Science.gov

Sample records for direct detection constraints

  1. Self-interacting dark matter without direct detection constraints

    NASA Astrophysics Data System (ADS)

    Zhang, Yue

    2017-03-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  2. Forecast constraints on inflation from combined CMB and gravitational wave direct detection experiments

    SciTech Connect

    Kuroyanagi, Sachiko; Gordon, Christopher; Silk, Joseph; Sugiyama, Naoshi

    2010-04-15

    We study how direct detection of the inflationary gravitational wave background constrains inflationary parameters and complements CMB polarization measurements. The error ellipsoids calculated using the Fisher information matrix approach with Planck and the direct detection experiment, Big Bang Observer (BBO), show different directions of parameter degeneracy, and the degeneracy is broken when they are combined. For a slow-roll parametrization, we show that BBO could significantly improve the constraints on the tensor-to-scalar ratio compared with Planck alone. We also look at a quadratic and a natural inflation model. In both cases, if the temperature of reheating is also treated as a free parameter, then the addition of BBO can significantly improve the error bars. In the case of natural inflation, we find that the addition of BBO could even partially improve the error bars of a cosmic variance-limited CMB experiment.

  3. First Direct Detection Constraints on eV-Scale Hidden Photon Dark Matter with DAMIC at SNOLAB

    SciTech Connect

    Aguilar-Arevalo, A.; et al.

    2016-11-09

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  4. Updated collider and direct detection constraints on Dark Matter models for the Galactic Center gamma-ray excess

    DOE PAGES

    Escudero, Miguel; Hooper, Dan; Witte, Samuel J.

    2017-02-20

    Utilizing an exhaustive set of simplified models, we revisit dark matter scenarios potentially capable of generating the observed Galactic Center gamma-ray excess, updating constraints from the LUX and PandaX-II experiments, as well as from the LHC and other colliders. We identify a variety of pseudoscalar mediated models that remain consistent with all constraints. In contrast, dark matter candidates which annihilate through a spin-1 mediator are ruled out by direct detection constraints unless the mass of the mediator is near an annihilation resonance, or the mediator has a purely vector coupling to the dark matter and a purely axial coupling tomore » Standard Model fermions. Furthermore, all scenarios in which the dark matter annihilates through t-channel processes are now ruled out by a combination of the constraints from LUX/PandaX-II and the LHC.« less

  5. Updated collider and direct detection constraints on Dark Matter models for the Galactic Center gamma-ray excess

    NASA Astrophysics Data System (ADS)

    Escudero, Miguel; Hooper, Dan; Witte, Samuel J.

    2017-02-01

    Utilizing an exhaustive set of simplified models, we revisit dark matter scenarios potentially capable of generating the observed Galactic Center gamma-ray excess, updating constraints from the LUX and PandaX-II experiments, as well as from the LHC and other colliders. We identify a variety of pseudoscalar mediated models that remain consistent with all constraints. In contrast, dark matter candidates which annihilate through a spin-1 mediator are ruled out by direct detection constraints unless the mass of the mediator is near an annihilation resonance, or the mediator has a purely vector coupling to the dark matter and a purely axial coupling to Standard Model fermions. All scenarios in which the dark matter annihilates through t-channel processes are now ruled out by a combination of the constraints from LUX/PandaX-II and the LHC.

  6. Constraints on Universal Extra-Dimensional Dark Matter from Direct Detection Results

    NASA Astrophysics Data System (ADS)

    Torpin, Trevor; Duda, Gintaras

    2011-04-01

    Detection of dark matter is one of the most challenging and important problems in astro-particle physics. One theory that produces a viable particle dark matter candidate is Universal Extra Dimensions (UED), in which the existence of a 4th spatial dimension is theorized. The extra dimension is not seen because it is compactifed on a circular orbifold whose radius is too small to be observed with current technology. What separates this theory over other Kaluza-Klein-type theories is that UED allows all standard model particles and fields to propagate in the extra dimension. The dark matter candidate in UED theories is a stable particle known as the Lightest Kaluza-Klein Particle or LKP, and the LKP can exist with sufficient relic density to serve as the dark matter. This work will present bounds on UED model parameters from direct dark matter searches such as the CDMS II.

  7. Detection of the integrated Sachs-Wolfe effect and corresponding dark energy constraints made with directional spherical wavelets

    NASA Astrophysics Data System (ADS)

    McEwen, J. D.; Vielva, P.; Hobson, M. P.; Martínez-González, E.; Lasenby, A. N.

    2007-04-01

    Using a directional spherical wavelet analysis we detect the integrated Sachs-Wolfe (ISW) effect, indicated by a positive correlation between the first-year Wilkinson Microwave Anisotropy Probe (WMAP) and NRAO VLA Sky Survey (NVSS) data. Detections are made using both a directional extension of the spherical Mexican hat wavelet and the spherical butterfly wavelet. We examine the possibility of foreground contamination and systematics in the WMAP data and conclude that these factors are not responsible for the signal that we detect. The wavelet analysis inherently enables us to localize on the sky those regions that contribute most strongly to the correlation. On removing these localized regions the correlation that we detect is reduced in significance, as expected, but it is not eliminated, suggesting that these regions are not the sole source of correlation between the data. This finding is consistent with predictions made using the ISW effect, where one would expect weak correlations over the entire sky. In a flat universe the detection of the ISW effect provides direct and independent evidence for dark energy. We use our detection to constrain dark energy parameters by deriving a theoretical prediction for the directional wavelet covariance statistic for a given cosmological model. Comparing these predictions with the data we place constraints on the equation-of-state parameter w and the vacuum energy density ΩΛ. We also consider the case of a pure cosmological constant, that is, w = -1. For this case we rule out a zero cosmological constant at greater than the 99.9 per cent significance level. All parameter estimates that we obtain are consistent with the standard cosmological concordance model values. Although wavelets perform very well when attempting to detect the ISW effect since one may probe only the regions where the signal is present, once all information is incorporated when computing parameter estimates, the performance of the wavelet analysis is

  8. Topological Constraints in Directed Polymer Melts.

    PubMed

    Serna, Pablo; Bunin, Guy; Nahum, Adam

    2015-11-27

    Polymers in a melt may be subject to topological constraints, as in the example of unlinked polymer rings. How to do statistical mechanics in the presence of such constraints remains a fundamental open problem. We study the effect of topological constraints on a melt of directed polymers, using simulations of a simple quasi-2D model. We find that fixing the global topology of the melt to be trivial changes the polymer conformations drastically. Polymers of length L wander in the transverse direction only by a distance of order (lnL)^{ζ} with ζ≃1.5. This is strongly suppressed in comparison with the Brownian L^{1/2} scaling which holds in the absence of the topological constraint. It is also much smaller than the predictions of standard heuristic approaches-in particular the L^{1/4} of a mean-field-like "array of obstacles" model-so our results present a sharp challenge to theory. Dynamics are also strongly affected by the constraints, and a tagged monomer in an infinite system performs logarithmically slow subdiffusion in the transverse direction. To cast light on the suppression of the strands' wandering, we analyze the topological complexity of subregions of the melt: the complexity is also logarithmically small, and is related to the wandering by a power law. We comment on insights the results give for 3D melts, directed and nondirected.

  9. Motion object detection by three-view constraint using moving camera

    NASA Astrophysics Data System (ADS)

    Yang, Wei; Gu, Guohua; Xu, Fuyuan

    2015-08-01

    We propose a three-view constraint for the motion object detection using moving camera. The proposed method classifies feature points in the video sequence into background or motion object by applying the epipolar constraint and a novel geometric constraint called the "three-view distance constraint". The three-view distance constraint, being the main contribution of this paper, is derived from the relative camera poses in three different views and implemented within the detection framework. Unlike the epipolar constraint, the three-view distance constraint modifies the surface degradation to the line degradation. The three-view distance constraint is capable of detecting moving objects followed by a moving camera in the same direction. We evaluate the proposed method with several video sequences to demonstrate the effectiveness and robustness of the three-view distance constraint.

  10. A new geometric constraint method of moving object detection using moving camera

    NASA Astrophysics Data System (ADS)

    Yang, Wei; Gu, Guohua; Wang, Wenjuan

    2015-09-01

    We propose a three-view constraint for the motion object detection using moving camera. The proposed method classifies feature points in the video sequence into background or motion object by applying the epipolar constraint and a novel geometric constraint called the "Three-view Distance Constraint". The three-view distance constraint, being the main contribution of this paper, is derived from the relative camera poses in three different views and implemented within the detection framework. Unlike the epipolar constraint, the three-view distance constraint modifies the surface degradation to the line degradation. The three-view distance constraint is capable of detecting moving objects followed by a moving camera in the same direction . We evaluate the proposed method with several video sequences to demonstrate the effectiveness and robustness of the three-view distance constraint.

  11. Detecting Extrasolar Planets Directly

    NASA Astrophysics Data System (ADS)

    Guenther, E. W.; Neuhäuser, R.; Huélamo, N.; Ott, T.; Brandner, W.; Alves, J.; Comerón, F.; Eckart, A.; Hatzes, A.

    Up to now, all extrasolar planets have been found by means of indirect methods. Direct detection of planets orbiting even the nearest stars seems at first glance to be impossible with present day equipment, because of the enormous difference in brightness between the star and the planet, and the small angular separation between them. However, young planets which are still in the contraction phase of evolution are comparatively bright in the infrared, and since many of the extrasolar planets detected have excentric orbits, where they are most of the time at a relatively large distance from the stars, the prospect of detecting young planets directly is much better. In fact, it is principle be possible to detect an extrasolar giant planet, if the planet is younger than 100 millon years, and if the distance is less than 100 pc. Three years ago we thus have embarked on a survey to observe more than one-hundred young, nearby stars in the near infrared. In this talk, we will review the status of the survey. In order to find out whether these stars have additionally a planet at a small distance from the star, we also carried out sensitive radial velocity observation of a subsample using an iodine-cell and the Echelle spectrograph of the Alfred-Jensch Telescope in Tautenburg.

  12. Directional Antineutrino Detection

    NASA Astrophysics Data System (ADS)

    Safdi, B. R.; Suerfu, J.

    2014-12-01

    We propose the first truly directional antineutrino detector for antineutrinos near the threshold for the inverse beta decay (IBD) of hydrogen, with potential applications including the spatial mapping of geo-neutrinos, searches for stellar antineutrinos, and the monitoring of nuclear reactors. The detector consists of adjacent and separated target and neutron-capture layers. The IBD events, which result in a neutron and a positron, take place in the target layers. These layers are thin enough so that the neutrons escape without scattering elastically. The neutrons are detected in the thicker neutron-capture layers. The location of the IBD event is determined from the energy deposited by the positron as it slows in the medium and from the two gamma rays that come from the positron annihilation. Since the neutron recoils in the direction of the antineutrino's motion, a line may then be drawn between the IBD event location and the neutron-capture location to approximate the antineutrino's velocity. In some events, we may even measure the positron's velocity, which further increases our ability to reconstruct the antineutrino's direction of motion. Our method significantly improves upon previous methods by allowing the neutron to freely travel a long distance before diffusing and being captured. Moreover, our design is a straightforward modification of existing antineutrino detectors; a prototype could easily be built with existing technology. We verify our design through Monte Carlo simulations in Geant4, using commercially-available boron-loaded plastic scintillators for the target and neutron-capture layer materials. We are able to discriminate from background using multiple coincidence signatures within a short, ~microsecond time interval. We conclude that the detector could likely operate above ground with minimal shielding.

  13. Methodological Constraints for Detecting the Modality Effect

    ERIC Educational Resources Information Center

    Schoor, Cornelia; Bannert, Maria; Jahn, Verena

    2011-01-01

    Introduction: The aim of our research was to investigate the modality effect in more detail by measuring it in a direct way. Two studies were conducted using the same subject and material. Method: Computer-based learning material was presented on several screens, each containing a short text and a picture. Modality was varied by presenting written…

  14. Automatic Constraint Detection for 2D Layout Regularization.

    PubMed

    Jiang, Haiyong; Nan, Liangliang; Yan, Dong-Ming; Dong, Weiming; Zhang, Xiaopeng; Wonka, Peter

    2016-08-01

    In this paper, we address the problem of constraint detection for layout regularization. The layout we consider is a set of two-dimensional elements where each element is represented by its bounding box. Layout regularization is important in digitizing plans or images, such as floor plans and facade images, and in the improvement of user-created contents, such as architectural drawings and slide layouts. To regularize a layout, we aim to improve the input by detecting and subsequently enforcing alignment, size, and distance constraints between layout elements. Similar to previous work, we formulate layout regularization as a quadratic programming problem. In addition, we propose a novel optimization algorithm that automatically detects constraints. We evaluate the proposed framework using a variety of input layouts from different applications. Our results demonstrate that our method has superior performance to the state of the art.

  15. Direct detection with dark mediators

    NASA Astrophysics Data System (ADS)

    Curtin, David; Surujon, Ze'ev; Tsai, Yuhsin

    2014-11-01

    We introduce dark mediator Dark Matter (dmDM) where the dark and visible sectors are connected by at least one light mediator ϕ carrying the same dark charge that stabilizes DM. ϕ is coupled to the Standard Model via an operator q bar qϕϕ* / Λ, and to dark matter via a Yukawa coupling yχχc bar χϕ. Direct detection is realized as the 2 → 3 process χN → χ bar Nϕ at tree-level for mϕ ≲ 10 keV and small Yukawa coupling, or alternatively as a loop-induced 2 → 2 process χN → χN. We explore the direct-detection consequences of this scenario and find that a heavy O (100 GeV) dmDM candidate fakes different O (10 GeV) standard WIMPs in different experiments. Large portions of the dmDM parameter space are detectable above the irreducible neutrino background and not yet excluded by any bounds. Interestingly, for the mϕ range leading to novel direct detection phenomenology, dmDM is also a form of Self-Interacting Dark Matter (SIDM), which resolves inconsistencies between dwarf galaxy observations and numerical simulations.

  16. Plasma dark matter direct detection

    SciTech Connect

    Clarke, J.D.; Foot, R. E-mail: rfoot@unimelb.edu.au

    2016-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken U(1)' gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed U(1)' neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless 'dark photon' (the U(1)' gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA annual modulation signal is due primarily to electron recoils (or even a combination of electron recoils and nuclear recoils). The importance of diurnal modulation (in addition to annual modulation) as a means of probing this kind of dark matter is also emphasised.

  17. DIRECT IMAGING CONSTRAINTS ON THE PUTATIVE EXOPLANET 14 Her C

    SciTech Connect

    Rodigas, Timothy J.; Males, Jared R.; Hinz, Philip M.; Knox, Russell P.; Mamajek, Eric E.

    2011-05-01

    We present results of deep direct imaging of the radial velocity (RV) planet-host star 14 Her (=GJ 614, HD 145675), obtained in the L' band with the Clio-2 camera and the MMT adaptive optics system. This star has one confirmed planet and an unconfirmed outer companion, suggested by residuals in the RV data. The orbital parameters of the unconfirmed object are not well constrained since many mass/semimajor axis configurations can fit the available data. The star has been directly imaged several times, but none of the campaigns has ruled out sub-stellar companions. With {approx}2.5 hr of integration, we rule out at 5{sigma} confidence {approx}>18 M{sub J} companions beyond {approx}25 AU, based on the Baraffe et al. COND mass-luminosity models. Combining our detection limits with fits to the RV data and analytic dynamical analysis, we constrain the orbital parameters of 14 Her c to be 3 {approx}< m/M{sub J} {approx}<42, 7 {approx}< a/AU {approx}<25, and e {approx}< 0.5. A wealth of information can be obtained from RV/direct imaging overlap, especially with deep imaging as this work shows. The collaboration between RV and direct imaging will become more important in the coming years as the phase space probed by each technique converges. Future studies involving RV/imaging overlap should be sure to consider the effects of a potential planet's projected separation, as quoting limits assuming face-on orientation will be misleading.

  18. Constraints on the detection of cryovolcanic plumes on Europa

    NASA Astrophysics Data System (ADS)

    Quick, Lynnae C.; Barnouin, Olivier S.; Prockter, Louise M.; Patterson, G. Wesley

    2013-09-01

    Surface venting is a common occurrence on several outer solar system satellites. Spacecraft have observed plumes erupting from the geologically young surfaces of Io, Triton and Enceladus. Europa also has a relatively young surface and previous studies have suggested that cryovolcanic eruptions may be responsible for the production of low-albedo deposits surrounding lenticulae and along triple band margins and lineae. Here, we have used the projected thicknesses of these deposits as constraints to determine the lifetimes of detectable cryovolcanic plumes that may have emplaced them. In an effort to explore the feasibility of detection of the particle component of plumes by spacecraft cameras operating at visible wavelengths, we present a conservative model to estimate plume characteristics such as height, eruption velocity, and optical depth under a variety of conditions. We find that cryovolcanic plumes on Europa are likely to be fairly small in stature with heights between 2.5 and 26 km, and eruption velocities between 81 and 261 m/s, respectively. Under these conditions and assuming that plumes are products of steady eruptions with particle radii of 0.5 μm, our model suggests that easily detectable plumes will have optical depths, τ, greater than or equal to 0.04, and that their lifetimes may be no more than 300,000 years. Plume detection may be possible if high phase angle limb observations and/or stereo imaging of the surface are undertaken in areas where eruptive activity is likely to occur. Cameras with imaging resolutions greater than 50 m/pixel should be used to make all observations. Future missions could employ the results of our model in searches for plume activity at Europa.

  19. Directional detection as a strategy to discover Galactic Dark Matter

    NASA Astrophysics Data System (ADS)

    Billard, J.; Mayet, F.; Macías-Pérez, J. F.; Santos, D.

    2010-07-01

    Directional detection of Galactic Dark Matter is a promising search strategy for discriminating WIMP events from background. Technical progress on gaseous detectors and read-outs has permitted the design and construction of competitive experiments. However, to take full advantage of this powerful detection method, one need to be able to extract information from an observed recoil map to identify a WIMP signal. We present a comprehensive formalism, using a map-based likelihood method allowing to recover the main incoming direction of the signal and its significance, thus proving its Galactic origin. This is a blind analysis intended to be used on any directional data. Constraints are deduced in the (σ,m) plane and systematic studies are presented in order to show that, using this analysis tool, unambiguous Dark Matter detection can be achieved on a large range of exposures and background levels.

  20. Global limits and interference patterns in dark matter direct detection

    SciTech Connect

    Catena, Riccardo; Gondolo, Paolo

    2015-08-13

    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  1. Global limits and interference patterns in dark matter direct detection

    SciTech Connect

    Catena, Riccardo; Gondolo, Paolo E-mail: paolo.gondolo@utah.edu

    2015-08-01

    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  2. Direct and indirect detection of dissipative dark matter

    SciTech Connect

    Fan, JiJi; Katz, Andrey; Shelton, Jessie E-mail: katz.andrey@gmail.com

    2014-06-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints.

  3. Thrust Direction Optimization: Satisfying Dawn's Attitude Agility Constraints

    NASA Technical Reports Server (NTRS)

    Whiffen, Gregory J.

    2013-01-01

    The science objective of NASA's Dawn Discovery mission is to explore the giant asteroid Vesta and the dwarf planet Ceres, the two largest members of the main asteroid belt. Dawn successfully completed its orbital mission at Vesta. The Dawn spacecraft has complex, difficult to quantify, and in some cases severe limitations on its attitude agility. The low-thrust transfers between science orbits at Vesta required very complex time varying thrust directions due to the strong and complex gravity and various science objectives. Traditional low-thrust design objectives (like minimum change in velocity or minimum transfer time) often result in thrust direction time evolutions that cannot be accommodated with the attitude control system available on Dawn. This paper presents several new optimal control objectives, collectively called thrust direction optimization that were developed and turned out to be essential to the successful navigation of Dawn at Vesta.

  4. Thrust Direction Optimization: Satisfying Dawn's Attitude Agility Constraints

    NASA Technical Reports Server (NTRS)

    Whiffen, Gregory J.

    2013-01-01

    The science objective of NASA's Dawn Discovery mission is to explore the two largest members of the main asteroid belt, the giant asteroid Vesta and the dwarf planet Ceres. Dawn successfully completed its orbital mission at Vesta. The Dawn spacecraft has complex, difficult to quantify, and in some cases severe limitations on its attitude agility. The low-thrust transfers between science orbits at Vesta required very complex time varying thrust directions due to the strong and complex gravity and various science objectives. Traditional thrust design objectives (like minimum (Delta)V or minimum transfer time) often result in thrust direction time evolutions that can not be accommodated with the attitude control system available on Dawn. This paper presents several new optimal control objectives, collectively called thrust direction optimization that were developed and necessary to successfully navigate Dawn through all orbital transfers at Vesta.

  5. Gaze Direction Detection in Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Forgeot d'Arc, Baudouin; Delorme, Richard; Zalla, Tiziana; Lefebvre, Aline; Amsellem, Frédérique; Moukawane, Sanaa; Letellier, Laurence; Leboyer, Marion; Mouren, Marie-Christine; Ramus, Franck

    2017-01-01

    Detecting where our partners direct their gaze is an important aspect of social interaction. An atypical gaze processing has been reported in autism. However, it remains controversial whether children and adults with autism spectrum disorder interpret indirect gaze direction with typical accuracy. This study investigated whether the detection of…

  6. Experimental constraint on dark matter detection with optical atomic clocks

    NASA Astrophysics Data System (ADS)

    Wcisło, P.; Morzyński, P.; Bober, M.; Cygan, A.; Lisak, D.; Ciuryło, R.; Zawada, M.

    2016-12-01

    The total mass density of the Universe appears to be dominated by dark matter. However, beyond its gravitational interactions at the galactic scale, little is known about its nature1. Several proposals have been advanced in recent years for the detection of dark matter2-4. In particular, a network of atomic clocks could be used to search for transient indicators of hypothetical dark matter5 in the form of stable topological defects; for example, monopoles, strings or domain walls6. The clocks become desynchronized when a dark-matter object sweeps through the network. This pioneering approach5 requires a comparison between at least two distant optical atomic clocks7-9. Here, by exploiting differences in the susceptibilities of the atoms and the cavity to the fine-structure constant10,11, we show that a single optical atomic clock12 is already sensitive to dark-matter events. This implies that existing optical atomic clocks13,14 can serve as a global topological-defect dark-matter observatory, without any further developments in experimental apparatus or the need for long phase-noise-compensated optical-fibre links15. Using optical atomic clocks, we explored a new dimension of astrophysical observations by constraining the strength of atomic coupling to hypothetical dark-matter cosmic objects. Under the conditions of our experiments, the degree of constraint was found to exceed the previously reported limits16 by more than three orders of magnitude.

  7. The US Dark Matter Direct Detection Program

    NASA Astrophysics Data System (ADS)

    Baer, Howard

    2007-11-01

    Recently, the joint HEPAP/AAAS DMSAG (Dark matter Scientific Assessment Group) outlined a strategy for the future of dark matter direct detection. I will discuss the motivations for dark matter detection, possible DM candidates from theory, and the variety of techniques proposed to push the search forward into the most interesting regimes of parameter space. These techniques include cryogenic detection, detection via noble liquids, and directional detection. Coupled with results from LHC in the next few years, we may be on our way to revealing the identity of the mysterious dark matter particle.

  8. Dark matter directional detection: comparison of the track direction determination

    NASA Astrophysics Data System (ADS)

    Couturier, C.; Zopounidis, J. P.; Sauzet, N.; Naraghi, F.; Santos, D.

    2017-01-01

    Several directional techniques have been proposed for a directional detection of Dark matter, among others anisotropic crystal detectors, nuclear emulsion plates, and low-pressure gaseous TPCs. The key point is to get access to the initial direction of the nucleus recoiling due to the elastic scattering by a WIMP. In this article, we aim at estimating, for each method, how the information of the recoil track initial direction is preserved in different detector materials. We use the SRIM simulation code to emulate the motion of the first recoiling nucleus in each material. We propose the use of a new observable, D, to quantify the preservation of the initial direction of the recoiling nucleus in the detector. We show that in an emulsion mix and an anisotropic crystal, the initial direction is lost very early, while in a typical TPC gas mix, the direction is well preserved.

  9. Goal Directed Model Inversion: Learning Within Domain Constraints

    NASA Technical Reports Server (NTRS)

    Colombano, Silvano P.; Compton, Michael; Raghavan, Bharathi; Lum, Henry, Jr. (Technical Monitor)

    1994-01-01

    Goal Directed Model Inversion (GDMI) is an algorithm designed to generalize supervised learning to the case where target outputs are not available to the learning system. The output of the learning system becomes the input to some external device or transformation, and only the output of this device or transformation can be compared to a desired target. The fundamental driving mechanism of GDMI is to learn from success. Given that a wrong outcome is achieved, one notes that the action that produced that outcome "would have been right if the outcome had been the desired one." The algorithm makes use of these intermediate "successes" to achieve the final goal. A unique and potentially very important feature of this algorithm is the ability to modify the output of the learning module to force upon it a desired syntactic structure. This differs from ordinary supervised learning in the following way: in supervised learning the exact desired output pattern must be provided. In GDMI instead, it is possible to require simply that the output obey certain rules, i.e., that it "make sense" in some way determined by the knowledge domain. The exact pattern that will achieve the desired outcome is then found by the system. The ability to impose rules while allowing the system to search for its own answers in the context of neural networks is potentially a major breakthrough in two ways: 1) it may allow the construction of networks that can incorporate immediately some important knowledge, i.e. would not need to learn everything from scratch as normally required at present, and 2) learning and searching would be limited to the areas where it is necessary, thus facilitating and speeding up the process. These points are illustrated with examples from robotic path planning and parametric design.

  10. Goal Directed Model Inversion: Learning Within Domain Constraints

    NASA Technical Reports Server (NTRS)

    Colombano, Silvano P.; Compton, Michael; Raghavan, Bharathi; Friedland, Peter (Technical Monitor)

    1994-01-01

    Goal Directed Model Inversion (GDMI) is an algorithm designed to generalize supervised learning to the case where target outputs are not available to the learning system. The output of the learning system becomes the input to some external device or transformation, and only the output of this device or transformation can be compared to a desired target. The fundamental driving mechanism of GDMI is to learn from success. Given that a wrong outcome is achieved, one notes that the action that produced that outcome "would have been right if the outcome had been the desired one." The algorithm makes use of these intermediate "successes" to achieve the final goal. A unique and potentially very important feature of this algorithm is the ability to modify the output of the learning module to force upon it a desired syntactic structure. This differs from ordinary supervised learning in the following way: in supervised learning the exact desired output pattern must be provided. In GDMI instead, it is possible to require simply that the output obey certain rules, i.e., that it "make sense" in some way determined by the knowledge domain. The exact pattern that will achieve the desired outcome is then found by the system. The ability to impose rules while allowing the system to search for its own answers in the context of neural networks is potentially a major breakthrough in two ways: (1) it may allow the construction of networks that can incorporate immediately some important knowledge, i.e., would not need to learn everything from scratch as normally required at present; and (2) learning and searching would be limited to the areas where it is necessary, thus facilitating and speeding up the process. These points are illustrated with examples from robotic path planning and parametric design.

  11. PROJECTED CONSTRAINTS ON THE COSMIC (SUPER)STRING TENSION WITH FUTURE GRAVITATIONAL WAVE DETECTION EXPERIMENTS

    SciTech Connect

    Sanidas, Sotirios A.; Battye, Richard A.; Stappers, Benjamin W. E-mail: rbattye@jb.man.ac.uk

    2013-02-10

    We present projected constraints on the cosmic string tension, G{mu}/c {sup 2}, that could be achieved by future gravitational wave detection experiments and express our results as semi-analytic relations of the form G{mu}({Omega}{sub gw} h {sup 2})/c {sup 2}, to allow for direct computation of the tension constraints for future experiments. These results can be applied to new constraints on {Omega}{sub gw} h {sup 2} as they are imposed. Experiments operating in different frequency bands probe different parts of the gravitational wave spectrum of a cosmic string network and are sensitive to different uncertainties in the underlying cosmic string model parameters. We compute the gravitational wave spectra of cosmic string networks based on the one-scale model, covering all the parameter space accessed by each experiment that is strongly dependent on the birth scale of loops relative to the horizon, {alpha}. The upper limits on the string tension avoid any assumptions on the model parameters. We perform this investigation for Pulsar Timing Array experiments of different durations, as well as ground-based and space-borne interferometric detectors.

  12. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  13. Direct/indirect detection signatures of nonthermally produced dark matter

    SciTech Connect

    Nagai, Minoru; Nakayama, Kazunori

    2008-09-15

    We study direct and indirect detection possibilities of neutralino dark matter produced nonthermally by, e.g., the decay of long-lived particles, as is easily implemented in the case of anomaly or mirage-mediation models. In this scenario, large self-annihilation cross sections are required to account for the present dark matter abundance, and it leads to significant enhancement of the gamma-ray signature from the galactic center and the positron flux from the dark matter annihilation. It is found that GLAST and PAMELA will find the signal or give tight constraints on such nonthermal production scenarios of neutralino dark matter.

  14. Testing keV sterile neutrino dark matter in future direct detection experiments

    NASA Astrophysics Data System (ADS)

    Campos, Miguel D.; Rodejohann, Werner

    2016-11-01

    We determine constraints on sterile neutrino warm dark matter through direct detection experiments, taking XENON100, XENON1T, and DARWIN as examples. If keV-scale sterile neutrinos scatter inelastically with bound electrons of the target material, an electron recoil signal is generated. This can be used to set limits on the sterile neutrino mass and its mixing with the active sector. While not competitive with astrophysical constraints from x-ray data, the constraints are the first direct laboratory bounds on sterile neutrino warm dark matter and will be in some parts of parameter space the strongest limits on keV-scale neutrinos.

  15. Biomarker detection technologies and future directions.

    PubMed

    Nimse, Satish Balasaheb; Sonawane, Mukesh Digambar; Song, Keum-Soo; Kim, Taisun

    2016-02-07

    Biomarkers play a vital role in disease detection and treatment follow-up. It is important to note that diseases in the early stage are typically treated with the greatest probability of success. However, due to various technical difficulties in current technologies for the detection of biomarkers, the potential of biomarkers is not explored completely. Therefore, the developments of technologies, which can enable the accurate detection of prostate cancer at an early stage with simple, experimental protocols are highly inevitable. This critical review evaluates the current methods and technologies used in the detection of biomarkers. The aim of this article is to provide a comprehensive review covering the advantages and disadvantages of the biomarker detection methods. Future directions for the development of technologies to achieve highly selective and sensitive detection of biomarkers for point-of-care applications are also commented on.

  16. Disentangling Dark Matter Dynamics with Directional Detection

    SciTech Connect

    Lisanti, Mariangela; Wacker, Jay G.; /SLAC

    2009-12-16

    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a non-minimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  17. Directional structures detection using steerable pyramid

    NASA Astrophysics Data System (ADS)

    Denis, Florence; Baskurt, Atilla M.

    2003-04-01

    The object of the work described in this paper concerns directional structures detection for particular aspects of inspection, such as scratches and marbling defect detection in leather images. Because of the very specific geometry of these structures, we intend to apply a multiscale and orientation-shiftable method. Scratches and marbling have various shapes and sizes. Multiscale approaches using oriented filters have proved to be efficient to detect such curvilinear patterns. We first use the information given by the increase of gray levels in the image to locate suspicious regions. The detection is then based on steerable filters, which can be steered to any orientation fixed by the user, and are synthesized using a limited number of basic filters. These filters are used in a recursive multi-scale transform: the steerable pyramid. Then, the curvilinear structures are extracted from the directional images at different scales.

