Moreover, the real samples of Fe (II) and nitrite in the local tap water were successfully analyzed, and compared with the standard UV absorption method, the quantitative results showed good performance, reproducibility, and reliability. This device could provide quantitative information very conveniently and show great potential to broad fields of resource-limited analysis, medical diagnostics, and on-site environmental detection.

  1. Colorimetric evaluation of display performance

    NASA Astrophysics Data System (ADS)

    Kosmowski, Bogdan B.

    2001-08-01

    The development of information techniques, using new technologies, physical phenomena and coding schemes, enables new application areas to be benefited form the introduction of displays. The full utilization of the visual perception of a human operator, requires the color coding process to be implemented. The evolution of displays, from achromatic (B&W) and monochromatic, to multicolor and full-color, enhances the possibilities of information coding, creating however a need for the quantitative methods of display parameter assessment. Quantitative assessment of color displays, restricted to photometric measurements of their parameters, is an estimate leading to considerable errors. Therefore, the measurements of a display's color properties have to be based on spectral measurements of the display and its elements. The quantitative assessment of the display system parameters should be made using colorimetric systems like CIE1931, CIE1976 LAB or LUV. In the paper, the constraints on the measurement method selection for the color display evaluation are discussed and the relations between their qualitative assessment and the ergonomic conditions of their application are also presented. The paper presents the examples of using LUV colorimetric system and color difference (Delta) E in the optimization of color liquid crystal displays.

  2. Incorporation of the fluoride induced Si-O bond cleavage and functionalized gold nanoparticle aggregation into one colorimetric probe for highly specific and sensitive detection of fluoride.

    PubMed

    Sun, Jie-Fang; Liu, Rui; Zhang, Zhong-Mian; Liu, Jing-Fu

    2014-04-11

    A highly selective and sensitive probe was developed for the field test of F(-) in environmental waters. The probe was fabricated by anchoring 4-mercaptopyridine (MPD) on AuNPs via Au-S interaction to form MPD-AuNPs, and further assembling 3-aminopropyltrimethoxysilane (APTMS) on the surface of MPD-AuNPs. The hydrolysis and cross-link of APTMS resulted in a thin monolayer of Si-O-Si protecting layer to encapsulated MPD-AuNPs. In the assay, F(-) reacted with Si-O bond and thus destroyed the outer protecting layer of the probe, and further triggered the aggregation of internal MPD-AuNPs by forming N-H-F hydrogen bond. The F(-) induced aggregation of functionalized AuNPs gave rise to significant solution color switch from red to blue, which facilitated visual assay of F(-) in the range of 1.0-7.0 μg mL(-1) by naked eyes. The probe is able to discriminate F(-) from a wide range of environmentally dominant ions, thus it can be applied to detect F(-) in drinkable water with satisfactory results that is agreed well with that of using ion chromatography.

  3. Direct immunoassay for detection of salmonellae in foods and feeds.

    PubMed

    Anderson, J M; Hartman, P A

    1985-05-01

    A direct enzyme immunoassay (EIA) with polyclonal antibodies was developed for detecting salmonellae in foods and feeds. Salmonella cells were attached firmly to the wells of polystyrene microtitration plates with a capture-antibody technique. Spicer-Edwards anti-H immunoglobulin G was bound to protein A-beta-D-galactosidase to serve as the signal; 4-methylumbelliferyl-beta-D-galactoside was used as the substrate. The sensitivity threshold was 10(7) cells per ml. Direct EIA, indirect EIA, and pure-culture techniques were compared by using 48 samples of naturally contaminated foods and feeds. The direct EIA was more sensitive than the indirect EIA or pure-culture technique. Food samples were analyzed within 3 working days, and 32 samples were tested simultaneously in a single 96-well microtitration plate. False-positive or false-negative results did not pose a problem. This direct EIA is sensitive, rapid, and amenable to automation.

  4. A Simple Paper-Based Colorimetric Device for Rapid Mercury(II) Assay.

    PubMed

    Chen, Weiwei; Fang, Xueen; Li, Hua; Cao, Hongmei; Kong, Jilie

    2016-01-01

    Contamination of the environment by mercury(II) ions (Hg(2+)) poses a serious threat to human health and ecosystems. Up to now, many reported Hg(2+) sensors require complex procedures, long measurement times and sophisticated instrumentation. We have developed a simple, rapid, low cost and naked-eye quantitative method for Hg(2+) environmental analysis using a paper-based colorimetric device (PCD). The sample solution to which platinum nanoparticles (PtNPs) have been added is dispensed to the detection zone on the PCD, where the 3,3,5,5-tetramethylbenzidine (TMB) substrate has been pre-loaded. The PtNPs effect a rapid oxidization of TMB, inducing blue colorization on the PCD. However, Hg(2+) in the solution rapidly interact with the PtNPs, suppressing the oxidation capacity and hence causing a decrease in blue intensity, which can be observed directly by the naked eye. Moreover, Hg(2+) at concentrations as low as 0.01 uM, can be successfully monitored using a fiber optic device, which gives a digital readout proportional to the intensity of the blue color change. This paper-based colorimetric device (PCD) shows great potential for field measurement of Hg(2+). PMID:27554633

  5. A Simple Paper-Based Colorimetric Device for Rapid Mercury(II) Assay

    PubMed Central

    Chen, Weiwei; Fang, Xueen; Li, Hua; Cao, Hongmei; Kong, Jilie

    2016-01-01

    Contamination of the environment by mercury(II) ions (Hg2+) poses a serious threat to human health and ecosystems. Up to now, many reported Hg2+ sensors require complex procedures, long measurement times and sophisticated instrumentation. We have developed a simple, rapid, low cost and naked-eye quantitative method for Hg2+ environmental analysis using a paper-based colorimetric device (PCD). The sample solution to which platinum nanoparticles (PtNPs) have been added is dispensed to the detection zone on the PCD, where the 3,3,5,5-tetramethylbenzidine (TMB) substrate has been pre-loaded. The PtNPs effect a rapid oxidization of TMB, inducing blue colorization on the PCD. However, Hg2+ in the solution rapidly interact with the PtNPs, suppressing the oxidation capacity and hence causing a decrease in blue intensity, which can be observed directly by the naked eye. Moreover, Hg2+ at concentrations as low as 0.01 uM, can be successfully monitored using a fiber optic device, which gives a digital readout proportional to the intensity of the blue color change. This paper-based colorimetric device (PCD) shows great potential for field measurement of Hg2+. PMID:27554633

  6. An Automated Directed Spectral Search Methodology for Small Target Detection

    NASA Astrophysics Data System (ADS)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  7. Hunting electroweakinos at future hadron colliders and direct detection experiments

    NASA Astrophysics Data System (ADS)

    di Cortona, Giovanni Grilli

    2015-05-01

    We analyse the mass reach for electroweakinos at future hadron colliders and their interplay with direct detection experiments. Motivated by the LHC data, we focus on split supersymmetry models with different electroweakino spectra. We find for example that a 100 TeV collider may explore Winos up to ˜ 7 TeV in low scale gauge mediation models or thermal Wino dark matter around 3 TeV in models of anomaly mediation with long-lived Winos. We show moreover how collider searches and direct detection experiments have the potential to cover large part of the parameter space even in scenarios where the lightest neutralino does not contribute to the whole dark matter relic density.

  8. Direct detection of CH/pi interactions in proteins.

    PubMed

    Plevin, Michael J; Bryce, David L; Boisbouvier, Jérôme

    2010-06-01

    XH/pi interactions make important contributions to biomolecular structure and function. These weakly polar interactions, involving pi-system acceptor groups, are usually identified from the three-dimensional structures of proteins. Here, nuclear magnetic resonance spectroscopy has been used to directly detect methyl/pi (Me/pi) interactions in proteins at atomic resolution. Density functional theory calculations predict the existence of weak scalar (J) couplings between nuclei involved in Me/pi interactions. Using an optimized isotope-labelling strategy, these J couplings have been detected in proteins using nuclear magnetic resonance spectroscopy. The resulting spectra provide direct experimental evidence of Me/pi interactions in proteins and allow a simple and unambiguous assignment of donor and acceptor groups. The use of nuclear magnetic resonance spectroscopy is an elegant way to identify and experimentally characterize Me/pi interactions in proteins without the need for arbitrary geometric descriptions or pre-existing three-dimensional structures. PMID:20489715

  9. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.

    2015-05-01

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  10. Dark matter effective field theory scattering in direct detection experiments

    DOE PAGESBeta

    Schneck, K.

    2015-05-01

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implicationsmore » of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.« less

  11. Directional detection of dark matter in universal bound states

    SciTech Connect

    Laha, Ranjan

    2015-10-06

    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angular recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.

  12. (In)Direct detection of boosted dark matter

    NASA Astrophysics Data System (ADS)

    Agashe, Kaustubh; Cui, Yanou; Necib, Lina; Thaler, Jesse

    2016-05-01

    We present a new multi-component dark matter model with a novel experimental signature that mimics neutral current interactions at neutrino detectors. In our model, the dark matter is composed of two particles, a heavier dominant component that annihilates to produce a boosted lighter component that we refer to as boosted dark matter. The lighter component is relativistic and scatters off electrons in neutrino experiments to produce Cherenkov light. This model combines the indirect detection of the dominant component with the direct detection of the boosted dark matter. Directionality can be used to distinguish the dark matter signal from the atmospheric neutrino background. We discuss the viable region of parameter space in current and future experiments.

  13. Dark matter effective field theory scattering in direct detection experiments

    NASA Astrophysics Data System (ADS)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.; SuperCDMS Collaboration

    2015-05-01

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  14. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  15. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  16. Physics from solar neutrinos in dark matter direct detection experiments

    NASA Astrophysics Data System (ADS)

    Cerdeño, David G.; Fairbairn, Malcolm; Jubb, Thomas; Machado, Pedro A. N.; Vincent, Aaron C.; Bœhm, Céline

    2016-05-01

    The next generation of dark matter direct detection experiments will be sensitive to both coherent neutrino-nucleus and neutrino-electron scattering. This will enable them to explore aspects of solar physics, perform the lowest energy measurement of the weak angle sin2 θ W to date, and probe contributions from new theories with light mediators. In this article, we compute the projected nuclear and electron recoil rates expected in several dark matter direct detection experiments due to solar neutrinos, and use these estimates to quantify errors on future measurements of the neutrino fluxes, weak mixing angle and solar observables, as well as to constrain new physics in the neutrino sector. Our analysis shows that the combined rates of solar neutrino events in second generation experiments (SuperCDMS and LZ) can yield a measurement of the pp flux to 2.5% accuracy via electron recoil, and slightly improve the 8B flux determination. Assuming a low-mass argon phase, projected tonne-scale experiments like DARWIN can reduce the uncertainty on both the pp and boron-8 neutrino fluxes to below 1%. Finally, we use current results from LUX, SuperCDMS and CDMSlite to set bounds on new interactions between neutrinos and electrons or nuclei, and show that future direct detection experiments can be used to set complementary constraints on the parameter space associated with light mediators.

  17. Direct detection of classically undetectable dark matter through quantum decoherence

    NASA Astrophysics Data System (ADS)

    Riedel, C. Jess

    2014-03-01

    Although various pieces of indirect evidence about the nature of dark matter have been collected, its direct detection has eluded experimental searches despite extensive effort. If the mass of dark matter is below 1 MeV, it is essentially imperceptible to conventional detection methods because negligible energy is transferred to nuclei during collisions. Here I propose directly detecting dark matter through the quantum decoherence it causes rather than its classical effects such as recoil or ionization. I show that quantum spatial superpositions are sensitive to low-mass dark matter which is inaccessible to classical techniques. This provides new independent motivation for matter interferometry with large masses, especially on spaceborne platforms. The apparent dark matter wind we experience as the Sun travels through the Milky Way ensures interferometers and related devices are directional detectors, and so are able to provide unmistakable evidence that decoherence has galactic origins. This research was partially supported by the U.S. Department of Energy through the LANL/LDRD program, and by the John Templeton Foundation through grant number 21484.

  18. Direct detection portals for self-interacting dark matter

    NASA Astrophysics Data System (ADS)

    Kaplinghat, Manoj; Tulin, Sean; Yu, Hai-Bo

    2014-02-01

    Dark matter self-interactions can affect the small scale structure of the Universe, reducing the central densities of dwarfs and low surface brightness galaxies in accord with observations. From a particle physics point of view, this points toward the existence of a 1-100 MeV particle in the dark sector that mediates self-interactions. Since mediator particles will generically couple to the Standard Model, direct detection experiments provide sensitive probes of self-interacting dark matter. We consider three minimal mechanisms for coupling the dark and visible sectors: photon kinetic mixing, Z boson mass mixing, and the Higgs portal. Self-interacting dark matter motivates a new benchmark paradigm for direct detection via momentum-dependent interactions, and ton-scale experiments will cover astrophysically motivated parameter regimes that are unconstrained by current limits. Direct detection is a complementary avenue to constrain velocity-dependent self-interactions that evade astrophysical bounds from larger scales, such as those from the bullet cluster.

  19. Direct Imaging Detectability of Tidally Heated ExoMoons (THEM)

    NASA Astrophysics Data System (ADS)

    Turner, E. L.; Peters, M. A.

    2014-03-01

    Existing and planned ground and space-based telescopes are capable of directly imaging plausible tidally heated exomoons orbiting gas-giant exoplanets. Tidally heated exomoons can easily be far more luminous than their host exoplanet and as much as 0.001 as bright as the system's stellar primary. Because emission from exomoons can be powered by tidal forces, their luminosities are independent of their separations from the system's stellar primary. Furthermore, high surface temperatures can occur in systems that are billions of years old. Tidally heated exomoons may thus be far easier targets for direct imaging studies than giant exoplanets that must be both young and at a large projected separation (typically at least tens of AU) from their primary to be accessible to direct imaging currently. For example, the (warm) Spitzer Space Telescope and the next generation of ground based instruments could detect an exomoon roughly the size of the Earth at a temperature of ~600 K and a distance ~5 parsecs in IR bands; in more favorable cases, detections are possible at distances of tens of parsecs. Future mid-infrared space telescopes, such as JWST and SPICA, will be capable of directly imaging tidally heated exomoons around the nearest two dozen stars with brightness temperatures of ~300 K and sizes similar to the Earth orbiting beyond 10 AU at a 5 sigma confidence level in a 10^4 second integration. It is also possible that some already imaged exoplanets are actually tidally heated exomoons or blends of such objects with hot young planets. If THEM exist and are sufficiently common (and thus nearby), it may be easier to directly image an exomoon with surface conditions that allow the existence of liquid water than it will be to resolve an Earth-like planet in the classical Habitable Zone of its primary. Preliminary results of a search for THEM in Spitzer archival images of nearby stars indicate that these data are sufficient to allow the detection of plausible THEM.