  18. Kaluza-Klein Dark Matter: Direct Detection vis-a-vis LHC (2013 update)

    SciTech Connect

    Arrenberg, Sebastian; Baudis, Laura; Kong, Kyoungchul; Matchev, Konstantin T.; Yoo, Jonghee

    2013-07-24

    We present updated results on the complementarity between high-energy colliders and dark matter direct detection experiments in the context of Universal Extra Dimensions (UED). In models with relatively small mass splittings between the dark matter candidate and the rest of the (colored) spectrum, the collider sensitivity is diminished, but direct detection rates are enhanced. UED provide a natural framework to study such mass degeneracies. We discuss the detection prospects for the KK photon $\\gamma_1$ and the KK $Z$-boson $Z_1$, combining the expected LHC reach with cosmological constraints from WMAP/Planck, and the sensitivity of current or planned direct detection experiments. Allowing for general mass splittings, neither colliders, nor direct detection experiments by themselves can explore all of the relevant KK dark matter parameter space. Nevertheless, they probe different parameter space regions, and the combination of the two types of constraints can be quite powerful.

  19. Microgels for multiplex and direct fluorescence detection

    NASA Astrophysics Data System (ADS)

    Causa, Filippo; Aliberti, Anna; Cusano, Angela M.; Battista, Edmondo; Netti, Paolo A.

    2015-05-01

    Blood borne oligonucleotides fragments contain useful clinical information whose detection and monitoring represent the new frontier in liquid biopsy as they can transform the current diagnosis procedure. For instance, recent studies have identified a new class of circulating biomarkers such as s miRNAs, and demonstrated that changes in their concentration are closely associated with the development of cancer and other pathologies. However, direct detection of miRNAs in body fluids is particularly challenging and demands high sensitivity -concentration range between atto to femtomolarspecificity, and multiplexing Here we report on engineered multifunctional microgels and innovative probe design for a direct and multiplex detection of relevant clinical miRNAs in fluorescence by single particle assay. Polyethyleneglycol-based microgels have a coreshell architecture with two spectrally encoded fluorescent dyes for multiplex analyses and are endowed with fluorescent probes for miRNA detection. Encoding and detection fluorescence signals are distinguishable by not overlapping emission spectra. Tuneable fluorescence probe conjugation and corresponding emission confinement on single microgel allows for enhanced target detection. Such suspension array has indeed high selectivity and sensitivity with a detection limit of 10-15 M and a dynamic range from 10-9 to 10-15 M. We believe that sensitivity in the fM concentration range, signal background minimization, multiplexed capability and direct measurement of such microgels will translate into diagnostic benefits opening up new roots toward liquid biopsy in the context of point-of-care testing through an easy and fast detection of sensitive diagnostic biomarkers directly in serum.

  20. A Generalized Radiation Model for Human Mobility: Spatial Scale, Searching Direction and Trip Constraint

    PubMed Central

    Kang, Chaogui; Liu, Yu; Guo, Diansheng; Qin, Kun

    2015-01-01

    We generalized the recently introduced “radiation model”, as an analog to the generalization of the classic “gravity model”, to consolidate its nature of universality for modeling diverse mobility systems. By imposing the appropriate scaling exponent λ, normalization factor κ and system constraints including searching direction and trip OD constraint, the generalized radiation model accurately captures real human movements in various scenarios and spatial scales, including two different countries and four different cities. Our analytical results also indicated that the generalized radiation model outperformed alternative mobility models in various empirical analyses. PMID:26600153

  1. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  2. Dark matter direct-detection experiments

    NASA Astrophysics Data System (ADS)

    Marrodán Undagoitia, Teresa; Rauch, Ludwig

    2016-01-01

    In recent decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focusing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  3. Detection of directed information flow in biosignals.

    PubMed

    Winterhalder, Matthias; Schelter, Björn; Hesse, Wolfram; Schwab, Karin; Leistritz, Lutz; Timmer, Jens; Witte, Herbert

    2006-12-01

    Several analysis techniques have been developed for time series to detect interactions in multidimensional dynamic systems. When analyzing biosignals generated by unknown dynamic systems, awareness of the different concepts upon which these analysis techniques are based, as well as the particular aspects the methods focus on, is a basic requirement for drawing reliable conclusions. For this purpose, we compare four different techniques for linear time series analysis. In general, these techniques detect the presence of interactions, as well as the directions of information flow, in a multidimensional system. We review the different conceptual properties of partial coherence, a Granger causality index, directed transfer function, and partial directed coherence. The performance of these tools is demonstrated by application to linear dynamic systems.

  4. Closing supersymmetric resonance regions with direct detection experiments

    SciTech Connect

    Kelso, Chris

    2014-01-01

    One of the few remaining ways that neutralinos could potentially evade constraints from direct detection experiments is if they annihilate through a resonance, as can occur if 2m{sub χ⁰} falls within about ~10% of either m{sub A/H}, m{sub h}, or m{sub Z}. Assuming a future rate of progress among direct detection experiments that is similar to that obtained over the past decade, we project that within 7 years the light Higgs and Z pole regions will be entirely closed, while the remaining parameter space near the A/H resonance will require that 2m{sub χ₀} be matched to the central value (near m{sub A}) to within less than 4%. At this rate of progress, it will be a little over a decade before multi-ton direct detection experiments will be able to close the remaining, highly-tuned, regions of the A/H resonance parameter space.

  5. Physics from solar neutrinos in dark matter direct detection experiments

    NASA Astrophysics Data System (ADS)

    Cerdeño, David G.; Fairbairn, Malcolm; Jubb, Thomas; Machado, Pedro A. N.; Vincent, Aaron C.; Bœhm, Céline

    2016-05-01

    The next generation of dark matter direct detection experiments will be sensitive to both coherent neutrino-nucleus and neutrino-electron scattering. This will enable them to explore aspects of solar physics, perform the lowest energy measurement of the weak angle sin2 θ W to date, and probe contributions from new theories with light mediators. In this article, we compute the projected nuclear and electron recoil rates expected in several dark matter direct detection experiments due to solar neutrinos, and use these estimates to quantify errors on future measurements of the neutrino fluxes, weak mixing angle and solar observables, as well as to constrain new physics in the neutrino sector. Our analysis shows that the combined rates of solar neutrino events in second generation experiments (SuperCDMS and LZ) can yield a measurement of the pp flux to 2.5% accuracy via electron recoil, and slightly improve the 8B flux determination. Assuming a low-mass argon phase, projected tonne-scale experiments like DARWIN can reduce the uncertainty on both the pp and boron-8 neutrino fluxes to below 1%. Finally, we use current results from LUX, SuperCDMS and CDMSlite to set bounds on new interactions between neutrinos and electrons or nuclei, and show that future direct detection experiments can be used to set complementary constraints on the parameter space associated with light mediators.

  6. Direct Cavity Detection of Majorana Pairs

    NASA Astrophysics Data System (ADS)

    Dartiailh, Matthieu C.; Kontos, Takis; Douçot, Benoit; Cottet, Audrey

    2017-03-01

    No experiment could directly test the particle-antiparticle duality of Majorana fermions, so far. However, this property represents a necessary ingredient towards the realization of topological quantum computing schemes. Here, we show how to complete this task by using microwave techniques. The direct coupling between a pair of overlapping Majorana bound states and the electric field from a microwave cavity is extremely difficult to detect due to the self-adjoint character of Majorana fermions which forbids direct energy exchanges with the cavity. We show theoretically how this problem can be circumvented by using photoassisted tunneling to fermionic reservoirs. The absence of a direct microwave transition inside the Majorana pair in spite of the light-Majorana coupling would represent a smoking gun for the Majorana self-adjoint character.

  7. Wind measurement via direct detection lidar

    NASA Astrophysics Data System (ADS)

    Afek, I.; Sela, N.; Narkiss, N.; Shamai, G.; Tsadka, S.

    2013-10-01

    Wind sensing Lidar is considered a promising technology for high quality wind measurements required for various applications such as hub height wind resource assessment, power curve measurements and advanced, real time, forward looking turbine control. Until recently, the only available Lidar technology was based on coherent Doppler shift detection, whose market acceptance has been slow primarily due to its exuberant price. Direct detection Lidar technology provides an alternative to remote sensing of wind by incorporating high precision measurement, a robust design and an affordable price tag.

  8. On the direct detection of gravitational waves

    NASA Astrophysics Data System (ADS)

    Pustovoit, V. I.

    2016-10-01

    Different types of gravitational wave (GW) detectors are considered. It is noted that interferometric techniques offer the greatest prospects for GW registration due to their high sensitivity and extremely wide frequency band. Using laser interferometers, proposed as far back as 1962 in the work by M E Gertsenshtein and V I Pustovoit published in Russian (Zh. Eksp. Teor. Fiz., vol. 43, p. 605, 1962) and in English translation (Sov. Phys. JETP, vol. 16, p. 433, 1963), it proved possible for the first time to directly detect GW emission from a merger of two black holes. It is noted that the assertion that Gertsen-shtein-Pustovoit's work was unknown to some of those experts involved in direct GW detection is inconsistent with reality. The problems of high-power laser radiation affecting the electrostatic polarization of free-mass mirrors are discussed. It is shown that mirror polarization can lead to additional links with electrically conducting elements of the design resulting in the interferometer's reduced sensitivity. Some new prospects for developing high reflection structures are discussed and heat extraction problems are considered. This article is the revised and extended version of the report “On the first direct detection of gravitational waves” delivered by V I Pustovoit at the Scientific Session of the Physical Sciences Division of the Russian Academy of Sciences (March 2, 2016). All other reports presented at the session were published in the preceding issue of Physics-Uspekhi (September 2016) (see Refs [108, 111-113]). (Editorial note)

  9. Community detection in directed acyclic graphs

    NASA Astrophysics Data System (ADS)

    Speidel, Leo; Takaguchi, Taro; Masuda, Naoki

    2015-08-01

    Some temporal networks, most notably citation networks, are naturally represented as directed acyclic graphs (DAGs). To detect communities in DAGs, we propose a modularity for DAGs by defining an appropriate null model (i.e., randomized network) respecting the order of nodes. We implement a spectral method to approximately maximize the proposed modularity measure and test the method on citation networks and other DAGs. We find that the attained values of the modularity for DAGs are similar for partitions that we obtain by maximizing the proposed modularity (designed for DAGs), the modularity for undirected networks and that for general directed networks. In other words, if we neglect the order imposed on nodes (and the direction of links) in a given DAG and maximize the conventional modularity measure, the obtained partition is close to the optimal one in the sense of the modularity for DAGs. Contribution to the Topical Issue "Temporal Network Theory and Applications", edited by Petter Holme.

  10. Aberration features in directional dark matter detection

    SciTech Connect

    Bozorgnia, Nassim; Gelmini, Graciela B.; Gondolo, Paolo E-mail: gelmini@physics.ucla.edu

    2012-08-01

    The motion of the Earth around the Sun causes an annual change in the magnitude and direction of the arrival velocity of dark matter particles on Earth, in a way analogous to aberration of stellar light. In directional detectors, aberration of weakly interacting massive particles (WIMPs) modulates the pattern of nuclear recoil directions in a way that depends on the orbital velocity of the Earth and the local galactic distribution of WIMP velocities. Knowing the former, WIMP aberration can give information on the latter, besides being a curious way of confirming the revolution of the Earth and the extraterrestrial provenance of WIMPs. While observing the full aberration pattern requires extremely large exposures, we claim that the annual variation of the mean recoil direction or of the event counts over specific solid angles may be detectable with moderately large exposures. For example, integrated counts over Galactic hemispheres separated by planes perpendicular to Earth's orbit would modulate annually, resulting in Galactic Hemisphere Annual Modulations (GHAM) with amplitudes larger than the usual non-directional annual modulation.

  11. Light magnetic dark matter in direct detection searches

    NASA Astrophysics Data System (ADS)

    Del Nobile, Eugenio; Kouvaris, Chris; Panci, Paolo; Sannino, Francesco; Virkajärvi, Jussi

    2012-08-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders.

  12. Dynamic Probing for Intrusion Detection under Resource Constraints

    DTIC Science & Technology

    2013-06-01

    performance measure of regret, defined as the performance loss compared to that of a genie who knows the entire attack processes a priori and probes...performance as that of the omniscient genie . Index Terms—Intrusion detection, dynamic probing, non- stochastic multi-armed bandit, regret. I...dynamic probing strategy under the performance measure of regret, de ned as the performance loss compared to that of a genie who knows the entire attack

  13. A miniaturized adaptive microphone array under directional constraint utilizing aggregated microphones.

    PubMed

    Matsumoto, Mitsuharu; Hashimoto, Shuji

    2006-01-01

    This paper introduces a miniaturized microphone array using the Directionally Constrained Minimization of Power (DCMP) method, which utilizes the transfer functions of microphones located at the same place, namely aggregated microphones. The phased microphone array realizes a noise reduction and direction of arrival (DOA) estimation system according to differences in the arrival time, phase shift, and/or the level of the sound wave for each microphone. Hence it is difficult to miniaturize the microphone array. The objective of our research is to miniaturize the system size using aggregated microphones. In this paper, we first show that the phased microphone array system and the proposed aggregated microphone system can be described within the same framework. We then apply a microphone array under directional constraint to the aggregated microphones and compare the proposed method with the microphone array. We show the directional pattern of the aggregated microphones. We also show the experimental results regarding DOA estimation.

  14. Direct and indirect constraints on CP-violating Higgs-quark and Higgs-gluon interactions

    SciTech Connect

    Chien, Y. T.; Cirigliano, V.; Dekens, W.; de Vries, J.; Mereghetti, E.

    2016-02-01

    Here we investigate direct and indirect constraints on the complete set of anomalous CP-violating Higgs couplings to quarks and gluons originating from dimension-6 operators, by studying their signatures at the LHC and in electric dipole moments (EDMs). We also show that existing uncertainties in hadronic and nuclear matrix elements have a significant impact on the interpretation of EDM experiments, and we quantify the improvements needed to fully exploit the power of EDM searches. Currently, the best bounds on the anomalous CP-violating Higgs interactions come from a combination of EDM measurements and the data from LHC Run 1. We argue that Higgs production cross section and branching ratios measurements at the LHC Run 2 will not improve the constraints significantly. But, the bounds on the couplings scale roughly linearly with EDM limits, so that future theoretical and experimental EDM developments can have a major impact in pinning down interactions of the Higgs.

  15. Direct and indirect constraints on CP-violating Higgs-quark and Higgs-gluon interactions

    DOE PAGES

    Chien, Y. T.; Cirigliano, V.; Dekens, W.; ...

    2016-02-01

    Here we investigate direct and indirect constraints on the complete set of anomalous CP-violating Higgs couplings to quarks and gluons originating from dimension-6 operators, by studying their signatures at the LHC and in electric dipole moments (EDMs). We also show that existing uncertainties in hadronic and nuclear matrix elements have a significant impact on the interpretation of EDM experiments, and we quantify the improvements needed to fully exploit the power of EDM searches. Currently, the best bounds on the anomalous CP-violating Higgs interactions come from a combination of EDM measurements and the data from LHC Run 1. We argue thatmore » Higgs production cross section and branching ratios measurements at the LHC Run 2 will not improve the constraints significantly. But, the bounds on the couplings scale roughly linearly with EDM limits, so that future theoretical and experimental EDM developments can have a major impact in pinning down interactions of the Higgs.« less

  16. Direct detection of dark matter axions with directional sensitivity

    SciTech Connect

    Irastorza, Igor G.; García, Juan A. E-mail: jagarpas@unizar.es

    2012-10-01

    We study the directional effect of the expected axion dark matter signal in a resonant cavity of an axion haloscope detector, for cavity geometries not satisfying the condition that the axion de Broglie wavelength λ{sub a} is sufficiently larger than the cavity dimensions L for a fully coherent conversion, i.e. λ{sub a}∼>2πL. We focus on long thin cavities immersed in dipole magnets and find, for appropriately chosen cavity lengths, an O(1) modulation of the signal with the cavity orientation with respect the momentum distribution of the relic axion background predicted by the isothermal sphere model for the galactic dark matter halo. This effect can be exploited to design directional axion dark matter detectors, providing an unmistakable signature of the extraterrestrial origin of a possible positive detection. Moreover, the precise shape of the modulation may give information of the galactic halo distribution and, for specific halo models, give extra sensitivity for higher axion masses.

  17. A theory and model of conflict detection in air traffic control: incorporating environmental constraints.

    PubMed

    Loft, Shayne; Bolland, Scott; Humphreys, Michael S; Neal, Andrew

    2009-06-01

    A performance theory for conflict detection in air traffic control is presented that specifies how controllers adapt decisions to compensate for environmental constraints. This theory is then used as a framework for a model that can fit controller intervention decisions. The performance theory proposes that controllers apply safety margins to ensure separation between aircraft. These safety margins are formed through experience and reflect the biasing of decisions to favor safety over accuracy, as well as expectations regarding uncertainty in aircraft trajectory. In 2 experiments, controllers indicated whether they would intervene to ensure separation between pairs of aircraft. The model closely predicted the probability of controller intervention across the geometry of problems and as a function of controller experience. When controller safety margins were manipulated via task instructions, the parameters of the model changed in the predicted direction. The strength of the model over existing and alternative models is that it better captures the uncertainty and decision biases involved in the process of conflict detection. (PsycINFO Database Record (c) 2009 APA, all rights reserved).

  18. Direct optical nanoscopy with axially localized detection

    NASA Astrophysics Data System (ADS)

    Bourg, N.; Mayet, C.; Dupuis, G.; Barroca, T.; Bon, P.; Lécart, S.; Fort, E.; Lévêque-Fort, S.

    2015-09-01

    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Here, we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called supercritical-angle fluorescence can be captured using a high-numerical-aperture objective and used to determine the axial position of the fluorophore with nanometre precision. We introduce a new technique for three-dimensional nanoscopy that combines direct stochastic optical reconstruction microscopy (dSTORM) with dedicated detection of supercritical-angle fluorescence emission. We demonstrate that our approach of direct optical nanoscopy with axially localized detection (DONALD) typically yields an isotropic three-dimensional localization precision of 20 nm within an axial range of ∼150 nm above the coverslip.

  19. Secure Distributed Detection under Energy Constraint in IoT-Oriented Sensor Networks.

    PubMed

    Zhang, Guomei; Sun, Hao

    2016-12-16

    We study the secure distributed detection problems under energy constraint for IoT-oriented sensor networks. The conventional channel-aware encryption (CAE) is an efficient physical-layer secure distributed detection scheme in light of its energy efficiency, good scalability and robustness over diverse eavesdropping scenarios. However, in the CAE scheme, it remains an open problem of how to optimize the key thresholds for the estimated channel gain, which are used to determine the sensor's reporting action. Moreover, the CAE scheme does not jointly consider the accuracy of local detection results in determining whether to stay dormant for a sensor. To solve these problems, we first analyze the error probability and derive the optimal thresholds in the CAE scheme under a specified energy constraint. These results build a convenient mathematic framework for our further innovative design. Under this framework, we propose a hybrid secure distributed detection scheme. Our proposal can satisfy the energy constraint by keeping some sensors inactive according to the local detection confidence level, which is characterized by likelihood ratio. In the meanwhile, the security is guaranteed through randomly flipping the local decisions forwarded to the fusion center based on the channel amplitude. We further optimize the key parameters of our hybrid scheme, including two local decision thresholds and one channel comparison threshold. Performance evaluation results demonstrate that our hybrid scheme outperforms the CAE under stringent energy constraints, especially in the high signal-to-noise ratio scenario, while the security is still assured.

  20. Secure Distributed Detection under Energy Constraint in IoT-Oriented Sensor Networks

    PubMed Central

    Zhang, Guomei; Sun, Hao

    2016-01-01

    We study the secure distributed detection problems under energy constraint for IoT-oriented sensor networks. The conventional channel-aware encryption (CAE) is an efficient physical-layer secure distributed detection scheme in light of its energy efficiency, good scalability and robustness over diverse eavesdropping scenarios. However, in the CAE scheme, it remains an open problem of how to optimize the key thresholds for the estimated channel gain, which are used to determine the sensor’s reporting action. Moreover, the CAE scheme does not jointly consider the accuracy of local detection results in determining whether to stay dormant for a sensor. To solve these problems, we first analyze the error probability and derive the optimal thresholds in the CAE scheme under a specified energy constraint. These results build a convenient mathematic framework for our further innovative design. Under this framework, we propose a hybrid secure distributed detection scheme. Our proposal can satisfy the energy constraint by keeping some sensors inactive according to the local detection confidence level, which is characterized by likelihood ratio. In the meanwhile, the security is guaranteed through randomly flipping the local decisions forwarded to the fusion center based on the channel amplitude. We further optimize the key parameters of our hybrid scheme, including two local decision thresholds and one channel comparison threshold. Performance evaluation results demonstrate that our hybrid scheme outperforms the CAE under stringent energy constraints, especially in the high signal-to-noise ratio scenario, while the security is still assured. PMID:27999282

  1. Bayesian analysis of multiple direct detection experiments

    NASA Astrophysics Data System (ADS)

    Arina, Chiara

    2014-12-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  2. Active semi-supervised community detection based on must-link and cannot-link constraints.

    PubMed

    Cheng, Jianjun; Leng, Mingwei; Li, Longjie; Zhou, Hanhai; Chen, Xiaoyun

    2014-01-01

    Community structure detection is of great importance because it can help in discovering the relationship between the function and the topology structure of a network. Many community detection algorithms have been proposed, but how to incorporate the prior knowledge in the detection process remains a challenging problem. In this paper, we propose a semi-supervised community detection algorithm, which makes full utilization of the must-link and cannot-link constraints to guide the process of community detection and thereby extracts high-quality community structures from networks. To acquire the high-quality must-link and cannot-link constraints, we also propose a semi-supervised component generation algorithm based on active learning, which actively selects nodes with maximum utility for the proposed semi-supervised community detection algorithm step by step, and then generates the must-link and cannot-link constraints by accessing a noiseless oracle. Extensive experiments were carried out, and the experimental results show that the introduction of active learning into the problem of community detection makes a success. Our proposed method can extract high-quality community structures from networks, and significantly outperforms other comparison methods.

  3. Directly detecting exozodiacal dust and disk variability

    NASA Astrophysics Data System (ADS)

    Scott, Nicholas J.

    2015-01-01

    Dust is common throughout stellar systems. The architecture of stellar systems may be typically comprised of a distant cold debris disk, a warm exozodiacal disk, and a hot inner disk. Dust in this exozodiacal region confounds exoplanet detections by scattering light or mimicking planetary emission. This environment must be well-modelled in order to find Earth-sized exoplanets. Interferometry at the Center for High Resolution Astronomy (CHARA) Array provides the angular resolution to directly detect near-infrared (NIR) excesses originating from warm and hot dust close to the host star. The recently upgraded Fiber-Linked Unit for Optical Recombination (JouFLU) is capable of measuring interferometric visibility contrasts to a precision of <0.1% and dust disk fluxes equal to 1% of the host star. There is likely a connection between these hot interferometrically detected dust disks and the harder-to-detect warm zodiacal dust analogues. In this way interferometric studies can observe the tip-of-the-iceberg of stellar system dust, providing details such as composition and grain size of dust, as well as statistics on the correlation of dust populations and stellar properties. These inner dust regions may exhibit a high degree of variability which should also be characterized and may give hint to the dust origin and replenishment mechanisms. JouFLU is currently involved in a large survey of exozodiacal dust stars of spectral types A through K with the aim to provide statistics about dust disk occurrence in relation to their host stars and the presence of cold dust reservoirs. Complementing this survey is a project of re-observing the earliest excess detections in order to determine their variability. In addition, NASA's InfraRed Telescope Facility (IRTF) provides a method for spectrophotometric detections of excess stellar flux corresponding to the presence of hot/warm exozodiacal dust. Multiple NIR interferometric instruments as well as medium resolution spectroscopy are a

  4. A Theory and Model of Conflict Detection in Air Traffic Control: Incorporating Environmental Constraints

    ERIC Educational Resources Information Center

    Loft, Shayne; Bolland, Scott; Humphreys, Michael S.; Neal, Andrew

    2009-01-01

    A performance theory for conflict detection in air traffic control is presented that specifies how controllers adapt decisions to compensate for environmental constraints. This theory is then used as a framework for a model that can fit controller intervention decisions. The performance theory proposes that controllers apply safety margins to…

  5. The Earth's velocity for direct detection experiments

    SciTech Connect

    McCabe, Christopher

    2014-02-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has hitherto received little explicit discussion. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  6. Dark matter direct detection with accelerometers

    NASA Astrophysics Data System (ADS)

    Graham, Peter W.; Kaplan, David E.; Mardon, Jeremy; Rajendran, Surjeet; Terrano, William A.

    2016-04-01

    The mass of the dark matter particle is unknown, and may be as low as ˜1 0-22 eV . The lighter part of this range, below ˜eV , is relatively unexplored both theoretically and experimentally but contains an array of natural dark matter candidates. An example is the relaxion, a light boson predicted by cosmological solutions to the hierarchy problem. One of the few generic signals such light dark matter can produce is a time-oscillating, equivalence-principle-violating force. We propose searches for this using accelerometers, and consider in detail the examples of torsion balances, atom interferometry, and pulsar timing. These approaches have the potential to probe large parts of unexplored parameter space in the next several years. Thus such accelerometers provide radically new avenues for the direct detection of dark matter.

  7. Direct fast neutron detection: A status report

    SciTech Connect

    Peurrung, A.J.; Hansen, R.R.; Craig, R.A.; Hensley, W.K.; Hubbard, C.W.; Keller, P.E.; Reeder, P.L.; Sunberg, D.S.

    1997-12-01

    This report describes the status of efforts to develop direct fast-neutron detection via proton recoil within plastic scintillator. Since recording proton recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the different pulse shapes that are to be expected primarily on the basis of the slower speed of the recoiling fission neutrons. Should this effort ultimately prove successful, the resulting novel technology will have the potential to significantly lower cost and increase capability for a number of critical neutron-detection applications. Considerable progress has been made toward a clear and compelling demonstration of this new technique. An exhaustive theoretical and numerical investigation of the method has been completed. The authors have been able to better understand the laboratory results and estimate the performance that could ultimately be achieved using the proposed technique. They have assessed the performance of a number of different algorithms for discriminating between neutron and gamma ray events. The results of this assessment will be critical when the construction of low-cost, field-portable neutron detectors becomes necessary. Finally, a laboratory effort to realize effective discrimination is well underway and has resulted in partial success.

  8. Kaluza-Klein dark matter: Direct detection vis-a-vis CERN LHC

    SciTech Connect

    Arrenberg, Sebastian; Baudis, Laura; Kong, Kyoungchul; Matchev, Konstantin T.; Yoo, Jonghee

    2008-09-01

    We explore the phenomenology of Kaluza-Klein (KK) dark matter in very general models with universal extra dimensions (UEDs), emphasizing the complementarity between high-energy colliders and dark matter direct detection experiments. In models with relatively small mass splittings between the dark matter candidate and the rest of the (colored) spectrum, the collider sensitivity is diminished, but direct detection rates are enhanced. UEDs provide a natural framework for such mass degeneracies. We consider both five-dimensional and six-dimensional nonminimal UED models, and discuss the detection prospects for various KK dark matter candidates: the KK photon {gamma}{sub 1}, the KK Z boson Z{sub 1}, the KK Higgs boson H{sub 1}, and the spinless KK photon {gamma}{sub H}. We combine collider limits, such as electroweak precision data and expected LHC reach, with cosmological constraints from WMAP, and the sensitivity of current or planned direct detection experiments. Allowing for general mass splittings, we show that neither colliders nor direct detection experiments by themselves can explore all of the relevant KK dark matter parameter space. Nevertheless, they probe different parameter space regions, and the combination of the two types of constraints can be quite powerful. For example, in the case of {gamma}{sub 1} in 5D UEDs the relevant parameter space will be almost completely covered by the combined CERN LHC and direct detection sensitivities expected in the near future.

  9. Kaluza-Klein Dark Matter: Direct Detection vis-a-vis LHC

    SciTech Connect

    Arrenberg, Sebastian; Baudis, Laura; Kong, Kyoungchul; Matchev, Konstantin T.; Yoo, Jonghee; /Fermilab

    2008-11-01

    We explore the phenomenology of Kaluza-Klein (KK) dark matter in very general models with universal extra dimensions (UEDs), emphasizing the complementarity between high-energy colliders and dark matter direct detection experiments. In models with relatively small mass splittings between the dark matter candidate and the rest of the (colored) spectrum, the collider sensitivity is diminished, but direct detection rates are enhanced. UEDs provide a natural framework for such mass degeneracies. We consider both 5-dimensional and 6-dimensional non-minimal UED models, and discuss the detection prospects for various KK dark matter candidates: the KK photon {gamma}{sub 1} (5D) the KK Z-boson Z{sub 1} (5D) and the spinless KK photon {gamma}{sub H} (6D). We combine collider limits such as electroweak precision data and expected LHC reach, with cosmological constraints from WMAP and the sensitivity of current or planned direct detection experiments. Allowing for general mass splittings, we show that neither colliders, nor direct detection experiments by themselves can explore all of the relevant KK dark matter parameter space. Nevertheless, they probe different parameter space regions and the combination of the two types of constraints can be quite powerful. For example, in the case of {gamma}{sub 1} in 5D UEDs the relevant parameter space will be almost completely covered by the combined LHC and direct detection sensitivities expected in the near future.

  10. Direct Exoplanet Detection with Binary Differential Imaging

    NASA Astrophysics Data System (ADS)

    Rodigas, Timothy J.; Weinberger, Alycia; Mamajek, Eric E.; Males, Jared R.; Close, Laird M.; Morzinski, Katie; Hinz, Philip M.; Kaib, Nathan

    2015-10-01

    Binaries are typically excluded from direct imaging exoplanet surveys. However, the recent findings of Kepler and radial velocity programs show that planets can and do form in binary systems. Here, we suggest that visual binaries offer unique advantages for direct imaging. We show that Binary Differential Imaging (BDI), whereby two stars are imaged simultaneously at the same wavelength within the isoplanatic patch at a high Strehl ratio, offers improved point spread function (PSF) subtraction that can result in increased sensitivity to planets close to each star. We demonstrate this by observing a young visual binary separated by 4″ with MagAO/Clio-2 at 3.9 μm, where the Strehl ratio is high, the isoplanatic patch is large, and giant planets are bright. Comparing BDI to angular differential imaging (ADI), we find that BDI’s 5σ contrast is ˜0.5 mag better than ADI’s within ˜1″ for the particular binary we observed. Because planets typically reside close to their host stars, BDI is a promising technique for discovering exoplanets in stellar systems that are often ignored. BDI is also 2-4× more efficient than ADI and classical reference PSF subtraction, since planets can be detected around both the target and PSF reference simultaneously. We are currently exploiting this technique in a new MagAO survey for giant planets in 140 young nearby visual binaries. BDI on a space-based telescope would not be limited by isoplanatism effects and would therefore be an even more powerful tool for imaging and discovering planets. This paper includes data obtained at the 6.5 m Magellan Telescopes located at Las Campanas Observatory, Chile.

  11. Direct Detection of Soil-Bound Prions

    PubMed Central

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  12. Preconditioned alternating direction method of multipliers for inverse problems with constraints

    NASA Astrophysics Data System (ADS)

    Jiao, Yuling; Jin, Qinian; Lu, Xiliang; Wang, Weijie

    2017-02-01

    We propose a preconditioned alternating direction method of multipliers (ADMM) to solve linear inverse problems in Hilbert spaces with constraints, where the feature of the sought solution under a linear transformation is captured by a possibly non-smooth convex function. During each iteration step, our method avoids solving large linear systems by choosing a suitable preconditioning operator. In case the data is given exactly, we prove the convergence of our preconditioned ADMM without assuming the existence of a Lagrange multiplier. In case the data is corrupted by noise, we propose a stopping rule using information on noise level and show that our preconditioned ADMM is a regularization method; we also propose a heuristic rule when the information on noise level is unavailable or unreliable and give its detailed analysis. Numerical examples are presented to test the performance of the proposed method.

  13. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    SciTech Connect

    Garny, Mathias; Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan E-mail: ibarra@tum.de E-mail: stefan.vogl@tum.de

    2012-11-01

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  14. Deciphering inflation with gravitational waves: Cosmic microwave background polarization vs direct detection with laser interferometers

    SciTech Connect

    Smith, Tristan L.; Peiris, Hiranya V.; Cooray, Asantha

    2006-06-15

    A detection of the primordial gravitational wave background is considered to be the 'smoking-gun' evidence for inflation. While superhorizon waves are probed with cosmic microwave background (CMB) polarization, the relic background will be studied with laser interferometers. The long lever arm spanned by the two techniques improves constraints on the inflationary potential and validation of consistency relations expected under inflation. If gravitational waves with a tensor-to-scalar amplitude ratio greater than 0.01 are detected by the CMB, then a direct-detection experiment with a sensitivity consistent with current concept studies should be pursued vigorously. If no primordial tensors are detected by the CMB, a direct-detection experiment to understand the simplest form of inflation must have a sensitivity improved by two to 3 orders of magnitude over current plans.

  15. Detecting and Diagnosing Grammatical Errors for Beginning Learners of German: From Learner Corpus Annotation to Constraint Satisfaction Problems

    ERIC Educational Resources Information Center

    Boyd, Adriane

    2012-01-01

    This thesis presents a corpus of beginning learner German with a reliable error annotation scheme and an approach for detecting and diagnosing grammatical errors in learner language. A constraint-based dependency parser provides the foundation for a flexible and modular analysis of German by representing parsing as a constraint satisfaction…

  16. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    DOE PAGES

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; ...

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using themore » background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.« less

  17. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    SciTech Connect

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X. Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar “stealth baryon” dark matter candidate, arising from a dark SU(4) confining gauge theory—“stealth dark matter.” In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest “baryon” states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be possibly detectable in the dark matter mass range of about 200–700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m6B, suggests the observable dark matter mass range is not appreciably modified. We highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  18. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    PubMed

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  19. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Berkowitz, E.; Brower, R. C.; Buchoff, M. I.; Fleming, G. T.; Jin, X.-Y.; Kiskis, J.; Kribs, G. D.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Rinaldi, E.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Vranas, P.; Weinberg, E.; Witzel, O.; Lattice Strong Dynamics LSD Collaboration

    2015-10-01

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory—"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N ) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1 /mB6 , suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  20. Model-independent indirect detection constraints on hidden sector dark matter

    NASA Astrophysics Data System (ADS)

    Elor, Gilly; Rodd, Nicholas L.; Slatyer, Tracy R.; Xue, Wei

    2016-06-01

    If dark matter inhabits an expanded ``hidden sector'', annihilations may proceed through sequential decays or multi-body final states. We map out the potential signals and current constraints on such a framework in indirect searches, using a model-independent setup based on multi-step hierarchical cascade decays. While remaining agnostic to the details of the hidden sector model, our framework captures the generic broadening of the spectrum of secondary particles (photons, neutrinos, e+e- and bar p p) relative to the case of direct annihilation to Standard Model particles. We explore how indirect constraints on dark matter annihilation limit the parameter space for such cascade/multi-particle decays. We investigate limits from the cosmic microwave background by Planck, the Fermi measurement of photons from the dwarf galaxies, and positron data from AMS-02. The presence of a hidden sector can change the constraints on the dark matter by up to an order of magnitude in either direction (although the effect can be much smaller). We find that generally the bound from the Fermi dwarfs is most constraining for annihilations to photon-rich final states, while AMS-02 is most constraining for electron and muon final states; however in certain instances the CMB bounds overtake both, due to their approximate independence on the details of the hidden sector cascade. We provide the full set of cascade spectra considered here as publicly available code with examples at http://web.mit.edu/lns/research/CascadeSpectra.html.

  1. NEW COMPLETENESS METHODS FOR ESTIMATING EXOPLANET DISCOVERIES BY DIRECT DETECTION

    SciTech Connect

    Brown, Robert A.; Soummer, Remi

    2010-05-20

    We report on new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list and stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission and its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization) and an estimate of the occurrence rate of planets ({eta}). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, and we prove the accuracy of this new approach. Our methods provide tools to define a mission for a particular science goal; for example, a mission can be defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built and how successive observations can be selected. Our approach also provides other critical mission attributes, such as the number of stars expected to be searched and the probability of zero discoveries. Because these attributes depend strongly on the mission scale (telescope diameter, observing capabilities and constraints, mission lifetime, etc.), our methods are directly applicable to the design of such future missions and provide guidance to the mission and instrument design based on scientific performance. We illustrate our new methods with practical calculations and exploratory design reference missions for the James Webb Space Telescope (JWST) operating with a distant starshade to reduce scattered and diffracted starlight on the focal plane. We estimate that five habitable Earth-mass planets would be discovered and characterized with spectroscopy, with a probability of zero discoveries of 0.004, assuming a small fraction of JWST observing time (7%), {eta} = 0.3, and 70 observing visits, limited by starshade

  2. Systematic aspects of direct extrasolar planet detection

    NASA Technical Reports Server (NTRS)

    Brown, Robert A.

    1988-01-01

    Using the first optical observatory in space, the Hubble Space Telescope, images of possible extrasolar planets will have poor contrast against the background of diffracted and scattered starlight. The very long exposure time required to achieve an adequate signal-to-noise ratio will make their detection infeasible. For a future telescope, a 16-fold increase in either the smoothness of the collecting area of the optics would reduce the exposure time to a tolerable value, but the contrast would remain low and the required photometric precision high. In this situation, the feasibility of detection would be contingent on the careful identification and control of systematic errors.

  3. Abundance constraints and direct redshift measurement of the diffuse X-ray emission from a distant cluster of galaxies

    NASA Astrophysics Data System (ADS)

    Hashimoto, Yasuhiro; Barcons, X.; Böhringer, H.; Fabian, A. C.; Hasinger, G.; Mainieri, V.; Brunner, H.

    2004-04-01

    We report on the XMM-Newton (XMM) observation of RX J1053.7+5735, one of the most distant X-ray selected clusters of galaxies, which also shows an unusual double-lobed X-ray morphology, indicative of a possible equal-mass cluster merger. The cluster was discovered during the ROSAT deep pointings in the direction of the Lockman Hole. All XMM Lockman Hole observations (PV, AO-1 & AO-2 phases) with the European Photon Imaging Camera (EPIC) were combined for the analysis, totaling exposure times ˜648 ks, 738 ks, and 758 ks for pn, MOS1, and MOS2, respectively. With this ``deep'' dataset, we could detect the Fe K line and obtain a strong constraint on cluster metallicity, which is difficult to achieve for clusters at z > 1. The best-fit abundance is 0.46+0.11-0.07 times the solar value. The Fe line emission also allows us to directly estimate the redshift of diffuse gas, with a value z = 1.14+0.01-0.01. This is one of the first clusters whose X-ray redshift is directly measured prior to the secure knowledge of cluster redshift by optical/NIR spectroscopy. We could also estimate the X-ray redshift separately for each of the two lobes in the double-lobed structure, and the result is consistent with the two lobes being part of one cluster system at the same redshift. Comparison with other metallicity measurements of nearby and distant clusters shows that there is little evolution in the ICM metallicity from z ˜ 1 to the present.

  4. Cell Detection from Redundant Candidate Regions under Non-Overlapping Constraints.

    PubMed

    Bise, Ryoma; Sato, Yoichi

    2015-01-12

    Cell detection and segmentation in microscopy images are essential for automated cell behavior analysis including cell shape analysis and cell tracking. Robust cell detection in high-density and low-contrast images is still challenging since cells often touch and partially overlap, forming a cell cluster with blurry intercellular boundaries. In such cases, current methods tend to detect multiple cells as a cluster. If the control parameters are adjusted to separate the touching cells, other problems often occur: a single cell may be segmented into several regions, and cells in low-intensity regions may not be detected. To solve these problems, we first detect redundant candidate regions, which include many false positives but in turn very few false negatives, by allowing candidate regions to overlap with each other. Next, the score for how likely the candidate region contains the main part of a single cell is computed for each cell candidate using supervised learning. Then we select an optimal set of cell regions from the redundant regions under non-overlapping constraints, where each selected region looks like a single cell and the selected regions do not overlap. We formulate this problem of optimal region selection as a binary linear programming problem under non-overlapping constraints. This binary linear programming maximizes the sum of the weighted scores of the selected regions, where a region's score represents how likely it is that the region corresponds to a single cell as determined by using cell appearance features.We demonstrated the effectiveness of our method for several types of cells in microscopy images. Our method performed better than five representative methods, achieving an F-measure of over 0.9 for all data sets. Experimental application of the proposed method to 3D images demonstrated that also works well for 3D cell detection.

  5. A semi-synchronous label propagation algorithm with constraints for community detection in complex networks

    PubMed Central

    Hou Chin, Jia; Ratnavelu, Kuru

    2017-01-01

    Community structure is an important feature of a complex network, where detection of the community structure can shed some light on the properties of such a complex network. Amongst the proposed community detection methods, the label propagation algorithm (LPA) emerges as an effective detection method due to its time efficiency. Despite this advantage in computational time, the performance of LPA is affected by randomness in the algorithm. A modified LPA, called CLPA-GNR, was proposed recently and it succeeded in handling the randomness issues in the LPA. However, it did not remove the tendency for trivial detection in networks with a weak community structure. In this paper, an improved CLPA-GNR is therefore proposed. In the new algorithm, the unassigned and assigned nodes are updated synchronously while the assigned nodes are updated asynchronously. A similarity score, based on the Sørensen-Dice index, is implemented to detect the initial communities and for breaking ties during the propagation process. Constraints are utilised during the label propagation and community merging processes. The performance of the proposed algorithm is evaluated on various benchmark and real-world networks. We find that it is able to avoid trivial detection while showing substantial improvement in the quality of detection. PMID:28374836

  6. Direct detection of particle dark matter

    NASA Astrophysics Data System (ADS)

    Rich, J.

    The paper discusses in general terms the problem of detecting and identifying weakly-interacting particles in the galactic halo via the observation of nuclei recoiling from elastic scatters. Emphasis is placed on experimental signatures and on detector requirements as to size, energy sensitivity and background. The problems are illustrated with three popular dark-matter candidates: heavy Diract neutrinos, supersymmetric photinos, and cosmions (particles invented to solve the solar-neutrino problem). Recent progress in the construction of suitable detectors is discussed.

  7. Polymeric assay film for direct colorimetric detection

    DOEpatents

    Charych, Deborah; Nagy, Jon; Spevak, Wayne

    2002-01-01

    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  8. Polymeric assay film for direct colorimetric detection

    DOEpatents

    Charych, Deborah; Nagy, Jon; Spevak, Wayne

    1999-01-01

    A lipid bilayer with affinity to an analyte, which directly signals binding by a changes in the light absorption spectra. This novel assay means and method has special applications in the drug development and medical testing fields. Using a spectrometer, the system is easily automated, and a multiple well embodiment allows inexpensive screening and sequential testing. This invention also has applications in industry for feedstock and effluent monitoring.

  9. Precision measurements, dark matter direct detection and LHC Higgs searches in a constrained NMSSM

    SciTech Connect

    Belanger, G.; Hugonie, C.; Pukhov, A. E-mail: cyril.hugonie@lpta.univ-montp2.fr

    2009-01-15

    We reexamine the constrained version of the Next-to-Minimal Supersymmetric Standard Model with semi universal parameters at the GUT scale (CNMSSM). We include constraints from collider searches for Higgs and susy particles, upper bound on the relic density of dark matter, measurements of the muon anomalous magnetic moment and of B-physics observables as well as direct searches for dark matter. We then study the prospects for direct detection of dark matter in large scale detectors and comment on the prospects for discovery of heavy Higgs states at the LHC.

  10. Brief Report: Eye Direction Detection Improves with Development in Autism

    ERIC Educational Resources Information Center

    Webster, Simon; Potter, Douglas D.

    2008-01-01

    Eye direction detection has been claimed to be intact in autism, but the development of this skill has not been investigated. Eleven children with autism and 11 typically developing children performed a demanding face-to-face eye direction detection task. Younger children with autism demonstrated a deficit in this skill, relative to younger…

  11. Indirect detection of radiation sources through direct detection of radiolysis products

    DOEpatents

    Farmer, Joseph C.; Fischer, Larry E.; Felter, Thomas E.

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  12. Model-independent indirect detection constraints on hidden sector dark matter

    SciTech Connect

    Elor, Gilly; Rodd, Nicholas L.; Slatyer, Tracy R.; Xue, Wei

    2016-06-10

    If dark matter inhabits an expanded “hidden sector”, annihilations may proceed through sequential decays or multi-body final states. We map out the potential signals and current constraints on such a framework in indirect searches, using a model-independent setup based on multi-step hierarchical cascade decays. While remaining agnostic to the details of the hidden sector model, our framework captures the generic broadening of the spectrum of secondary particles (photons, neutrinos, e{sup +}e{sup −} and p-barp) relative to the case of direct annihilation to Standard Model particles. We explore how indirect constraints on dark matter annihilation limit the parameter space for such cascade/multi-particle decays. We investigate limits from the cosmic microwave background by Planck, the Fermi measurement of photons from the dwarf galaxies, and positron data from AMS-02. The presence of a hidden sector can change the constraints on the dark matter by up to an order of magnitude in either direction (although the effect can be much smaller). We find that generally the bound from the Fermi dwarfs is most constraining for annihilations to photon-rich final states, while AMS-02 is most constraining for electron and muon final states; however in certain instances the CMB bounds overtake both, due to their approximate independence on the details of the hidden sector cascade. We provide the full set of cascade spectra considered here as publicly available code with examples at http://web.mit.edu/lns/research/CascadeSpectra.html.

  13. Pulmonary nodule detection in CT images based on shape constraint CV model

    SciTech Connect

    Wang, Bing; Tian, Xuedong; Wang, Qian; Yang, Ying; Xie, Hongzhi E-mail: xiehongzhi@medmail.com.cn; Zhang, Shuyang; Gu, Lixu E-mail: xiehongzhi@medmail.com.cn

    2015-03-15

    Purpose: Accurate detection of pulmonary nodules remains a technical challenge in computer-aided diagnosis systems because some nodules may adhere to the blood vessels or the lung wall, which have low contrast compared to the surrounding tissues. In this paper, the analysis of typical shape features of candidate nodules based on a shape constraint Chan–Vese (CV) model combined with calculation of the number of blood branches adhered to nodule candidates is proposed to reduce false positive (FP) nodules from candidate nodules. Methods: The proposed scheme consists of three major stages: (1) Segmentation of lung parenchyma from computed tomography images. (2) Extraction of candidate nodules. (3) Reduction of FP nodules. A gray level enhancement combined with a spherical shape enhancement filter is introduced to extract the candidate nodules and their sphere-like contour regions. FPs are removed by analysis of the typical shape features of nodule candidates based on the CV model using spherical constraint and by investigating the number of blood branches adhered to the candidate nodules. The constrained shapes of CV model are automatically achieved from the extracted candidate nodules. Results: The detection performance was evaluated on 127 nodules of 103 cases including three types of challenging nodules, which are juxta-pleural nodules, juxta-vascular nodules, and ground glass opacity nodules. The free-receiver operating characteristic (FROC) curve shows that the proposed method is able to detect 88% of all the nodules in the data set with 4 FPs per case. Conclusions: Evaluation shows that the authors’ method is feasible and effective for detection of three types of nodules in this study.

  14. Direct Detection of the Asteroidal YORP Effect

    NASA Astrophysics Data System (ADS)

    Lowry, Stephen C.; Fitzsimmons, A.; Pravec, P.; Vokrouhlicky, D.; Boehnhardt, H.; Taylor, P. A.; Margot, J. L.; Galád, A.; Irwin, M.; Irwin, J.; Kusnirák, P.

    2007-10-01

    The Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect is a torque that can modify the rotation rates and obliquities of small bodies in the solar system via the combined effects of incident solar radiation pressure and the recoil effect from anisotropic emission of thermal photons. The YORP effect is the only realistic mechanism for explaining the intriguing spin-axis alignments within the Koronis asteroid family, and quite possibly explains the anomalous distribution of spin rates for small asteroids. YORP is now thought to be an important mechanism in the formation of binary asteroid systems, and has a direct bearing on the related Yarkovsky effect, which affects the orbital motion of small asteroids. Despite its importance, there exists only indirect evidence for the presence of YORP on solar system objects, until now. We conducted an optical-imaging monitoring campaign from 2001-2005 on a small near-Earth asteroid, 2000 PH5, now known as asteroid (54509) YORP. We found that the asteroid has been continuously increasing its sidereal rotation rate by (2.0 ± 0.2)*10-4 deg./day2, over this 4-yr period (Lowry et al., 2007, Science 316, 272-274). The observed YORP strength is consistent with detailed shape-model-based theoretical calculations of the effect (Taylor et al., 2007, Science 316, 274-277). We simulated the asteroid's close Earth approaches from 2001 to 2005, showing that gravitational torques cannot explain the observed spin rate increase. Dynamical simulations suggest that 2000 PH5 may reach a rotation period of just 20 seconds toward the end of its expected lifetime.

  15. Wavelet-based target detection using multiscale directional analysis

    NASA Astrophysics Data System (ADS)

    Chambers, Bradley J.; Reynolds, William D., Jr.; Campbell, Derrick S.; Fennell, Darius K.; Ansari, Rashid

    2007-04-01

    Efficient processing of imagery derived from remote sensing systems has become ever more important due to increasing data sizes, rates, and bit depths. This paper proposes a target detection method that uses a special class of wavelets based on highly frequency-selective directional filter banks. The approach helps isolate object features in different directional filter output components. These components lend themselves well to the application of powerful denoising and edge detection procedures in the wavelet domain. Edge information is derived from directional wavelet decompositions to detect targets of known dimension in electro optical imagery. Results of successful detection of objects using the proposed method are presented in the paper. The approach highlights many of the benefits of working with directional wavelet analysis for image denoising and detection.

  16. Readout technologies for directional WIMP Dark Matter detection

    NASA Astrophysics Data System (ADS)

    Battat, J. B. R.; Irastorza, I. G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.; Colas, P.; Consiglio, L.; Dafni, T.; D'Ambrosio, N.; Deaconu, C.; De Lellis, G.; Descombes, T.; Di Crescenzo, A.; Di Marco, N.; Druitt, G.; Eggleston, R.; Ferrer-Ribas, E.; Fusayasu, T.; Galán, J.; Galati, G.; García, J. A.; Garza, J. G.; Gentile, V.; Garcia-Sciveres, M.; Giomataris, Y.; Guerrero, N.; Guillaudin, O.; Guler, A. M.; Harton, J.; Hashimoto, T.; Hedges, M. T.; Iguaz, F. J.; Ikeda, T.; Jaegle, I.; Kadyk, J. A.; Katsuragawa, T.; Komura, S.; Kubo, H.; Kuge, K.; Lamblin, J.; Lauria, A.; Lee, E. R.; Lewis, P.; Leyton, M.; Loomba, D.; Lopez, J. P.; Luzón, G.; Mayet, F.; Mirallas, H.; Miuchi, K.; Mizumoto, T.; Mizumura, Y.; Monacelli, P.; Monroe, J.; Montesi, M. C.; Naka, T.; Nakamura, K.; Nishimura, H.; Ochi, A.; Papevangelou, T.; Parker, J. D.; Phan, N. S.; Pupilli, F.; Richer, J. P.; Riffard, Q.; Rosa, G.; Santos, D.; Sawano, T.; Sekiya, H.; Seong, I. S.; Snowden-Ifft, D. P.; Spooner, N. J. C.; Sugiyama, A.; Taishaku, R.; Takada, A.; Takeda, A.; Tanaka, M.; Tanimori, T.; Thorpe, T. N.; Tioukov, V.; Tomita, H.; Umemoto, A.; Vahsen, S. E.; Yamaguchi, Y.; Yoshimoto, M.; Zayas, E.

    2016-11-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  17. The Multigroup Common Factor Model with Minimal Uniqueness Constraints and the Power to Detect Uniform Bias

    ERIC Educational Resources Information Center

    Hessen, David J.; Dolan, Conor V.; Wicherts, Jelte M.

    2006-01-01

    An alternative formulation of the multigroup common factor model with minimal uniqueness constraints is considered. This alternative formulation is based on a simple identification constraint that is related to the standard maximum likelihood constraint used in single-group common factor analysis. It is argued that the alternative formulation…

  18. Direction finding antenna system for spark detection and localization

    NASA Astrophysics Data System (ADS)

    Topor, Raluca E.; Bucuci, Stefania C.; Tamas, Razvan D.; Danisor, Alin; Dumitrascu, Ana; Berescu, Serban

    2015-02-01

    This paper proposes a novel UWB antenna system for spark detection and localization by using the amplitude comparison direction finding (DF) method. The proposed design consists of two identical axially crossed "padlock" shaped UWB antennas, with unbalanced feeding. Simulation results show that such radiating systems can be used for assessing the direction of arrival for short pulses.

  19. Nuclear Magnetic Resonance-Assisted Prediction of Secondary Structure for RNA: Incorporation of Direction-Dependent Chemical Shift Constraints.

    PubMed

    Chen, Jonathan L; Bellaousov, Stanislav; Tubbs, Jason D; Kennedy, Scott D; Lopez, Michael J; Mathews, David H; Turner, Douglas H

    2015-11-17

    Knowledge of RNA structure is necessary to determine structure-function relationships and to facilitate design of potential therapeutics. RNA secondary structure prediction can be improved by applying constraints from nuclear magnetic resonance (NMR) experiments to a dynamic programming algorithm. Imino proton walks from NOESY spectra reveal double-stranded regions. Chemical shifts of protons in GH1, UH3, and UH5 of GU pairs, UH3, UH5, and AH2 of AU pairs, and GH1 of GC pairs were analyzed to identify constraints for the 5' to 3' directionality of base pairs in helices. The 5' to 3' directionality constraints were incorporated into an NMR-assisted prediction of secondary structure (NAPSS-CS) program. When it was tested on 18 structures, including nine pseudoknots, the sensitivity and positive predictive value were improved relative to those of three unrestrained programs. The prediction accuracy for the pseudoknots improved the most. The program also facilitates assignment of chemical shifts to individual nucleotides, a necessary step for determining three-dimensional structure.

  20. Comparing readout strategies to directly detect dark matter

    NASA Astrophysics Data System (ADS)

    Billard, J.

    2015-01-01

    Over the past decades, several ideas and technologies have been developed to directly detect weakly interacting massive particles (WIMP) from the galactic halo. All these detection strategies share the common goal of discriminating a WIMP signal from the residual backgrounds. By directly detecting WIMPs, one can measure some or all of the observables associated to each nuclear recoil candidates, such as their energy and direction. In this study, we compare and examine the discovery potentials of each readout strategies from counting only (bubble chambers) to directional detectors (Time Projection Chambers) with 1d-, 2d-, and 3d-sensitivity. Using a profile likelihood analysis, we show that, in the case of a large and irreducible background contamination characterized by an energy distribution similar to the expected WIMP signal, directional information can improve the sensitivity of the experiment by several orders of magnitude. We also found that 1d directional detection is only less effective than a full 3d directional sensitivity by about a factor of 3, or 10 if we assume no sense recognition, still improving by a factor of 2 or more if only the energy of the events is being measured.

  1. Simplified dark matter models with charged mediators: prospects for direct detection

    NASA Astrophysics Data System (ADS)

    Sandick, Pearl; Sinha, Kuver; Teng, Fei

    2016-10-01

    We consider direct detection prospects for a class of simplified models of fermionic dark matter (DM) coupled to left and right-handed Standard Model fermions via two charged scalar mediators with arbitrary mixing angle α. DM interactions with the nucleus are mediated by higher electromagnetic moments, which, for Majorana DM, is the anapole moment. After giving a full analytic calculation of the anapole moment, including its α dependence, and matching with limits in the literature, we compute the DM-nucleon scattering cross-section and show the LUX and future LZ constraints on the parameter space of these models. We then compare these results with constraints coming from F ermi-LAT continuum and line searches. Results in the supersymmetric limit of these simplified models are provided in all cases. We find that future direct detection experiments will be able to probe most of the parameter space of these models for O (100 - 200) GeV DM and lightest mediator mass ≲ O (5%) larger than the DM mass. The direct detection prospects dwindle for larger DM mass and larger mass gap between the DM and the lightest mediator mass, although appreciable regions are still probed for O (200) GeV DM and lightest mediator mass ≲ O (20%) larger than the DM mass. The direct detection bounds are also attenuated near certain "blind spots" in the parameter space, where the anapole moment is severely suppressed due to cancellation of different terms. We carefully study these blind spots and the associated F ermi-LAT signals in these regions.

  2. Exploiting physical constraints for multi-spectral exo-planet detection

    NASA Astrophysics Data System (ADS)

    Thiébaut, Éric; Devaney, Nicholas; Langlois, Maud; Hanley, Kenneth

    2016-07-01

    We derive a physical model of the on-axis PSF for a high contrast imaging system such as GPI or SPHERE. This model is based on a multi-spectral Taylor series expansion of the diffraction pattern and predicts that the speckles should be a combination of spatial modes with deterministic chromatic magnification and weighting. We propose to remove most of the residuals by fitting this model on a set of images at multiple wavelengths and times. On simulated data, we demonstrate that our approach achieves very good speckle suppression without additional heuristic parameters. The residual speckles1, 2 set the most serious limitation in the detection of exo-planets in high contrast coronographic images provided by instruments such as SPHERE3 at the VLT, GPI4, 5 at Gemini, or SCExAO6 at Subaru. A number of post-processing methods have been proposed to remove as much as possible of the residual speckles while preserving the signal from the planets. These methods exploit the fact that the speckles and the planetary signal have different temporal and spectral behaviors. Some methods like LOCI7 are based on angular differential imaging8 (ADI), spectral differential imaging9, 10 (SDI), or on a combination of ADI and SDI.11 Instead of working on image differences, we propose to tackle the exo-planet detection as an inverse problem where a model of the residual speckles is fit on the set of multi-spectral images and, possibly, multiple exposures. In order to reduce the number of degrees of freedom, we impose specific constraints on the spatio-spectral distribution of stellar speckles. These constraints are deduced from a multi-spectral Taylor series expansion of the diffraction pattern for an on-axis source which implies that the speckles are a combination of spatial modes with deterministic chromatic magnification and weighting. Using simulated data, the efficiency of speckle removal by fitting the proposed multi-spectral model is compared to the result of using an approximation

  3. Detecting relic gravitational waves in the CMB: Optimal parameters and their constraints

    SciTech Connect

    Zhao, W.; Baskaran, D.

    2009-04-15

    The prospect of detecting relic gravitational waves, through their imprint in the cosmic microwave background radiation, provides an excellent opportunity to study the very early Universe. In the simplest viable theoretical models the relic gravitational wave background is characterized by two parameters, the tensor-to-scalar ratio r and the tensor spectral index n{sub t}. In this paper, we analyze the potential joint constraints on these two parameters, r and n{sub t}, using the data from the upcoming cosmic microwave background radiation experiments. Introducing the notion of the best-pivot multipole l{sub t}*, we find that at this pivot multipole the parameters r and n{sub t} are uncorrelated, and have the smallest variances. We derive the analytical formulas for the best-pivot multipole number l{sub t}*, and the variances of the parameters r and n{sub t}. We verify these analytical calculations using numerical simulation methods, and find agreement to within 20%. The analytical results provide a simple way to estimate the detection ability for the relic gravitational waves by the future observations of the cosmic microwave background radiation.

  4. Future Direct Spectroscopic Detection of Hot Jupiters with IGRINS

    NASA Astrophysics Data System (ADS)

    Gullikson, Kevin; Endl, Mike

    2013-08-01

    With about 700 confirmed extrasolar planets, it is time to move beyond discovery and towards characterization. Perhaps the most basic parameter of an extrasolar planet is its mass; however, this is very difficult to determine if the planet does not transit the star. The radial velocity technique, still the most fruitful method of discovering planets in the solar neighborhood, can only determine a minimum planet mass. We investigate a method using the near-future IGRINS near infrared spectrograph to detect the orbital motion of the planet itself. We simulate several observations of a star with an orbiting planet, and search for the spectral signature of the planet by cross-correlating against planet model spectra. A detection appears as a strong peak in the cross-correlation function, and gives the radial velocity of the planet at the time of observation. This, combined with the motion of the star from traditional radial velocity planet search programs, can determine the actual planet mass. We find that the IGRINS instrument can detect the spectral signature from large planets on very close orbits (so-called Hot Jupiters), and that the detections can provide tight constraints on the true planet mass.

  5. Detecting communities by asymmetric intimacy in directed-weighted network

    NASA Astrophysics Data System (ADS)

    Wang, Xingyuan; Qin, Xiaomeng

    Community detection and analysis have attracted wide public concerns over the recent years. Meanwhile, many related algorithms in complex networks have been proposed. However, most of them concentrate on undirected and unweighted networks. Concerning the significant theoretical value and potential application foreground for directed-weighted networks, in this paper, a novel hierarchical communities detection algorithm (termed as DCBAI) has been proposed on the basis of asymmetric intimacy between nodes. Community structures are effectively detected by node clustering algorithm in directed-weighted network, and a set of optimal communities are generated. In addition, a new and asymmetric parameter is adopted to measure the intimate relationship between nodes. We make some simulation using the proposed algorithm in real-world networks and artificial networks, and the result obtained proves that the parameter can describe the direct and indirect relationships between two nodes. Eventually, comparison with similar algorithms shows that our proposed algorithm has better performance.

  6. Directed dynamical influence is more detectable with noise

    PubMed Central

    Jiang, Jun-Jie; Huang, Zi-Gang; Huang, Liang; Liu, Huan; Lai, Ying-Cheng

    2016-01-01

    Successful identification of directed dynamical influence in complex systems is relevant to significant problems of current interest. Traditional methods based on Granger causality and transfer entropy have issues such as difficulty with nonlinearity and large data requirement. Recently a framework based on nonlinear dynamical analysis was proposed to overcome these difficulties. We find, surprisingly, that noise can counterintuitively enhance the detectability of directed dynamical influence. In fact, intentionally injecting a proper amount of asymmetric noise into the available time series has the unexpected benefit of dramatically increasing confidence in ascertaining the directed dynamical influence in the underlying system. This result is established based on both real data and model time series from nonlinear ecosystems. We develop a physical understanding of the beneficial role of noise in enhancing detection of directed dynamical influence. PMID:27066763

  7. Directed dynamical influence is more detectable with noise

    NASA Astrophysics Data System (ADS)

    Jiang, Jun-Jie; Huang, Zi-Gang; Huang, Liang; Liu, Huan; Lai, Ying-Cheng

    2016-04-01

    Successful identification of directed dynamical influence in complex systems is relevant to significant problems of current interest. Traditional methods based on Granger causality and transfer entropy have issues such as difficulty with nonlinearity and large data requirement. Recently a framework based on nonlinear dynamical analysis was proposed to overcome these difficulties. We find, surprisingly, that noise can counterintuitively enhance the detectability of directed dynamical influence. In fact, intentionally injecting a proper amount of asymmetric noise into the available time series has the unexpected benefit of dramatically increasing confidence in ascertaining the directed dynamical influence in the underlying system. This result is established based on both real data and model time series from nonlinear ecosystems. We develop a physical understanding of the beneficial role of noise in enhancing detection of directed dynamical influence.