  20. (In)direct detection of boosted dark matter

    SciTech Connect

    Agashe, Kaustubh; Cui, Yanou; Necib, Lina; Thaler, Jesse E-mail: cuiyo@umd.edu E-mail: jthaler@mit.edu

    2014-10-01

    We initiate the study of novel thermal dark matter (DM) scenarios where present-day annihilation of DM in the galactic center produces boosted stable particles in the dark sector. These stable particles are typically a subdominant DM component, but because they are produced with a large Lorentz boost in this process, they can be detected in large volume terrestrial experiments via neutral-current-like interactions with electrons or nuclei. This novel DM signal thus combines the production mechanism associated with indirect detection experiments (i.e. galactic DM annihilation) with the detection mechanism associated with direct detection experiments (i.e. DM scattering off terrestrial targets). Such processes are generically present in multi-component DM scenarios or those with non-minimal DM stabilization symmetries. As a proof of concept, we present a model of two-component thermal relic DM, where the dominant heavy DM species has no tree-level interactions with the standard model and thus largely evades direct and indirect DM bounds. Instead, its thermal relic abundance is set by annihilation into a subdominant lighter DM species, and the latter can be detected in the boosted channel via the same annihilation process occurring today. Especially for dark sector masses in the 10 MeV–10 GeV range, the most promising signals are electron scattering events pointing toward the galactic center. These can be detected in experiments designed for neutrino physics or proton decay, in particular Super-K and its upgrade Hyper-K, as well as the PINGU/MICA extensions of IceCube. This boosted DM phenomenon highlights the distinctive signatures possible from non-minimal dark sectors.

  1. (In)direct detection of boosted dark matter

    NASA Astrophysics Data System (ADS)

    Agashe, Kaustubh; Cui, Yanou; Necib, Lina; Thaler, Jesse

    2014-10-01

    We initiate the study of novel thermal dark matter (DM) scenarios where present-day annihilation of DM in the galactic center produces boosted stable particles in the dark sector. These stable particles are typically a subdominant DM component, but because they are produced with a large Lorentz boost in this process, they can be detected in large volume terrestrial experiments via neutral-current-like interactions with electrons or nuclei. This novel DM signal thus combines the production mechanism associated with indirect detection experiments (i.e. galactic DM annihilation) with the detection mechanism associated with direct detection experiments (i.e. DM scattering off terrestrial targets). Such processes are generically present in multi-component DM scenarios or those with non-minimal DM stabilization symmetries. As a proof of concept, we present a model of two-component thermal relic DM, where the dominant heavy DM species has no tree-level interactions with the standard model and thus largely evades direct and indirect DM bounds. Instead, its thermal relic abundance is set by annihilation into a subdominant lighter DM species, and the latter can be detected in the boosted channel via the same annihilation process occurring today. Especially for dark sector masses in the 10 MeV-10 GeV range, the most promising signals are electron scattering events pointing toward the galactic center. These can be detected in experiments designed for neutrino physics or proton decay, in particular Super-K and its upgrade Hyper-K, as well as the PINGU/MICA extensions of IceCube. This boosted DM phenomenon highlights the distinctive signatures possible from non-minimal dark sectors.

  2. Superconducting Nuclear Recoil Sensor for Directional Dark Matter Detection

    NASA Astrophysics Data System (ADS)

    Junghans, Ann; Baldwin, Kevin; Hehlen, Markus; Lafler, Randy; Loomba, Dinesh; Phan, Nguyen; Weisse-Bernstein, Nina

    The Universe consists of 72% dark energy, 23% dark matter and only 5% of ordinary matter. One of the greatest challenges of the scientific community is to understand the nature of dark matter. Current models suggest that dark matter is made up of slowly moving, weakly interacting massive particles (WIMPs). But detecting WIMPs is challenging, as their expected signals are small and rare compared to the large background that can mimic the signal. The largest and most robust unique signature that sets them apart from other particles is the day-night variation of the directionality of dark matter on Earth. This modulation could be observed with a direction-sensitive detector and hence, would provide an unambiguous signature for the galactic origin of WIMPs. There are many studies underway to attempt to detect WIMPs both directly and indirectly, but solid-state WIMP detectors are widely unexplored although they would present many advantages to prevalent detectors that use large volumes of low pressure gas. We present first results of a novel multi-layered architecture, in which WIMPs would interact primarily with solid layers to produce nuclear recoils that then induce measureable voltage pulses in adjacent superconductor layers. This work was supported by the U.S. Department of Energy through the LANL Laboratory Directed Research and Development Program.

  3. Directional genomic hybridization for chromosomal inversion discovery and detection.

    PubMed

    Ray, F Andrew; Zimmerman, Erin; Robinson, Bruce; Cornforth, Michael N; Bedford, Joel S; Goodwin, Edwin H; Bailey, Susan M

    2013-04-01

    Chromosomal rearrangements are a source of structural variation within the genome that figure prominently in human disease, where the importance of translocations and deletions is well recognized. In principle, inversions-reversals in the orientation of DNA sequences within a chromosome-should have similar detrimental potential. However, the study of inversions has been hampered by traditional approaches used for their detection, which are not particularly robust. Even with significant advances in whole genome approaches, changes in the absolute orientation of DNA remain difficult to detect routinely. Consequently, our understanding of inversions is still surprisingly limited, as is our appreciation for their frequency and involvement in human disease. Here, we introduce the directional genomic hybridization methodology of chromatid painting-a whole new way of looking at structural features of the genome-that can be employed with high resolution on a cell-by-cell basis, and demonstrate its basic capabilities for genome-wide discovery and targeted detection of inversions. Bioinformatics enabled development of sequence- and strand-specific directional probe sets, which when coupled with single-stranded hybridization, greatly improved the resolution and ease of inversion detection. We highlight examples of the far-ranging applicability of this cytogenomics-based approach, which include confirmation of the alignment of the human genome database and evidence that individuals themselves share similar sequence directionality, as well as use in comparative and evolutionary studies for any species whose genome has been sequenced. In addition to applications related to basic mechanistic studies, the information obtainable with strand-specific hybridization strategies may ultimately enable novel gene discovery, thereby benefitting the diagnosis and treatment of a variety of human disease states and disorders including cancer, autism, and idiopathic infertility.

  4. Direct Real-Time Detection of Vapors from Explosive Compounds

    SciTech Connect

    Ewing, Robert G.; Clowers, Brian H.; Atkinson, David A.

    2013-10-03

    The real-time detection of vapors from low volatility explosives including PETN, tetryl, RDX and nitroglycerine along with various compositions containing these substances is demonstrated. This was accomplished with an atmospheric flow tube (AFT) using a non-radioactive ionization source and coupled to a mass spectrometer. Direct vapor detection was demonstrated in less than 5 seconds at ambient temperature without sample pre-concentration. The several seconds of residence time of analytes in the AFT provides a significant opportunity for reactant ions to interact with analyte vapors to achieve ionization. This extended reaction time, combined with the selective ionization using the nitrate reactant ions (NO3- and NO3-•HNO3), enables highly sensitive explosives detection. Observed signals from diluted explosive vapors indicate detection limits below 10 ppqv using selected ion monitoring (SIM) of the explosive-nitrate adduct at m/z 349, 378, 284 and 289 for tetryl, PETN, RDX and NG respectively. Also provided is a demonstration of the vapor detection from 10 different energetic formulations, including double base propellants, plastic explosives and commercial blasting explosives using SIM for the NG, PETN and RDX product ions.

  5. Direct Imaging Detectability of Tidally Heated ExoMoons (THEM)

    NASA Astrophysics Data System (ADS)

    Turner, Edwin L.; Peters, Mary Anne

    2013-07-01

    Existing and planned ground and space based telescopes are capable of directly imaging plausible tidally heated exomoons orbiting gas-giant exoplanets. Tidally heated exomoons can plausibly be far more luminous than their host exoplanet and as much as 0.001 as bright as the system's stellar primary. Because emission from exomoons can be powered by tidal forces, their luminosities are independent of their separations from the system's stellar primary. Furthermore, high surface temperatures can occur in systems that are billions of years old. Tidally heated exomoons may thus be far easier targets for direct imaging studies than giant exoplanets which must be both young and at a large projected separation (typically at least tens of AU) from their primary to be accessible to direct imaging currently. For example, the (warm) Spitzer Space Telescope and the next generation of ground based instruments could detect an exomoon roughly the size of the Earth at a temperature of ~600 K and a distance ~5 parsecs in IR bands; in more favorable cases, detections are possible at distances of tens of parsecs. Future mid-infrared space telescopes, such as JWST and SPICA, will be capable of directly imaging tidally heated exomoons around the nearest two dozen stars with brightness temperatures of ~300 K and sizes similar to the Earth orbiting beyond 10 AU at a 5 sigma confidence level in a 10^4 second integration. If such exomoons exist and are sufficiently common (and thus nearby), it may be easier to directly image an exomoon with surface conditions that allow the existence of liquid water than it will be to resolve an Earth-like planet in the classical Habitable Zone from its primary.

  6. Direct and indirect detection of dissipative dark matter

    SciTech Connect

    Fan, JiJi; Katz, Andrey; Shelton, Jessie E-mail: katz.andrey@gmail.com

    2014-06-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints.

  7. Auditory feature detection for stimuli presented from different directions

    NASA Astrophysics Data System (ADS)

    Bronkhorst, Adelbert W.; Townsend, James T.

    2002-05-01

    The processing of stimulus features by the visual system is commonly studied by measuring response times (RTs) for detection of targets presented with a varying number of distracters. In audition, however, interpretation of the interaction between target and distracters is complicated by effects like masking, binaural gain and fusion. In the present paradigm, which uses stimuli presented from different directions in the horizontal plane, these confounding effects were either minimized or kept constant. Targets were synthetic vowels and RTs were measured for detection of three features: F0, spectrum (type of vowel) and direction. Both single features and conjunctions were studied. Independent variables were the type of distracters (synthetic vowels or spectrally shaped noise) and their number. Results show that the effect of the number of distracters on the RT is smallest for the spectrum feature; RTs for the detection of F0 are largest and vary considerably across subjects. For conjunctions of features, the RTs lie, as expected, between the RTs for the single features. The effect of the type of distracter on the RT is small-this indicates that the processing involved in segregating vowels from noise is not more efficient than that used for segregating vowels from other vowels.

  8. Monthly modulation in dark matter direct-detection experiments

    SciTech Connect

    Britto, Vivian; Meyers, Joel E-mail: jmeyers@cita.utoronto.ca

    2015-11-01

    The signals in dark matter direct-detection experiments should exhibit modulation signatures due to the Earth's motion with respect to the Galactic dark matter halo. The annual and daily modulations, due to the Earth's revolution about the Sun and rotation about its own axis, have been explored previously. Monthly modulation is another such feature present in direct detection signals, and provides a nearly model-independent method of distinguishing dark matter signal events from background. We study here monthly modulations in detail for both WIMP and WISP dark matter searches, examining both the effect of the motion of the Earth about the Earth-Moon barycenter and the gravitational focusing due to the Moon. For WIMP searches, we calculate the monthly modulation of the count rate and show the effects are too small to be observed in the foreseeable future. For WISP dark matter experiments, we show that the photons generated by WISP to photon conversion have frequencies which undergo a monthly modulating shift which is detectable with current technology and which cannot in general be neglected in high resolution WISP searches.

  9. Clustering and community detection in directed networks: A survey

    NASA Astrophysics Data System (ADS)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis

    2013-12-01

    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  10. Optimetric system facilitates colorimetric and fluorometric measurements

    NASA Technical Reports Server (NTRS)

    Haley, F. C.

    1968-01-01

    Compact, unitary optimetric systems uses a single device for colorimetric, fluorometric and spectral absorption measurements. The basic element of the unitary systems is a test cell containing filter elements with uniquely fabricated lenses.

  11. Functional self-assembling bolaamphiphilic polydiacetylenes as colorimetric sensor scaffolds

    SciTech Connect

    Song, Jie; Cisar, Justin S.; Bertozzi, Carolyn R.

    2004-05-28

    Conjugated polymers capable of responding to external stimuli by changes in optical, electrical or electrochemical properties can be used for the construction of direct sensing devices. Polydiacetylene-based systems are attractive for sensing applications due to their colorimetric response to changes in the local environment. Here we present the design, preparation and characterization of self-assembling functional bolaamphiphilic polydiacetylenes (BPDAs) inspired by Nature's strategy for membrane stabilization. We show that by placing polar headgroups on both ends of the diacetylene lipids in a transmembranic fashion, and altering the chemical nature of the polar surface residues, the conjugated polymers can be engineered to display a range of radiation-, thermal- and pH-induced colorimetric responses. We observed dramatic nanoscopic morphological transformations accompanying charge-induced chromatic transitions, suggesting that both side chain disordering and main chain rearrangement play important roles in altering the effective conjugation lengths of the poly(ene-yne). These results establish the foundation for further development of BPDA-based colorimetric sensors.

  12. Colorimetric Coupled Enzyme Assay for Cystathionine β-Synthase.

    PubMed

    Rocchiccioli, Marco; Moschini, Roberta; Cappiello, Laura; Balestri, Francesco; Cappiello, Mario; Mura, Umberto; Del-Corso, Antonella

    2016-01-01

    A colorimetric coupled enzyme assay for the determination of cystathionine β-synthase activity is described. The method exploits cystathionine γ-lyase as an ancillary enzyme capable of transforming cystathionine, produced by cystathionine β-synthase, into cysteine. The cysteine is then spectrophotometrically detected at 560 nm, after its specific complexation with ninhydrin. This method was used to detect cystathionine β-synthase in crude extracts, and for the kinetic characterization of the enzyme partially purified from bovine kidney. A rapid two-step protocol is described for the partial purification of cystathionine γ-lyase from bovine kidney, aimed at a suitable and stable ancillary enzyme preparation. PMID:27506718

  13. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength.

    PubMed

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-01-01

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology. PMID:24694515

  14. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength

    PubMed Central

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-01-01

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology. PMID:24694515

  15. Optical filtering in directly modulated/detected OOFDM systems.

    PubMed

    Sánchez, C; Ortega, B; Wei, J L; Capmany, J

    2013-12-16

    This work presents a theoretical investigation on the performance of directly modulated/detected (DM/DD) optical orthogonal frequency division multiplexed (OOFDM) systems subject to optical filtering. The impact of both linear and nonlinear distortion effects are taken into account to calculate the effective signal-to-noise ratio of each subcarrier. These results are then employed to optimize the design parameters of two simple optical filtering structures: a Mach Zehnder interferometer and a uniform fiber Bragg grating, leading to a significant optical power budget improvement given by 3.3 and 3dB, respectively. These can be further increased to 5.5 and 4.2dB respectively when balanced detection configurations are employed. We find as well that this improvement is highly dependent on the clipping ratio. PMID:24514636

  16. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength.

    PubMed

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-01-01

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology.

  17. Detecting tubular structures via direct vector field singularity characterization.

    PubMed

    Cabuk, Aytekin D; Alpay, Erdenay; Acar, Burak

    2010-01-01

    The initial step of vessel segmentation in 3D is the detection of vessel centerlines. The proposed methods in literature are either dependent on vessel radius and/or have low response at vessel bifurcations. In this paper we propose a 3D tubular structure detection method that removes these two drawbacks. The proposed method exploits the observations on the eigenvalues of the Hessian matrix as is done in literature, yet it employs a direct 3D vector field singularity characterization. The Gradient Vector Flow vector field is used and the eigenvalues of its Jacobian are exploited in computing a parameter free vesselness map. Results on phantom and real patient data exhibit robustness to scale, high response at vessel bifurcations, and good noise/non-vessel structure suppression.

  18. Direct/indirect detection signatures of nonthermally produced dark matter

    SciTech Connect

    Nagai, Minoru; Nakayama, Kazunori

    2008-09-15

    We study direct and indirect detection possibilities of neutralino dark matter produced nonthermally by, e.g., the decay of long-lived particles, as is easily implemented in the case of anomaly or mirage-mediation models. In this scenario, large self-annihilation cross sections are required to account for the present dark matter abundance, and it leads to significant enhancement of the gamma-ray signature from the galactic center and the positron flux from the dark matter annihilation. It is found that GLAST and PAMELA will find the signal or give tight constraints on such nonthermal production scenarios of neutralino dark matter.

  19. Direct detection of the 229Th nuclear clock transition

    NASA Astrophysics Data System (ADS)

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B.; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E.; Trautmann, Norbert G.; Thirolf, Peter G.

    2016-05-01

    Today’s most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of 229Th (denoted 229mTh). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for 229mTh2+. More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard.

  20. Directional detection of dark matter in universal bound states

    DOE PAGESBeta

    Laha, Ranjan

    2015-10-06

    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angularmore » recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.« less

  1. Direct detection of the (229)Th nuclear clock transition.

    PubMed

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E; Trautmann, Norbert G; Thirolf, Peter G

    2016-05-01

    Today's most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of (229)Th (denoted (229m)Th). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for (229m)Th(2+). More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard. PMID:27147026

  2. Direct detection of the (229)Th nuclear clock transition.

    PubMed

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E; Trautmann, Norbert G; Thirolf, Peter G

    2016-05-01

    Today's most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of (229)Th (denoted (229m)Th). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for (229m)Th(2+). More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard.

  3. Photoacoustic and Colorimetric Visualization of Latent Fingerprints.

    PubMed

    Song, Kai; Huang, Peng; Yi, Chenglin; Ning, Bo; Hu, Song; Nie, Liming; Chen, Xiaoyuan; Nie, Zhihong

    2015-12-22

    There is a high demand on a simple, rapid, accurate, user-friendly, cost-effective, and nondestructive universal method for latent fingerprint (LFP) detection. Herein, we describe a combination imaging strategy for LFP visualization with high resolution using poly(styrene-alt-maleic anhydride)-b-polystyrene (PSMA-b-PS) functionalized gold nanoparticles (GNPs). This general approach integrates the merits of both colorimetric imaging and photoacoustic imaging. In comparison with the previous methods, our strategy is single-step and does not require the signal amplification by silver staining. The PSMA-b-PS functionalized GNPs have good stability, tunable color, and high affinity for universal secretions (proteins/polypeptides/amino acids), which makes our approach general and flexible for visualizing LFPs on different substrates (presumably with different colors) and from different people. Moreover, the unique optical property of GNPs enables the photoacoustic imaging of GNPs-deposited LFPs with high resolution. This allows observation of level 3 hyperfine features of LFPs such as the pores and ridge contours by photoacoustic imaging. This technique can potentially be used to identify chemicals within LFP residues. We believe that this dual-modality imaging of LFPs will find widespread use in forensic investigations and medical diagnostics. PMID:26528550

  4. Photoacoustic and Colorimetric Visualization of Latent Fingerprints.

    PubMed

    Song, Kai; Huang, Peng; Yi, Chenglin; Ning, Bo; Hu, Song; Nie, Liming; Chen, Xiaoyuan; Nie, Zhihong

    2015-12-22

    There is a high demand on a simple, rapid, accurate, user-friendly, cost-effective, and nondestructive universal method for latent fingerprint (LFP) detection. Herein, we describe a combination imaging strategy for LFP visualization with high resolution using poly(styrene-alt-maleic anhydride)-b-polystyrene (PSMA-b-PS) functionalized gold nanoparticles (GNPs). This general approach integrates the merits of both colorimetric imaging and photoacoustic imaging. In comparison with the previous methods, our strategy is single-step and does not require the signal amplification by silver staining. The PSMA-b-PS functionalized GNPs have good stability, tunable color, and high affinity for universal secretions (proteins/polypeptides/amino acids), which makes our approach general and flexible for visualizing LFPs on different substrates (presumably with different colors) and from different people. Moreover, the unique optical property of GNPs enables the photoacoustic imaging of GNPs-deposited LFPs with high resolution. This allows observation of level 3 hyperfine features of LFPs such as the pores and ridge contours by photoacoustic imaging. This technique can potentially be used to identify chemicals within LFP residues. We believe that this dual-modality imaging of LFPs will find widespread use in forensic investigations and medical diagnostics.

  5. The Direct Detectability of Giant Exoplanets in the Optical

    NASA Astrophysics Data System (ADS)

    Greco, Johnny P.; Burrows, Adam

    2015-08-01

    Motivated by the possibility that a coronagraph will be put on the Wide-field Infrared Survey Telescope (WFIRST)/Astrophysics Focused Telescope Assets (AFTA), we explore the direct detectability of extrasolar giant planets (EGPs) in the optical. We quantify a planet's detectability by the fraction of its orbit for which it is in an observable configuration ({f}{obs}). Using a suite of Monte Carlo experiments, we study the dependence of {f}{obs} upon the inner working angle (IWA) and minimum achievable contrast ({C}{min}) of the direct-imaging observatory; the planet's phase function, geometric albedo, single-scattering albedo, radius, and distance from Earth; and the semimajor axis distribution of EGPs. We calculate phase functions for a given geometric or single-scattering albedo, assuming various scattering mechanisms. We find that the Lambertian phase function can predict significantly larger {f}{obs}s with respect to the more realistic Rayleigh phase function. For observations made with WFIRST/AFTA's baseline capabilities ({C}{min}∼ {10}-9, {IWA}∼ 0\\buildrel{\\prime\\prime}\\over{.} 2), Jupiter-like planets orbiting stars within 10, 30, and 50 pc of Earth have volume-averaged observability fractions of ∼12%, 3%, and 0.5%, respectively. At 10 pc, such observations yield {f}{obs}\\gt 1% for low- to modest-eccentricity planets with semimajor axes in the range ∼2–10 AU. If {C}{min}={10}-10, this range extends to ∼35 AU. We find that, in all but the most optimistic configurations, the probability for detection in a blind search is low (< 5%). However, with orbital parameter constraints from long-term radial-velocity campaigns and Gaia astrometry, the tools we develop in this work can be used to determine both the most promising systems to target and when to observe them.

  6. Understanding WIMP-baryon interactions with direct detection: a roadmap

    SciTech Connect

    Gluscevic, Vera; Peter, Annika H.G. E-mail: apeter@physics.osu.edu

    2014-09-01

    We study prospects of dark-matter direct-detection searches for probing non-relativistic effective theory for WIMP-baryon scattering. We simulate a large set of noisy recoil-energy spectra for different scattering scenarios (beyond the standard momentum-independent contact interaction), for Generation 2 and futuristic experiments. We analyze these simulations and quantify the probability of successfully identifying the operator governing the scattering, if a WIMP signal is observed. We find that the success rate depends on a combination of factors: the WIMP mass, the mediator mass, the type of interaction, and the experimental energy window. For example, for a 20 GeV WIMP, Generation 2 is only likely to identify the right operator if the interaction is Coulomb-like, and is unlikely to do so in any other case. For a WIMP with a mass of 200 GeV or higher, success is almost guaranteed. We also find that, regardless of the scattering model and the WIMP parameters, a single Generation 2 experiment is unlikely to successfully discern the momentum dependence of the underlying operator on its own, but prospects improve drastically when experiments with different target materials and energy windows are analyzed jointly. Furthermore, we examine the quality of parameter estimation and degeneracies in the multi-dimensional parameter space of the effective theory. We find in particular that the resulting WIMP mass estimates can be severely biased if data are analyzed assuming the standard (momentum-independent) operator while the actual operator has momentum-dependence. Finally, we evaluate the ultimate reach of direct detection, finding that the prospects for successful operator selection prior to reaching the irreducible backgrounds are excellent, if the signal is just below the current limits, but slim if Generation 2 does not report WIMP detection.

  7. Passive, Direct-Read Monitoring System for Selective Detection and Quantification of Hydrogen Chloride

    NASA Technical Reports Server (NTRS)

    Chapman, K. B.; Mihaylov, G. M.; Kirollos, K. S.

    2000-01-01

    Monitoring the exposure of an employee to hydrogen chloride or hydrochloric acid in the presence of other acids has been a challenge to the industrial hygiene community. The capability of a device to differentiate the levels of acid vapors would allow for more accurate determinations of exposure and therefore improved occupational health. In this work, a selective direct-read colorimetric badge system was validated for Short Term Exposure Limit (STEL) monitoring of hydrogen chloride. The passive colorimetric badge system consists of a direct reading badge and a color scale. The badge has a coated indicator layer with a diffusive resistance in the shape of an exclamation mark. An exclamation mark will appear if hydrogen chloride is present in the atmosphere at concentrations at or above 2.0 ppm. By using the color scale, the intensity of the color formed on the badge can be further quantified up to 25 ppm. The system was validated according to a protocol based on the NIOSH Protocol for the Evaluation of Passive Monitors. The badge was exposed to relative humidities ranging from 11% to 92%, temperatures ranging from 7 C to 400 C and air velocities ranging from 5 cm/sec to 170 cm/sec. All experiments were conducted in a laboratory vapor generation system. Hydrofluoric acid, nitric acid, sulfuric acid, chlorine, hydrogen sulfide and organic acids showed no effect on the performance of the hydrogen chloride monitoring system. The passive badge and color scale system exceeded the accuracy requirements as defined by NIOSH. At ambient conditions, the mean coefficient of variation was 10.86 and the mean bias was 1.3%. This data was presented previously at the American Industrial Hygiene Conference and Exposition in Toronto, Canada in June 1999.

  8. Development of a novel gamma probe for detecting radiation direction

    NASA Astrophysics Data System (ADS)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  9. Isothermal Detection of Mycoplasma pneumoniae Directly from Respiratory Clinical Specimens

    PubMed Central

    Petrone, Brianna L.; Wolff, Bernard J.; DeLaney, Alexandra A.; Diaz, Maureen H.

    2015-01-01

    Mycoplasma pneumoniae is a leading cause of community-acquired pneumonia (CAP) across patient populations of all ages. We have developed a loop-mediated isothermal amplification (LAMP) assay that enables rapid, low-cost detection of M. pneumoniae from nucleic acid extracts and directly from various respiratory specimen types. The assay implements calcein to facilitate simple visual readout of positive results in approximately 1 h, making it ideal for use in primary care facilities and resource-poor settings. The analytical sensitivity of the assay was determined to be 100 fg by testing serial dilutions of target DNA ranging from 1 ng to 1 fg per reaction, and no cross-reactivity was observed against 17 other Mycoplasma species, 27 common respiratory agents, or human DNA. We demonstrated the utility of this assay by testing nucleic acid extracts (n = 252) and unextracted respiratory specimens (n = 72) collected during M. pneumoniae outbreaks and sporadic cases occurring in the United States from February 2010 to January 2014. The sensitivity of the LAMP assay was 88.5% tested on extracted nucleic acid and 82.1% evaluated on unextracted clinical specimens compared to a validated real-time PCR test. Further optimization and improvements to this method may lead to the availability of a rapid, cost-efficient laboratory test for M. pneumoniae detection that is more widely available to primary care facilities, ultimately facilitating prompt detection and appropriate responses to potential M. pneumoniae outbreaks and clusters within the community. PMID:26179304

  10. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}−g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-til-tilde(p{sub R}). The entire family of conventional halo-independent g-tilde(v{sub min}) plots for all DM masses are directly found from the single h-tilde(p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde(p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde(v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  11. Halo-independent direct detection analyses without mass assumptions

    DOE PAGESBeta

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR),more » the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.« less

  12. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew E-mail: pjfox@fnal.gov E-mail: matthew.mccullough@cern.ch

    2015-10-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}− g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-tilde (p{sub R}). The entire family of conventional halo-independent g-tilde (v{sub min}) plots for all DM masses are directly found from the single h-tilde (p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde (p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde (v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  13. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  14. Nanoparticle-catalyzed reductive bleaching for fabricating turn-off and enzyme-free amplified colorimetric bioassays.