  8. Working Group Report: WIMP Dark Matter Direct Detection

    SciTech Connect

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  9. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    PubMed Central

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  10. Direct detection of antihydrogen atoms using a BGO crystal

    NASA Astrophysics Data System (ADS)

    Nagata, Y.; Kuroda, N.; Ohtsuka, M.; Leali, M.; Lodi-Rizzini, E.; Mascagna, V.; Tajima, M.; Torii, H. A.; Zurlo, N.; Matsuda, Y.; Venturelli, L.; Yamazaki, Y.

    2016-12-01

    The ASACUSA collaboration has developed a detector consisting of a large size BGO crystal to detect an atomic antihydrogen beam, and performed the direct detection of antihydrogen atoms. Energy spectra from antihydrogen annihilation on the BGO crystal are discussed in comparison to simulation results from the GEANT4 toolkit. Background mainly originating from cosmic rays were strongly suppressed by analyzing the energy deposited in the BGO and requiring a multiplicity of charged pions. Thus antihydrogen events were identified.

  11. Field-stepped direct detection electron paramagnetic resonance.

    PubMed

    Yu, Zhelin; Liu, Tengzhi; Elajaili, Hanan; Rinard, George A; Eaton, Sandra S; Eaton, Gareth R

    2015-09-01

    The widest scan that had been demonstrated previously for rapid scan EPR was a 155G sinusoidal scan. As the scan width increases, the voltage requirement across the resonating capacitor and scan coils increases dramatically and the background signal induced by the rapidly changing field increases. An alternate approach is needed to achieve wider scans. A field-stepped direct detection EPR method that is based on rapid-scan technology is now reported, and scan widths up to 6200G have been demonstrated. A linear scan frequency of 5.12kHz was generated with the scan driver described previously. The field was stepped at intervals of 0.01 to 1G, depending on the linewidths in the spectra. At each field data for triangular scans with widths up to 11.5G were acquired. Data from the triangular scans were combined by matching DC offsets for overlapping regions of successive scans. This approach has the following advantages relative to CW, several of which are similar to the advantages of rapid scan. (i) In CW if the modulation amplitude is too large, the signal is broadened. In direct detection field modulation is not used. (ii) In CW the small modulation amplitude detects only a small fraction of the signal amplitude. In direct detection each scan detects a larger fraction of the signal, which improves the signal-to-noise ratio. (iii) If the scan rate is fast enough to cause rapid scan oscillations, the slow scan spectrum can be recovered by deconvolution after the combination of segments. (iv) The data are acquired with quadrature detection, which permits phase correction in the post processing. (v) In the direct detection method the signal typically is oversampled in the field direction. The number of points to be averaged, thereby improving the signal-to-noise ratio, is determined in post processing based on the desired field resolution. A degased lithium phthalocyanine sample was used to demonstrate that the linear deconvolution procedure can be employed with field

  12. Direct detection of a microlens in the Milky Way.

    PubMed

    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D

    2001-12-06

    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs.

  13. Directional statistics for realistic weakly interacting massive particle direct detection experiments. II. 2D readout

    NASA Astrophysics Data System (ADS)

    Morgan, Ben; Green, Anne M.

    2005-12-01

    The direction dependence of the WIMP direct detection rate provides a powerful tool for distinguishing a WIMP signal from possible backgrounds. We study the number of events required to discriminate a WIMP signal from an isotropic background for a detector with 2-d readout using nonparametric circular statistics. We also examine the number of events needed to (i) detect a deviation from rotational symmetry, due to flattening of the Milky Way halo and (ii) detect a deviation in the mean direction due to a tidal stream. If the senses of the recoils are measured then of order 20--70 events (depending on the plane of the 2-d readout and the detector location) will be sufficient to reject isotropy of the raw recoil angles at 90% confidence. If the senses can not be measured these number increase by roughly 2 orders of magnitude (compared with an increase of 1 order of magnitude for the case of full 3-d readout). The distributions of the reduced angles, with the (time-dependent) direction of solar motion subtracted, are far more anisotropic, however, and if the isotropy tests are applied to these angles then the numbers of events required are similar to the case of 3-d readout. A deviation from rotational symmetry will only be detectable if the Milky Way halo is significantly flattened. The deviation in the mean direction due to a tidal stream is potentially detectable, however, depending on the density and direction of the stream. The meridian plane (which contains the Earth’s spin axis) is, for all detector locations, the optimum readout plane for rejecting isotropy. However readout in this plane can not be used for detecting flattening of the Milky Way halo or a stream with direction perpendicular to the galactic plane. In these cases the optimum readout plane depends on the detector location.

  14. Sol-gel matrices for direct colorimetric detection of analytes

    DOEpatents

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  15. Sol-Gel Matrices For Direct Colorimetric Detection Of Analytes

    DOEpatents

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2002-11-26

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  16. Analysis of the theoretical bias in dark matter direct detection

    SciTech Connect

    Catena, Riccardo

    2014-09-01

    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias.

  17. Comparison of direct and heterodyne detection optical intersatellite communication links

    NASA Technical Reports Server (NTRS)

    Chen, C. C.; Gardner, C. S.

    1987-01-01

    The performance of direct and heterodyne detection optical intersatellite communication links are evaluated and compared. It is shown that the performance of optical links is very sensitive to the pointing and tracking errors at the transmitter and receiver. In the presence of random pointing and tracking errors, optimal antenna gains exist that will minimize the required transmitter power. In addition to limiting the antenna gains, random pointing and tracking errors also impose a power penalty in the link budget. This power penalty is between 1.6 to 3 dB for a direct detection QPPM link, and 3 to 5 dB for a heterodyne QFSK system. For the heterodyne systems, the carrier phase noise presents another major factor of performance degradation that must be considered. In contrast, the loss due to synchronization error is small. The link budgets for direct and heterodyne detection systems are evaluated. It is shown that, for systems with large pointing and tracking errors, the link budget is dominated by the spatial tracking error, and the direct detection system shows a superior performance because it is less sensitive to the spatial tracking error. On the other hand, for systems with small pointing and tracking jitters, the antenna gains are in general limited by the launch cost, and suboptimal antenna gains are often used in practice. In which case, the heterodyne system has a slightly higher power margin because of higher receiver sensitivity.

  18. Channel simulation for direct-detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.

    1974-01-01

    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct-detection optical communication system. The system is capable of providing signal fading statistics which obey log-normal, beta, Rayleigh, Ricean, or chi-square density functions. Experimental tests of the performance of the channel simulator are presented.

  19. Halo-Independent Comparison of Direct Dark Matter Detection Data

    DOE PAGES

    Del Nobile, Eugenio

    2014-01-01

    We review the halo-independent formalism that allows comparing data from different direct dark matter detection experiments without making assumptions on the properties of the dark matter halo. We apply this method to spin-independent WIMP-nuclei interactions, for both isospin-conserving and isospin-violating couplings, and to WIMPs interacting through an anomalous magnetic moment.

  20. Channel simulation for direct detection optical communication systems

    NASA Technical Reports Server (NTRS)

    Tycz, M.; Fitzmaurice, M. W.

    1974-01-01

    A technique is described for simulating the random modulation imposed by atmospheric scintillation and transmitter pointing jitter on a direct detection optical communication system. The system is capable of providing signal fading statistics which obey log normal, beta, Rayleigh, Ricean or chi-squared density functions. Experimental tests of the performance of the Channel Simulator are presented.

  1. Directed energy active illumination for near-Earth object detection

    NASA Astrophysics Data System (ADS)

    Riley, Jordan; Lubin, Philip; Hughes, Gary B.; O'Neill, Hugh; Meinhold, Peter; Suen, Jonathan; Bible, Johanna; Johansson, Isabella E.; Griswold, Janelle; Cook, Brianna

    2014-09-01

    On 15 February 2013, a previously unknown ~20 m asteroid struck Earth near Chelyabinsk, Russia, releasing kinetic energy equivalent to ~570 kt TNT. Detecting objects like the Chelyabinsk impactor that are orbiting near Earth is a difficult task, in part because such objects spend much of their own orbits in the direction of the Sun when viewed from Earth. Efforts aimed at protecting Earth from future impacts will rely heavily on continued discovery. Ground-based optical observatory networks and Earth-orbiting spacecraft with infrared sensors have dramatically increased the pace of discovery. Still, less than 5% of near-Earth objects (NEOs) >=100 m/~100 Mt TNT have been identified, and the proportion of known objects decreases rapidly for smaller sizes. Low emissivity of some objects also makes detection by passive sensors difficult. A proposed orbiting laser phased array directed energy system could be used for active illumination of NEOs, enhancing discovery particularly for smaller and lower emissivity objects. Laser fiber amplifiers emit very narrow-band energy, simplifying detection. Results of simulated illumination scenarios are presented based on an orbiting emitter array with specified characteristics. Simulations indicate that return signals from small and low emissivity objects is strong enough to detect. The possibility for both directed and full sky blind surveys is discussed, and the resulting diameter and mass limits for objects in different observational scenarios. The ability to determine both position and speed of detected objects is also discussed.

  2. Detection of Laser Optic Defects Using Gradient Direction Matching

    SciTech Connect

    Chen, B Y; Kegelmeyer, L M; Liebman, J A; Salmon, J T; Tzeng, J; Paglieroni, D W

    2005-12-14

    That National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) will be the world's largest and most energetic laser. It has thousands of optics and depends heavily on the quality and performance of these optics. Over the past several years, we have developed the NIF Optics Inspection Analysis System that automatically finds defects in a specific optic by analyzing images taken of that optic. This paper describes a new and complementary approach for the automatic detection of defects based on detecting the diffraction ring patterns in downstream optic images caused by defects in upstream optics. Our approach applies a robust pattern matching algorithm for images called Gradient Direction Matching (GDM). GDM compares the gradient directions (the direction of flow from dark to light) of pixels in a test image to those of a specified model and identifies regions in the test image whose gradient directions are most in line with those of the specified model. For finding rings, we use luminance disk models whose pixels have gradient directions all pointing toward the center of the disk. After GDM identifies potential rings locations, we rank these rings by how well they fit the theoretical diffraction ring pattern equation. We perform false alarm mitigation by throwing out rings of low fit. A byproduct of this fitting procedure is an estimate of the size of the defect and its distance from the image plane. We demonstrate the potential effectiveness of this approach by showing examples of rings detected in real images of NIF optics.

  3. Direct Detection of Sub-GeV Dark Matter

    SciTech Connect

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer

    2012-03-20

    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  4. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo

    2015-07-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  5. Dark matter directional detection in non-relativistic effective theories

    SciTech Connect

    Catena, Riccardo

    2015-07-20

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF{sub 4}, CS{sub 2} and {sup 3}He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  6. Direct Fast-Neutron Detection: A Progress Report

    SciTech Connect

    AJ Peurrung; DC Stromswold; PL Reeder; RR Hansen

    1998-10-18

    It is widely acknowledged that Mure neutron-detection technologies will need to offer increased performance at lower cost. One clear route toward these goals is rapid and direct detection of fast neutrons prior to moderation. This report describes progress to date in an effort to achieve such neutron detection via proton recoil within plastic scintillator. Since recording proton-recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the substantial difference in the speed of fission neutrons and gamma-ray photons. Should this effort ultimately prove successful, the resulting. technology would make a valuable contribution toward meeting the neutron-detection needs of the next century. This report describes the detailed investigations that have been part of Pacific Northwest National Laborato@s efforts to demonstrate direct fast-neutron detection in the laboratory. Our initial approach used a single, solid piece of scintillator along with the electronics needed for pulse-type differentiation. Work to date has led to the conclusion that faster scintillator and/or faster electronics will be necessary before satisfactory gamma-ray discrimination is achieved with this approach. Acquisition and testing of both faster scintillator and faster electronics are currently in progress. The "advanced" approach to direct fast-neutron detection uses a scintillating assembly with an overall density that is lower than that of ordinary plastic scintillator. The lower average density leads to longer interaction times for both neutrons and gamma rays, allowing easier discrimination. The modeling, optimization, and design of detection systems using this approach are described in detail.

  7. Lepton-flavored asymmetric dark matter and interference in direct detection

    NASA Astrophysics Data System (ADS)

    Hamze, Ali; Kilic, Can; Koeller, Jason; Trendafilova, Cynthia; Yu, Jiang-Hao

    2015-02-01

    In flavored dark matter models, dark matter can scatter off of nuclei through Higgs and photon exchange, both of which can arise from renormalizable interactions and individually lead to strong constraints from direct detection. While these two interaction channels can destructively interfere in the scattering amplitude, for a thermal relic with equal abundances for the dark matter particle and its antiparticle, this produces no effect on the total event rate. Focusing on lepton-flavored dark matter, we show that it is quite natural for dark matter to have become asymmetric during high-scale leptogenesis, and that in this case the direct detection bounds can be significantly weakened due to interference. We quantify this by mapping out and comparing the regions of parameter space that are excluded by direct detection for the symmetric and asymmetric cases of lepton-flavored dark matter. In particular, we show that the entire parameter region except for a narrow Higgs resonance window is ruled out in the symmetric case for fermion dark matter when the coupling to the Higgs dominates over the coupling to leptons, while large portions of parameter space are still allowed for the asymmetric case. The same is also true for a dark matter mass above 8 GeV for scalar dark matter when the coupling to leptons dominates over the coupling to the Higgs.

  8. Informational constraints on the emergence of passing direction in the team sport of futsal.

    PubMed

    Corrêa, Umberto Cesar; Vilar, Luís; Davids, Keith; Renshaw, Ian

    2014-01-01

    This study investigated compound spatial and temporal measures of interpersonal interactions purported to constrain the emergence of affordances for passing direction in the team sport of futsal. For this purpose, attacker-defender interactions in 37 sequences of play from a futsal competition in which 24 male professional players participated (M=30.04 years, SD=4.10) were filmed and analysed using TACTO software. Relative angle data were used as measures to study coordination tendencies that emerged between players during performance. Results showed that the direction for a pass emerged from relative angles between: (1) the vector from a ball carrier to ball receiver and the vector from the ball carrier to the nearest defender (70°) (p<0.01) and (2) the vector from a ball carrier to ball receiver and the vector from the ball carrier to a ball receiver's nearest defender (31°) (p < 0.01). Furthermore, passing direction was also constrained by temporal information from the emergence of both angles, since the pass was performed to attacker-defender dyads with the highest velocities of these angles (p < 0.05). Results suggested that decisions on selecting the direction of a pass in the team sport of futsal emerged at critical values of these key compound motion measures.

  9. Direct detection of sub-GeV dark matter with semiconductor targets

    SciTech Connect

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; Soto, Adrián; Volansky, Tomer; Yu, Tien -Tien

    2016-05-09

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their O(1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark, with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. In conclusion, the searches we propose will probe vast new regions of unexplored dark matter model and parameter space.

  10. Direct detection of sub-GeV dark matter with semiconductor targets

    NASA Astrophysics Data System (ADS)

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; Soto, Adrián; Volansky, Tomer; Yu, Tien-Tien

    2016-05-01

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their {O} (1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark , with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. The searches we propose will probe vast new regions of unexplored dark matter model and parameter space.

  11. Direct detection of sub-GeV dark matter with semiconductor targets

    DOE PAGES

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; ...

    2016-05-09

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their O(1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcomingmore » several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark, with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. In conclusion, the searches we propose will probe vast new regions of unexplored dark matter model and parameter space.« less

  12. Spaceborne Simulations of Two Direct-Detection Doppler Lidar Techniques

    NASA Technical Reports Server (NTRS)

    McGill, Matthew J.; Li, Steve X.

    1998-01-01

    Direct-detection (or incoherent) lidar is now a proven technique for measuring winds in the atmosphere. Over the last few years, several types of direct-detection lidar have evolved. These methods rely on Fabry-Perot interferometers(also termed etalons) or other narrow-passband filters to provide the required spectral resolution. One method, now called the edge (EDG) technique, uses a sharply-sloping filter and measures changes in the filter transmission caused by Doppler shifting of the laser wavelength. A variation of the EDG method, called the double-edge (DEDG) technique, uses two filters. The molecular DEDG method was first demonstrated by Chanin et al. for stratospheric measurements and more recently Korb et al. successfully demonstrated the aerosol DEDG through the troposphere. A second method, here termed the multi-channel (MC) technique, measures Doppler shifts by observing angular displacement of a Fabry-Perot fringe in a spatially resolving detector. The EDG technique thus employs the Fabry-Perot to convert the frequency shift into an amplitude signal, while the MC technique uses the Fabry-Perot to resolve the spectral signature which is then fitted to determine the centroid. The focus of this presentation is on the DEDG and MC methods because these are viewed as the current state of the art in direct-detection lidar. Successful ground-based demonstrations of direct-detection wind measurements have resulted in proposals for spaceborne systems. With this new emphasis on spaceborne systems comes the need for accurate prediction of spaceborne direct-detection Doppler lidar performance. Previously, the EDG and MC methods have been compared although only for aerosol Doppler systems. A recent paper by McGill and Spinhirne compares the DEDG and MC methods in a non-system specific manner for both the aerosol and molecular Doppler systems. The purpose of this presentation is to extend the previous work of McGill and Spinhirne to examine the performance of

  13. Future directions for H sub x O sub y detection

    NASA Technical Reports Server (NTRS)

    Crosley, David R. (Editor); Hoell, James M. (Editor)

    1986-01-01

    The activities and recommendations of the NASA workshop on the Future Directions for H sub x O sub y detection are given. The objective of this workshop was to access future directions for the measurement of the OH radical as well as other H sub x O sub y species. The workshop discussions were focused by two broad questions: (1) What are the capabilities of potential measurement methods? and (2) Will the results from the most promising method be useful in furthering understanding of tropospheric chemistry?

  14. Dark matter effective field theory scattering in direct detection experiments

    DOE PAGES

    Schneck, K.

    2015-05-01

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implicationsmore » of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.« less

  15. Directional detection of dark matter in universal bound states

    SciTech Connect

    Laha, Ranjan

    2015-10-06

    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angular recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.

  16. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  17. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  18. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect

    Schneck, K.

    2015-05-01

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  19. An Automated Directed Spectral Search Methodology for Small Target Detection

    NASA Astrophysics Data System (ADS)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  20. Direct detection of classically undetectable dark matter through quantum decoherence

    NASA Astrophysics Data System (ADS)

    Riedel, C. Jess

    2014-03-01

    Although various pieces of indirect evidence about the nature of dark matter have been collected, its direct detection has eluded experimental searches despite extensive effort. If the mass of dark matter is below 1 MeV, it is essentially imperceptible to conventional detection methods because negligible energy is transferred to nuclei during collisions. Here I propose directly detecting dark matter through the quantum decoherence it causes rather than its classical effects such as recoil or ionization. I show that quantum spatial superpositions are sensitive to low-mass dark matter which is inaccessible to classical techniques. This provides new independent motivation for matter interferometry with large masses, especially on spaceborne platforms. The apparent dark matter wind we experience as the Sun travels through the Milky Way ensures interferometers and related devices are directional detectors, and so are able to provide unmistakable evidence that decoherence has galactic origins. This research was partially supported by the U.S. Department of Energy through the LANL/LDRD program, and by the John Templeton Foundation through grant number 21484.

  1. Dark matter direct detection with non-Maxwellian velocity structure

    SciTech Connect

    Kuhlen, Michael; Weiner, Neal; Diemand, Jürg; Moore, Ben; Potter, Doug; Stadel, Joachim; Madau, Piero; Zemp, Marcel E-mail: neal.weiner@nyu.edu E-mail: pmadau@ucolick.org E-mail: dpotter@physik.uzh.ch E-mail: mzemp@umich.edu

    2010-02-01

    The velocity distribution function of dark matter particles is expected to show significant departures from a Maxwell-Boltzmann distribution. This can have profound effects on the predicted dark matter - nucleon scattering rates in direct detection experiments, especially for dark matter models in which the scattering is sensitive to the high velocity tail of the distribution, such as inelastic dark matter (iDM) or light (few GeV) dark matter (LDM), and for experiments that require high energy recoil events, such as many directionally sensitive experiments. Here we determine the velocity distribution functions from two of the highest resolution numerical simulations of Galactic dark matter structure (Via Lactea II and GHALO), and study the effects for these scenarios. For directional detection, we find that the observed departures from Maxwell-Boltzmann increase the contrast of the signal and change the typical direction of incoming DM particles. For iDM, the expected signals at direct detection experiments are changed dramatically: the annual modulation can be enhanced by more than a factor two, and the relative rates of DAMA compared to CDMS can change by an order of magnitude, while those compared to CRESST can change by a factor of two. The spectrum of the signal can also change dramatically, with many features arising due to substructure. For LDM the spectral effects are smaller, but changes do arise that improve the compatibility with existing experiments. We find that the phase of the modulation can depend upon energy, which would help discriminate against background should it be found.

  2. [Public financing of health care in Africa, budgetary constraints and direct payment by users: an overview of the essential questions].

    PubMed

    Mathonnat, Jacky

    2008-12-01

    The improvement of health in Africa is confronted with many challenges. The financial resources devoted to health are insufficient, but to increase them is not enough. It is essential to reinforce the systems of health care and to improve efficiency of the public and private expenditure in health. In the majority of the countries, the budgetary constraints are strong, but there is room for maneuver to increase the public health expenditure, by domestic financing or by foreign assistance. It is advisable, however, to be particularly vigilant as to the negative effects which could possibly result from this on the various elements which might play a significant role in the improvement of health. States must exploit relevantly all possibilities of increasing the health expenditure which become available. A majority of them are not able to afford to neglect direct payments, even although they have to be integrated into a coherent strategy of financing, carefully analyzed and implemented.

  3. A generating set direct search augmented Lagrangian algorithm for optimization with a combination of general and linear constraints.

    SciTech Connect

    Lewis, Robert Michael (College of William and Mary, Williamsburg, VA); Torczon, Virginia Joanne (College of William and Mary, Williamsburg, VA); Kolda, Tamara Gibson

    2006-08-01

    We consider the solution of nonlinear programs in the case where derivatives of the objective function and nonlinear constraints are unavailable. To solve such problems, we propose an adaptation of a method due to Conn, Gould, Sartenaer, and Toint that proceeds by approximately minimizing a succession of linearly constrained augmented Lagrangians. Our modification is to use a derivative-free generating set direct search algorithm to solve the linearly constrained subproblems. The stopping criterion proposed by Conn, Gould, Sartenaer and Toint for the approximate solution of the subproblems requires explicit knowledge of derivatives. Such information is presumed absent in the generating set search method we employ. Instead, we show that stationarity results for linearly constrained generating set search methods provide a derivative-free stopping criterion, based on a step-length control parameter, that is sufficient to preserve the convergence properties of the original augmented Lagrangian algorithm.

  4. New constraints on direct collapse black hole formation in the early Universe

    NASA Astrophysics Data System (ADS)

    Agarwal, Bhaskar; Smith, Britton; Glover, Simon; Natarajan, Priyamvada; Khochfar, Sadegh

    2016-07-01

    Direct collapse black holes (DCBH) have been proposed as a solution to the challenge of assembling supermassive black holes by z > 6 to explain the bright quasars observed at this epoch. The formation of a DCBH seed with MBH ˜ 104-5 M⊙ requires a pristine atomic-cooling halo to be illuminated by an external radiation field that is sufficiently strong to entirely suppress H2 cooling in the halo. Many previous studies have attempted to constrain the critical specific intensity that is likely required to suppress H2 cooling, denoted as Jcrit. However, these studies have typically assumed that the incident external radiation field can be modelled with a blackbody spectrum. Under this assumption, it is possible to derive a unique value for Jcrit that depends only on the temperature of the blackbody. In this study we consider a more realistic spectral energy distribution (SED) for the external source of radiation that depends entirely on its star formation history and age. The rate of destruction of the species responsible for suppressing molecular hydrogen cooling depends on the detailed shape of the SED. Therefore the value of Jcrit is tied to the shape of the incident SED of the neighbouring galaxy. We fit a parametric form to the rates of destruction of H2 and H- that permit direct collapse. Owing to this, we find that Jcrit is not a fixed threshold but can lie anywhere in the range Jcrit ˜ 0.5-103, depending on the details of the source stellar population.

  5. Direct atmosphere opacity observations from CALIPSO provide new constraints on cloud-radiation interactions

    NASA Astrophysics Data System (ADS)

    Guzman, R.; Chepfer, H.; Noel, V.; Vaillant de Guélis, T.; Kay, J. E.; Raberanto, P.; Cesana, G.; Vaughan, M. A.; Winker, D. M.

    2017-01-01

    The spaceborne lidar CALIPSO (Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation) directly measures atmospheric opacity. In 8 years of CALIPSO observations, we find that 69% of vertical profiles penetrate through the complete atmosphere. The remaining 31% do not reach the surface, due to opaque clouds. The global mean altitude of full attenuation of the lidar beam (z_opaque) is 3.2 km, but there are large regional variations in this altitude. Of relevance to cloud-climate studies, the annual zonal mean longwave cloud radiative effect and annual zonal mean z_opaque weighted by opaque cloud cover are highly correlated (0.94). The annual zonal mean shortwave cloud radiative effect and annual zonal mean opaque cloud cover are also correlated (-0.95). The new diagnostics introduced here are implemented within a simulator framework to enable scale-aware and definition-aware evaluation of the LMDZ5B global climate model. The evaluation shows that the model overestimates opaque cloud cover (31% obs. versus 38% model) and z_opaque (3.2 km obs. versus 5.1 km model). In contrast, the model underestimates thin cloud cover (35% obs. versus 14% model). Further assessment shows that reasonable agreement between modeled and observed longwave cloud radiative effects results from compensating errors between insufficient warming by thin clouds and excessive warming due to overestimating both z_opaque and opaque cloud cover. This work shows the power of spaceborne lidar observations to directly constrain cloud-radiation interactions in both observations and models.

  6. Direct Real-Time Detection of Vapors from Explosive Compounds

    SciTech Connect

    Ewing, Robert G.; Clowers, Brian H.; Atkinson, David A.

    2013-10-03

    The real-time detection of vapors from low volatility explosives including PETN, tetryl, RDX and nitroglycerine along with various compositions containing these substances is demonstrated. This was accomplished with an atmospheric flow tube (AFT) using a non-radioactive ionization source and coupled to a mass spectrometer. Direct vapor detection was demonstrated in less than 5 seconds at ambient temperature without sample pre-concentration. The several seconds of residence time of analytes in the AFT provides a significant opportunity for reactant ions to interact with analyte vapors to achieve ionization. This extended reaction time, combined with the selective ionization using the nitrate reactant ions (NO3- and NO3-•HNO3), enables highly sensitive explosives detection. Observed signals from diluted explosive vapors indicate detection limits below 10 ppqv using selected ion monitoring (SIM) of the explosive-nitrate adduct at m/z 349, 378, 284 and 289 for tetryl, PETN, RDX and NG respectively. Also provided is a demonstration of the vapor detection from 10 different energetic formulations, including double base propellants, plastic explosives and commercial blasting explosives using SIM for the NG, PETN and RDX product ions.

  7. Clustering and community detection in directed networks: A survey

    NASA Astrophysics Data System (ADS)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis

    2013-12-01

    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  8. Monthly modulation in dark matter direct-detection experiments

    SciTech Connect

    Britto, Vivian; Meyers, Joel E-mail: jmeyers@cita.utoronto.ca

    2015-11-01

    The signals in dark matter direct-detection experiments should exhibit modulation signatures due to the Earth's motion with respect to the Galactic dark matter halo. The annual and daily modulations, due to the Earth's revolution about the Sun and rotation about its own axis, have been explored previously. Monthly modulation is another such feature present in direct detection signals, and provides a nearly model-independent method of distinguishing dark matter signal events from background. We study here monthly modulations in detail for both WIMP and WISP dark matter searches, examining both the effect of the motion of the Earth about the Earth-Moon barycenter and the gravitational focusing due to the Moon. For WIMP searches, we calculate the monthly modulation of the count rate and show the effects are too small to be observed in the foreseeable future. For WISP dark matter experiments, we show that the photons generated by WISP to photon conversion have frequencies which undergo a monthly modulating shift which is detectable with current technology and which cannot in general be neglected in high resolution WISP searches.

  9. Direct mass spectrometric detection of trace explosives in soil samples.

    PubMed

    Ma, Lipo; Xin, Bin; Chen, Yi

    2012-04-07

    The detection of explosives in soil is of great significance in public security programmes and environmental science. In the present work, a ppb-level method was established to directly detect the semi-volatile explosives, RDX and TNT, present in complex soil samples. The method used thermal sampling technique and a direct current atmospheric pressure glow discharge source mounted with a brass cylinder electrode (9 mm × 4.6 mm i.d./5.6 mm o.d.) to face the samples, requiring no sample pretreatment steps such as soil extraction (about ten hours). It was characterized by the merits of easy operation, high sensitivity and fast speed, and has been validated by real soil samples from various locations around a factory or firecracker releasing fields. It took only 5 min per sample, with the limit of detection down to 0.5 ppb (S/N = 3) trinitrohexahydro-1,3,5-triazine in soils heated at 170 °C. It is also extendable to the analysis of other volatile analytes.

  10. Direct detection of alpha synuclein oligomers in vivo

    PubMed Central

    2013-01-01

    Background Rat models of Parkinson’s disease are widely used to elucidate the mechanisms underlying disease etiology or to investigate therapeutic approaches. Models were developed using toxins such as MPTP or 6-OHDA to specifically target dopaminergic neurons resulting in acute neuronal loss in the substantia nigra or by using viral vectors to induce the specific and gradual expression of alpha synuclein in the substantia nigra. The detection of alpha- synuclein oligomers, the presumed toxic species, in these models and others has been possible using only indirect biochemical approaches to date. Here we coinjected AAVs encoding alpha-synuclein fused to the N- or C-terminal half of VenusYFP in rat substantia nigra pars compacta and describe for the first time a novel viral vector rodent model with the unique ability to directly detect and track alpha synuclein oligomers ex vivo and in vivo. Results Viral coinjection resulted in widespread VenusYFP signal within the nigrostriatal pathway, including cell bodies in the substantia nigra and synaptic accumulation in striatal terminals, suggestive of in vivo alpha-synuclein oligomers formation. Transduced rats showed alpha-synuclein induced dopaminergic neuron loss in the substantia nigra, the appearance of dystrophic neurites, and gliosis in the striatum. Moreover, we have applied in vivo imaging techniques in the living mouse to directly image alpha-synuclein oligomers in the cortex. Conclusion We have developed a unique animal model that provides a tool for the Parkinson’s disease research community with which to directly detect alpha- synuclein oligomers in vivo and screen therapeutic approaches targeting alpha-synuclein oligomers. PMID:24252244

  11. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength

    PubMed Central

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-01-01

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology. PMID:24694515

  12. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength.

    PubMed

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-04-03

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology.

  13. Magnetic eigenmaps for community detection in directed networks

    NASA Astrophysics Data System (ADS)

    Fanuel, Michaël; Alaíz, Carlos M.; Suykens, Johan A. K.