    PubMed

    Li, Wei; Qiang, Weibing; Li, Jie; Li, Hui; Dong, Yifan; Zhao, Yaju; Xu, Danke

    2014-01-15

    Nanoparticle-catalyzed reductive bleaching reactions of colored substrates are emerging as a class of novel indicator reactions for fabricating enzyme-free amplified colorimetric biosensing (turn-off mode), which are exactly opposite to the commonly used oxidative coloring processes of colorless substrates in traditional enzyme-catalyzed amplified colorimetric bioassays (turn-on mode). In this work, a simple theoretical analysis shows that the sensitivity of this colorimetric bioassay can be improved by increasing the amplification factor (kcatΔt), or enhancing the binding affinity between analyte and receptor (Kd), or selecting the colored substrates with high extinction coefficients (ε). Based on this novel strategy, we have developed a turn-off and cost-effective amplified colorimetric thrombin aptasensor. This aptasensor made full use of sandwich binding of two affinity aptamers for increased specificity, magnetic particles for easy separation and enrichment, and gold nanoparticle (AuNP)-catalyzed reductive bleaching reaction to generate the amplified colorimetric signal. With 4-nitrophenol (4-NP) as the non-dye colored substrate, colorimetric bioassay of thrombin was achieved by the endpoint method with a detection limit of 91pM. In particular, when using methylene blue (MB) as the substrate, for the first time, a more convenient and efficient kinetic-based colorimetric thrombin bioassay was achieved without the steps of acidification termination and magnetic removal of particles, with a low detection limit of 10pM, which was superior to the majority of the existing colorimetric thrombin aptasensors. The proposed colorimetric protocol is expected to hold great promise in field analysis and point-of-care applications.

  15. Gold nanoparticles based colorimetric nanodiagnostics for cancer and infectious diseases

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Persano, Stefano; Cecere, Paola; Sabella, Stefania; Pompa, Pier Paolo

    2014-03-01

    Traditional in vitro diagnostics requires specialized laboratories and costly instrumentation, both for the amplification of nucleic acid targets (usually achieved by PCR) and for the assay readout, often based on fluorescence. We are developing hybrid nanomaterials-based sensors for the rapid and low-cost diagnosis of various disease biomarkers, for applications in portable platforms for diagnostics at the point-of-care. To this aim, we exploited the size and distancedependent optical properties of gold nanoparticles (AuNPs) to achieve colorimetric detection. Moreover, in order to avoid the complexity of thermal cycles associated to traditional PCR, the design of our systems includes signal amplification schemes, achieved by the use of enzymes (nucleases, helicase) or DNAzymes. Focused on instrument-free and sensitive detection, we carefully combined the intrinsic sensitivity by multivalency of functionalized AuNPs with isothermal and non-stringent enzyme-aided reaction conditions, controlled AuNPs aggregates, universal reporters and magnetic microparticles, the latter used both as a substrate and as a means for the colorimetric detection. We obtained simple and robust assays for the sensitive (pM range or better) naked-eye detection of cancer or infectious diseases (HPV, HCV) biomarkers, requiring no instrumentation except for a simple heating plate. Finally, we are also developing non-medical applications of these bio-nanosensors, such as in the development of on-field rapid tests for the detection of pollutants and other food and water contaminants.

  16. Neutralino Dark Matter: Update on Direct and Indirect Detection

    SciTech Connect

    Scopel, S.

    2005-12-02

    Neutralinos represent a viable solution to the Dark Matter problem. In particular, while I discuss here a wide range for their masses, I will deserve a special attention to light neutralinos, which arise in supersymmetric models without unifications conditions of gaugino masses at the GUT scale. They have sizeable direct and indirect detection signals, which are bounded from below by the cosmological constraint on their relic abundance, but are not yet excluded by present direct and indirect searches, including limits coming from the BR(Bs {yields} {mu}+ + {mu}-) decay rate. They represent so an interesting experimental challenge. An intriguing aspect of light neutralinos is also that they could explain the DAMA modulation effect in a still existing compatibility window with other direct search experiments. I also discuss the gamma-ray signal from dark matter annihilation in our Galaxy and give some examples of external objects, namely the Andromeda Galaxy (M31) and M87. Predictions for the fluxes turn out to be below the level required to explain the possible indications of a {gamma}-ray excess shown by EGRET, CANGAROO-II and HESS (toward the Galactic Center) and HEGRA (from M87). As far as future experiments are concerned, only the signal from the galactic center could be accessible to both satellite-borne experiments and to ACTs, even though this requires very steep dark matter density profiles.

  17. Tropospheric Wind Profile Measurements with a Direct Detection Doppler Lidar

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce M.; Li, Steven X.; Korb, C. Laurence; Chen, Huailin; Mathur, Savyasachee

    1998-01-01

    Research has established the importance of global tropospheric wind measurements for large scale improvements in numerical weather prediction. In addition, global wind measurements provide data that are fundamental to the understanding and prediction of global climate change. These tasks are closely linked with the goals of the NASA Earth Science Enterprise and Global Climate Change programs. NASA Goddard has been actively involved in the development of direct detection Doppler lidar methods and technologies to meet the wind observing needs of the atmospheric science community. In this paper we describe a recently developed prototype wind lidar system using a direct detection Doppler technique for measuring wind profiles from the surface through the troposphere. This system uses a pulsed ND:YAG laser operating at 1064 nm as the transmitter. The laser pulse is directed to the atmosphere using a 40 cm diameter scan mirror. The portion of the laser energy backscattered from aerosols and molecules is collected by a 40 cm diameter telescope and coupled via fiber optics into the Doppler receiver. Single photon counting APD's are used to detect the atmospheric backscattered signal. The principle element of the receiver is a dual bandpass tunable Fabry Perot etalon which analyzes the Doppler shift of the incoming laser signal using the double edge technique. The double edge technique uses two high resolution optical filters having bandpasses offset relative to one another such that the 'edge' of the first filter's transmission function crosses that of the second at the half power point. The outgoing laser frequency is located approximately at the crossover point. Due to the opposite going slopes of the edges, a Doppler shift in the atmospheric backscattered laser frequency produces a positive change in signal for one filter and a negative change in the second filter. Taking the ratio of the two edge channel signals yields a result which is directly proportional to the

  18. Direct Testing of Blood Cultures for Detection of Streptococcal Antigens

    PubMed Central

    Wetkowski, Maryellen A.; Peterson, Ellena M.; De La Maza, Luis M.

    1982-01-01

    A direct, rapid, and simple method for the detection of streptococcal antigens of Lancefield groups A, B, C, D, and G from blood cultures was developed by using a coagglutination test. Fifty-five clinical specimens and 117 simulated blood cultures containing gram-positive cocci were tested. Out of 6,261 clinical blood cultures screened, 55 cultures from 53 patients were positive, with organisms resembling streptococci, by Gram stain. Of these cultures, 78% (43 of 55) were pure cultures of streptococci, and 22% (12 of 55) were mixed with at least one other organism. Of the 43 pure cultures only, correct reactions were obtained (grouping correctly or giving no cross-reactions, or both) with 86% (37 of 43) of the isolates, 12% (5 of 43) exhibited cross-reactions, and 2% (1 of 43) gave false-negative reactions. All of the cross-reacting isolates were Streptococcus pneumoniae, which reacted with the group C reagent, and the false-negative reaction occurred with a Streptococcus bovis isolate. However, by using a direct modified bile solubility test, the correct identification of the S. pneumoniae isolates was obtained. Therefore, by using the modified bile solubility test in conjunction with the direct grouping method, 98% (42 of 43) of the isolates in pure culture could be identified accurately and rapidly after the detection of a positive Gram stain. Correct grouping reactions were obtained with 83% (10 of 12) of the mixed blood cultures, and false-negative results occurred with 17% (2 of 12) of them. Both cultures contained an enterococcus and a gram-negative rod. Of the 117 simulated blood cultures, there was only one incorrect grouping reaction; this occurred with an S. bovis isolate that cross-reacted with the group C reagent. The direct grouping reaction was positive when blood cultures contained a minimum of 1 × 108 to 8 × 108 colony-forming units per ml. In general, this procedure provided information on the identification of the organism 24 h earlier than by

  19. Direct-detection wind lidar operating with a multimode laser.

    PubMed

    Bruneau, Didier; Blouzon, Frédéric; Spatazza, Joseph; Montmessin, Franck; Pelon, Jacques; Faure, Benoît

    2013-07-10

    A direct-detection wind lidar that operates with a multimode laser has been developed and tested. The instrument exploits the light backscattered by particles using a Mach-Zehnder interferometer with an optical path difference matched to the free spectral range of the laser longitudinal modes. In addition to requiring no monomodal emission, the system requires no frequency locking between the interferometer and the laser. We report laboratory and atmospheric measurements that show that the lidar is capable of measuring the radial wind velocity with a systematic error lower than 1 ms(-1) and a random error lower than 2 ms(-1) for a signal-to-noise ratio of 100. The development is motivated by the possibility to probe wind with a compact system in planetary atmospheres.

  20. Magnetic Bead-Based Colorimetric Immunoassay for Aflatoxin B1 Using Gold Nanoparticles

    PubMed Central

    Wang, Xu; Niessner, Reinhard; Knopp, Dietmar

    2014-01-01

    A competitive colorimetric immunoassay for the detection of aflatoxin B1 (AFB) has been established using biofunctionalized magnetic beads (MBs) and gold nanoparticles (GNPs). Aflatoxin B1-bovine serum albumin conjugates (AFB-BSA) modified MBs were employed as capture probe, which could specifically bind with GNP-labeled anti-AFB antibodies through immunoreaction, while such specific binding was competitively inhibited by the addition of AFB. After magnetic separation, the supernatant solution containing unbound GNPs was directly tested by UV-Vis spectroscopy. The absorption intensity was directly proportional to the AFB concentration. The influence of GNP size, incubation time and pH was investigated in detail. After optimization, the developed method could detect AFB in a linear range from 20 to 800 ng/L, with the limit of detection at 12 ng/L. The recoveries for spiked maize samples ranged from 92.8% to 122.0%. The proposed immunoassay provides a promising approach for simple, rapid, specific and cost-effective detection of toxins in the field of food safety. PMID:25405511

  1. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    NASA Astrophysics Data System (ADS)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  2. Single molecule detection of direct, homologous, DNA/DNA pairing

    PubMed Central

    Danilowicz, C.; Lee, C. H.; Kim, K.; Hatch, K.; Coljee, V. W.; Kleckner, N.; Prentiss, M.

    2009-01-01

    Using a parallel single molecule magnetic tweezers assay we demonstrate homologous pairing of two double-stranded (ds) DNA molecules in the absence of proteins, divalent metal ions, crowding agents, or free DNA ends. Pairing is accurate and rapid under physiological conditions of temperature and monovalent salt, even at DNA molecule concentrations orders of magnitude below those found in vivo, and in the presence of a large excess of nonspecific competitor DNA. Crowding agents further increase the reaction rate. Pairing is readily detected between regions of homology of 5 kb or more. Detected pairs are stable against thermal forces and shear forces up to 10 pN. These results strongly suggest that direct recognition of homology between chemically intact B-DNA molecules should be possible in vivo. The robustness of the observed signal raises the possibility that pairing might even be the “default” option, limited to desired situations by specific features. Protein-independent homologous pairing of intact dsDNA has been predicted theoretically, but further studies are needed to determine whether existing theories fit sequence length, temperature, and salt dependencies described here. PMID:19903884

  3. Subcarrier multiplexing with dispersion reduction and direct detection

    DOEpatents

    Sargis, Paul D.; Haigh, Ronald E.; McCammon, Kent G.

    1997-01-01

    An SCM system for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream.

  4. Direct x-ray detection with conjugated polymer devices

    NASA Astrophysics Data System (ADS)

    Boroumand, F. A.; Zhu, M.; Dalton, A. B.; Keddie, J. L.; Sellin, P. J.; Gutierrez, J. J.

    2007-07-01

    The authors report the first direct detection of x-ray induced photocurrents in thick films (up to 20μm) of conjugated polymers. Schottky-based "sandwich" structures were fabricated from layers of either poly[1-methoxy-4-(2-ethylhexyloxy)-phenylenevinylene] (MEH-PPV) or poly(9,9-dioctylfluorene) (PFO) on indium tin oxide substrates using a top contact of aluminum. Good rectification was achieved from the Al-polymer contact, with a reverse bias leakage current density as low as 4nA/cm2 at an electric field strength of 25kV/cm. Irradiation with x-rays from a 50kV x-ray tube produced a linear increase in photocurrent over a dose rate range from 4to18mGy/s. The observed x-ray sensitivities of 240nC/mGy/cm3 for MEH-PPV and 480nC/mGy/cm3 for PFO structures are comparable to that reported for Si devices. A response time of <150ms to pulsed x-ray irradiation was measured with no evidence of long-lived current transients. Conjugated polymers offer the advantage of easy coatability over large areas and on curved surfaces. Their low average atomic number provides tissue-equivalent dosimetric response, with many potential applications including medical x-ray and synchrotron photon detection.

  5. Subcarrier multiplexing with dispersion reduction and direct detection

    DOEpatents

    Sargis, P.D.; Haigh, R.E.; McCammon, K.G.

    1997-01-21

    An SCM system is disclosed for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream. 2 figs.

  6. Lenslet array to further suppress starlight for direct exoplanet detection

    NASA Astrophysics Data System (ADS)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-07-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  7. Direct Detections of Young Stars in Nearby Elliptical Galaxies

    NASA Astrophysics Data System (ADS)

    Ford, H. Alyson; Bregman, Joel N.