    2017-02-01

    Communities in directed networks have often been characterized as regions with a high density of links, or as sets of nodes with certain patterns of connection. Our approach for community detection combines the optimization of a quality function and a spectral clustering of a deformation of the combinatorial Laplacian, the so-called magnetic Laplacian. The eigenfunctions of the magnetic Laplacian, which we call magnetic eigenmaps, incorporate structural information. Hence, using the magnetic eigenmaps, dense communities including directed cycles can be revealed as well as "role" communities in networks with a running flow, usually discovered thanks to mixture models. Furthermore, in the spirit of the Markov stability method, an approach for studying communities at different energy levels in the network is put forward, based on a quantum mechanical system at finite temperature.

  14. New archaeomagnetic direction results from China and their constraints on palaeosecular variation of the geomagnetic field in Eastern Asia

    NASA Astrophysics Data System (ADS)

    Cai, Shuhui; Tauxe, Lisa; Deng, Chenglong; Qin, Huafeng; Pan, Yongxin; Jin, Guiyun; Chen, Xuexiang; Chen, Wei; Xie, Fei; Zhu, Rixiang

    2016-11-01

    We carried out an archaeomagnetic directional study on 38 oriented samples (bricks and baked clays) collected from four archaeological locations at three provinces in China. The ages of our samples, spanning from ˜3000 BCE to ˜1300 CE, were constrained using a combination of archaeological context, radiocarbon dating and stratigraphic information. Rock magnetic results demonstrate that the main magnetic minerals of the studied samples are magnetite and/or hematite in single domain and superparamagnetic states. A total of 20 new reliable archaeodirectional data from 12 independent sites are obtained after thermal demagnetization experiments. These are the first set of archaeodirectional data in China produced since the 1990s. The published data are largely from the past 2 kyr and data from older time periods are rare. Our new data, especially those from period older than 3 ka, fill many gaps of the presently published dataset and will provide strong constraints on palaeosecular variation of the geomagnetic field in Eastern Asia and on the improvement of global models. Quite a few inflection points in the direction of the geomagnetic field are recorded in Eastern Asia over the past 10 kyr and some of them synchronize with the maximums or minimums of the palaeointensity. The palaeosecular variation rates are very low (based on present data distribution) before 2000 BCE and then start to increase and fluctuate afterward, which is generally consistent with the pattern of palaeointensity variations in this area.

  15. Direct detection of Vibrio cholerae in stool samples.

    PubMed Central

    Varela, P; Pollevick, G D; Rivas, M; Chinen, I; Binsztein, N; Frasch, A C; Ugalde, R A

    1994-01-01

    A direct method to detect Vibrio cholerae in stool samples was developed by using a PCR procedure that did not require a DNA purification step. Dilution (1/100) of stool samples prevented inhibition of the reaction by contaminants, and two consecutive PCRs, the second one with a nested primer, achieved the desired sensitivity. Comparison of the results obtained from stool swab samples processed by the two-step PCR and by an enzyme-linked immunosorbent assay using GM1 as the capture molecule showed that the former is more sensitive and gave positive results even when V. cholerae was not culturable or dead. Images PMID:8051251

  16. Directional detection of dark matter in universal bound states

    DOE PAGES

    Laha, Ranjan

    2015-10-06

    It has been suggested that several small-scale structure anomalies in Λ CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown in Ref. [1] that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Ref. [2] studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angularmore » recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Furthermore, observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.« less

  17. Direct detection of the 229Th nuclear clock transition

    NASA Astrophysics Data System (ADS)

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B.; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E.; Trautmann, Norbert G.; Thirolf, Peter G.

    2016-05-01

    Today’s most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of 229Th (denoted 229mTh). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for 229mTh2+. More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard.

  18. Cytochrome oxidase subunit III from Arbacia lixula: detection of functional constraints by comparison with homologous sequences.

    PubMed

    De Giorgi, C; Martiradonna, A; Saccone, C

    1993-01-01

    In this paper we report the comparison of the sequences of the cytochrome oxidase subunit III from three different sea urchin species. Both nucleotide and amino acid sequences have been analyzed. The nucleotide sequence analysis reveals that the sea urchin sequences obey some rules already found in mammals. The base substitution analysis carried out on the sequences of the three species pairs, shows that the evolutionary dynamics of the first and the second codon positions are so slow that do not allow a quantitative measurement of their genetic distances, thus demonstrating that also in these species the COIII gene is strongly conserved during evolution. Changes occurring at the third codon positions indicate that the three species evolved from a common ancestor under different directional mutational pressure. The multi-alignment of the sea urchin proteins indicates the existence of the amino acid sequence motif N R T that represents a possible glycosylation site. Another glycosylation site has been detected in the mammalian cytochrome oxidase subunit III, in a position slightly different. Such an analysis revealed, for the first time, a new functional aspect of this sequence.

  19. On the existence of low-mass dark matter and its direct detection.

    PubMed

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R; Ulbricht, Hendrik

    2015-01-27

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too.

  20. On the Existence of Low-Mass Dark Matter and its Direct Detection

    PubMed Central

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too. PMID:25622565

  1. Development of a novel gamma probe for detecting radiation direction

    NASA Astrophysics Data System (ADS)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  2. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}−g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-til-tilde(p{sub R}). The entire family of conventional halo-independent g-tilde(v{sub min}) plots for all DM masses are directly found from the single h-tilde(p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde(p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde(v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  3. Halo-independent direct detection analyses without mass assumptions

    DOE PAGES

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; ...

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR),more » the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.« less

  4. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ – σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin – g~ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g~(vmin) plots for all DM masses are directly found from the single tilde h~(pR) plot through a simple rescaling of axes. By considering results in tildeh~(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g~(vmin) plots for different DM masses. As a result, we conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  5. Halo-independent direct detection analyses without mass assumptions

    SciTech Connect

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew E-mail: pjfox@fnal.gov E-mail: matthew.mccullough@cern.ch

    2015-10-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m{sub χ}−σ{sub n} plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v{sub min}− g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v{sub min} to nuclear recoil momentum (p{sub R}), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-tilde (p{sub R}). The entire family of conventional halo-independent g-tilde (v{sub min}) plots for all DM masses are directly found from the single h-tilde (p{sub R}) plot through a simple rescaling of axes. By considering results in h-tilde (p{sub R}) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde (v{sub min}) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  6. Halo-independent direct detection analyses without mass assumptions

    NASA Astrophysics Data System (ADS)

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the mχ-σn plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the vmin-tilde g plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from vmin to nuclear recoil momentum (pR), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call tilde h(pR). The entire family of conventional halo-independent tilde g(vmin) plots for all DM masses are directly found from the single tilde h(pR) plot through a simple rescaling of axes. By considering results in tilde h(pR) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple tilde g(vmin) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity.

  7. Using known QTLs to detect directional epistatic interactions.

    PubMed

    Slatkin, Montgomery; Kirkpatrick, Mark

    2012-02-01

    Epistasis plays important roles in evolution, for example in the evolution of recombination, but each of the current methods to study epistasis has limitations. Here, we propose a new strategy. If a quantitative trait locus (QTL) affecting a quantitative character has been identified, individuals who have the same genotype at that QTL can be regarded as comprising a subpopulation whose response to selection depends in part on interactions with other loci affecting the character. We define the marginal differences to be the differences in the average phenotypes of individuals with different genotypes of that QTL. We show that the response of the marginal differences to directional selection on the quantitative character depends on epistatic gene interactions. For a model with no interactions, the marginal differences do not differ on average from their starting values once linkage equilibrium has been re-established. If there is directional epistasis, meaning that interactions between the QTL and other loci tend to increase or decrease the character more than under an additive model, then the marginal differences will tend to increase or decrease accordingly when larger values of the character are selected for. We develop a likelihood ratio test for significant changes in the marginal differences and show that it has some power to detect directional epistasis for realistic sample sizes. We also show that epistatic interactions which affect the evolution of the marginal differences do not necessarily result in a substantial epistatic component of the genetic variance.

  8. Tropospheric Wind Profile Measurements with a Direct Detection Doppler Lidar

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce M.; Li, Steven X.; Korb, C. Laurence; Chen, Huailin; Mathur, Savyasachee

    1998-01-01

    Research has established the importance of global tropospheric wind measurements for large scale improvements in numerical weather prediction. In addition, global wind measurements provide data that are fundamental to the understanding and prediction of global climate change. These tasks are closely linked with the goals of the NASA Earth Science Enterprise and Global Climate Change programs. NASA Goddard has been actively involved in the development of direct detection Doppler lidar methods and technologies to meet the wind observing needs of the atmospheric science community. In this paper we describe a recently developed prototype wind lidar system using a direct detection Doppler technique for measuring wind profiles from the surface through the troposphere. This system uses a pulsed ND:YAG laser operating at 1064 nm as the transmitter. The laser pulse is directed to the atmosphere using a 40 cm diameter scan mirror. The portion of the laser energy backscattered from aerosols and molecules is collected by a 40 cm diameter telescope and coupled via fiber optics into the Doppler receiver. Single photon counting APD's are used to detect the atmospheric backscattered signal. The principle element of the receiver is a dual bandpass tunable Fabry Perot etalon which analyzes the Doppler shift of the incoming laser signal using the double edge technique. The double edge technique uses two high resolution optical filters having bandpasses offset relative to one another such that the 'edge' of the first filter's transmission function crosses that of the second at the half power point. The outgoing laser frequency is located approximately at the crossover point. Due to the opposite going slopes of the edges, a Doppler shift in the atmospheric backscattered laser frequency produces a positive change in signal for one filter and a negative change in the second filter. Taking the ratio of the two edge channel signals yields a result which is directly proportional to the

  9. Measurements of direct CP violation and constraints on the CKM triangle in B → K*π decays

    SciTech Connect

    Wagner, Andrew Phillips

    2010-02-01

    We constrain the apex of the Cabibbo-Kobayashi-Maskawa unitarity triangle with measurements of B → K*π amplitudes from analyses of B0 → K+π-π0 and B0 → KSπ+π- decays. This constraint is consistent with the world average. The B0 → K+π-π0 decay mode is reconstructed from a sample of 454 million B0$\\bar{B}$ 0 events collected by the BABAR detector at SLAC. We measure direct CP violation in B0 → K*+π- decays at the level of 3σ when measurements from both B0 → K+π-π0 and B0 → KSπ+π- decays are combined.

  10. Complex Scalar Field Dark Matter and the Stochastic Gravitational Wave Background from Inflation: New Cosmological Constraints and Detectability

    NASA Astrophysics Data System (ADS)

    Li, Bohua; Shapiro, Paul R.; Rindler-Daller, Tanja

    2017-01-01

    We consider an alternative to WIMP cold dark matter (CDM), ultralight bosonic dark matter (m≥10-22 eV) described by a complex scalar field (SFDM), of which the comoving particle number density is conserved after particle production during standard reheating (w=p/ρ=0). In a ΛSFDM universe, SFDM starts relativistic, evolving from stiff (w=1) to radiation-like (w=1/3), before becoming nonrelativistic at late times (w=0). Thus, before the familiar radiation-dominated phase, there is an even earlier phase of stiff-SFDM-domination, during which the expansion rate is higher than in ΛCDM. The transitions between these phases, determined by SFDM particle mass m, and coupling strength λ, of a quartic self-interaction, are therefore constrained by cosmological observables, particularly Neff, the effective number of neutrino species during BBN, and zeq, the redshift of matter-radiation equality. Furthermore, since the homogeneous energy density contributed by the stochastic gravitational wave background (SGWB) from inflation is amplified during the stiff phase, relative to the other components, the SGWB can contribute a radiation-like component large enough to affect these observables. This same amplification makes possible detection of this SGWB at high frequencies by current laser interferometer experiments, e.g., aLIGO/Virgo, eLISA. For SFDM particle parameters that satisfy these cosmological constraints, the amplified SGWB is detectable by aLIGO, for values of tensor-to-scalar ratio r currently allowed by CMB polarization measurements, for a broad range of possible reheat temperatures Tre. For a given r, if SFDM parameters marginally satisfy cosmological constraints (maximizing total SGWB energy density), the SGWB is maximally detectable when modes that reenter the horizon when reheating ends have frequencies in the 10-50 Hz aLIGO band today. For example, if r=0.01, the maximally detectable model for (λ/(mc2)2, m)=(10-18 eV-1cm3, 8×10-20 eV) has Tre=104 GeV, for

  11. Consequences of statistical sense determination for WIMP directional detection

    NASA Astrophysics Data System (ADS)

    Green, Anne M.; Morgan, Ben

    2008-01-01

    We study the consequences of limited recoil sense reconstruction on the number of events required to reject isotropy and detect a WIMP signal using a directional detector. For a constant probability of determining the sense correctly, 3-d readout and zero background, we find that as the probability is decreased from 1.0 to 0.75 the number of events required increases by a factor of a few. As the probability is decreased further the number of events increases sharply, and isotropy can be rejected more easily by discarding the sense information and using axial statistics. This however requires an order of magnitude more events than vectorial data with perfect sense determination. We also consider energy dependent probabilities of correctly measuring the sense. Our main finding is that correctly determining the sense of the abundant, but less anisotropic, low energy recoils is most important.

  12. Direct-detection wind lidar operating with a multimode laser.

    PubMed

    Bruneau, Didier; Blouzon, Frédéric; Spatazza, Joseph; Montmessin, Franck; Pelon, Jacques; Faure, Benoît

    2013-07-10

    A direct-detection wind lidar that operates with a multimode laser has been developed and tested. The instrument exploits the light backscattered by particles using a Mach-Zehnder interferometer with an optical path difference matched to the free spectral range of the laser longitudinal modes. In addition to requiring no monomodal emission, the system requires no frequency locking between the interferometer and the laser. We report laboratory and atmospheric measurements that show that the lidar is capable of measuring the radial wind velocity with a systematic error lower than 1 ms(-1) and a random error lower than 2 ms(-1) for a signal-to-noise ratio of 100. The development is motivated by the possibility to probe wind with a compact system in planetary atmospheres.

  13. Directional eye fixation sensor using birefringence-based foveal detection

    NASA Astrophysics Data System (ADS)

    Gramatikov, Boris I.; Zalloum, Othman H. Y.; Wu, Yi Kai; Hunter, David G.; Guyton, David L.

    2007-04-01

    We recently developed and reported an eye fixation monitor that detects the fovea by its radial orientation of birefringent nerve fibers. The instrument used a four-quadrant photodetector and a normalized difference function to check for a best match between the detector quadrants and the arms of the bow-tie pattern of polarization states surrounding the fovea. This function had a maximum during central fixation but could not tell where the subject was looking relative to the center. We propose a linear transformation to obtain horizontal and vertical eye position coordinates from the four photodetector signals, followed by correction based on a priori calibration information. The method was verified on both a computer model and on human eyes. The major advantage of this new eye-tracking method is that it uses true information coming from the fovea, rather than reflections from other structures, to identify the direction of foveal gaze.

  14. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    NASA Astrophysics Data System (ADS)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  15. Indirect detection constraints on s- and t-channel simplified models of dark matter

    NASA Astrophysics Data System (ADS)

    Carpenter, Linda M.; Colburn, Russell; Goodman, Jessica; Linden, Tim

    2016-09-01

    Recent Fermi-LAT observations of dwarf spheroidal galaxies in the Milky Way have placed strong limits on the gamma-ray flux from dark matter annihilation. In order to produce the strongest limit on the dark matter annihilation cross section, the observations of each dwarf galaxy have typically been "stacked" in a joint-likelihood analysis, utilizing optical observations to constrain the dark matter density profile in each dwarf. These limits have typically been computed only for singular annihilation final states, such as b b ¯ or τ+τ- . In this paper, we generalize this approach by producing an independent joint-likelihood analysis to set constraints on models where the dark matter particle annihilates to multiple final-state fermions. We interpret these results in the context of the most popular simplified models, including those with s- and t-channel dark matter annihilation through scalar and vector mediators. We present our results as constraints on the minimum dark matter mass and the mediator sector parameters. Additionally, we compare our simplified model results to those of effective field theory contact interactions in the high-mass limit.

  16. Direct x-ray detection with conjugated polymer devices

    NASA Astrophysics Data System (ADS)

    Boroumand, F. A.; Zhu, M.; Dalton, A. B.; Keddie, J. L.; Sellin, P. J.; Gutierrez, J. J.

    2007-07-01

    The authors report the first direct detection of x-ray induced photocurrents in thick films (up to 20μm) of conjugated polymers. Schottky-based "sandwich" structures were fabricated from layers of either poly[1-methoxy-4-(2-ethylhexyloxy)-phenylenevinylene] (MEH-PPV) or poly(9,9-dioctylfluorene) (PFO) on indium tin oxide substrates using a top contact of aluminum. Good rectification was achieved from the Al-polymer contact, with a reverse bias leakage current density as low as 4nA/cm2 at an electric field strength of 25kV/cm. Irradiation with x-rays from a 50kV x-ray tube produced a linear increase in photocurrent over a dose rate range from 4to18mGy/s. The observed x-ray sensitivities of 240nC/mGy/cm3 for MEH-PPV and 480nC/mGy/cm3 for PFO structures are comparable to that reported for Si devices. A response time of <150ms to pulsed x-ray irradiation was measured with no evidence of long-lived current transients. Conjugated polymers offer the advantage of easy coatability over large areas and on curved surfaces. Their low average atomic number provides tissue-equivalent dosimetric response, with many potential applications including medical x-ray and synchrotron photon detection.

  17. Lenslet array to further suppress starlight for direct exoplanet detection

    NASA Astrophysics Data System (ADS)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-07-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  18. Subcarrier multiplexing with dispersion reduction and direct detection

    DOEpatents

    Sargis, Paul D.; Haigh, Ronald E.; McCammon, Kent G.

    1997-01-01

    An SCM system for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream.

  19. Subcarrier multiplexing with dispersion reduction and direct detection

    DOEpatents

    Sargis, P.D.; Haigh, R.E.; McCammon, K.G.

    1997-01-21

    An SCM system is disclosed for simultaneously reducing the concomitant problems of receiver complexity and dispersion penalty and without requiring the use of an expensive, high-bandwidth optical detector. The system provides both a dispersion reduction and a direct detection to the receiver, with microwave mixers and lithium niobate external modulators that produce sidebands that are only separated by a few gigahertz from a principal laser optical carrier. Digital data streams are independently impressed upon these sidebands for transmission over an ordinary single-mode fiber. Independent high-speed data streams are upconverted to microwave frequencies. These subcarriers are then combined with a microwave power combiner and amplified with a microwave amplifier. A solid-state 1550-nm laser carrier is modulated by the microwave subcarriers. An erbium-doped fiber amplifier (EDFA) is used just prior to long-distance transmission over ordinary single-mode fiber. The transmitted optical signal may then traverse multiple EDFAs to compensate for long-haul optical fiber losses prior to detection. At a receiving end, the optical signal is split into multiple paths. The subcarrier channels are optically pre-selected using a narrowband optical filter, such as a fiber Fabry-Perot (FFP) filter. An optical detector converts the selected optical signal into a baseband electrical data stream. 2 figs.

  20. Direct and Indirect Dark Matter Detection in Gauge Theories

    SciTech Connect

    Queiroz, Farinaldo

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  1. DIRECT DETECTIONS OF YOUNG STARS IN NEARBY ELLIPTICAL GALAXIES

    SciTech Connect

    Ford, H. Alyson; Bregman, Joel N.

    2013-06-20

    Small amounts of star formation in elliptical galaxies are suggested by several results: surprisingly young ages from optical line indices, cooling X-ray gas, and mid-infrared dust emission. Such star formation has previously been difficult to directly detect, but using ultraviolet Hubble Space Telescope Wide Field Camera 3 imaging, we have identified individual young stars and star clusters in four nearby ellipticals. Ongoing star formation is detected in all galaxies, including three ellipticals that have previously exhibited potential signposts of star-forming conditions (NGC 4636, NGC 4697, and NGC 4374), as well as the typical ''red and dead'' NGC 3379. The current star formation in our closest targets, where we are most complete, is between 2.0 and 9.8 Multiplication-Sign 10{sup -5} M{sub Sun} yr{sup -1}. The star formation history was roughly constant from 0.5 to 1.5 Gyr (at (3-5) Multiplication-Sign 10{sup -4} M{sub Sun} yr{sup -1}), but decreased by a factor of several in the past 0.3 Gyr. Most star clusters have a mass between 10{sup 2} and 10{sup 4} M{sub Sun }. The specific star formation rates of {approx}10{sup -16} yr{sup -1} (at the present day) or {approx}10{sup -14} yr{sup -1} (when averaging over the past Gyr) imply that a fraction 10{sup -8} of the stellar mass is younger than 100 Myr and 10{sup -5} is younger than 1 Gyr, quantifying the level of frosting of recent star formation over the otherwise passive stellar population. There is no obvious correlation between either the presence or spatial distribution of postulated star formation indicators and the star formation we detect.

  2. Direct detection of brown dwarf companions of nearby stars

    NASA Astrophysics Data System (ADS)

    Oppenheimer, Ben R.

    This thesis presents the first direct detection of a substellar companion of a star other than the Sun. This object, a brown dwarf called Gliese 229B, presented a unique opportunity to characterize low-temperature brown dwarfs for the first time. The discovery and initial spectrum of Gliese 229B show that the object must be substellar based on its intrinsic luminosity of 6.4×10-6Lsolar and its cool surface temperature, 900 K. Detailed study of Gliese 229B includes extensive photometric measurements from 0.5 to 12 μm, high signal-to-noise ratio spectroscopy from 0.84 to 5.0 μm and the detection of 0'' t; yr-1 of orbital motion. These results are presented in Chapters 2 and 3. A detailed review of brown dwarf science leads to a complete and scientifically meaningful definition of the classes ``planet'' and ``brown dwarf''' in Chapter 1. After the discovery of Gliese 229B, which was found in a survey for companions of young stars, we began an extensive search for brown dwarf companions in orbit about all known stars within 8 pc of the Sun and with δ > -35°. The search includes optical coronagraphic and infrared direct imaging of these stars, conducted on the Palomar 60' and 200' telescopes respectively. The search was designed to find companions of each star without color bias. While the search revealed no other brown dwarf companions of these stars, it did uncover 6 new stellar companions. The sensitivity limits of the survey permit the detection of brown dwarfs up to four magnitudes fainter than Gliese 229B around 90% of the stars. The sensitivity is, however, not uniform spatially or from star to star. This limits our ability to make strong statements about the prevalence of brown dwarf companions of nearby stars. The survey does have sensitivity to all stellar companions between 3 and 30' from the survey stars, however. Chapter 5 describes related work on very low-mass stars in the Pleiades star cluster. This optical spectroscopy involved trying to find a

  3. Constraints on the Detection of the Solar Nebula's Oxidation State Through Asteroid Observations

    NASA Technical Reports Server (NTRS)

    Abell, P. A.; Gaffey, M. J.; Hardersen, P. S.

    2005-01-01

    Introduction: Asteroids represent the only in situ surviving population of planetesimals from the formation of the inner solar system and therefore include materials from the very earliest stages of solar system formation. Hence, these bodies can provide constraints on the processes and conditions that were present during this epoch and can be used to test current models and theories describing the late solar nebula, the early solar system and subsequent planetary accretion. From detailed knowledge of asteroid mineralogic compositions the probable starting materials, thermal histories, and oxidation states of asteroid parent bodies can be inferred. If such data can be obtained from specific mainbelt source regions, then this information can be used to map out the formation conditions of the late solar nebula within the inner solar system and possibly distinguish any trends in oxidation state that may be present.

  4. Complementarity of direct dark matter detection and indirect detection through gamma rays

    SciTech Connect

    Bergstroem, Lars; Bringmann, Torsten; Edsjoe, Joakim

    2011-02-15

    We show, by using an extensive sample of viable supersymmetric models as templates, that indirect detection of dark matter through gamma rays may have a large potential for identifying the nature of dark matter. This is, in particular, true also for models that give too weak dark matter-nucleon scattering cross sections to be probed by present and planned direct detection experiments. Also models with a mass scale too high to be accessible at CERN's LHC accelerator may show up in next-generation imaging Cherenkov telescope arrays. Based on our findings, we therefore suggest to view indirect searches as genuine particle physics experiments, complementing other strategies to probe so far unknown regions in the parameter space of e.g. supersymmetric models, and propose a new approach that would make use of telescopes dedicated for dark matter searches. As a concrete example for the potential of such an approach, we consider an array of imaging air Cherenkov telescopes, the Dark Matter Array (DMA), and show that such an experiment could extend present-day limits by several orders of magnitude, reaching a large class of models that would remain undetected in both direct detection experiments and searches at the LHC. In addition, in a sizable part of the parameter space, signals from more than one type of dark matter detection experiment would be possible, something that may eventually be necessary in order to identify the dark matter candidate.

  5. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection.

    PubMed

    Ellis, John; Evans, Jason L; Luo, Feng; Nagata, Natsumi; Olive, Keith A; Sandick, Pearl

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale [Formula: see text]below the grand unification (GUT) scale [Formula: see text], a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if [Formula: see text] is close to [Formula: see text], but it may lie within its reach if [Formula: see text] GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.

  6. GEOCHEMICAL AND ISOTOPIC CONSTRAINTS ON GROUND-WATER FLOW DIRECTIONS, MIXING AND RECHARGE AT YUCCA MOUNTAIN, NEVADA

    SciTech Connect

    A. Meijer; E. Kwicklis

    2000-08-17

    This analysis is governed by the Office of Civilian Radioactive Waste Management (OCRWM) Analysis and Modeling Report Development Plan entitled ''Geochemical and Isotopic Constraints on Groundwater Flow Directions, Mixing and Recharge at Yucca Mountain'' (CRWMS M&O 1999a). As stated in this Development Plan, the purpose of the work is to provide an analysis of groundwater recharge rates, flow directions and velocities, and mixing proportions of water from different source areas based on groundwater geochemical and isotopic data. The analysis of hydrochemical and isotopic data is intended to provide a basis for evaluating the hydrologic system at Yucca Mountain independently of analyses based purely on hydraulic arguments. Where more than one conceptual model for flow is possible, based on existing hydraulic data, hydrochemical and isotopic data may be useful in eliminating some of these conceptual models. This report documents the use of geochemical and isotopic data to constrain rates and directions of groundwater flow near Yucca Mountain and the timing and magnitude of recharge in the Yucca Mountain vicinity. The geochemical and isotopic data are also examined with regard to the possible dilution of groundwater recharge from Yucca Mountain by mixing with groundwater downgradient from the potential repository site. Specifically, the primary tasks of this report, as listed in the AMR Development Plan (CRWMS M&O 1999a), consist of the following: (1) Compare geochemical and isotopic data for perched and pore water in the unsaturated zone with similar data from the saturated zone to determine if local recharge is present in the regional groundwater system; (2) Determine the timing of the recharge from stable isotopes such as deuterium ({sup 2}H) and oxygen-18 ({sup 18}O), which are known to vary over time as a function of climate, and from radioisotopes such as carbon-14 ({sup 14}C) and chlorine-36 ({sup 36}Cl); (3) Determine the magnitude of recharge from relatively

  7. A direction detective asymmetrical twin-core fiber curving sensor

    NASA Astrophysics Data System (ADS)

    An, Maowei; Geng, Tao; Yang, Wenlei; Zeng, Hongyi; Li, Jian

    2015-10-01

    Long period fiber gratings (LPFGs), which can couple the core mode to the forward propagating cladding modes of a fiber and have the advantage of small additional loss, no backward reflection, small size, which is widely used in optical fiber sensors and optical communication systems. LPFG has different fabricating methods, in order to write gratings on the twin-core at the same time effectively, we specially choose electric heating fused taper system to fabricate asymmetric dual-core long period fiber grating, because this kind of method can guarantee the similarity of gratings on the twin cores and obtain good geometric parameters of LPFG, such as cycle, cone waist. Then we use bending test platform to conduct bending test for each of the core of twin-core asymmetric long period fiber grating. Experiments show that: the sensitivity of asymmetrical twin-core long period fiber grating's central core under bending is -5.47nm·m, while the sensitivity of asymmetric twin-core long period fiber grating partial core changed with the relative position of screw micrometer. The sensitivity at 0°, 30°, 90° direction is -4.22nm·m, -9.84nm·m, -11.44nm·m respectively. The experiment results strongly demonstrate the properties of rim sensing of asymmetrical twin-core fiber gratings which provides the possibility of simultaneously measuring the bending magnitude and direction and solving the problem of cross sensing when multi-parameter measuring. In other words, we can detect temperature and bend at the same time by this sensor. As our knowledge, it is the first time simultaneously measuring bend and temperature using this structure of fiber sensors.

  8. Direct detection of exothermic dark matter with light mediator

    SciTech Connect

    Geng, Chao-Qiang; Huang, Da; Lee, Chun-Hao; Wang, Qing

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  9. Detection of biological threats. A challenge for directed molecular evolution.

    PubMed

    Petrenko, Valery A; Sorokulova, Iryna B

    2004-08-01

    The probe technique originated from early attempts of Anton van Leeuwenhoek to contrast microorganisms under the microscope using plant juices, successful staining of tubercle bacilli with synthetic dyes by Paul Ehrlich and discovery of a stain for differentiation of gram-positive and gram-negative bacteria by Hans Christian Gram. The technique relies on the principle that pathogens have unique structural features, which can be recognized by specifically labeled organic molecules. A hundred years of extensive screening efforts led to discovery of a limited assortment of organic probes that are used for identification and differentiation of bacteria. A new challenge--continuous monitoring of biological threats--requires long lasting molecular probes capable of tight specific binding of pathogens in unfavorable conditions. To respond to the challenge, probe technology is being revolutionized by utilizing methods of combinatorial chemistry, phage display and directed molecular evolution. This review describes how molecular evolution methods are applied for development of peptide, antibody and phage probes, and summarizes the author's own data on development of landscape phage probes against Salmonella typhimurium. The performance of the probes in detection of Salmonella is illustrated by a precipitation test, enzyme-linked immunosorbent assay (ELISA), fluorescence-activated cell sorting (FACS) and fluorescent, optical and electron microscopy.

  10. SUSY under siege from direct and indirect WIMP detection experiments

    NASA Astrophysics Data System (ADS)

    Baer, Howard; Barger, Vernon; Serce, Hasan

    2016-12-01

    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC), BayesFits (BF) and Fittino (FO) collaborations, nonthermal wino dark matter (NThW) and finally mixed axion-Higgsino dark matter from SUSY with radiatively driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV Higgsino parameter space from BF group are ruled out. The 100-300 GeV Higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections from ton-scale noble liquid detectors should discover or rule out WIMPs from the remaining parameter space of these surviving models.

  11. The effective field theory of dark matter direct detection

    SciTech Connect

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  12. Direct detection of light ''Ge-phobic'' exothermic dark matter

    SciTech Connect

    Gelmini, Graciela B.; Georgescu, Andreea; Huh, Ji-Haeng E-mail: a.georgescu@physics.ucla.edu

    2014-07-01

    We present comparisons of direct dark matter (DM) detection data for light WIMPs with exothermic scattering with nuclei (exoDM), both assuming the Standard Halo Model (SHM) and in a halo model–independent manner. Exothermic interactions favor light targets, thus reducing the importance of upper limits derived from xenon targets, the most restrictive of which is at present the LUX limit. In our SHM analysis the CDMS-II-Si and CoGeNT regions become allowed by these bounds, however the recent SuperCDMS limit rejects both regions for exoDM with isospin-conserving couplings. An isospin-violating coupling of the exoDM, in particular one with a neutron to proton coupling ratio of -0.8 (which we call ''Ge-phobic''), maximally reduces the DM coupling to germanium and allows the CDMS-II-Si region to become compatible with all bounds. This is also clearly shown in our halo-independent analysis.

  13. Direct detection of light anapole and magnetic dipole DM

    SciTech Connect

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo E-mail: gelmini@physics.ucla.edu E-mail: jhhuh@physics.ucla.edu

    2014-06-01

    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section.