    2013-06-01

    Small amounts of star formation in elliptical galaxies are suggested by several results: surprisingly young ages from optical line indices, cooling X-ray gas, and mid-infrared dust emission. Such star formation has previously been difficult to directly detect, but using ultraviolet Hubble Space Telescope Wide Field Camera 3 imaging, we have identified individual young stars and star clusters in four nearby ellipticals. Ongoing star formation is detected in all galaxies, including three ellipticals that have previously exhibited potential signposts of star-forming conditions (NGC 4636, NGC 4697, and NGC 4374), as well as the typical "red and dead" NGC 3379. The current star formation in our closest targets, where we are most complete, is between 2.0 and 9.8 × 10-5 M ⊙ yr-1. The star formation history was roughly constant from 0.5 to 1.5 Gyr (at (3-5) × 10-4 M ⊙ yr-1), but decreased by a factor of several in the past 0.3 Gyr. Most star clusters have a mass between 102 and 104 M ⊙. The specific star formation rates of ~10-16 yr-1 (at the present day) or ~10-14 yr-1 (when averaging over the past Gyr) imply that a fraction 10-8 of the stellar mass is younger than 100 Myr and 10-5 is younger than 1 Gyr, quantifying the level of frosting of recent star formation over the otherwise passive stellar population. There is no obvious correlation between either the presence or spatial distribution of postulated star formation indicators and the star formation we detect. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with program 11583.

  8. DIRECT DETECTIONS OF YOUNG STARS IN NEARBY ELLIPTICAL GALAXIES

    SciTech Connect

    Ford, H. Alyson; Bregman, Joel N.

    2013-06-20

    Small amounts of star formation in elliptical galaxies are suggested by several results: surprisingly young ages from optical line indices, cooling X-ray gas, and mid-infrared dust emission. Such star formation has previously been difficult to directly detect, but using ultraviolet Hubble Space Telescope Wide Field Camera 3 imaging, we have identified individual young stars and star clusters in four nearby ellipticals. Ongoing star formation is detected in all galaxies, including three ellipticals that have previously exhibited potential signposts of star-forming conditions (NGC 4636, NGC 4697, and NGC 4374), as well as the typical ''red and dead'' NGC 3379. The current star formation in our closest targets, where we are most complete, is between 2.0 and 9.8 Multiplication-Sign 10{sup -5} M{sub Sun} yr{sup -1}. The star formation history was roughly constant from 0.5 to 1.5 Gyr (at (3-5) Multiplication-Sign 10{sup -4} M{sub Sun} yr{sup -1}), but decreased by a factor of several in the past 0.3 Gyr. Most star clusters have a mass between 10{sup 2} and 10{sup 4} M{sub Sun }. The specific star formation rates of {approx}10{sup -16} yr{sup -1} (at the present day) or {approx}10{sup -14} yr{sup -1} (when averaging over the past Gyr) imply that a fraction 10{sup -8} of the stellar mass is younger than 100 Myr and 10{sup -5} is younger than 1 Gyr, quantifying the level of frosting of recent star formation over the otherwise passive stellar population. There is no obvious correlation between either the presence or spatial distribution of postulated star formation indicators and the star formation we detect.

  9. Direct and Indirect Dark Matter Detection in Gauge Theories

    SciTech Connect

    Queiroz, Farinaldo

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  10. The intermediate size direct detection detector for electron microscopy

    NASA Astrophysics Data System (ADS)

    Jin, Liang; Milazzo, Anna-Clare; Kleinfelder, Stuart; Li, Shengdong; Leblanc, Philippe; Duttweiler, Fred; Bouwer, James C.; Peltier, Steve T.; Ellisman, Mark; Xuong, Nguyen-Huu

    2007-02-01

    In a longstanding effort to overcome limits of film and the charge coupled device (CCD) systems in electron microscopy, we have developed a radiation-tolerant system that can withstand direct electron bombardment. A prototype Direct Detection Device (DDD) detector based on an Active Pixel Sensor (APS) has delivered unprecedented performance with an excellent signal-to-noise ratio (approximately 5/1 for a single incident electron in the range of 200-400 keV) and a very high spatial resolution. This intermediate size prototype features a 512×550 pixel format of 5μm pitch. The detector response to uniform beam illumination and to single electron hits is reported. Radiation tolerance with high-energy electron exposure is also impressive, especially with cooling to -15 °C. Stable performance has been demonstrated, even after a total dose of 3.3×10 6 electrons/pixel. The characteristics of this new detector have exciting implications for transmission electron microscopy, especially for cryo-EM as applied to biological macromolecules.

  11. Reactive Arrays of Colorimetric Sensors for Metabolite and Steroid Identification.

    PubMed

    Batres, Gary; Jones, Talia; Johnke, Hannah; Wilson, Mark; Holmes, Andrea E; Sikich, Sharmin

    2014-12-31

    The work described herein examines a rapid mix-and-measure method called DETECHIP suitable for screening of steroids and metabolites. The addition of steroids and metabolites to reactive arrays of colorimetric sensors generated characteristic color "fingerprints" that were used to identify the analyte. A color analysis tool was used to identify the analyte pool that now includes biologically relevant analytes. The mix-and-measure arrays allowed the detection of disease metabolites, orotic acid and argininosuccinic acid; and the steroids androsterone, 1,4-androstadiene, testosterone, stanozolol, and estrone. The steroid 1,4-androstadiene was also detected by this method while dissolved in synthetic urine. Some of the steroids, such as androstadiene, stanozolol, and androsterone were co-dissolved with (2-hydroxypropyl)-β-cyclodextrin in order to increase solubility in aqueous buffered solutions. The colorimetric arrays do not intend to eliminate ELISA or mass spectroscopy based screening, but to possibly provide an alternative analytical detection method for steroids and metabolites. PMID:25019034

  12. Colorimetric and fluorometric dual-readout sensor for lysozyme.

    PubMed

    Zheng, Hanye; Qiu, Suyan; Xu, Kefeng; Luo, Linguang; Song, Yibiao; Lin, Zhenyu; Guo, Longhua; Qiu, Bin; Chen, Guonan

    2013-11-01

    A novel, highly sensitive and selective dual-readout sensor (colorimetric and fluorometric) for the detection of lysozyme was proposed. The fluorescence of triazolylcoumarin molecules was quenched by Au nanoparticles (AuNPs) initially through the fluorescence resonance energy transfer (FRET), after the addition of lysozyme, the stronger binding of lysozyme onto the surfaces of AuNPs made triazolylcoumarin molecules remove from the AuNPs surface and led to the recovery of the fluorescence of triazolylcoumarin molecules, and accompanied by the discernable color change of the solution from red to purple. The lowest detectable concentration for lysozyme was 50 ng mL(-1) by the naked eye, and the limit of detection (LOD) was 23 ng mL(-1) by fluorescence measurements. In addition, satisfactory results for lysozyme detection in hen egg white were confirmed in the study. Moreover, the presented sensor provides a reliable option to determine lysozyme with high sensitivity and selectivity. PMID:23978821

  13. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X.-Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.; Lattice Strong Dynamics LSD Collaboration

    2015-10-01

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory—"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N ) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1 /mB6 , suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  14. Direct Sequence Detection of Structured H5 Influenza Viral RNA

    PubMed Central

    Kerby, Matthew B.; Freeman, Sarah; Prachanronarong, Kristina; Artenstein, Andrew W.; Opal, Steven M.; Tripathi, Anubhav

    2008-01-01

    We describe the development of sequence-specific molecular beacons (dual-labeled DNA probes) for identification of the H5 influenza subtype, cleavage motif, and receptor specificity when hybridized directly with in vitro transcribed viral RNA (vRNA). The cloned hemagglutinin segment from a highly pathogenic H5N1 strain, A/Hanoi/30408/2005(H5N1), isolated from humans was used as template for in vitro transcription of sense-strand vRNA. The hybridization behavior of vRNA and a conserved subtype probe was characterized experimentally by varying conditions of time, temperature, and Mg2+ to optimize detection. Comparison of the hybridization rates of probe to DNA and RNA targets indicates that conformational switching of influenza RNA structure is a rate-limiting step and that the secondary structure of vRNA dominates the binding kinetics. The sensitivity and specificity of probe recognition of other H5 strains was calculated from sequence matches to the National Center for Biotechnology Information influenza database. The hybridization specificity of the subtype probes was experimentally verified with point mutations within the probe loop at five locations corresponding to the other human H5 strains. The abundance frequencies of the hemagglutinin cleavage motif and sialic acid recognition sequences were experimentally tested for H5 in all host viral species. Although the detection assay must be coupled with isothermal amplification on the chip, the new probes form the basis of a portable point-of-care diagnostic device for influenza subtyping. PMID:18403607

  15. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    DOE PAGESBeta

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X. Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; et al

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using themore » background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.« less

  16. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    PubMed

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  17. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    PubMed

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter. PMID:26551103

  18. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    SciTech Connect

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X. Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  19. A direction detective asymmetrical twin-core fiber curving sensor

    NASA Astrophysics Data System (ADS)

    An, Maowei; Geng, Tao; Yang, Wenlei; Zeng, Hongyi; Li, Jian

    2015-10-01

    Long period fiber gratings (LPFGs), which can couple the core mode to the forward propagating cladding modes of a fiber and have the advantage of small additional loss, no backward reflection, small size, which is widely used in optical fiber sensors and optical communication systems. LPFG has different fabricating methods, in order to write gratings on the twin-core at the same time effectively, we specially choose electric heating fused taper system to fabricate asymmetric dual-core long period fiber grating, because this kind of method can guarantee the similarity of gratings on the twin cores and obtain good geometric parameters of LPFG, such as cycle, cone waist. Then we use bending test platform to conduct bending test for each of the core of twin-core asymmetric long period fiber grating. Experiments show that: the sensitivity of asymmetrical twin-core long period fiber grating's central core under bending is -5.47nm·m, while the sensitivity of asymmetric twin-core long period fiber grating partial core changed with the relative position of screw micrometer. The sensitivity at 0°, 30°, 90° direction is -4.22nm·m, -9.84nm·m, -11.44nm·m respectively. The experiment results strongly demonstrate the properties of rim sensing of asymmetrical twin-core fiber gratings which provides the possibility of simultaneously measuring the bending magnitude and direction and solving the problem of cross sensing when multi-parameter measuring. In other words, we can detect temperature and bend at the same time by this sensor. As our knowledge, it is the first time simultaneously measuring bend and temperature using this structure of fiber sensors.

  20. Sensitiveness of the colorimetric estimation of titanium

    USGS Publications Warehouse

    Wells, R.C.

    1911-01-01

    The accuracy of the colorimetric estimation of titanium is practically constant over concentrations ranging from the strongest down to those containing about 1.5 mg. TiO2 in 100 cc. The change in concentration required to produce a perceptible difference in intensity between two solutions, at favorable concentrations, was found to be about 6.5 per cent, which does not differ much from the results of others with chromium and copper solutions. With suitable precautions, such as comparing by substitution and taking the mean of several settings or of the two perceptibly different extremes, the accuracy of the colorimetric comparisons appears to be about 2 per cent.

  1. Evaluation of the Spectral Response of Functionalized Silk Inverse Opals as Colorimetric Immunosensors.

    PubMed

    Burke, Kelly A; Brenckle, Mark A; Kaplan, David L; Omenetto, Fiorenzo G

    2016-06-29

    Regenerated silk fibroin is a high molecular weight protein obtained by purifying the cocoons of the domesticated silkworm, Bombyx mori. This report exploits the aqueous processing and tunable β sheet secondary structure of regenerated silk to produce nanostructures (i.e., inverse opals) that can be used as colorimetric immunosensors. Such sensors would enable direct detection of antigens by changes in reflectance spectra induced by binding events within the nanostructure. Silk inverse opals were prepared by solution casting and annealing in a humidified atmosphere to render the silk insoluble. Next, antigen sensing capabilities were imparted to silk through a three step synthesis: coupling of avidin to silk surfaces, coupling of biotin to antibodies, and lastly antibody attachment to silk through avidin-biotin interactions. Varying the antibody enables detection of different antigens, as demonstrated using different protein antigens: antibodies, red fluorescent protein, and the beta subunit of cholera toxin. Antigen binding to sensors induces a red shift in the opal reflectance spectra, while sensors not exposed to antigen showed either no shift or a slight blue shift. This work constitutes a first step for the design of biopolymer-based optical systems that could directly detect antigens using commercially available reagents and environmentally friendly chemistries. PMID:27322909

  2. Evaluation of the Spectral Response of Functionalized Silk Inverse Opals as Colorimetric Immunosensors.

    PubMed

    Burke, Kelly A; Brenckle, Mark A; Kaplan, David L; Omenetto, Fiorenzo G

    2016-06-29

    Regenerated silk fibroin is a high molecular weight protein obtained by purifying the cocoons of the domesticated silkworm, Bombyx mori. This report exploits the aqueous processing and tunable β sheet secondary structure of regenerated silk to produce nanostructures (i.e., inverse opals) that can be used as colorimetric immunosensors. Such sensors would enable direct detection of antigens by changes in reflectance spectra induced by binding events within the nanostructure. Silk inverse opals were prepared by solution casting and annealing in a humidified atmosphere to render the silk insoluble. Next, antigen sensing capabilities were imparted to silk through a three step synthesis: coupling of avidin to silk surfaces, coupling of biotin to antibodies, and lastly antibody attachment to silk through avidin-biotin interactions. Varying the antibody enables detection of different antigens, as demonstrated using different protein antigens: antibodies, red fluorescent protein, and the beta subunit of cholera toxin. Antigen binding to sensors induces a red shift in the opal reflectance spectra, while sensors not exposed to antigen showed either no shift or a slight blue shift. This work constitutes a first step for the design of biopolymer-based optical systems that could directly detect antigens using commercially available reagents and environmentally friendly chemistries.

  3. 3D graphene network@WO3 nanowire composites: a multifunctional colorimetric and electrochemical biosensing platform.

    PubMed

    Ma, Ye; Zhao, Minggang; Cai, Bin; Wang, Wei; Ye, Zhizhen; Huang, Jingyun

    2014-10-01

    A three dimensional graphene network (3DGN)@WO3 nanowire (NW) sensor is proposed which can perform colorimetric and electrochemical sensing techniques to detect H2O2, ascorbic acid and dopamine. The 3DGN provides three functions: anchoring, separating, conducting, while the WO3 NWs maximize surface area and catalyse reactions.

  4. A highly sensitive gold nanoparticle-based colorimetric probe for pyrophosphate using a competition assay approach.

    PubMed

    Kim, Sudeok; Eom, Min Sik; Kim, Seung Kyung; Seo, Seong Hyeok; Han, Min Su

    2013-01-01

    In this study, a mixture of [Zn(2)(1,3-bis[bis(2-pyridylmethyl)aminomethyl]benzene)](4+) ([Zn(2)(BBPAB)](4+)) and 11-mercaptoundecylphosphoric acid functionalized gold nanoparticles (Phos-AuNPs) is shown to be a highly sensitive colorimetric probe that can easily detect pyrophosphate (PPi) at less than 200 nM with the naked eye.

  5. Direct detection of light ''Ge-phobic'' exothermic dark matter

    SciTech Connect

    Gelmini, Graciela B.; Georgescu, Andreea; Huh, Ji-Haeng E-mail: a.georgescu@physics.ucla.edu

    2014-07-01

    We present comparisons of direct dark matter (DM) detection data for light WIMPs with exothermic scattering with nuclei (exoDM), both assuming the Standard Halo Model (SHM) and in a halo model–independent manner. Exothermic interactions favor light targets, thus reducing the importance of upper limits derived from xenon targets, the most restrictive of which is at present the LUX limit. In our SHM analysis the CDMS-II-Si and CoGeNT regions become allowed by these bounds, however the recent SuperCDMS limit rejects both regions for exoDM with isospin-conserving couplings. An isospin-violating coupling of the exoDM, in particular one with a neutron to proton coupling ratio of -0.8 (which we call ''Ge-phobic''), maximally reduces the DM coupling to germanium and allows the CDMS-II-Si region to become compatible with all bounds. This is also clearly shown in our halo-independent analysis.

  6. Direct detection of exothermic dark matter with light mediator

    NASA Astrophysics Data System (ADS)

    Geng, Chao-Qiang; Huang, Da; Lee, Chun-Hao; Wang, Qing

    2016-08-01

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  7. The effective field theory of dark matter direct detection

    SciTech Connect

    Fitzpatrick, A. Liam; Katz, Emanuel; Haxton, Wick; Lubbers, Nicholas; Xu, Yiming E-mail: haxton@berkeley.edu E-mail: nlubbers@bu.edu

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  8. Enabling Technologies for Direct Detection Optical Phase Modulation Formats

    NASA Astrophysics Data System (ADS)

    Xu, Xian

    Phase modulation formats are believed to be one of the key enabling techniques for next generation high speed long haul fiber-optic communication systems due to the following main advantages: (1) with a balanced detection, a better receiver sensitivity over conventional intensity modulation formats, e.g., a ˜3-dB sensitivity improvement using differential phase shift keying (DPSK) and a ˜1.3-dB sensitivity improvement using differential quadrature phase shift keying (DQPSK); (2) excellent robustness against fiber nonlinearities; (3) high spectrum efficiency when using multilevel phase modulation formats, such as DQPSK. As the information is encoded in the phase of the optical field, the phase modulation formats are sensitive to the phase-related impairments and the deterioration induced in the phase-intensity conversion. This consequently creates new challenging issues. The research objective of this thesis is to depict some of the challenging issues and provide possible solutions. The first challenge is the cross-phase modulation (XPM) penalty for the phase modulated channels co-propagating with the intensity modulated channels. The penalty comes from the pattern dependent intensity fluctuations of the neighboring intensity modulated channels being converted into phase noise in the phase modulation channels. We propose a model to theoretically analyze the XPM penalty dependence on the walk off effect. From this model, we suggest that using fibers with large local dispersion or intentionally introducing some residual dispersion per span would help mitigate the XPM penalty. The second challenge is the polarization dependent frequency shift (PDf) induced penalty during the phase-intensity conversion. The direct detection DPSK is usually demodulated in a Mach-Zehnder delay interferometer (DI). The polarization dependence of DI introduces a PDf causing a frequency offset between the laser's frequency and the transmissivity peak of DI, degrading the demodulated DPSK

  9. Visual Screening and Colorimetric Determination of Clenbuterol and Ractopamine Using Unmodified Gold Nanoparticles as Probe.

    PubMed

    Luo, Yeli; Liu, Xin; Guo, Jiajia; Gao, Hanting; Li, Ying; Xu, Jingyue; Shen, Fei; Sun, Chunyan

    2016-01-01

    In this paper, a sensitive method for the colorimetric detection of clenbuterol and ractopamine using citrate-stabilized gold nanoparticles (AuNPs) as probe was developed. The concentration of clenbuterol and ractopamine could be determined with naked eyes or a UV-vis spectrometer. By optimizing the influence of NaHSO₄ and incubation time, clenbuterol could be detected in the linear range of 0.1-4 µg/mL with the detection limit of 0.0158 µg/mL, and ractopamine could be detected in the linear range of 1-9 µg/mL with the detection limit of 0.0229 µg/mL. The proposed method could be successfully applied to detect clenbuterol and ractopamine in pig urines by a simple pre-treatment with excellent recoveries. The proposed colorimetric assay exhibits good reproducibility and accuracy, providing a simple and rapid method for the analysis of clenbuterol and ractopamine. PMID:27398486

  10. Paper bioassay based on ceria nanoparticles as colorimetric probes.

    PubMed

    Ornatska, Maryna; Sharpe, Erica; Andreescu, Daniel; Andreescu, Silvana

    2011-06-01

    We report the first use of redox nanoparticles of cerium oxide as colorimetric probes in bioanalysis. The method is based on changes in the physicochemical properties of ceria nanoparticles, used here as chromogenic indicators, in response to the analyte. We show that these particles can be fully integrated in a paper-based bioassay. To construct the sensor, ceria nanoparticles and glucose oxidase were coimmobilized onto filter paper using a silanization procedure. In the presence of glucose, the enzymatically generated hydrogen peroxide induces a visual color change of the ceria nanoparticles immobilized onto the bioactive sensing paper, from white-yellowish to dark orange, in a concentration-dependent manner. A detection limit of 0.5 mM glucose with a linear range up to 100 mM and a reproducibility of 4.3% for n = 11 ceria paper strips were obtained. The assay is fully reversible and can be reused for at least 10 consecutive measurement cycles, without significant loss of activity. Another unique feature is that it does not require external reagents, as all the sensing components are fixed onto the paper platform. The bioassay can be stored for at least 79 days at room temperature while maintaining the same analytical performance. An example of analytical application was demonstrated for the detection of glucose in human serum. The results demonstrate the potential of this type of nanoparticles as novel components in the development of robust colorimetric bioassays. PMID:21524141

  11. Paper-based tuberculosis diagnostic devices with colorimetric gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Tsai, Tsung-Ting; Shen, Shu-Wei; Cheng, Chao-Min; Chen, Chien-Fu

    2013-08-01

    A colorimetric sensing strategy employing gold nanoparticles and a paper assay platform has been developed for tuberculosis diagnosis. Unmodified gold nanoparticles and single-stranded detection oligonucleotides are used to achieve rapid diagnosis without complicated and time-consuming thiolated or other surface-modified probe preparation processes. To eliminate the use of sophisticated equipment for data analysis, the color variance for multiple detection results was simultaneously collected and concentrated on cellulose paper with the data readout transmitted for cloud computing via a smartphone. The results show that the 2.6 nM tuberculosis mycobacterium target sequences extracted from patients can easily be detected, and the turnaround time after the human DNA is extracted from clinical samples was approximately 1 h.

  12. Bed bug detection: Current technologies and future directions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study evaluates current technologies used to detect bed bug infestations, and presents new information regarding the underlying chemical basis of canines scent detection. The manuscript also reports new and future devices that may play a part in bed bug detection in the future....

  13. Colorimetric Titration Experiment for the Undergraduate Laboratory.

    ERIC Educational Resources Information Center

    Lopez, Edwin; Vassos, Basil H.

    1984-01-01

    Describes a colorimetric titration instrument usable in the undergraduate laboratory that fulfills the objectives of ruggedness, freedom from ambient light interference, and low cost. Although accessories can be added (raising the price), the basic instrument is low priced and can be used manually with a simple voltmeter. (JN)

  14. Visualizing Capsaicinoids: Colorimetric Analysis of Chili Peppers

    ERIC Educational Resources Information Center

    Thompson, Robert Q.; Chu, Christopher; Gent, Robin; Gould, Alexandra P.; Rios, Laura; Vertigan, Theresa M.

    2012-01-01

    A colorimetric method for total capsaicinoids in chili pepper ("Capsicum") fruit is described. The placental material of the pepper, containing 90% of the capsaicinoids, was physically separated from the colored materials in the pericarp and extracted twice with methanol, capturing 85% of the remaining capsaicinoids. The extract, evaporated and…

  15. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M.

    2015-12-29

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  16. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M. E-mail: gresham@whitman.edu E-mail: apeter@physics.osu.edu

    2015-12-01

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either 'heavy' or 'light' mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  17. Identifying the theory of dark matter with direct detection

    NASA Astrophysics Data System (ADS)

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H. G.; Zurek, Kathryn M.

    2015-12-01

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin-, momentum-, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either "heavy" or "light" mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  18. Enhancement of Colorimetric Response of Enzymatic Reactions by Thermally Evaporated Plasmonic Thin Films: Application to Glial Fibrillary Acidic Protein

    PubMed Central

    Abel, Biebele; Kabir, Tabassum S.; Odukoya, Babatunde; Mohammed, Muzaffer; Aslan, Kadir

    2015-01-01

    We report the enhancement of the colorimetric response of horseradish peroxidase (HRP) and alkaline phosphatase (AP) in bioassays by thermally evaporated silver, gold, copper and nickel thin films. In this regard, a model bioassay based on biotin-avidin interactions was employed. Biotin groups and enzymes were introduced to all surfaces using a biotinylated linker molecule and avidin, respectively. The colorimetric response of HRP in the model bioassay carried out on the plasmonic thin films were up to 4.4-fold larger as compared to control samples (i.e., no plasmonic thin films), where the largest enhancement of colorimetric response was observed on silver thin films. The colorimetric response of AP on plasmonic thin films was found to be similar to those observed on control samples, which was attributed to the loss of enzymes from the surface during the bioassay steps. The extent of enzymes immobilized on to plasmonic thin films was found to affect the colorimetric response of the model bioassay. These findings allowed us to demonstrate the use of silver thin films for the detection of glial fibrillary acidic protein (GFAP), where the colorimetric response of the standard bioassays for GFAP was enhanced up to 67% as compared to bioassays on glass slides. PMID:25663850

  19. PDM-16QAM vector signal generation and detection based on intensity modulation and direct detection

    NASA Astrophysics Data System (ADS)

    Chen, Long; Yu, Jianjun; Li, Xinying

    2016-07-01

    We experimentally demonstrate a novel and simple method to generate and detect high speed polarization-division-multiplexing 16-ary quadrature-amplitude-modulation (PDM-16QAM) vector signal enabled by Mach-Zehnder modulator-based (MZM-based) optical-carrier-suppression (OCS) intensity modulation and direct detection. Due to the adoption of OCS intensity modulation, carrier beating can be avoided at the receiver, and thus polarization de-multiplexing can be implemented by digital-signal-processing-based (DSP-based) cascaded multi-modulus algorithm (CMMA) equalization instead of a polarization tracking system. The change of both amplitude and phase information due to the adoption of OCS modulation can be equalized by DSP-based amplitude and phase precoding at the transmitter. Up to 64-Gb/s PDM-16QAM vector signal is generated and detected after 2-km single-mode fiber-28 (SMF-28) or 20-km large-effective-area fiber (LEAF) transmission with a bit-error-ratio (BER) less than the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3.

  20. Direct detection of hyaluronidase in urine using cationic gold nanoparticles: a potential diagnostic test for bladder cancer.