  14. Enabling Technologies for Direct Detection Optical Phase Modulation Formats

    NASA Astrophysics Data System (ADS)

    Xu, Xian

    Phase modulation formats are believed to be one of the key enabling techniques for next generation high speed long haul fiber-optic communication systems due to the following main advantages: (1) with a balanced detection, a better receiver sensitivity over conventional intensity modulation formats, e.g., a ˜3-dB sensitivity improvement using differential phase shift keying (DPSK) and a ˜1.3-dB sensitivity improvement using differential quadrature phase shift keying (DQPSK); (2) excellent robustness against fiber nonlinearities; (3) high spectrum efficiency when using multilevel phase modulation formats, such as DQPSK. As the information is encoded in the phase of the optical field, the phase modulation formats are sensitive to the phase-related impairments and the deterioration induced in the phase-intensity conversion. This consequently creates new challenging issues. The research objective of this thesis is to depict some of the challenging issues and provide possible solutions. The first challenge is the cross-phase modulation (XPM) penalty for the phase modulated channels co-propagating with the intensity modulated channels. The penalty comes from the pattern dependent intensity fluctuations of the neighboring intensity modulated channels being converted into phase noise in the phase modulation channels. We propose a model to theoretically analyze the XPM penalty dependence on the walk off effect. From this model, we suggest that using fibers with large local dispersion or intentionally introducing some residual dispersion per span would help mitigate the XPM penalty. The second challenge is the polarization dependent frequency shift (PDf) induced penalty during the phase-intensity conversion. The direct detection DPSK is usually demodulated in a Mach-Zehnder delay interferometer (DI). The polarization dependence of DI introduces a PDf causing a frequency offset between the laser's frequency and the transmissivity peak of DI, degrading the demodulated DPSK

  15. Constraint monitoring in TOSCA

    NASA Technical Reports Server (NTRS)

    Beck, Howard

    1992-01-01

    The Job-Shop Scheduling Problem (JSSP) deals with the allocation of resources over time to factory operations. Allocations are subject to various constraints (e.g., production precedence relationships, factory capacity constraints, and limits on the allowable number of machine setups) which must be satisfied for a schedule to be valid. The identification of constraint violations and the monitoring of constraint threats plays a vital role in schedule generation in terms of the following: (1) directing the scheduling process; and (2) informing scheduling decisions. This paper describes a general mechanism for identifying constraint violations and monitoring threats to the satisfaction of constraints throughout schedule generation.

  16. A study of the impacts of flow direction and electrical constraints on vulnerability assessment of power grid using electrical betweenness measures

    NASA Astrophysics Data System (ADS)

    Wu, Di; Ma, Feng; Javadi, Milad; Thulasiraman, Krishnaiya; Bompard, Ettore; Jiang, John N.

    2017-01-01

    In this paper, we analyze the impacts of major electrical properties, including node constraints, line limits, and flow direction, on vulnerability assessment of power grid using several types of electrical betweenness measures. Specifically, we first propose a set of new electrical betweenness measures, which takes into account flow direction in power grids. Then, the impacts of major electrical properties on vulnerability assessment of power grid are analyzed by comparing the identification results of critical components based on the proposed electrical betweenness measures with those based on the other two types of electrical betweenness measures reported in the literature, which take into consideration node constraints and line limits, respectively. Analysis results show the important impact of flow direction on the identification of critical components. The results lead us to introduce a set of combined electrical betweenness measures that take into account node constraints, line limits, and flow direction together. Simulation results on the IEEE 300-bus system and the Italian power grid show that the combined electrical betweenness measures are superior in identifying critical components and more useful in assessing power grid vulnerability.

  17. Bed bug detection: Current technologies and future directions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study evaluates current technologies used to detect bed bug infestations, and presents new information regarding the underlying chemical basis of canines scent detection. The manuscript also reports new and future devices that may play a part in bed bug detection in the future....

  18. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M. E-mail: gresham@whitman.edu E-mail: apeter@physics.osu.edu

    2015-12-01

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either 'heavy' or 'light' mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  19. Identifying the theory of dark matter with direct detection

    SciTech Connect

    Gluscevic, Vera; Gresham, Moira I.; McDermott, Samuel D.; Peter, Annika H.G.; Zurek, Kathryn M.

    2015-12-29

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  20. Implications of the Muon Anomalous Magnetic Moment for Direct Detection of Neutralino Dark Matter

    NASA Astrophysics Data System (ADS)

    Kim, Y. G.; Nojiri, M. M.

    2001-09-01

    We investigate the implications of a recent measurement of the muon anomalous magnetic moment for the direct detection of neutralino dark matter in three different SUSY models: mSUGRA, a model with non-universal Higgs mass, and an SO(10) GUT model. We consider two cases for the value of Δ aμ, 27 × 10-10 < Δ aμ < 59 × 10-10 (corresponding to a range of 1σ about the experimental value) and 0 < Δ aμ < 11 × 10-10 (corresponding to a range more than 2σ below the experimental value). In the mSUGRA model, the counting ratio may be above the sensitivity of future experiments in the case that parameters are within a 1σ bound of Δ aμ. However, Ωχ tends to be large compared to the currently accepted value Ω=0.3. For models with non-universal scalar masses, the possibility of having a consistent Ωχ and a large counting ratio exists in the region of parameter space where the Higgsino mass μ is smaller than the mSUGRA prediction. In particular, in the SO(10) model, the LSP dark matter detection rate may be enhanced by almost one order of magnitude compared to that in mSUGRA and the model with non-universal Higgs mass, for cosmologically acceptable Ωχ h2. The highest detection rate of LSP dark matter occurs in the region where the LSP constitutes a subdominant part of the local halo DM. The implications of the SUSY mass parameter measurement subject to the cosmological constraint are also discussed.

  1. Action change detection in video using a bilateral spatial-temporal constraint

    NASA Astrophysics Data System (ADS)

    Tian, Jing; Chen, Li

    2016-08-01

    Action change detection in video aims to detect action discontinuity in video. The silhouettes-based features are desirable for action change detection. This paper studies the problem of silhouette-quality assessment. For that, a non-reference approach without the need for ground truth is proposed in this paper to evaluate the quality of silhouettes, by exploiting both the boundary contrast of the silhouettes in the spatial domain and the consistency of the silhouettes in the temporal domain. This is in contrast to that either only spatial information or only temporal information of silhouettes is exploited in conventional approaches. Experiments are conducted using artificially generated degraded silhouettes to show that the proposed approach outperforms conventional approaches to achieve more accurate quality assessment. Furthermore, experiments are performed to show that the proposed approach is able to improve the accuracy performance of conventional action change approaches in two human action video data-sets. The average runtime of the proposed approach for Weizmann action video data-set is 0.08 second for one frame using Matlab programming language. It is computationally efficient and potential to real-time implementations.

  2. Extended maximum likelihood halo-independent analysis of dark matter direct detection data

    SciTech Connect

    Gelmini, Graciela B.; Georgescu, Andreea; Gondolo, Paolo; Huh, Ji-Haeng

    2015-11-24

    We extend and correct a recently proposed maximum-likelihood halo-independent method to analyze unbinned direct dark matter detection data. Instead of the recoil energy as independent variable we use the minimum speed a dark matter particle must have to impart a given recoil energy to a nucleus. This has the advantage of allowing us to apply the method to any type of target composition and interaction, e.g. with general momentum and velocity dependence, and with elastic or inelastic scattering. We prove the method and provide a rigorous statistical interpretation of the results. As first applications, we find that for dark matter particles with elastic spin-independent interactions and neutron to proton coupling ratio f{sub n}/f{sub p}=−0.7, the WIMP interpretation of the signal observed by CDMS-II-Si is compatible with the constraints imposed by all other experiments with null results. We also find a similar compatibility for exothermic inelastic spin-independent interactions with f{sub n}/f{sub p}=−0.8.

  3. Capacity, cutoff rate, and coding for a direct-detection optical channel

    NASA Technical Reports Server (NTRS)

    Massey, J. L.

    1980-01-01

    It is shown that Pierce's pulse position modulation scheme with 2 to the L pulse positions used on a self-noise-limited direct detection optical communication channel results in a 2 to the L-ary erasure channel that is equivalent to the parallel combination of L completely correlated binary erasure channels. The capacity of the full channel is the sum of the capacities of the component channels, but the cutoff rate of the full channel is shown to be much smaller than the sum of the cutoff rates. An interpretation of the cutoff rate is given that suggests a complexity advantage in coding separately on the component channels. It is shown that if short-constraint-length convolutional codes with Viterbi decoders are used on the component channels, then the performance and complexity compare favorably with the Reed-Solomon coding system proposed by McEliece for the full channel. The reasons for this unexpectedly fine performance by the convolutional code system are explored in detail, as are various facets of the channel structure.

  4. PDM-16QAM vector signal generation and detection based on intensity modulation and direct detection

    NASA Astrophysics Data System (ADS)

    Chen, Long; Yu, Jianjun; Li, Xinying

    2016-07-01

    We experimentally demonstrate a novel and simple method to generate and detect high speed polarization-division-multiplexing 16-ary quadrature-amplitude-modulation (PDM-16QAM) vector signal enabled by Mach-Zehnder modulator-based (MZM-based) optical-carrier-suppression (OCS) intensity modulation and direct detection. Due to the adoption of OCS intensity modulation, carrier beating can be avoided at the receiver, and thus polarization de-multiplexing can be implemented by digital-signal-processing-based (DSP-based) cascaded multi-modulus algorithm (CMMA) equalization instead of a polarization tracking system. The change of both amplitude and phase information due to the adoption of OCS modulation can be equalized by DSP-based amplitude and phase precoding at the transmitter. Up to 64-Gb/s PDM-16QAM vector signal is generated and detected after 2-km single-mode fiber-28 (SMF-28) or 20-km large-effective-area fiber (LEAF) transmission with a bit-error-ratio (BER) less than the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3.

  5. Constraint-Induced Movement Therapy Combined with Transcranial Direct Current Stimulation over Premotor Cortex Improves Motor Function in Severe Stroke: A Pilot Randomized Controlled Trial

    PubMed Central

    Batista, Larissa M.; Nogueira, Lídia L. R. F.; de Oliveira, Eliane A.; de Carvalho, Antonio G. C.; Lima, Soriano S.; Santana, Jordânia R. M.; de Lima, Emerson C. C.; Fernández-Calvo, Bernardino

    2017-01-01

    Objective. We compared the effects of transcranial direct current stimulation at different cortical sites (premotor and motor primary cortex) combined with constraint-induced movement therapy for treatment of stroke patients. Design. Sixty patients were randomly distributed into 3 groups: Group A, anodal stimulation on premotor cortex and constraint-induced movement therapy; Group B, anodal stimulation on primary motor cortex and constraint-induced movement therapy; Group C, sham stimulation and constraint-induced movement therapy. Evaluations involved analysis of functional independence, motor recovery, spasticity, gross motor function, and muscle strength. Results. A significant improvement in primary outcome (functional independence) after treatment in the premotor group followed by primary motor group and sham group was observed. The same pattern of improvement was highlighted among all secondary outcome measures regarding the superior performance of the premotor group over primary motor and sham groups. Conclusions. Premotor cortex can contribute to motor function in patients with severe functional disabilities in early stages of stroke. This study was registered in ClinicalTrials.gov database (NCT 02628561). PMID:28250992

  6. Constraint-Induced Movement Therapy Combined with Transcranial Direct Current Stimulation over Premotor Cortex Improves Motor Function in Severe Stroke: A Pilot Randomized Controlled Trial.

    PubMed

    Andrade, Suellen M; Batista, Larissa M; Nogueira, Lídia L R F; de Oliveira, Eliane A; de Carvalho, Antonio G C; Lima, Soriano S; Santana, Jordânia R M; de Lima, Emerson C C; Fernández-Calvo, Bernardino

    2017-01-01

    Objective. We compared the effects of transcranial direct current stimulation at different cortical sites (premotor and motor primary cortex) combined with constraint-induced movement therapy for treatment of stroke patients. Design. Sixty patients were randomly distributed into 3 groups: Group A, anodal stimulation on premotor cortex and constraint-induced movement therapy; Group B, anodal stimulation on primary motor cortex and constraint-induced movement therapy; Group C, sham stimulation and constraint-induced movement therapy. Evaluations involved analysis of functional independence, motor recovery, spasticity, gross motor function, and muscle strength. Results. A significant improvement in primary outcome (functional independence) after treatment in the premotor group followed by primary motor group and sham group was observed. The same pattern of improvement was highlighted among all secondary outcome measures regarding the superior performance of the premotor group over primary motor and sham groups. Conclusions. Premotor cortex can contribute to motor function in patients with severe functional disabilities in early stages of stroke. This study was registered in ClinicalTrials.gov database (NCT 02628561).

  7. Target detection in GPR data using joint low-rank and sparsity constraints

    NASA Astrophysics Data System (ADS)

    Bouzerdoum, Abdesselam; Tivive, Fok Hing Chi; Abeynayake, Canicious

    2016-05-01

    In ground penetrating radars, background clutter, which comprises the signals backscattered from the rough, uneven ground surface and the background noise, impairs the visualization of buried objects and subsurface inspections. In this paper, a clutter mitigation method is proposed for target detection. The removal of background clutter is formulated as a constrained optimization problem to obtain a low-rank matrix and a sparse matrix. The low-rank matrix captures the ground surface reflections and the background noise, whereas the sparse matrix contains the target reflections. An optimization method based on split-Bregman algorithm is developed to estimate these two matrices from the input GPR data. Evaluated on real radar data, the proposed method achieves promising results in removing the background clutter and enhancing the target signature.

  8. Tests of WIMP Dark Matter Candidates with Direct Dark Matter Detection Experiments

    NASA Astrophysics Data System (ADS)

    Georgescu, Andreea Irina

    by CDMS-II-Si is compatible with the constraints imposed by all other experiments with null results. We also find a similar compatibility for exothermic inelastic spin-independent interactions with ƒn/ƒ p = --0.8. Finally, we reexamine the interpretation of the annual modulation signal observed by the DAMA experiment as due to WIMPs with a spin-dependent coupling mostly to protons. We consider both axial-vector and pseudo-scalar couplings, and elastic as well as endothermic and exothermic inelastic scattering. We conclude that the DAMA signal is in strong tension with null results of other direct detection experiments, particularly PICASSO and KIMS.

  9. Recent Results in Dark Matter Direct Detection Experiments

    SciTech Connect

    Kelso, Christopher Michael

    2012-08-01

    In this dissertation, we study the original excess of low energy events observed by the Co- GeNT collaboration and the annual modulation reported by the DAMA/LIBRA collaboration, and discuss whether these signals could both be the result of the same elastically scattering dark matter particle. We find that, without channeling but when taking into account uncertainties in the relevant quenching factors, a dark matter candidate with a mass of approximately ~7.0 GeV and a cross section with nucleons of σDM-N ~2 x 10-40 cm2 could account for both of these observations. We also compare the region of parameter space favored by DAMA/LIBRA and CoGeNT to the constraints from XENON 10, XENON 100, and CDMS (Si).

  10. Comparison of IPDA lidar receiver sensitivity for coherent detection and for direct detection using sine-wave and pulsed modulation.

    PubMed

    Sun, Xiaoli; Abshire, James B

    2012-09-10

    We use theoretical models to compare the receiver signal to noise ratio (SNR) vs. average rate of detected signal photons for an integrated path differential absorption (IPDA) lidar using coherent detection with continuous wave (CW) lasers and direct detection with sine-wave and pulse modulations. The results show the coherent IPDA lidar has high receiver gain and narrow bandwidth to overcome the effects of detector circuit noise and background light, but the actual receiver performance can be limited by the coherent mixing efficiency, speckle and other factors. For direct detection, using sine-wave modulation allows the use of a low peak power laser transmitter and synchronous detection. The pulse modulation technique requires higher laser peak powers but is more efficient than sine-wave modulation in terms of average detected signal photon rate required to achieve a given receiver SNR. We also conducted experiments for the direct detection cases and the results agreed well with theory.

  11. MSSM A-funnel and the galactic center excess: prospects for the LHC and direct detection experiments

    DOE PAGES

    Freese, Katherine; López, Alejandro; Shah, Nausheen R.; ...

    2016-04-11

    The pseudoscalar resonance or “A-funnel” in the Minimal Supersymmetric Standard Model (MSSM) is a widely studied framework for explaining dark matter that can yield interesting indirect detection and collider signals. The well-known Galactic Center excess (GCE) at GeV energies in the gamma ray spectrum, consistent with annihilation of a ≲ 40 GeV dark matter particle, has more recently been shown to be compatible with significantly heavier masses following reanalysis of the background.For this study, we explore the LHC and direct detection implications of interpreting the GCE in this extended mass window within the MSSM A-funnel framework. We find that compatibilitymore » with relic density, signal strength, collider constraints, and Higgs data can be simultaneously achieved with appropriate parameter choices. The compatible regions give very sharp predictions of 200-600 GeV CP-odd/even Higgs bosons at low tan β at the LHC and spin-independent cross sections ≈ 10-11 pb at direct detection experiments. Finally, regardless of consistency with the GCE, this study serves as a useful template of the strong correlations between indirect, direct, and LHC signatures of the MSSM A-funnel region.« less

  12. MSSM A-funnel and the galactic center excess: prospects for the LHC and direct detection experiments

    SciTech Connect

    Freese, Katherine; López, Alejandro; Shah, Nausheen R.; Shakya, Bibhushan

    2016-04-11

    The pseudoscalar resonance or “A-funnel” in the Minimal Supersymmetric Standard Model (MSSM) is a widely studied framework for explaining dark matter that can yield interesting indirect detection and collider signals. The well-known Galactic Center excess (GCE) at GeV energies in the gamma ray spectrum, consistent with annihilation of a ≲ 40 GeV dark matter particle, has more recently been shown to be compatible with significantly heavier masses following reanalysis of the background.For this study, we explore the LHC and direct detection implications of interpreting the GCE in this extended mass window within the MSSM A-funnel framework. We find that compatibility with relic density, signal strength, collider constraints, and Higgs data can be simultaneously achieved with appropriate parameter choices. The compatible regions give very sharp predictions of 200-600 GeV CP-odd/even Higgs bosons at low tan β at the LHC and spin-independent cross sections ≈ 10-11 pb at direct detection experiments. Finally, regardless of consistency with the GCE, this study serves as a useful template of the strong correlations between indirect, direct, and LHC signatures of the MSSM A-funnel region.

  13. Bed bug detection: current technologies and future directions.

    PubMed

    Vaidyanathan, Rajeev; Feldlaufer, Mark F

    2013-04-01

    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use.

  14. Bed Bug Detection: Current Technologies and Future Directions

    PubMed Central

    Vaidyanathan, Rajeev; Feldlaufer, Mark F.

    2013-01-01

    Technologies to detect bed bugs have not kept pace with their global resurgence. Early detection is critical to prevent infestations from spreading. Detection based exclusively on bites is inadequate, because reactions to insect bites are non-specific and often misdiagnosed. Visual inspections are commonly used and depend on identifying live bugs, exuviae, or fecal droplets. Visual inspections are inexpensive, but they are time-consuming and unreliable when only a few bugs are present. Use of a dog to detect bed bugs is gaining in popularity, but it can be expensive, may unintentionally advertise a bed bug problem, and is not foolproof. Passive monitors mimic natural harborages; they are discreet and typically use an adhesive to trap bugs. Active monitors generate carbon dioxide, heat, a pheromone, or a combination to attract bed bugs to a trap. New technologies using DNA analysis, mass spectrometry, and electronic noses are innovative but impractical and expensive for widespread use. PMID:23553226

  15. Detection of methicillin-resistant Staphylococcus aureus directly by loop-mediated isothermal amplification and direct cefoxitin disk diffusion tests.

    PubMed

    Metwally, L; Gomaa, N; Hassan, R

    2014-05-01

    We evaluated the utility of 2 methods for detection of methicillin-resistant Staphylococcus aureus (MRSA) directly from signal-positive blood culture bottles: loop-mediated isothermal amplification (LAMP) assay, and direct cefoxitin disk diffusion (DCDD) test using a 30 μg cefoxitin disk. In parallel, standard microbiological identification and oxacillin susceptibility testing with MecA PCR was performed. Of 60 blood cultures positive for Gram-positive cocci in clusters, LAMP (via detection of the FemA and MecA genes) showed 100% sensitivity and specificity for identification of MRSA/MSSA. When coagulase-negative staphylococci were tested, sensitivity for detection of methicillin resistance was 91.7% and specificity was 100%. DCDD along with direct tube coagulase assay detected only 80.6% of MRSA/MSSA. LAMP showed higher diagnostic accuracy although DCDD was more cost-effective and did not require additional reagents or supplies.

  16. Adaptive NN control for discrete-time pure-feedback systems with unknown control direction under amplitude and rate actuator constraints.

    PubMed

    Chen, Weisheng

    2009-07-01

    This paper focuses on the problem of adaptive neural network tracking control for a class of discrete-time pure-feedback systems with unknown control direction under amplitude and rate actuator constraints. Two novel state-feedback and output-feedback dynamic control laws are established where the function tanh(.) is employed to solve the saturation constraint problem. Implicit function theorem and mean value theorem are exploited to deal with non-affine variables that are used as actual control. Radial basis function neural networks are used to approximate the desired input function. Discrete Nussbaum gain is used to estimate the unknown sign of control gain. The uniform boundedness of all closed-loop signals is guaranteed. The tracking error is proved to converge to a small residual set around the origin. A simulation example is provided to illustrate the effectiveness of control schemes proposed in this paper.

  17. The Higgs boson in the Standard Model theoretical constraints and a direct search in the wh channel at the Tevatron

    SciTech Connect

    Huske, Nils Kristian

    2010-09-10

    We have presented results in two different yet strongly linked aspects of Higgs boson physics. We have learned about the importance of the Higgs boson for the fate of the Standard Model, being either only a theory limited to explaining phenomena at the electroweak scale or, if the Higgs boson lies within a mass range of 130 < mH < 160 GeV the SM would remain a self consistent theory up to highest energy scales O(mPl). This could have direct implications on theories of cosmological inflation using the Higgs boson as the particle giving rise to inflation in the very early Universe, if it couples non-minimally to gravity, an effect that would only become significant at very high energies. After understanding the immense meaning of proving whether the Higgs boson exists and if so, at which mass, we have presented a direct search for a Higgs boson in associated production with a W boson in a mass range 100 < mH < 150 GeV. A light Higgs boson is favored regarding constraints from electroweak precision measurements. As a single analysis is not yet sensitive for an observation of the Higgs boson using 5.3 fb-1 of Tevatron data, we set limits on the production cross section times branching ratio. At the Tevatron, however, we are able to combine the sensitivity of our analyses not only across channels or analyses at a single experiment but also across both experiments, namely CDF and D0. This yields to the so-called Tevatron Higgs combination which, in total, combines 129 analyses from both experiments with luminosities of up to 6.7 fb-1. The results of a previous Tevatron combination led to the first exclusion of possible Higgs boson masses since the LEP exclusion in 2001. The latest Tevatron combination from July 2010 can be seen in Fig. 111 and limits compared to the Standard Model expectation are listed in Table 23. It excludes a SM Higgs boson in the regions of 100 < mH < 109 GeV as well as 158 < m

  18. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology.

    PubMed

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-11-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1-0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology.

  19. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-01-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1–0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology. PMID:26272507

  20. When does female multiple mating evolve to adjust inbreeding? Effects of inbreeding depression, direct costs, mating constraints, and polyandry as a threshold trait

    PubMed Central

    Duthie, A. Bradley; Bocedi, Greta; Reid, Jane M.

    2016-01-01

    Polyandry is often hypothesized to evolve to allow females to adjust the degree to which they inbreed. Multiple factors might affect such evolution, including inbreeding depression, direct costs, constraints on male availability, and the nature of polyandry as a threshold trait. Complex models are required to evaluate when evolution of polyandry to adjust inbreeding is predicted to arise. We used a genetically explicit individual‐based model to track the joint evolution of inbreeding strategy and polyandry defined as a polygenic threshold trait. Evolution of polyandry to avoid inbreeding only occurred given strong inbreeding depression, low direct costs, and severe restrictions on initial versus additional male availability. Evolution of polyandry to prefer inbreeding only occurred given zero inbreeding depression and direct costs, and given similarly severe restrictions on male availability. However, due to its threshold nature, phenotypic polyandry was frequently expressed even when strongly selected against and hence maladaptive. Further, the degree to which females adjusted inbreeding through polyandry was typically very small, and often reflected constraints on male availability rather than adaptive reproductive strategy. Evolution of polyandry solely to adjust inbreeding might consequently be highly restricted in nature, and such evolution cannot necessarily be directly inferred from observed magnitudes of inbreeding adjustment. PMID:27464756

  1. EARLY-PHASE PHOTOMETRY AND SPECTROSCOPY OF TRANSITIONAL TYPE Ia SN 2012ht: DIRECT CONSTRAINT ON THE RISE TIME

    SciTech Connect

    Yamanaka, Masayuki; Nogami, Daisaku; Maeda, Keiichi; Kawabata, Miho; Masumoto, Kazunari; Matsumoto, Katsura; Tanaka, Masaomi; Takaki, Katsutoshi; Ueno, Issei; Itoh, Ryosuke; Kawabata, Koji S.; Moritani, Yuki; Akitaya, Hiroshi; Yoshida, Michitoshi; Arai, Akira; Honda, Satoshi; Nishiyama, Koichi; Kabashima, Fujio

    2014-02-20

    We report photometric and spectroscopic observations of the nearby Type Ia Supernova (SN Ia) 2012ht from –15.8 days to +49.1 days after B-band maximum. The decline rate of the light curve is Δm {sub 15}(B) = 1.39 ± 0.05 mag, which is intermediate between normal and subluminous SNe Ia, and similar to that of the ''transitional'' Type Ia SN 2004eo. The spectral line profiles also closely resemble those of SN 2004eo. We were able to observe SN 2012ht at a very early phase, when it was still rising and was about three magnitudes fainter than at the peak. The rise time to the B-band maximum is estimated to be 17.6 ± 0.5 days and the time of the explosion is MJD 56277.98 ± 0.13. SN 2012ht is the first transitional SN Ia whose rise time is directly measured without using light curve templates, and the fifth SN Ia overall. This rise time is consistent with those of the other four SNe within the measurement error, even including the extremely early detection of SN 2013dy. The rising part of the light curve can be fitted by a quadratic function, and shows no sign of a shock-heating component due to the interaction of the ejecta with a companion star. The rise time is significantly longer than that inferred for subluminous SNe such as SN 1991bg, which suggests that a progenitor and/or explosion mechanism of transitional SNe Ia are more similar to normal SNe Ia rather than to subluminous SNe Ia.

  2. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures

    PubMed Central

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G.

    2015-01-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers. PMID:26424841

  3. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures.

    PubMed

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G; Corso, Alejandra

    2015-12-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers.

  4. Rapid Detection and Identification of Respiratory Viruses by Direct Immunofluorescence

    PubMed Central

    D'Alessio, Donn; Williams, Stanley; Dick, Elliot C.

    1970-01-01

    The use of fluorescein-conjugated antiserum against respiratory syncytial (RS) and parainfluenza 1 and 3 viruses was compared with conventional techniques in the rapid detection of virus in tissue cultures inoculated with pharyngeal specimens known to contain these viruses. Twenty-three specimens were tested: 9 RS, 8 parainfluenza 1, and 6 parainfluenza 3. The fluorescent-antibody technique (FA) detected virus in 52% of the tissue cultures in 24 hr, and, by 72 hr, 22 of the 23 cultures were FA-positive whereas only 5 were positive by conventional techniques. Additionally, conjugated antisera were prepared against herpes simplex, influenza A2, and adenovirus type 5. All conjugates stained only the homologous virus and were 100- to 10,000-fold more sensitive than conventional techniques in detecting descending dilutions of virus inocula by 24 hr. With the procedures described, several antisera could be conjugated and ready for use within 24 hr. Serum fractionation was by ammonium sulfate precipitation, and with the procedure outlined virtually complete recovery of the globulin fraction and elimination of all of the albumin were accomplished. Images PMID:4098101

  5. Teleconnection Paths via Climate Network Direct Link Detection.

    PubMed

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-12-31

    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales.

  6. Additional sampling directions improve detection range of wireless radiofrequency probes

    PubMed Central

    Mada, Marius; Carpenter, T. Adrian; Sawiak, Stephen J.; Williams, Guy B.

    2015-01-01

    Purpose While MRI is enhancing our knowledge about the structure and function of the human brain, subject motion remains a problem in many clinical applications. Recently, the use of wireless radiofrequency markers with three one‐dimensional (1D) navigators for prospective correction was demonstrated. This method is restricted in the range of motion that can be corrected, however, because of limited information in the 1D readouts. Methods Here, the limitation of techniques for disambiguating marker locations was investigated. It was shown that including more sampling directions extends the tracking range for head rotations. The efficiency of trading readout resolution for speed was explored. Results Tracking of head rotations was demonstrated from −19.2 to 34.4°, −2.7 to 10.0°, and −60.9 to 70.9° in the x‐, y‐, and z‐directions, respectively. In the presence of excessive head motion, the deviation of marker estimates from SPM8 was reduced by 17.1% over existing three‐projection methods. This was achieved by using an additional seven directions, extending the time needed for readouts by a factor of 3.3. Much of this increase may be circumvented by reducing resolution, without compromising accuracy. Conclusion Including additional sampling directions extends the range in which markers can be used, for patients who move a lot. Magn Reson Med 76:913–918, 2016. © 2015 The Authors. Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:26418189

  7. A halo-independent lower bound on the dark matter capture rate in the Sun from a direct detection signal

    SciTech Connect

    Blennow, Mattias; Herrero-Garcia, Juan; Schwetz, Thomas

    2015-05-21

    We show that a positive signal in a dark matter (DM) direct detection experiment can be used to place a lower bound on the DM capture rate in the Sun, independent of the DM halo. For a given particle physics model and DM mass we obtain a lower bound on the capture rate independent of the local DM density, velocity distribution, galactic escape velocity, as well as the scattering cross section. We illustrate this lower bound on the capture rate by assuming that upcoming direct detection experiments will soon obtain a significant signal. When comparing the lower bound on the capture rate with limits on the high-energy neutrino flux from the Sun from neutrino telescopes, we can place upper limits on the branching fraction of DM annihilation channels leading to neutrinos. With current data from IceCube and Super-Kamiokande non-trivial limits can be obtained for spin-dependent interactions and direct annihilations into neutrinos. In some cases also annihilations into ττ or bb start getting constrained. For spin-independent interactions current constraints are weak, but they may become interesting for data from future neutrino telescopes.

  8. Detection of nucleic acid sequences by invader-directed cleavage

    DOEpatents

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  9. Direct detection of relic active and sterile neutrinos

    NASA Astrophysics Data System (ADS)

    Li, Yu-Feng

    2016-05-01

    Both active and sterile sub-eV neutrinos can form the cosmic neutrino background in the early Universe. We consider the beta-decaying (e.g., 3H) and EC-decaying (e.g., 163Ho) nuclei as the promising targets to capture relic neutrinos in the laboratory. We calculate the capture rates of relic electron neutrinos and antineutrinos against the corresponding beta decay or electron capture (EC) decay backgrounds in the (3+Ns) flavor mixing scheme, and discuss the future prospect in terms of the PTOLEMY project. We stress that such direct measurements of hot DM might not be hopeless in the long term.