    PubMed

    Nossier, Ahmed Ibrahim; Eissa, Sanaa; Ismail, Manal Fouad; Hamdy, Mohamed Ahmed; Azzazy, Hassan Mohamed El-Said

    2014-04-15

    Hyaluronidase (HAase) was reported as a urinary marker of bladder cancer. In this study, a simple colorimetric gold nanoparticle (AuNP) assay was developed for rapid and sensitive detection of urinary HAase activity. Charge interaction between polyanionic hyaluronic acid (HA) and cationic AuNPs stabilized with cetyl trimethyl ammonium bromide (CTAB) led to formation of gold aggregates and a red to blue color shift. HAase digests HA into small fragments preventing the aggregation of cationic AuNPs. The nonspecific aggregation of AuNPs in urine samples was overcome by pre-treatment of samples with the polycationic chitosan that was able to agglomerate all negatively charged interfering moieties before performing the assay. The developed AuNP assay was compared with zymography for qualitative detection of urinary HAase activity in 40 bladder carcinoma patients, 11 benign bladder lesions patients and 15 normal individuals, the assay sensitivity was 82.5% vs. 65% for zymography, while the specificity for both assays was 96.1%. The absorption ratio, A530/A620 of the reacted AuNP solution was used to quantify the HAase activity. The best cut off value was 93.5 μU/ng protein, at which the sensitivity was 90% and the specificity was 80.8%.The developed colorimetric AuNP HAase assay is simple, inexpensive, and can aid noninvasive diagnosis of bladder cancer. PMID:24240162

  1. Interface engineering catalytic graphene for smart colorimetric biosensing.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Quan, Xie

    2012-04-24

    Herein a hybrid catalyst consisting of "naked" Au-NPs in situ grown on graphene sheets is engineered, which exhibits a synergetic effect in mimicking peroxidase at its interface, although free Au-NPs or graphene alone has very little activity. What is more, one of the unique features of our synergetic catalyst is that its interface can be reversibly switched from "inactive" to "active" upon treatment with different ssDNA species in solution, thus providing a powerful and versatile basis for designing graphene/DNA-based label-free colorimetric biosensors. Compared with other signal transduction modes in traditional graphene/aptamer-based systems, our novel signaling strategy not only avoids any labeling or modification procedures but also reduces the background signal due to the "off-on" switching mode during the sensing. Furthermore, this facile and general approach can be applicable to the other extended graphene/aptamer-based systems for colorimetric detection of a wide range of analytes. We envision that the tunable graphene-based smart interface could find potential applications in the development of biocatalysis, bioassays, and smart material devices in the future. PMID:22443302

  2. A Wash-Free Homogeneous Colorimetric Immunoassay Method

    PubMed Central

    Liu, Huiqiao; Rong, Pengfei; Jia, Hongwei; Yang, Jie; Dong, Bo; Dong, Qiong; Yang, Cejun; Hu, Pengzhi; Wang, Wei; Liu, Haitao; Liu, Dingbin

    2016-01-01

    Rapid and convenient biosensing platforms could be beneficial to timely diagnosis and treatment of diseases in virtually any care settings. Sandwich immunoassays, the most commonly used methods for protein detection, often rely on expensive tags such as enzyme and tedious wash and incubation procedures operated by skilled labor. In this report, we revolutionized traditional sandwich immunoassays by providing a wash-free homogeneous colorimetric immunoassay method without requirement of any separation steps. The proposed strategy was realized by controlling the growth of gold nanoparticles (AuNPs) to mediate the interparticle spacing in the protein-AuNP oligomers. We have demonstrated the successful in vitro detection of cancer biomarker in serum samples from patients with high clinical sensitivity and specificity. PMID:26722373

  3. Comparison of IPDA lidar receiver sensitivity for coherent detection and for direct detection using sine-wave and pulsed modulation.

    PubMed

    Sun, Xiaoli; Abshire, James B

    2012-09-10

    We use theoretical models to compare the receiver signal to noise ratio (SNR) vs. average rate of detected signal photons for an integrated path differential absorption (IPDA) lidar using coherent detection with continuous wave (CW) lasers and direct detection with sine-wave and pulse modulations. The results show the coherent IPDA lidar has high receiver gain and narrow bandwidth to overcome the effects of detector circuit noise and background light, but the actual receiver performance can be limited by the coherent mixing efficiency, speckle and other factors. For direct detection, using sine-wave modulation allows the use of a low peak power laser transmitter and synchronous detection. The pulse modulation technique requires higher laser peak powers but is more efficient than sine-wave modulation in terms of average detected signal photon rate required to achieve a given receiver SNR. We also conducted experiments for the direct detection cases and the results agreed well with theory.

  4. Bed bug detection: current technologies and future directions.

    PubMed

    Vaidyanathan, Rajeev; Feldlaufer, Mark F

    2013-04-01

    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use. PMID:23553226

  5. Bed Bug Detection: Current Technologies and Future Directions

    PubMed Central

    Vaidyanathan, Rajeev; Feldlaufer, Mark F.

    2013-01-01

    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use. PMID:23553226

  6. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-01-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1–0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology. PMID:26272507

  7. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology.

    PubMed

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-11-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1-0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology.

  8. Calculations of rates for direct detection of neutralino dark matter

    SciTech Connect

    Griest, K.

    1988-08-08

    The detection rates in cryogenic detectors of neutralinos, the most well motivated supersymmetric dark-matter candidate, are calculated. These rates can differ greatly from the special cases of pure photoinos and pure Higgsinos which are usually considered. In addition, a new term is found in the elastic-scattering cross section proportional to the Z-ino component which is ''spin independent,'' even for these Majorana particles. As a result, substantial detection rates exist for previously disfavored, mostly spinless materials such as germanium and mercury.

  9. Calculations of rates for direct detection of neutralino dark matter

    NASA Technical Reports Server (NTRS)

    Griest, Kim

    1988-01-01

    The detection rates in cryogenic detectors of neutralinos, the most well motivated supersymmetric dark-matter candidate, are calculated. These rates can differ greatly from the special case of pure photinos and pure Higgsinos which are usually considered. In addition, a new term is found in the elastic-scattering cross section proportional to the Z-ino component which is 'spin independent', even for these Majorana particles. As a result, substantial detection rates exist for previously disfavored, mostly spinless materials such as germanium and mercury.

  10. Three dimensional colorimetric assay assemblies

    SciTech Connect

    Charych, D.; Reichart, A.

    2000-06-27

    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  11. Three dimensional colorimetric assay assemblies

    DOEpatents

    Charych, Deborah; Reichart, Anke

    2000-01-01

    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  12. Direct detection of RDX vapor using a conjugated polymer network.

    PubMed

    Gopalakrishnan, Deepti; Dichtel, William R

    2013-06-01

    1,3,5-Trinitroperhydro-1,3,5-triazine (RDX) is a principal component of plastic explosives used in acts of terrorism and within improvised explosive devices, among others. Approaches to detect RDX compatible with remote, "stand-off" sampling that do not require preconcentration strategies, such as the swabs commonly employed in airports, will benefit military and civilian security. Such detection remains a significant challenge because RDX is 10(3) less volatile than 1,3,5-trinitrotoluene (TNT), corresponding to a parts-per-trillion vapor pressure under ambient conditions. Therefore, while fluorescence quenching of conjugated polymers is sufficiently sensitive to detect TNT vapors, RDX vapor detection is undemonstrated. Here we report a cross-linked phenylene vinylene polymer network whose fluorescence is quenched by trace amounts of RDX introduced from solution or the vapor phase. Fluorescence quenching is reduced, but remains significant, when partially degraded RDX is employed, suggesting that the polymer responds to RDX itself. The polymer network also responds to TNT and PETN similarly introduced from solution or the vapor phase. Pure solvents, volatile amines, and the outgassed vapors from lipstick or sunscreen do not quench polymer fluorescence. The established success of TNT sensors based on fluorescence quenching makes this a material of interest for real-world explosive sensors and will motivate further interest in cross-linked polymers and framework materials for sensing applications. PMID:23641956

  13. Direct Detections of the Yarkovsky Effect: Status and Outlook

    NASA Astrophysics Data System (ADS)

    Chesley, Steven R.; Farnocchia, Davide; Pravec, Petr; Vokrouhlický, David

    2016-01-01

    We report the current results on a comprehensive scan of the near-Earth asteroid catalog for evidence of the Yarkovsky effect in the orbital motion of these bodies. While most objects do not have sufficient observational data to reveal such slight acceleration, we do identify 42 asteroids with a ``valid'' detection of the Yarkovsky effect, i.e., those with a signal at least 3 times greater than the formal uncertainty and a value compatible with the Yarkovsky mechanism. We also identify a special category of non-detection, which we refer to as ``weak signal,'' where the objects are of a size that would permit a clear detection if the Yarkovsky effect is maximized, and yet the orbit is clearly incompatible with such accelerations. The implication is that the Yarkovsky effect is reduced in these cases, presumably due to mid-range obliquity, but possibly also due to size, bulk density, thermal inertia, albedo, or spin rate markedly different from assumptions. Finally, there are a number of asteroids showing a significant signal for nongravitational acceleration, and yet with a magnitude too great to be attributed to the Yarkovsky effect. We term these ``spurious detections'' because most are due to erroneous optical astrometry, often involving a single isolated night from precovery observations. Some cases may be due to other nongravitational accelerations, such as outgassing, mass loss, or micro-meteoroid flux.

  14. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures.

    PubMed

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G; Corso, Alejandra

    2015-12-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers.

  15. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures

    PubMed Central

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G.

    2015-01-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers. PMID:26424841

  16. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures.

    PubMed

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G; Corso, Alejandra

    2015-12-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers. PMID:26424841

  17. Development of a nanobody-alkaline phosphatase fusion protein and its application in a highly sensitive direct competitive fluorescence enzyme immunoassay for detection of ochratoxin A in cereal.

    PubMed

    Liu, Xing; Xu, Yang; Wan, De-bin; Xiong, Yong-hua; He, Zhen-yun; Wang, Xian-xian; Gee, Shirley J; Ryu, Dojin; Hammock, Bruce D

    2015-01-20

    A rapid and sensitive direct competitive fluorescence enzyme immunoassay (dc-FEIA) for ochratoxin A (OTA) based on a nanobody (Nb)-alkaline phosphatase (AP) fusion protein was developed. The VHH (variable domain of heavy chain antibody) gene of Nb28 was subcloned into the expression vector pecan45 containing the AP double-mutant gene. The Nb28-AP construct was transformed into Escherichia coli BL21(DE3)plysS, and soluble expression in bacteria was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. Both the Nb properties and AP enzymatic activity were validated by colorimetric and fluorometric analysis. The 50% inhibitory concentration and the detection limit of the dc-FEIA were 0.13 and 0.04 ng/mL, respectively, with a linear range of 0.06-0.43 ng/mL. This assay was compared with LC-MS/MS, and the results indicated the reliability of Nb-AP fusion protein-based dc-FEIA for monitoring OTA contamination in cereal.

  18. Colorimetric sensor strips for formaldehyde assay utilizing fluoral-p decorated polyacrylonitrile nanofibrous membranes.

    PubMed

    Wang, Xueqin; Si, Yang; Mao, Xue; Li, Yan; Yu, Jianyong; Wang, Huaping; Ding, Bin

    2013-09-01

    A facile, ultrasensitive, and selective sensor strip utilizing 4-amino-3-penten-2-one (fluoral-p) functionalized electrospun polyacrylonitrile (PAN) (PAN/fluoral-p) nanofibrous membranes has been successfully developed for naked-eye colorimetric assay of formaldehyde. The sensor strips presented a significant reflectance decreasing band at 417 nm which induced a vivid color change from white to yellow and achieved a much lower naked-eye detection limit of 40 ppb compared with the World Health Organization standard (80 ppb). Based on the specific Hantzsch reaction between fluoral-p and formaldehyde, the as-prepared PAN/fluoral-p membranes are highly selective to formaldehyde with little interference from other volatile organic compounds and the proposed mechanism of this reaction is discussed carefully. Moreover, the colorimetric responses were visually quantitative using UV-vis spectra and the color difference calculated from L*, a*, b* values. Furthermore, due to the extremely large surface area and high porosity of the as-spun PAN nanofibrous membranes, the sensitivity of the nanofibrous membranes-based strips is much higher than traditional filter paper-based ones. Hence, such promising portable colorimetric sensor strips could not only potentially allow for assaying gaseous formaldehyde, but also facilitate the design and development of a novel colorimetric sensing system based on nanofibrous membranes. PMID:23831600

  19. Single Chain Fragment Variable Recombinant Antibody Functionalized Gold Nanoparticles for a Highly Sensitive Colorimetric Immunoassay

    PubMed Central

    Liu, Yang; Liu, Yi; Raymond, Raymond L.; Zeng, Xiangqun

    2009-01-01

    In this report, the peptide linker connecting scFv VH and VL domains were genetically modified to contain different amino acids (i.e. cysteine (scFv-cys) or histidines ( scFv-his)) to enable the scFv to adsorb or self-assemble onto the gold nanoparticles (NPs). The scFv-cys stabilized gold NPs were used to develop a highly sensitive colorimetric immunosensor. The scFv-cys stabilized gold NPs were characterized by UV-vis spectra, transmission electron microscope (TEM) and FT-IR. After adding the antigen rabbit IgG, the solution of scFv-cys stabilized gold NPs shows obvious visible color change from deep red to light purple due to the aggregation of the gold nanoparticles. Based on the colorimetric aggregation of scFv-cys stabilized gold NPs, the immunosensor exhibits high sensitivity with detection limit of 1.7 nM and good specificity. The good properties of the colorimetric aggregation immunosensor would be attributed to the small size of scFv and the covalent link between the scFv and gold NPs that improve the better orientation and enhance the probe density. With the advantages of speed, simplicity and specificity, the colorimetric immunoassay based on the functionalized scFv stabilized gold NPs represents a promising approach for protein analysis and clinical diagnostics. PMID:19327975

  20. Development of a colorimetric assay for rapid quantitative measurement of clavulanic acid in microbial samples.

    PubMed

    Dai, Xida; Xiang, Sihai; Li, Jia; Gao, Qiang; Yang, Keqian

    2012-02-01

    We developed a colorimetric assay to quantify clavulanic acid (CA) in culture broth of Streptomyces clavuligerus, to facilitate screening of a large number of S. clavuligerus mutants. The assay is based on a β-lactamase-catalyzed reaction, in which the yellow substrate nitrocefin (λ (max)=390 nm) is converted to a red product (λ (max)=486 nm). Since CA can irreversibly inhibit β-lactamase activity, the level of CA in a sample can be measured as a function of the A (390)/A (486) ratio in the assay mixture. The sensitivity and detection window of the assay were determined to be 50 μg L(-1) and 50 μg L(-1) to 10 mg L(-1), respectively. The reliability of the assay was confirmed by comparing assay results with those obtained by HPLC. The assay was used to screen a pool of 65 S. clavuligerus mutants and was reliable for identifying CA over-producing mutants. Therefore, the assay saves time and labor in large-scale mutant screening and evaluation tasks. The detection window and the reliability of this assay are markedly better than those of previously reported CA assays. This assay method is suitable for high throughput screening of microbial samples and allows direct visual observation of CA levels on agar plates.