  10. A prototype direct-detection CCD for protein crystallography.

    PubMed

    Green, Katherine S; Szebenyi, Doletha M E; Boggs, Kasey; Bredthauer, Richard; Tate, Mark W; Gruner, Sol M

    2013-08-01

    The fabrication and testing of a prototype deep-depletion direct-conversion X-ray CCD detector are described. The device is fabricated on 600 µm-thick high-resistivity silicon, with 24 × 24 µm pixels in a 4k × 4k pixel format. Calibration measurements and the results of initial protein crystallography experiments at the Cornell High Energy Synchrotron Source (CHESS) F1 beamline are described, as well as suggested improvements for future versions of the detector.

  11. Future directions for the early detection of colorectal cancer recurrence.

    PubMed

    Walker, Avery S; Johnson, Eric K; Maykel, Justin A; Stojadinovic, Alex; Nissan, Aviram; Brucher, Bjorn; Champagne, Bradley J; Steele, Scott R

    2014-01-01

    Surgical resection remains a mainstay of treatment and is highly effective for localized colorectal cancer. However, ~30-40% of patients develop recurrence following surgery and 40-50% of recurrences are apparent within the first few years after initial surgical resection. Several variables factor into the ultimate outcome of these patients, including the extent of disease, tumor biology, and patient co-morbidities. Additionally, the time from initial treatment to the development of recurrence is strongly associated with overall survival, particularly in patients who recur within one year of their surgical resection. Current post-resection surveillance strategies involve physical examination, laboratory, endoscopic and imaging studies utilizing various high and low-intensity protocols. Ultimately, the goal is to detect recurrence as early as possible, and ideally in the asymptomatic localized phase, to allow initiation of treatment that may still result in cure. While current strategies have been effective, several efforts are evolving to improve our ability to identify recurrent disease at its earliest phase. Our aim with this article is to briefly review the options available and, more importantly, examine emerging and future options to assist in the early detection of colon and rectal cancer recurrence.

  12. Direct detection at submillimetre wavelengths using superconducting tunnel junctions

    NASA Astrophysics Data System (ADS)

    Withington, S.; Isaak, K. G.; Kovtonyuk, S. A.; Panhuyzen, R. A.; Klapwijk, T. M.

    1995-12-01

    Superconducting tunnel-junction direct detectors are considered in some detail. For frequencies below twice that of the gap there is some bias voltage for which the input impedance is real, the responsivity quantum limited, and the dynamic range high. A susperconducting detector saturates for two reasons: intrinsic saturation due to the relative increase in two-photon tunnelling processes, and extrinsic saturation due to the input match changing with bias voltage. The responsivity of a detector with a resistive RF source is least sensitive to bias-voltage changes and has the greatest dynamic range when operating with a sloping load line. In the case of an inductive source, the dynamic range can be higher than the intrinsic saturation rate would suggest. Ideally, superconducting tunnel-junction detectors should be biased in a constant-voltage mode. If the responsivity is to be depressed by no more than a few percent, the photon step should have a height which is no more than one quarter of the total current turn-on at the gap. Superconducting direct detectors can be used to make precise and well-calibrated optical measurements at submillimetre wavelengths.

  13. Xenon bubble chambers for direct dark matter detection

    NASA Astrophysics Data System (ADS)

    Levy, C.; Fallon, S.; Genovesi, J.; Khaitan, D.; Klimov, K.; Mock, J.; Szydagis, M.

    2016-03-01

    The search for dark matter is one of today's most exciting fields. As bigger detectors are being built to increase their sensitivity, background reduction is an ever more challenging issue. To this end, a new type of dark matter detector is proposed, a xenon bubble chamber, which would combine the strengths of liquid xenon TPCs, namely event by event energy resolution, with those of a bubble chamber, namely insensitivity to electronic recoils. In addition, it would be the first time ever that a dark matter detector is active on all three detection channels, ionization and scintillation characteristic of xenon detectors, and heat through bubble formation in superheated fluids. Preliminary simulations show that, depending on threshold, a discrimination of 99.99% to 99.9999+% can be achieved, which is on par or better than many current experiments. A prototype is being built at the University at Albany, SUNY. The prototype is currently undergoing seals, thermal, and compression testing.

  14. Direct detection of a single photon by humans

    PubMed Central

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  15. Coherent radio-frequency detection for narrowband direct comb spectroscopy.

    PubMed

    Anstie, James D; Perrella, Christopher; Light, Philip S; Luiten, Andre N

    2016-02-22

    We demonstrate a scheme for coherent narrowband direct optical frequency comb spectroscopy. An extended cavity diode laser is injection locked to a single mode of an optical frequency comb, frequency shifted, and used as a local oscillator to optically down-mix the interrogating comb on a fast photodetector. The high spectral coherence of the injection lock generates a microwave frequency comb at the output of the photodiode with very narrow features, enabling spectral information to be further down-mixed to RF frequencies, allowing optical transmittance and phase to be obtained using electronics commonly found in the lab. We demonstrate two methods for achieving this step: a serial mode-by-mode approach and a parallel dual-comb approach, with the Cs D1 transition at 894 nm as a test case.

  16. CRISPRdigger: detecting CRISPRs with better direct repeat annotations

    PubMed Central

    Ge, Ruiquan; Mai, Guoqin; Wang, Pu; Zhou, Manli; Luo, Youxi; Cai, Yunpeng; Zhou, Fengfeng

    2016-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) are important genetic elements in many bacterial and archaeal genomes, and play a key role in prokaryote immune systems’ fight against invasive foreign elements. The CRISPR system has also been engineered to facilitate target gene editing in eukaryotic genomes. Using the common features of mis-annotated CRISPRs in prokaryotic genomes, this study proposed an accurate de novo CRISPR annotation program CRISPRdigger, which can take a partially assembled genome as its input. A comprehensive comparison with the three existing programs demonstrated that CRISPRdigger can recover more Direct Repeats (DRs) for CRISPRs and achieve a higher accuracy for a query genome. The program was implemented by Perl and all the parameters had default values, so that a user could annotate CRISPRs in a query genome by supplying only a genome sequence in the FASTA format. All the supplementary data are available at http://www.healthinformaticslab.org/supp/. PMID:27596864

  17. Kicked waveforms: prospects for direct detection of black hole recoils

    NASA Astrophysics Data System (ADS)

    Gerosa, Davide; Moore, Christopher

    2017-01-01

    Generic black hole binaries radiate gravitational waves anisotropically, imparting a recoil, or kick, velocity to the merger remnant. If a component of the kick along the line of sight is present, gravitational waves emitted during the final orbits and merger will be gradually Doppler shifted as the kick builds up. We develop a simple prescription to capture this effect in existing waveform models, showing that future gravitational wave experiments will be able to perform direct measurements, not only of the black hole kick velocity, but also of its accumulation profile. In particular, the eLISA space mission will measure supermassive black hole kick velocities as low as 500 km/s, which are expected to be a common outcome of black hole binary coalescence following galaxy mergers. Black hole kicks thus constitute a promising new observable in the growing field of gravitational wave astronomy. Einstein Fellow.

  18. Direct detection of variable tropospheric clouds near Titan's south pole.

    PubMed

    Brown, Michael E; Bouchez, Antonin H; Griffith, Caitlin A

    Atmospheric conditions on Saturn's largest satellite, Titan, allow the possibility that it could possess a methane condensation and precipitation cycle with many similarities to Earth's hydrological cycle. Detailed imaging studies of Titan have hitherto shown no direct evidence for tropospheric condensation clouds, although there has been indirect spectroscopic evidence for transient clouds. Here we report images and spectra of Titan that show clearly transient clouds, concentrated near the south pole, which is currently near the point of maximum solar heating. The discovery of these clouds demonstrates the existence of condensation and localized moist convection in Titan's atmosphere. Their location suggests that methane cloud formation is controlled seasonally by small variations in surface temperature, and that the clouds will move from the south to the north pole on a 15-year timescale.

  19. Direct detection of extra-solar planetary systems from the ground and space

    NASA Technical Reports Server (NTRS)

    Terrile, R. J.

    1986-01-01

    This paper discusses recent work in the development of instrumentation used for the direct detection of planetary systems from ground-based and space-based observatories. Direct methods such as CCD coronagraphic imaging of nearby stars must overcome the large contrast differences between parent star and the circumstellar material. However, these methods have the advantage over indirect methods in that more advanced space-based direct detection instrumentation can lead to a significantly greater science return.

  20. A direct immunoassay for detecting diatoms in groundwater as an indicator of the direct influence of surface water

    USGS Publications Warehouse

    Walker, C.E.; Schrock, R.M.; Reilly, T.J.; Baehr, A.L.

    2005-01-01

    Groundwater under the direct influence of surface water (GWUDISW) is of concern in communities where growing public demand on groundwater resources has resulted in increased withdrawals and hydraulic stress near surface water bodies. Under these conditions, contaminants such as methyl-tert butyl ether (MTBE) and biological materials have been detected in domestic wells. Other contaminants and pathogens associated with surface water are not routinely tested for in groundwater-supplied systems. To address the need for methods to easily identify potentially vulnerable supplies, a direct immunoassay for the quantitative detection of diatoms in raw water samples was developed as a measure of surface water influence on groundwater. Cell wall preparations from Nitzschia palea Ku??tzing, a freshwater diatom found throughout North America, were used to produce a polyclonal antibody that was applied in a direct enzyme-linked immunosorbent assay (ELISA) developed to detect the presence of N. palea cell wall components. The direct immunoassay allows detection at 500 cells L-1, a level similar to diatom concentrations observed in samples of groundwater collected near the test site. This investigation was the first attempt to utilize an ELISA as an indicator of surface water influence on groundwater. Further research is needed to develop more specific diatom-based monoclonal antibodies, determine cross-reactivity, and optimize sample processing and ELISA procedures for development of a standardized method. ?? Springer 2005.

  1. A direct immunoassay for detecting diatoms in groundwater as an indicator of the direct influence of surface water

    USGS Publications Warehouse

    Walker, C.E.; Schrock, R.M.; Reilly, T.J.; Baehr, A.L.

    2005-01-01

    Groundwater under the direct influence of surface water (GWUDISW) is of concern in communities where growing public demand on groundwater resources has resulted in increased withdrawals and hydraulic stress near surface water bodies. Under these conditions, contaminants such as methyl-tert butyl ether (MTBE) and biological materials have been detected in domestic wells. Other contaminants and pathogens associated with surface water are not routinely tested for in groundwater-supplied systems. To address the need for methods to easily identify potentially vulnerable supplies, a direct immunoassay for the quantitative detection of diatoms in raw water samples was developed as a measure of surface water influence on groundwater. Cell wall preparations from Nitzschia palea Kützing, a freshwater diatom found throughout North America, were used to produce a polyclonal antibody that was applied in a direct enzyme-linked immunosorbent assay (ELISA) developed to detect the presence of N. palea cell wall components. The direct immunoassay allows detection at 500 cells L−1, a level similar to diatom concentrations observed in samples of groundwater collected near the test site. This investigation was the first attempt to utilize an ELISA as an indicator of surface water influence on groundwater. Further research is needed to develop more specific diatom-based monoclonal antibodies, determine cross-reactivity, and optimize sample processing and ELISA procedures for development of a standardized method.

  2. Low complexity PAPR reduction techniques for clipping and quantization noise mitigation in direct-detection O-OFDM systems

    NASA Astrophysics Data System (ADS)

    Nadal, Laia; Svaluto Moreolo, Michela; Fàbrega, Josep M.; Junyent, Gabriel

    2014-06-01

    We present different distortionless peak-to-average power ratio (PAPR) reduction techniques that can be easily applied, without any symmetry restriction, in direct-detection (DD) optical orthogonal frequency division multiplexing (O-OFDM) systems based on the fast Hartley transform (FHT). The performance of DD O-OFDM systems is limited by the constraints on system components such as digital-to-analog converter (DAC), analog-to-digital converter (ADC), the Mach-Zehnder modulator (MZM) and electrical amplifiers. In this paper, in order to relax the constraints on these components, we propose to symmetrically clip the transmitted signal and apply low complexity (LC) distortionless PAPR reduction schemes able to mitigate, at the same time, PAPR, quantization and clipping noise. We demonstrate that, applying LC-selective mapping (SLM) without any additional transform block, the PAPR reduction is 1.5dB with only one additional FHT block using LC-partial transmit sequence (PTS) with random partitions; up to 3.1dB reduction is obtained. Moreover, the sensitivity performance and the power efficiency are enhanced. In fact, applying LC PAPR reduction techniques with one additional transform block and a 6 bit DAC resolution, the required receiver power for 8 dB clipping level and for a 10-3BER is reduced by 5.1dB.

  3. First direct detection of clay minerals on Mars

    NASA Astrophysics Data System (ADS)

    Singer, R. B.; Owensby, P. D.; Clark, R. N.

    1985-04-01

    Magnesian clays or clay-type minerals were conclusively detected in the martian regolith. Near-IR spectral observations of Mars using the Mauna Kea 2.2-m telescope show weak but definite absorption bands near microns. The absorption band positions and widths match those produced by combined OH stretch and Mg-OH lattice modes and are diagnostic of minerals with structural OH such as clays and amphiboles. Likely candidate minerals include serpentine, talc, hectorite, and sponite. There is no spectral evidence for aluminous hydroxylated minerals. No distinct band occurs at 2.55 microns, as would be expected if carbonates were responsible for the 2.35 micron absorption. High-albedo regions such as Elysium and Utopia have the strongest bands near 2.35 microns, as would be expected for heavily weathered soils. Low-albedo regions such as Iapygia show weaker but distinct bands, consistent with moderate coatings, streaks, and splotches of bright weathered material. In all areas observed, the 2.35-micron absorption is at least three times weaker than would be expected if well-crystallized clay minerals made up the bulk of bright soils on Mars.

  4. Detecting biological responses to flow management: Missed opportunities; future directions

    USGS Publications Warehouse

    Souchon, Y.; Sabaton, C.; Deibel, R.; Reiser, D.; Kershner, J.; Gard, M.; Katopodis, C.; Leonard, P.; Poff, N.L.; Miller, W.J.; Lamb, B.L.

    2008-01-01

    The conclusions of numerous stream restoration assessments all around the world are extremely clear and convergent: there has been insufficient appropriate monitoring to improve general knowledge and expertise. In the specialized field of instream flow alterations, we consider that there are several opportunities comparable to full-size experiments. Hundreds of water management decisions related to instream flow releases have been made by government agencies, native peoples, and non-governmental organizations around the world. These decisions are based on different methods and assumptions and many flow regimes have been adopted by formal or informal rules and regulations. Although, there have been significant advances in analytical capabilities, there has been very little validation monitoring of actual outcomes or research related to the response of aquatic dependent species to new flow regimes. In order to be able to detect these kinds of responses and to better guide decision, a general design template is proposed. The main steps of this template are described and discussed, in terms of objectives, hypotheses, variables, time scale, data management, and information, in the spirit of adaptive management. The adoption of such a framework is not always easy, due to differing interests of actors for the results, regarding the duration of monitoring, nature of funding and differential timetables between facilities managers and technicians. Nevertheless, implementation of such a framework could help researchers and practitioners to coordinate and federate their efforts to improve the general knowledge of the links between the habitat dynamics and biological aquatic responses. Copyright ?? 2008 John Wiley & Sons, Ltd.

  5. Direct Detection Doppler Lidar for Spaceborne Wind Measurement

    NASA Technical Reports Server (NTRS)

    Korb, C. Laurence; Flesia, Cristina

    1999-01-01

    The theory of double edge lidar techniques for measuring the atmospheric wind using aerosol and molecular backscatter is described. Two high spectral resolution filters with opposite slopes are located about the laser frequency for the aerosol based measurement or in the wings of the Rayleigh - Brillouin profile for the molecular measurement. This doubles the signal change per unit Doppler shift and improves the measurement accuracy by nearly a factor of 2 relative to the single edge technique. For the aerosol based measurement, the use of two high resolution edge filters reduces the effects of background, Rayleigh scattering, by as much as an order of magnitude and substantially improves the measurement accuracy. Also, we describe a method that allows the Rayleigh and aerosol components of the signal to be independently determined. A measurement accuracy of 1.2 m/s can be obtained for a signal level of 1000 detected photons which corresponds to signal levels in the boundary layer. For the molecular based measurement, we describe the use of a crossover region where the sensitivity of a molecular and aerosol-based measurement are equal. This desensitizes the molecular measurement to the effects of aerosol scattering and greatly simplifies the measurement. Simulations using a conical scanning spaceborne lidar at 355 nm give an accuracy of 2-3 m/s for altitudes of 2-15 km for a 1 km vertical resolution, a satellite altitude of 400 km, and a 200 km x 200 km spatial.

  6. First Direct Detection of Clay Minerals on Mars

    NASA Technical Reports Server (NTRS)

    Singer, R. B.; Owensby, P. D.; Clark, R. N.

    1985-01-01

    Magnesian clays or clay-type minerals were conclusively detected in the martian regolith. Near-IR spectral observations of Mars using the Mauna Kea 2.2-m telescope show weak but definite absorption bands near microns. The absorption band positions and widths match those produced by combined OH stretch and Mg-OH lattice modes and are diagnostic of minerals with structural OH such as clays and amphiboles. Likely candidate minerals include serpentine, talc, hectorite, and sponite. There is no spectral evidence for aluminous hydroxylated minerals. No distinct band occurs at 2.55 microns, as would be expected if carbonates were responsible for the 2.35 micron absorption. High-albedo regions such as Elysium and Utopia have the strongest bands near 2.35 microns, as would be expected for heavily weathered soils. Low-albedo regions such as Iapygia show weaker but distinct bands, consistent with moderate coatings, streaks, and splotches of bright weathered material. In all areas observed, the 2.35-micron absorption is at least three times weaker than would be expected if well-crystallized clay minerals made up the bulk of bright soils on Mars.

  7. The direct detection of boosted dark matter at high energies and PeV events at IceCube

    SciTech Connect

    Bhattacharya, A.; Gandhi, R.; Gupta, A.

    2015-03-13

    We study the possibility of detecting dark matter directly via a small but energetic component that is allowed within present-day constraints. Drawing closely upon the fact that neutral current neutrino nucleon interactions are indistinguishable from DM-nucleon interactions at low energies, we extend this feature to high energies for a small, non-thermal but highly energetic population of DM particle χ, created via the decay of a significantly more massive and long-lived non-thermal relic Φ, which forms the bulk of DM. If χ interacts with nucleons, its cross-section, like the neutrino-nucleus coherent cross-section, can rise sharply with energy leading to deep inelastic scattering, similar to neutral current neutrino-nucleon interactions at high energies. Thus, its direct detection may be possible via cascades in very large neutrino detectors. As a specific example, we apply this notion to the recently reported three ultra-high energy PeV cascade events clustered around 1 – 2 PeV at IceCube (IC). We discuss the features which may help discriminate this scenario from one in which only astrophysical neutrinos constitute the event sample in detectors like IC.

  8. The direct detection of boosted dark matter at high energies and PeV events at IceCube

    DOE PAGES

    Bhattacharya, A.; Gandhi, R.; Gupta, A.

    2015-03-13

    We study the possibility of detecting dark matter directly via a small but energetic component that is allowed within present-day constraints. Drawing closely upon the fact that neutral current neutrino nucleon interactions are indistinguishable from DM-nucleon interactions at low energies, we extend this feature to high energies for a small, non-thermal but highly energetic population of DM particle χ, created via the decay of a significantly more massive and long-lived non-thermal relic Φ, which forms the bulk of DM. If χ interacts with nucleons, its cross-section, like the neutrino-nucleus coherent cross-section, can rise sharply with energy leading to deep inelasticmore » scattering, similar to neutral current neutrino-nucleon interactions at high energies. Thus, its direct detection may be possible via cascades in very large neutrino detectors. As a specific example, we apply this notion to the recently reported three ultra-high energy PeV cascade events clustered around 1 – 2 PeV at IceCube (IC). We discuss the features which may help discriminate this scenario from one in which only astrophysical neutrinos constitute the event sample in detectors like IC.« less

  9. The direct detection of boosted dark matter at high energies and PeV events at IceCube

    SciTech Connect

    Bhattacharya, A.; Gandhi, R.; Gupta, A.

    2015-03-13

    We study the possibility of detecting dark matter directly via a small but energetic component that is allowed within present-day constraints. Drawing closely upon the fact that neutral current neutrino nucleon interactions are indistinguishable from DM-nucleon interactions at low energies, we extend this feature to high energies for a small, non-thermal but highly energetic population of DM particle χ, created via the decay of a significantly more massive and long-lived non-thermal relic ϕ, which forms the bulk of DM. If χ interacts with nucleons, its cross-section, like the neutrino-nucleus coherent cross-section, can rise sharply with energy leading to deep inelastic scattering, similar to neutral current neutrino-nucleon interactions at high energies. Thus, its direct detection may be possible via cascades in very large neutrino detectors. As a specific example, we apply this notion to the recently reported three ultra-high energy PeV cascade events clustered around 1−2 PeV at IceCube (IC). We discuss the features which may help discriminate this scenario from one in which only astrophysical neutrinos constitute the event sample in detectors like IC.

  10. In search of genetic constraints limiting the evolution of egg size: direct and correlated responses to artificial selection on a prenatal maternal effector.

    PubMed

    Pick, J L; Hutter, P; Tschirren, B

    2016-06-01

    Maternal effects are an important force in nature, but the evolutionary dynamics of the traits that cause them are not well understood. Egg size is known to be a key mediator of prenatal maternal effects with an established genetic basis. In contrast to theoretical expectations for fitness-related traits, there is a large amount of additive genetic variation in egg size observed in natural populations. One possible mechanism for the maintenance of this variation is through genetic constraints caused by a shared genetic basis among traits. Here we created replicated, divergent selection lines for maternal egg investment in Japanese quail (Coturnix japonica) to quantify the role of genetic constraints in the evolution of egg size. We found that egg size responds rapidly to selection, accompanied by a strong response in all egg components. Initially, we observed a correlated response in body size, but this response declined over time, showing that egg size and body size can evolve independently. Furthermore, no correlated response in fecundity (measured as the proportion of days on which a female laid an egg) was observed. However, the response to selection was asymmetrical, with egg size plateauing after one generation of selection in the high but not the low investment lines. We attribute this pattern to the presence of genetic asymmetries, caused by directional dominance or unequal allele frequencies. Such asymmetries may contribute to the evolutionary stasis in egg size observed in natural populations, despite a positive association between egg size and fitness.

  11. A review of the discovery reach of directional Dark Matter detection

    NASA Astrophysics Data System (ADS)

    Mayet, F.; Green, A. M.; Battat, J. B. R.; Billard, J.; Bozorgnia, N.; Gelmini, G. B.; Gondolo, P.; Kavanagh, B. J.; Lee, S. K.; Loomba, D.; Monroe, J.; Morgan, B.; O'Hare, C. A. J.; Peter, A. H. G.; Phan, N. S.; Vahsen, S. E.

    2016-04-01

    Cosmological observations indicate that most of the matter in the Universe is Dark Matter. Dark Matter in the form of Weakly Interacting Massive Particles (WIMPs) can be detected directly, via its elastic scattering off target nuclei. Most current direct detection experiments only measure the energy of the recoiling nuclei. However, directional detection experiments are sensitive to the direction of the nuclear recoil as well. Due to the Sun's motion with respect to the Galactic rest frame, the directional recoil rate has a dipole feature, peaking around the direction of the Solar motion. This provides a powerful tool for demonstrating the Galactic origin of nuclear recoils and hence unambiguously detecting Dark Matter. Furthermore, the directional recoil distribution depends on the WIMP mass, scattering cross section and local velocity distribution. Therefore, with a large number of recoil events it will be possible to study the physics of Dark Matter in terms of particle and astrophysical properties. We review the potential of directional detectors for detecting and characterizing WIMPs.

  12. Signal to Noise Ratios of Pulsed and Sinewave Modulated Direct Detection Lidar for IPDA Measurements

    NASA Technical Reports Server (NTRS)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    The signal-to-noise ratios have been derived for IPDA lidar using a direct detection receiver for both pulsed and sinewave laser modulation techniques, and the results and laboratory measurements are presented

  13. Evaluation of two methods for direct detection of Fusarium spp. in water.

    PubMed

    Graça, Mariana G; van der Heijden, Inneke M; Perdigão, Lauro; Taira, Cleison; Costa, Silvia F; Levin, Anna S

    2016-04-01

    Fusarium is a waterborne fungus that causes severe infections especially in patients with prolonged neutropenia. Traditionally, the detection of Fusarium in water is done by culturing which is difficult and time consuming. A faster method is necessary to prevent exposure of susceptible patients to contaminated water. The objective of this study was to develop a molecular technique for direct detection of Fusarium in water. A direct DNA extraction method from water was developed and coupled to a genus-specific PCR, to detect 3 species of Fusarium (verticillioides, oxysporum and solani). The detection limits were 10 cells/L and 1 cell/L for the molecular and culture methods, respectively. To our knowledge, this is the first method developed to detect Fusarium directly from water.

  14. CHEMICAL ENRICHMENT OF DAMPED Ly{alpha} SYSTEMS AS A DIRECT CONSTRAINT ON POPULATION III STAR FORMATION

    SciTech Connect

    Kulkarni, Girish; Hennawi, Joseph F.; Rollinde, Emmanuel; Vangioni, Elisabeth

    2013-08-01

    . We find that these distributions are anchored toward abundance ratios set by Population II supernova yields, but they exhibit a tail which depends significantly on the Population III IMF for z > 5. Thus, a sample of DLA metallicity and relative abundance measurements at high redshift holds the promise to constrain Population III enrichment and the Population III IMF. We find that a sample of just 10 DLAs with relative abundances measured to an accuracy of 0.1 dex is sufficient to constrain the Population III IMF at 4{sigma}. These constraints may prove stronger than other probes of Population III enrichment, such as metal-poor stars and individual metal-poor DLAs. Our results provide a global picture of the thermal, ionization, and chemical evolution of the universe, and have the potential to rule out certain Population III scenarios.

  15. Direct fluorescent antibody technique for the detection of bacterial kidney disease in paraffin-embedded tissues

    USGS Publications Warehouse

    Ochiai, T.; Yasutake, W.T.; Gould, R.W.

    1985-01-01

    The direct fluorescent antibody technique (FAT) was successfully used to detect the causative agent of bacterial kidney disease (BKD), Renibacterium salmoninarum, in Bouin's solution flexed and paraffinembedded egg and tissue sections. This method is superior to gram stain and may be particularly useful in detecting the BKD organism in fish with low-grade infection.

  16. Directional Pair-Production Spectrometer Design for Airborne Stand-Off Detection of Special Nuclear Material

    DTIC Science & Technology

    2011-03-01

    isotope of interest. Through simultaneous operation as a Compton camera , the detection system will be able to measure rudimentary directional...Spectroscopy .................................................................................. 4 I. 5. Compton Camera ...II. 4. Chance Compton Scattering Detection Efficiency Calculations .......................... 27 II. 5. Compton Camera Images

  17. Evaluation of harmonic direction-finding systems for detecting locomotor activity

    USGS Publications Warehouse

    Boyarski, V.L.; Rodda, G.H.; Savidge, J.A.

    2007-01-01

    We conducted a physical simulation experiment to test the efficacy of harmonic direction finding for remotely detecting locomotor activity in animals. The ability to remotely detect movement helps to avoid disturbing natural movement behavior. Remote detection implies that the observer can sense only a change in signal bearing. In our simulated movements, small changes in bearing (<5.7??) were routinely undetectable. Detectability improved progressively with the size of the simulated animal movement. The average (??SD) of reflector tag movements correctly detected for 5 observers was 93.9 ?? 12.8% when the tag was moved ???11.5??; most observers correctly detected tag movements ???20.1??. Given our data, one can assess whether the technique will be effective for detecting movements at an observation distance appropriate for the study organism. We recommend that both habitat and behavior of the organism be taken into consideration when contemplating use of this technique for detecting locomotion.

  18. Combining parallel detection of proton echo planar spectroscopic imaging (PEPSI) measurements with a data-consistency constraint improves SNR.

    PubMed

    Tsai, Shang-Yueh; Hsu, Yi-Cheng; Chu, Ying-Hua; Kuo, Wen-Jui; Lin, Fa-Hsuan

    2015-12-01

    One major challenge of MRSI is the poor signal-to-noise ratio (SNR), which can be improved by using a surface coil array. Here we propose to exploit the spatial sensitivity of different channels of a coil array to enforce the k-space data consistency (DC) in order to suppress noise and consequently to improve MRSI SNR. MRSI data were collected using a proton echo planar spectroscopic imaging (PEPSI) sequence at 3 T using a 32-channel coil array and were averaged with one, two and eight measurements (avg-1, avg-2 and avg-8). The DC constraint was applied using a regularization parameter λ of 1, 2, 3, 5 or 10. Metabolite concentrations were quantified using LCModel. Our results show that the suppression of noise by applying the DC constraint to PEPSI reconstruction yields up to 32% and 27% SNR gain for avg-1 and avg-2 data with λ = 5, respectively. According to the reported Cramer-Rao lower bounds, the improvement in metabolic fitting was significant (p < 0.01) when the DC constraint was applied with λ ≥ 2. Using the DC constraint with λ = 3 or 5 can minimize both root-mean-square errors and spatial variation for all subjects using the avg-8 data set as reference values. Our results suggest that MRSI reconstructed with a DC constraint can save around 70% of scanning time to obtain images and spectra with similar SNRs using λ = 5.

  19. Is Anyone Looking at Me? Direct Gaze Detection in Children with and without Autism

    ERIC Educational Resources Information Center

    Senju, Atsushi; Kikuchi, Yukiko; Hasegawa, Toshikazu; Tojo, Yoshikuni; Osanai, Hiroo

    2008-01-01

    Atypical processing of eye contact is one of the significant characteristics of individuals with autism, but the mechanism underlying atypical direct gaze processing is still unclear. This study used a visual search paradigm to examine whether the facial context would affect direct gaze detection in children with autism. Participants were asked to…

  20. The utility of direct specimen detection by Sanger sequencing in hospitalized pediatric patients.

    PubMed

    Mongkolrattanothai, Kanokporn; Dien Bard, Jennifer

    2017-02-01

    Direct microbial DNA detection from clinical specimens by polymerase chain reaction and Sanger sequencing has been developed to address the innate limitations of traditional culture-based work-up. We report our institution's experience with direct specimen sequencing, its clinical utility, and barriers to effective clinical implementation.

  1. PREFACE: CYGNUS 2013: 4th Workshop on Directional Detection of Dark Matter

    NASA Astrophysics Data System (ADS)

    Naka, Tatsuhiro; Miuchi, Kentaro

    2013-12-01

    It is a great pleasure to publish the proceedings of the 4th Workshop on Directional Detection of Dark Matter held in Toyama, Japan on 10-12 June 2013 (CYGNUS 2013). These proceedings contain written versions of the presentations made at CYGNUS 2013 as scientific outputs of the directional detection of dark matter. The GYGNUS workshop started in 2007 at Boulby Underground Laboratory (UK), followed by CYGNUS 2009 (MIT in Cambridge, Massachusetts, USA) and CYGNUS 2011 (AUSSOIS, France). CYGNUS 2013 was held by the combination of a two and a half days of scientific program and a half day visit to the underground laboratory (Kamioka Observatory) as a 'tradition' of CYGNUS workshops. The name 'CYGNUS' came from the fact that the 'dark matter wind' is expected to come from the direction of the constellation Cygnus due to the motion of the Solar system in the galaxy. A general aim of these CYGNUS workshops is to bring together the theoretical and experimental studies on the directional dark matter detection. Directional detection of dark matter is a promising approach to a 'clear detection' and also to 'further investigations' of galactic dark matter, or Weakly Interacting Massive Particles (WIMPs). Directional detection requires the simultaneous detection of the energy and track of low energy recoils. Among many technological challenges for the requirement above, three of them, namely size, background, and directionality (angular resolution and head-tail detection), are most important to demonstrate and improve the quality as a dark matter detector. In the workshop, up-to-date activities by the international reserchers are discussed. The workshop was a great success thanks to the oral contributions and fruitful discussions held throughout the workshop period. We hope that readers will remember and share the great enthusiasm shown during the CYGNUS 2013 workshop. The Editors Tatsuhiro Naka and Kentaro Miuchi

  2. Searching for Dark Matter in Unification Models: A Hint from Indirect Sensitivities towards Future Signals in Direct Detection and B-decays

    SciTech Connect

    Olive, Keith A.