  1. Highly selective colorimetric bacteria sensing based on protein-capped nanoparticles.

    PubMed

    Qiu, Suyan; Lin, Zhenyu; Zhou, Yaomin; Wang, Donggen; Yuan, Lijuan; Wei, Yihua; Dai, Tingcan; Luo, Linguang; Chen, Guonan

    2015-02-21

    A rapid and cost-effective colorimetric sensor has been developed for the detection of bacteria (Bacillus subtilis was selected as an example). The sensor was designed to rely on lysozyme-capped AuNPs with the advantages of effective amplification and high specificity. In the sensing system, lysozyme was able to bind strongly to Bacillus subtilis, which effectively induced a color change of the solution from light purple to purplish red. The lowest concentration of Bacillus subtilis detectable by the naked eye was 4.5 × 10(3) colony-forming units (CFU) mL(-1). Similar results were discernable from UV-Vis absorption measurements. A good specificity was observed through a statistical analysis method using the SPSS software (version 17.0). This simple colorimetric sensor may therefore be a rapid and specific method for a bacterial detection assay in complex samples. PMID:25503063

  2. Protein-based nanobiosensor for direct detection of hydrogen sulfide

    NASA Astrophysics Data System (ADS)

    Omidi, Meisam; Amoabediny, Ghasem; Yazdian, Fatemeh; Habibi-Rezaei, M.

    2015-01-01

    The chemically modified cytochrome c from equine heart, EC (232-700-9), was immobilized onto gold nanoparticles in order to develop a specific biosensing system for monitoring hydrogen sulfide down to the micromolar level, by means of a localized surface plasmon resonance spectroscopy. The sensing mechanism is based on the cytochrome-c conformational changes in the presence of H2S which alter the dielectric properties of the gold nanoparticles and the surface plasmon resonance peak undergoes a redshift. According to the experiments, it is revealed that H2S can be detected at a concentration of 4.0 μ \\text{M} (1.3 \\text{ppb}) by the fabricated biosensor. This simple, quantitative and sensitive sensing platform provides a rapid and convenient detection for H2S at concentrations far below the hazardous limit.

  3. Aptamer beacons for the direct detection of proteins.

    PubMed

    Hamaguchi, N; Ellington, A; Stanton, M

    2001-07-15

    We have designed a new class of molecules, which we term aptamer beacons, for detecting a wide range of ligands. Similar to molecular beacons, aptamer beacons can adopt two or more conformations, one of which allows ligand binding. A fluorescence-quenching pair is used to report changes in conformation induced by ligand binding. An anti-thrombin aptamer was engineered into an aptamer beacon by adding nucleotides to the 5'-end which are complementary to nucleotides at the 3'-end of the aptamer. In the absence of thrombin, the added nucleotides will form a duplex with the 3'-end, forcing the aptamer beacon into a stem-loop structure. In the presence of thrombin, the aptamer beacon forms the ligand-binding structure. This conformational change causes a change in the distance between a fluorophore attached to the 5'-end and a quencher attached to the 3'-end. Aptamer beacon can be a sensitive tool for detecting proteins and other chemical compounds.

  4. Rapid Detection and Identification of Respiratory Viruses by Direct Immunofluorescence

    PubMed Central

    D'Alessio, Donn; Williams, Stanley; Dick, Elliot C.

    1970-01-01

    The use of fluorescein-conjugated antiserum against respiratory syncytial (RS) and parainfluenza 1 and 3 viruses was compared with conventional techniques in the rapid detection of virus in tissue cultures inoculated with pharyngeal specimens known to contain these viruses. Twenty-three specimens were tested: 9 RS, 8 parainfluenza 1, and 6 parainfluenza 3. The fluorescent-antibody technique (FA) detected virus in 52% of the tissue cultures in 24 hr, and, by 72 hr, 22 of the 23 cultures were FA-positive whereas only 5 were positive by conventional techniques. Additionally, conjugated antisera were prepared against herpes simplex, influenza A2, and adenovirus type 5. All conjugates stained only the homologous virus and were 100- to 10,000-fold more sensitive than conventional techniques in detecting descending dilutions of virus inocula by 24 hr. With the procedures described, several antisera could be conjugated and ready for use within 24 hr. Serum fractionation was by ammonium sulfate precipitation, and with the procedure outlined virtually complete recovery of the globulin fraction and elimination of all of the albumin were accomplished. Images PMID:4098101

  5. The detection of transient directional couplings based on phase synchronization

    NASA Astrophysics Data System (ADS)

    Wagner, T.; Fell, J.; Lehnertz, K.

    2010-05-01

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  6. Teleconnection Paths via Climate Network Direct Link Detection.

    PubMed

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-12-31

    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales. PMID:26765033

  7. Aptamer-based colorimetric sensing of acetamiprid in soil samples: sensitivity, selectivity and mechanism.

    PubMed

    Shi, Huijie; Zhao, Guohua; Liu, Meichuan; Fan, Lifang; Cao, Tongcheng

    2013-09-15

    A simple and selective aptamer-based colorimetric method was developed for highly sensitive detection of acetamiprid, taking advantages of the sensitive target-induced colour changes that arisen from the interparticle plasmon coupling during the aggregation of Au nanoparticles (NPs). The results showed that the established method could be applied to detect acetamiprid in the linear range between 75 nM to 7.5 μM, with a low detection limit of 5 nM. Meanwhile, by employing an "artificial antibody" acetamiprid-binding aptamer (ABA) as recognition element, highly selective and specific colorimetric visualization of acetamiprid was obtained. It indicated that pesticides which may coexist with acetamiprid could not interfere with the detection of acetamiprid even that had similar structure with acetamiprid, such as imidacloprid and chlorpyrifos. Mechanism study suggested that it could be attributed to the specific supramolecular interaction between ABA and acetamiprid, as well as the resulted target-binding event induced conformation changes of ABA from random coil to hairpin structure. The practical application of the colorimetric method was realized for detecting acetamiprid in real soil samples and monitoring its natural degradation process. PMID:23846126

  8. Additional sampling directions improve detection range of wireless radiofrequency probes

    PubMed Central

    Mada, Marius; Carpenter, T. Adrian; Sawiak, Stephen J.; Williams, Guy B.

    2015-01-01

    Purpose While MRI is enhancing our knowledge about the structure and function of the human brain, subject motion remains a problem in many clinical applications. Recently, the use of wireless radiofrequency markers with three one‐dimensional (1D) navigators for prospective correction was demonstrated. This method is restricted in the range of motion that can be corrected, however, because of limited information in the 1D readouts. Methods Here, the limitation of techniques for disambiguating marker locations was investigated. It was shown that including more sampling directions extends the tracking range for head rotations. The efficiency of trading readout resolution for speed was explored. Results Tracking of head rotations was demonstrated from −19.2 to 34.4°, −2.7 to 10.0°, and −60.9 to 70.9° in the x‐, y‐, and z‐directions, respectively. In the presence of excessive head motion, the deviation of marker estimates from SPM8 was reduced by 17.1% over existing three‐projection methods. This was achieved by using an additional seven directions, extending the time needed for readouts by a factor of 3.3. Much of this increase may be circumvented by reducing resolution, without compromising accuracy. Conclusion Including additional sampling directions extends the range in which markers can be used, for patients who move a lot. Magn Reson Med 76:913–918, 2016. © 2015 The Authors. Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:26418189

  9. Direct detection of a microlens in the Milky Way.

    PubMed

    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D

    2001-12-01

    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs.

  10. Direct detection of a microlens in the Milky Way.

    PubMed

    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D

    2001-12-01

    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs. PMID:11740553

  11. Detection of nucleic acid sequences by invader-directed cleavage

    DOEpatents

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  12. Direct detection of relic active and sterile neutrinos

    NASA Astrophysics Data System (ADS)

    Li, Yu-Feng

    2016-05-01

    Both active and sterile sub-eV neutrinos can form the cosmic neutrino background in the early Universe. We consider the beta-decaying (e.g., 3H) and EC-decaying (e.g., 163Ho) nuclei as the promising targets to capture relic neutrinos in the laboratory. We calculate the capture rates of relic electron neutrinos and antineutrinos against the corresponding beta decay or electron capture (EC) decay backgrounds in the (3+Ns) flavor mixing scheme, and discuss the future prospect in terms of the PTOLEMY project. We stress that such direct measurements of hot DM might not be hopeless in the long term.

  13. A prototype direct-detection CCD for protein crystallography

    PubMed Central

    Green, Katherine S.; Szebenyi, Doletha M. E.; Boggs, Kasey; Bredthauer, Richard; Tate, Mark W.; Gruner, Sol M.

    2013-01-01

    The fabrication and testing of a prototype deep-depletion direct-conversion X-ray CCD detector are described. The device is fabricated on 600 µm-thick high-resistivity silicon, with 24 × 24 µm pixels in a 4k × 4k pixel format. Calibration measurements and the results of initial protein crystallography experiments at the Cornell High Energy Synchrotron Source (CHESS) F1 beamline are described, as well as suggested improvements for future versions of the detector. PMID:24046505

  14. Direct detection of a single photon by humans.

    PubMed

    Tinsley, Jonathan N; Molodtsov, Maxim I; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  15. Direct detection of a single photon by humans

    PubMed Central

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  16. Frequency-agile bandpass filter for direct detection lidar receivers.

    PubMed

    Gittins, C M; Lawrence, W G; Marinelli, W J

    1998-12-20

    We discuss the development of a frequency-agile receiver for CO(2) laser-based differential absorption lidar (DIAL) systems. The receiver is based on the insertion of a low-order tunable etalon into the detector field of view. The incorporation of the etalon into the receiver reduces system noise by decreasing the instantaneous spectral bandwidth of the IR detector to a narrow wavelength range centered on the transmitted CO(2) laser line, thereby improving the overall D* of the detection system. A consideration of overall lidar system performance results in a projected factor of a 2-7 reduction in detector system noise, depending on the characteristics of the environment being probed. These improvements can play a key role in extending the ability of DIAL systems to monitor chemical releases from long standoff distances.

  17. Xenon bubble chambers for direct dark matter detection

    NASA Astrophysics Data System (ADS)

    Levy, C.; Fallon, S.; Genovesi, J.; Khaitan, D.; Klimov, K.; Mock, J.; Szydagis, M.

    2016-03-01

    The search for dark matter is one of today's most exciting fields. As bigger detectors are being built to increase their sensitivity, background reduction is an ever more challenging issue. To this end, a new type of dark matter detector is proposed, a xenon bubble chamber, which would combine the strengths of liquid xenon TPCs, namely event by event energy resolution, with those of a bubble chamber, namely insensitivity to electronic recoils. In addition, it would be the first time ever that a dark matter detector is active on all three detection channels, ionization and scintillation characteristic of xenon detectors, and heat through bubble formation in superheated fluids. Preliminary simulations show that, depending on threshold, a discrimination of 99.99% to 99.9999+% can be achieved, which is on par or better than many current experiments. A prototype is being built at the University at Albany, SUNY. The prototype is currently undergoing seals, thermal, and compression testing.

  18. Development of colorimetric solid phase extraction (C-SPE) for in-flight monitoring of spacecraft water supplies

    NASA Astrophysics Data System (ADS)

    Gazda, Daniel Bryan

    2004-12-01

    Colorimetric solid phase extraction (C-SPE) is a sorption-spectrophotometric technique that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water samples. In C-SPE, a syringe is used to meter a known volume of sample through a membrane impregnated with a selective colorimetric reagent along with any additives required to optimize the complexation of the reagent and analyte. As the sample is passed through the membrane, analytes are extracted and complexed, leading to a detectable change in the optical characteristics of the membrane. The analyte-reagent complex is then quantified directly on the membrane, using a hand-held diffuse reflectance spectrophotometer. This dissertation focuses on the development, ground testing, and microgravity flight demonstration of C-SPE methods to meet the near- and long-term water quality monitoring needs of NASA. To this end, the ability of C-SPE to function in a microgravity environment was tested through performance evaluations of methods for the determination of the biocidal agents silver(I) and iodine on the KC-135 microgravity simulator. The biocidal iodine platform was investigated further to determine which iodine species is responsible for the C-SPE signal. Through systematic comparisons of C-SPE results and UV-Visible absorbance studies it was determined that biocidally active I2 is the iodine species complexed by poly(vinylpyrrolidone). The application of C-SPE to additional target water quality parameters is demonstrated through the determination of nickel(II), a metal leachate found in archived water samples from the International Space Station, using dimethylglyoxime. This method introduced a new variation of C-SPE, the quantification of trace analytes based on the collection of an insoluble, colored precipitate. The nickel(II) method was then combined with the method for biocidal silver(I) and a new method to measure sample pH to create a

  19. CRISPRdigger: detecting CRISPRs with better direct repeat annotations.

    PubMed

    Ge, Ruiquan; Mai, Guoqin; Wang, Pu; Zhou, Manli; Luo, Youxi; Cai, Yunpeng; Zhou, Fengfeng

    2016-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) are important genetic elements in many bacterial and archaeal genomes, and play a key role in prokaryote immune systems' fight against invasive foreign elements. The CRISPR system has also been engineered to facilitate target gene editing in eukaryotic genomes. Using the common features of mis-annotated CRISPRs in prokaryotic genomes, this study proposed an accurate de novo CRISPR annotation program CRISPRdigger, which can take a partially assembled genome as its input. A comprehensive comparison with the three existing programs demonstrated that CRISPRdigger can recover more Direct Repeats (DRs) for CRISPRs and achieve a higher accuracy for a query genome. The program was implemented by Perl and all the parameters had default values, so that a user could annotate CRISPRs in a query genome by supplying only a genome sequence in the FASTA format. All the supplementary data are available at http://www.healthinformaticslab.org/supp/. PMID:27596864

  20. Direct detection of variable tropospheric clouds near Titan's south pole.

    PubMed

    Brown, Michael E; Bouchez, Antonin H; Griffith, Caitlin A

    Atmospheric conditions on Saturn's largest satellite, Titan, allow the possibility that it could possess a methane condensation and precipitation cycle with many similarities to Earth's hydrological cycle. Detailed imaging studies of Titan have hitherto shown no direct evidence for tropospheric condensation clouds, although there has been indirect spectroscopic evidence for transient clouds. Here we report images and spectra of Titan that show clearly transient clouds, concentrated near the south pole, which is currently near the point of maximum solar heating. The discovery of these clouds demonstrates the existence of condensation and localized moist convection in Titan's atmosphere. Their location suggests that methane cloud formation is controlled seasonally by small variations in surface temperature, and that the clouds will move from the south to the north pole on a 15-year timescale.