    2006-11-28

    A comparison is made between accelerator and direct detection constraints in constrained versions of the minimal supersymmetric standard model. Models considered are based on mSUGRA, where scalar and gaugino masses are unified at the GUT scale. In addition, the mSUGRA relation between the (unified) A and B parameters is assumed, as is the relation between m0 and gravitino mass. Also considered are models where the latter two conditions are dropped (the CMSSM), and a less constrained version where the Higgs soft masses are not unified at the GUT scale (the NUHM)

  3. Direct Detection of 16S rRNA in Soil Extracts by Using Oligonucleotide Microarrays

    PubMed Central

    Small, Jack; Call, Douglas R.; Brockman, Fred J.; Straub, Timothy M.; Chandler, Darrell P.

    2001-01-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 μg of total RNA, representing approximately 7.5 × 106 Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  4. Single-particle cryo-EM data acquisition by using direct electron detection camera

    PubMed Central

    Wu, Shenping; Armache, Jean-Paul; Cheng, Yifan

    2016-01-01

    Recent advances in single-particle electron cryo-microscopy (cryo-EM) were largely facilitated by the application of direct electron detection cameras. These cameras feature not only a significant improvement in detective quantum efficiency but also a high frame rate that enables images to be acquired as ‘movies’ made of stacks of many frames. In this review, we discuss how the applications of direct electron detection cameras in cryo-EM have changed the way the data are acquired. PMID:26546989

  5. Receiver Signal to Noise Ratios for IPDA Lidars Using Sine-wave and Pulsed Laser Modulation and Direct Detections

    NASA Technical Reports Server (NTRS)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    Integrated path differential absorption (IPDA) lidar can be used to remotely measure the column density of gases in the path to a scattering target [1]. The total column gas molecular density can be derived from the ratio of the laser echo signal power with the laser wavelength on the gas absorption line (on-line) to that off the line (off-line). 80th coherent detection and direct detection IPDA lidar have been used successfully in the past in horizontal path and airborne remote sensing measurements. However, for space based measurements, the signal propagation losses are often orders of magnitude higher and it is important to use the most efficient laser modulation and detection technique to minimize the average laser power and the electrical power from the spacecraft. This paper gives an analysis the receiver signal to noise ratio (SNR) of several laser modulation and detection techniques versus the average received laser power under similar operation environments. Coherent detection [2] can give the best receiver performance when the local oscillator laser is relatively strong and the heterodyne mixing losses are negligible. Coherent detection has a high signal gain and a very narrow bandwidth for the background light and detector dark noise. However, coherent detection must maintain a high degree of coherence between the local oscillator laser and the received signal in both temporal and spatial modes. This often results in a high system complexity and low overall measurement efficiency. For measurements through atmosphere the coherence diameter of the received signal also limits the useful size of the receiver telescope. Direct detection IPDA lidars are simpler to build and have fewer constraints on the transmitter and receiver components. They can use much larger size 'photon-bucket' type telescopes to reduce the demands on the laser transmitter. Here we consider the two most widely used direct detection IPDA lidar techniques. The first technique uses two CW

  6. Sequential Two-Dimensional Partial Response Maximum Likelihood Detection Scheme with Constant-Weight Constraint Code for Holographic Data Storage Systems

    NASA Astrophysics Data System (ADS)

    Kong, Gyuyeol; Choi, Sooyong

    2012-08-01

    A sequential two-dimensional (2D) partial response maximum likelihood (PRML) detection scheme for holographic data storage (HDS) systems is proposed. We use two complexity reduction schemes, a reduced-state trellis and a constant-weight (CW) constraint. In the reduced-state trellis, the limited candidate bits surrounding the target bit are considered for the 2D PRML detector. In the CW constraint, the trellis transitions that violate the CW condition that each code-word block has only one white bit are eliminated. However, the 2D PRML detector using the complexity reduction schemes, which operates on 47 states and 169 branches, has performance degradation. To overcome performance degradation, a sequential detection algorithm uses the estimated a priori probability. By the sequential procedure, we mitigate 2D intersymbol interference with an enhanced reliability of the branch metric. Simulation results show that the proposed 2D PRML detection scheme yields about 3 dB gains over the one-dimensional PRML detection scheme.

  7. Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

    DOE PAGES

    Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; ...

    2015-01-09

    We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: mDM, Mmed , gDM and gq, the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework can be used to establishmore » an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches.« less

  8. Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

    SciTech Connect

    Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; McCabe, Christopher

    2015-01-09

    We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: mDM, Mmed , gDM and gq, the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework can be used to establish an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches.

  9. Signal averaging limitations in heterodyne- and direct-detection laser remote sensing measurements

    NASA Technical Reports Server (NTRS)

    Menyuk, N.; Killinger, D. K.; Menyuk, C. R.

    1983-01-01

    The improvement in measurement uncertainty brought about by the averaging of increasing numbers of pulse return signals in both heterodyne- and direct-detection lidar systems is investigated. A theoretical analysis is presented which shows the standard deviation of the mean measurement to decrease as the inverse square root of the number of measurements, except in the presence of temporal correlation. Experimental measurements based on a dual-hybrid-TEA CO2 laser differential absorption lidar system are reported which demonstrate that the actual reduction in the standard deviation of the mean in both heterodyne- and direct-detection systems is much slower than the inverse square-root dependence predicted for uncorrelated signals, but is in agreement with predictions in the event of temporal correlation. Results thus favor the use of direct detection at relatively short range where the lower limit of the standard deviation of the mean is about 2 percent, but advantages of heterodyne detection at longer ranges are noted.

  10. Advancing Solar Irradiance Measurement for Climate-Related Studies: Accurate Constraint on Direct Aerosol Radiative Effect (DARE)

    NASA Technical Reports Server (NTRS)

    Tsay, Si-Chee; Ji, Q. Jack

    2011-01-01

    Earth's climate is driven primarily by solar radiation. As summarized in various IPCC reports, the global average of radiative forcing for different agents and mechanisms, such as aerosols or CO2 doubling, is in the range of a few W/sq m. However, when solar irradiance is measured by broadband radiometers, such as the fleet of Eppley Precision Solar Pyranometers (PSP) and equivalent instrumentation employed worldwide, the measurement uncertainty is larger than 2% (e.g., WMO specification of pyranometer, 2008). Thus, out of the approx. 184 W/sq m (approx.263 W/sq m if cloud-free) surface solar insolation (Trenberth et al. 2009), the measurement uncertainty is greater than +/-3.6 W/sq m, overwhelming the climate change signals. To discern these signals, less than a 1 % measurement uncertainty is required and is currently achievable only by means of a newly developed methodology employing a modified PSP-like pyranometer and an updated calibration equation to account for its thermal effects (li and Tsay, 2010). In this talk, we will show that some auxiliary measurements, such as those from a collocated pyrgeometer or air temperature sensors, can help correct historical datasets. Additionally, we will also demonstrate that a pyrheliometer is not free of the thermal effect; therefore, comparing to a high cost yet still not thermal-effect-free "direct + diffuse" approach in measuring surface solar irradiance, our new method is more economical, and more likely to be suitable for correcting a wide variety of historical datasets. Modeling simulations will be presented that a corrected solar irradiance measurement has a significant impact on aerosol forcing, and thus plays an important role in climate studies.

  11. Excluding the light dark matter window of a 331 model using LHC and direct dark matter detection data

    SciTech Connect

    Cogollo, D.; Gonzalez-Morales, Alma X.; Queiroz, Farinaldo S.; Teles, P. Rebello E-mail: alxogonz@ucsc.edu E-mail: patricia.rebello.teles@cern.ch

    2014-11-01

    We sift the impact of the recent Higgs precise measurements, and recent dark matter direct detection results, on the dark sector of an electroweak extension of the Standard Model that has a complex scalar as dark matter. We find that in this model the Higgs decays with a large branching ratio into dark matter particles, and charged scalars when these are kinematically available, for any coupling strength differently from the so called Higgs portal. Moreover, we compute the abundance and spin-independent WIMP-nucleon scattering cross section, which are driven by the Higgs and Z{sup '} boson processes. We decisively exclude the 1–500 GeV dark matter window and find the most stringent lower bound in the literature on the scale of symmetry breaking of the model namely 10 TeV, after applying the LUX-2013 limit. Interestingly, the projected XENON1T constraint will be able to rule out the entire 1 GeV–1000 GeV dark matter mass range. Lastly, for completeness, we compute the charged scalar production cross section at the LHC and comment on the possibility of detection at current and future LHC runnings.

  12. A comparison of directed search target detection versus in-scene target detection in Worldview-2 datasets

    NASA Astrophysics Data System (ADS)

    Grossman, S.

    2015-05-01

    Since the events of September 11, 2001, the intelligence focus has moved from large order-of-battle targets to small targets of opportunity. Additionally, the business community has discovered the use of remotely sensed data to anticipate demand and derive data on their competition. This requires the finer spectral and spatial fidelity now available to recognize those targets. This work hypothesizes that directed searches using calibrated data perform at least as well as inscene manually intensive target detection searches. It uses calibrated Worldview-2 multispectral images with NEF generated signatures and standard detection algorithms to compare bespoke directed search capabilities against ENVI™ in-scene search capabilities. Multiple execution runs are performed at increasing thresholds to generate detection rates. These rates are plotted and statistically analyzed. While individual head-to-head comparison results vary, 88% of the directed searches performed at least as well as in-scene searches with 50% clearly outperforming in-scene methods. The results strongly support the premise that directed searches perform at least as well as comparable in-scene searches.

  13. Superconducting Quantum Interference Devices for the Detection of Magnetic Flux and Application to Airborne High Frequency Direction Finding

    DTIC Science & Technology

    2015-03-26

    SUPERCONDUCTING QUANTUM INTERFERENCE DEVICES FOR THE DETECTION OF MAGNETIC FLUX AND APPLICATION TO AIRBORNE HIGH FREQUENCY DIRECTION FINDING THESIS...SUPERCONDUCTING QUANTUM INTERFERENCE DEVICES FOR THE DETECTION OF MAGNETIC FLUX AND APPLICATION TO AIRBORNE HIGH FREQUENCY DIRECTION FINDING THESIS Presented to the...SUPERCONDUCTING QUANTUM INTERFERENCE DEVICES FOR THE DETECTION OF MAGNETIC FLUX AND APPLICATION TO AIRBORNE HIGH FREQUENCY DIRECTION FINDING THESIS Travis

  14. Nonlinear impairment compensation for DFT-S OFDM signal transmission with directly modulated laser and direct detection

    NASA Astrophysics Data System (ADS)

    Gou, Pengqi; Wang, Kaihui; Qin, Chaoyi; Yu, Jianjun

    2017-03-01

    We experimentally demonstrate a 16-ary quadrature amplitude modulation (16QAM) DFT-spread optical orthogonal frequency division multiplexing (OFDM) transmission system utilizing a cost-effective directly modulated laser (DML) and direct detection. For 20-Gbaud 16QAM-OFDM signal, with the aid of nonlinear equalization (NLE) algorithm, we respectively provide 6.2-dB and 5.2-dB receiver sensitivity improvement under the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3 for the back-to-back (BTB) case and after transmission over 10-km standard single mode fiber (SSMF) case, related to only adopt post-equalization scheme. To our knowledge, this is the first time to use dynamic nonlinear equalizer (NLE) based on the summation of the square of the difference between samples in one IM/DD OFDM system with DML to mitigate nonlinear distortion.

  15. Application of head flexion detection for enhancing eye gaze direction classification.

    PubMed

    Al-Rahayfeh, Amer; Faezipour, Miad

    2014-01-01

    Extensive research has been conducted on the tracking and detection of the eye gaze and head movement detection as these aspects of technology can be applied as alternative approaches for various interfacing devices. This paper proposes enhancements to the classification of the eye gaze direction. Viola Jones face detector is applied to first declare the region of the eye. Circular Hough Transform is then used to detect the iris location. Support Vector Machine (SVM) is applied to classify the eye gaze direction. Accuracy of the system is enhanced by calculating the flexion angle of the head through the utilization of a microcontroller and flex sensors. In case of rotated face images, the face can be rotated back to zero degrees through the flexion angle calculation. This is while Viola Jones face detector is limited to face images with very little or no rotation angle. Accuracy is initiated by enhancing the effectiveness of the system in the overall procedure of classifying the direction of the eye gaze. Therefore, the head direction is a main determinant in enhancing the control method. Different control signals are enhanced by the eye gaze direction classification and the head direction detection.

  16. Detection of Mycobacterium avium subsp. paratuberculosis by a Direct In Situ PCR Method

    PubMed Central

    Delgado, Fernando; Aguilar, Diana; Garbaccio, Sergio; Francinelli, Gladys; Hernández-Pando, R.; Romano, María Isabel

    2011-01-01

    In situ detection of Mycobacterium avium subsp. paratuberculosis is useful for diagnosis and research of paratuberculosis. The aim of this paper was to detect this agent in formalin-fixed, paraffin-embedded tissue samples by a direct in situ PCR. The technique was performed on ileum or ileocaecal lymph node samples from 8 naturally infected cattle and 1 healthy calf, by using p89 and p92 primers for amplification of IS900 sequence. Moderate positive signal was detected in all positive samples and not in negative control, but tissues resulted were affected in many cases due to the enzymatic treatment and the high temperature exposition. Although the technique was useful for Map detection, the signal was lower than immunohistochemistry probably because of the fixation process. In one case, signal was higher, which might be due to the detection of spheroplasts. Thus, the described method should be recommended when others resulted negative or for spheroplasts detection. PMID:21772965

  17. Doubling direct-detection data rate by polarization multiplexing of 16-QAM without active polarization control.

    PubMed

    Nazarathy, Moshe; Agmon, Amos

    2013-12-30

    We introduce and simulate a technique enabling to utilize the polarization dimension in direct-detection optical transmission, supporting polarization multiplexing (POL-MUX) over direct-detection (DD) methods previously demonstrated for a single polarization such as direct-detection OFDM. POL-MUX is currently precluded in self-coherent DD with remotely transmitted pilot, as signal x pilot components may randomly fade out. We propose POL-MUX transmission of advanced modulation formats, such as 16-QAM and higher, by means of a novel low-complexity photonic integrated optical front-end and adaptive 3x2 MIMO DSP. The principle of operation is as follows: an additional X x Y cross-polarizations signal is generated, providing three projections onto an over-complete frame of three dependent vectors. This enables to resiliently reconstruct the received state of polarization even when the remotely transmitted pilot fades along one of the received polarization axes.

  18. Halo-independent direct detection of momentum-dependent dark matter

    SciTech Connect

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M. E-mail: frandsen@cp3-origins.net

    2014-10-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  19. Migratory birds use head scans to detect the direction of the earth's magnetic field.

    PubMed

    Mouritsen, Henrik; Feenders, Gesa; Liedvogel, Miriam; Kropp, Wiebke

    2004-11-09

    Night-migratory songbirds are known to use a magnetic compass , but how do they detect the reference direction provided by the geomagnetic field, and where is the sensory organ located? The most prominent characteristic of geomagnetic sensory input, whether based on visual patterns or magnetite-mediated forces , is the predicted symmetry around the north-south or east-west magnetic axis. Here, we show that caged migratory garden warblers perform head-scanning behavior well suited to detect this magnetic symmetry plane. In the natural geomagnetic field, birds move toward their migratory direction after head scanning. In a zero-magnetic field , where no symmetry plane exists, the birds almost triple their head-scanning frequency, and the movement direction after a head scan becomes random. Thus, the magnetic sensory organ is located in the bird's head, and head scans are used to locate the reference direction provided by the geomagnetic field.

  20. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    SciTech Connect

    Matthews, John A.J.; Gold, Michael S.

    2016-08-11

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  1. Directed Design of Experiments (DOE) for Determining Probability of Detection (POD) Capability of NDE Systems (DOEPOD)

    NASA Technical Reports Server (NTRS)

    Generazio, Ed

    2007-01-01

    This viewgraph presentation reviews some of the issues that people who specialize in Non destructive evaluation (NDE) have with determining the statistics of the probability of detection. There is discussion of the use of the binominal distribution, and the probability of hit. The presentation then reviews the concepts of Directed Design of Experiments for Validating Probability of Detection of Inspection Systems (DOEPOD). Several cases are reviewed, and discussed. The concept of false calls is also reviewed.

  2. The ArDM, a ton-scale liquid argon experiment for direct dark matter detection

    NASA Astrophysics Data System (ADS)

    Otyugova, P.; Ar DM Collaboration

    2008-07-01

    The ArDM project aims at developing and operating large noble liquid detectors to search for direct evidence of Weakly Interacting Massive Particles (WIMP) as Dark Matter in the Universe. The initial goal is to design, assemble and operate an approximately 1 ton liquid argon prototype based on the double-phase detection principle to demonstrate the feasibility of a ton-scale experiment with the required performance to efficiently detect and sufficiently discriminate backgrounds for a successful WIMP detection. The detector will independently measure the primary scintillation light and the ionization charge. This paper will mainly describe the concept, R&D results and status of the charge read out system.

  3. Microneedle Biosensor: A Method for Direct Label-free Real Time Protein Detection

    PubMed Central

    Esfandyarpour, Rahim; Esfandyarpour, Hesaam; Javanmard, Mehdi; Harris, James S.; Davis, Ronald W.

    2012-01-01

    Here we present the development of an array of electrical micro-biosensors in a microfluidic channel, called microneedle biosensors. A microneedle biosensor is a real-time, label-free, direct electrical detection platform, which is capable of high sensitivity detection, measuring the change in ionic current and impedance modulation, due to the presence or reaction of biomolecules such as proteins and nucleic acids. In this study, we successfully fabricated and electrically characterized the sensors and demonstrated successful detection of target protein. In this study, we used biotinylated bovine serum albumin as the receptor and streptavidin as the target analyte PMID:23355762

  4. A SETI metapolicy: New directions towards comprehensive policies concerning the detection of extraterrestrial intelligence

    NASA Astrophysics Data System (ADS)

    Baxter, Stephen; Elliott, John

    2012-09-01

    At present we have only one agreed public policy for handling the detection of an extraterrestrial intelligence (ETI), the 'First SETI Protocol' of 1989, which guides action in the immediate aftermath of detection, even though SETI (the Search for Extraterrestrial Intelligence) constitutes an active search for such a detection. The purpose of this paper is to set out areas in which policies might fruitfully be developed, including reviewing the rationale and investment in SETI, handling ETI artefacts, and approaches to direct contact. 'Negative' possibilities will be examined, for example, whether an ETI artefact or data should be purposefully destroyed.

  5. Observations and modelling of CO and [C i] in protoplanetary disks. First detections of [C i] and constraints on the carbon abundance

    NASA Astrophysics Data System (ADS)

    Kama, M.; Bruderer, S.; Carney, M.; Hogerheijde, M.; van Dishoeck, E. F.; Fedele, D.; Baryshev, A.; Boland, W.; Güsten, R.; Aikutalp, A.; Choi, Y.; Endo, A.; Frieswijk, W.; Karska, A.; Klaassen, P.; Koumpia, E.; Kristensen, L.; Leurini, S.; Nagy, Z.; Perez Beaupuits, J.-P.; Risacher, C.; van der Marel, N.; van Kempen, T. A.; van Weeren, R. J.; Wyrowski, F.; Yıldız, U. A.

    2016-04-01

    Context. The gas-solid budget of carbon in protoplanetary disks is related to the composition of the cores and atmospheres of the planets forming in them. The principal gas-phase carbon carriers CO, C0, and C+ can now be observed regularly in disks. Aims: The gas-phase carbon abundance in disks has thus far not been well characterized observationally. We obtain new constraints on the [C]/[H] ratio in a large sample of disks, and compile an overview of the strength of [C i] and warm CO emission. Methods: We carried out a survey of the CO 6-5 line and the [C i] 1-0 and 2-1 lines towards 37 disks with the APEX telescope, and supplemented it with [C ii] data from the literature. The data are interpreted using a grid of models produced with the DALI disk code. We also investigate how well the gas-phase carbon abundance can be determined in light of parameter uncertainties. Results: The CO 6-5 line is detected in 13 out of 33 sources, [C i] 1-0 in 6 out of 12, and [C i] 2-1 in 1 out of 33. With separate deep integrations, the first unambiguous detections of the [C i] 1-0 line in disks are obtained, in TW Hya and HD 100546. Conclusions: Gas-phase carbon abundance reductions of a factor of 5-10 or more can be identified robustly based on CO and [C i] detections, assuming reasonable constraints on other parameters. The atomic carbon detection towards TW Hya confirms a factor of 100 reduction of [C]/[H]gas in that disk, while the data are consistent with an ISM-like carbon abundance for HD 100546. In addition, BP Tau, T Cha, HD 139614, HD 141569, and HD 100453 are either carbon-depleted or gas-poor disks. The low [C i] 2-1 detection rates in the survey mostly reflect insufficient sensitivity for T Tauri disks. The Herbig Ae/Be disks with CO and [C ii] upper limits below the models are debris-disk-like systems. An increase in sensitivity of roughly order of magnitude compared to our survey is required to obtain useful constraints on the gas-phase [C]/[H] ratio in most of the

  6. Evaluation of four methods for the detection of streptococcal group A antigen directly from throat swabs.

    PubMed

    Betriu, C; de la Torre, F; Muñoz, P; Fernández, A; Picazo, J J

    1988-12-01

    We have compared the sensitivity, specificity and reproducibility of four rapid tests for the detection of group A beta-hemolytic streptococci antigen directly from a throat swab. The four methods were very specific, all of them offered reproductibility and surpassed conventional culture in speed and simplicity.

  7. Less-simplified models of dark matter for direct detection and the LHC

    NASA Astrophysics Data System (ADS)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-04-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳ 10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators' mass. We derive the strongest limits for combinations of vector + scalar, vector + "squark", and "squark" + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  8. An FPGA-based data acquisition system for directional dark matter detection

    NASA Astrophysics Data System (ADS)

    Yang, Chen; Nicoloff, Catherine; Sanaullah, Ahmed; Sridhar, Arvind; Herbordt, Martin; Battat, James; Battat Lab at Wellesley College Team; CAAD Lab at Boston University Team

    2017-01-01

    Directional dark matter detection is a powerful tool in the search for dark matter. Low-pressure gas TPCs are commonly used for directional detection, and dark-matter-induced recoils are mm long. These tracks can be reconstructed by micropatterned readouts. Because large detector volumes are needed, a cost-effective data acquisition system capable of scaling to large channel counts (105 or 106) is required. The Directional Recoil Identification From Tracks (DRIFT) collaboration has pioneered the use of TPCs for directional detection. We employ a negative ion gas with drift speed comparable to the electron drift speed in liquid argon (LAr). We aim to use electronics developed for million-channel readouts in large LAr neutrino detectors. We have built a prototype Micromegas-based directional detector with 103 channels. A FPGA-based back-end system (BE) receives a 12 Gbps data stream from eight ASIC-based front-end boards (FE), each with 128 detector channels. The BE buffers 3 μs of pretrigger data for all channels in DRAM, and streams triggered data to a host PC. We will describe the system architecture and present preliminary measurements from the DAQ. We acknowledge the support of the Research Corporation for Science Advancement, the NSF and the Massachusetts Space Grant Consortium.

  9. An automated method for detecting architectural distortions on mammograms using direction analysis of linear structures.

    PubMed

    Matsubara, T; Ito, A; Tsunomori, A; Hara, T; Muramatsu, C; Endo, T; Fujita, H

    2015-08-01

    Architectural distortion is one of the most important findings when evaluating mammograms for breast cancer. Abnormal breast architecture is characterized by the presence of spicules, which are distorted mammary structures that are not accompanied by an increased density or mass. We have been developing an automated method for detecting spiculated architectural distortions by analyzing linear structures extracted by normal curvature. However, some structures that are possibly related to distorted areas are not extracted using this method. The purpose of this study was to develop a new automated method for direction analysis of linear structures to improve detection performance in mammography. The direction of linear structures in each region of interest (ROI) was first determined using a direction filter and a background filter that can define one of eight directions (0°, 22.5°, 45°, 67.5°, 90°, 112.5°, 135°, and 157.5°). The concentration and isotropic indexes were calculated using the determined direction of the linear structures in order to extract the candidate areas. Discriminant analysis was performed to eliminate false positives results. Our database consisted of 168 abnormal images containing 174 distorted areas and 580 normal images. The sensitivity of the new method was 81%. There were 2.6 and 4.2 false positives per image using the new and previous methods, respectively. These findings show that our new method is effective for detecting spiculated architectural distortions.

  10. Direct and fast detection of Alexandrium minutum algae by using high frequency microbalance.

    PubMed

    Sousa, Célia; Compère, Chantal; Dreanno, Catherine; Crassous, Marie-Pierre; Gas, Fabienne; Baus, Beatrice; Perrot, Hubert

    2014-09-01

    In this paper, a simple detection of a toxic algae, Alexandrium minutum, was developed using highly sensitive quartz crystal microbalance. In terms of performance, compared with other conventional analytical tools, the main interest of our immunosensor is based on a fast and direct detection of these living cells. This system requires the use of one monoclonal antibody directed against the surface antigen of A. minutum. We demonstrate that the whole living and motile algae are caught and detected. The high specificity of the biosensor is also demonstrated by testing several other dinoflagellate species. The frequency shift is correlated to the A. minutum cell concentration. This simple system is potentially promising for environmental monitoring purposes.

  11. CAN IBEX DETECT INTERSTELLAR NEUTRAL HELIUM OR OXYGEN FROM ANTI-RAM DIRECTIONS?

    SciTech Connect

    Galli, A.; Wurz, P.; Park, J.; Kucharek, H.; Möbius, E.; Schwadron, N. A.; Sokół, J. M.; Bzowski, M.; Kubiak, M. A.; Swaczyna, P.; Fuselier, S. A.; McComas, D. J.

    2015-10-15

    To better constrain the parameters of the interstellar neutral flow, we searched the Interstellar Boundary EXplorer (IBEX)-Lo database for helium and oxygen from the interstellar medium in the anti-ram direction in the three years (2009–2011) with the lowest background rates. We found that IBEX-Lo cannot observe interstellar helium from the anti-ram direction because the helium energy is too low for indirect detection by sputtering off the IBEX-Lo conversion surface. Our results show that this sputtering process has a low energy threshold between 25 and 30 eV, whereas the energy of the incident helium is only 10 eV for these observations. Interstellar oxygen, on the other hand, could in principle be detected in the anti-ram hemisphere, but the expected magnitude of the signal is close to the detection limit imposed by counting statistics and by the magnetospheric foreground.

  12. Acoustic Magnetic Resonance Investigations Utilizing Direct, Backward Wave, and SQUID Detection.

    NASA Astrophysics Data System (ADS)

    Mozurkewich, George, Jr.

    Acoustic magnetic resonance investigations were undertaken utilizing three distinct methods of detection. (1) In direct detection, increased ultrasonic attenuation due to resonant absorption is monitored directly. (2) In backward wave spectroscopy, resonant absorption introduces ultrasonic nonlinearities which generate a backward propagating wave. The amplitude of the resulting echo reflects the resonant susceptibility. (3) In SQUID detection, which is proposed here for the first time, changes in the magnetization of the spin system are detected using a superconducting quantum interference device. Using direct detection, nuclear acoustic resonance of ('183)W in metallic tungsten has been observed for the first time. Because ('183)W is isotopically dilute (14%) and has a small gyromagnetic ratio (179 Hz/G), the predicted dipolar linewidth is only 0.10 G. The observed, inhomogenously broadened lineshape (0.44 G peak to peak, with additional structure on the high field side) is attributed to spatial variation of the sample's demagnetizing field. Theoretical fits to the lineshape are calculated and discussed. The Knight shift is (1.0397 (+OR-) 0.0026)%. The neutral acceptor in indium doped silicon was examined using the recently developed technique of backward wave phonon spectroscopy. The high power results show multiple quantum transitions and a broad background feature which peaks near 2T and extends beyond 8T (spectrometer frequency = 6 GHz). It is shown that the background signal arises largely from transitions between Kramers doublets at sites with static strain of order 100 (mu)eV. In addition, a new interface phenomenon, the enhanced backward wave, is described. A new method of detection of acoustic magnetic resonance, using a SQUID magnetometer, is proposed. An attempt to realize such a detection system did not succeed. Reasons for the failure are analyzed, and design modifications are suggested. A SQUID detection system should be valuable for very weak

  13. Energy dependence of direct detection cross section for asymmetric mirror dark matter

    SciTech Connect

    An Haipeng; Chen Shaolong; Mohapatra, Rabindra N.; Nussinov, Shmuel; Zhang Yue

    2010-07-15

    In a recent paper, four of the present authors proposed a class of dark matter models where generalized parity symmetry leads to equality of dark matter abundance with baryon asymmetry of the Universe and predicts dark matter mass to be around 5 GeV. In this paper, we explore how this model can be tested in direct search experiments. In particular, we point out that if the dark matter happens to be the mirror neutron, the direct detection cross section has the unique feature that it increases at low recoil energy unlike the case of conventional weakly interacting massive particles. It is also interesting to note that the predicted spin-dependent scattering could make significant contribution to the total direct detection rate, especially for light nucleus. With this scenario, one could explain recent DAMA and CoGeNT results.

  14. Simultaneous multi-vehicle detection and tracking framework with pavement constraints based on machine learning and particle filter algorithm

    NASA Astrophysics Data System (ADS)

    Wang, Ke; Huang, Zhi; Zhong, Zhihua

    2014-11-01

    Due to the large variations of environment with ever-changing background and vehicles with different shapes, colors and appearances, to implement a real-time on-board vehicle recognition system with high adaptability, efficiency and robustness in complicated environments, remains challenging. This paper introduces a simultaneous detection and tracking framework for robust on-board vehicle recognition based on monocular vision technology. The framework utilizes a novel layered machine learning and particle filter to build a multi-vehicle detection and tracking system. In the vehicle detection stage, a layered machine learning method is presented, which combines coarse-search and fine-search to obtain the target using the AdaBoost-based training algorithm. The pavement segmentation method based on characteristic similarity is proposed to estimate the most likely pavement area. Efficiency and accuracy are enhanced by restricting vehicle detection within the downsized area of pavement. In vehicle tracking stage, a multi-objective tracking algorithm based on target state management and particle filter is proposed. The proposed system is evaluated by roadway video captured in a variety of traffics, illumination, and weather conditions. The evaluating results show that, under conditions of proper illumination and clear vehicle appearance, the proposed system achieves 91.2% detection rate and 2.6% false detection rate. Experiments compared to typical algorithms show that, the presented algorithm reduces the false detection rate nearly by half at the cost of decreasing 2.7%-8.6% detection rate. This paper proposes a multi-vehicle detection and tracking system, which is promising for implementation in an on-board vehicle recognition system with high precision, strong robustness and low computational cost.

  15. Electrical percolation-based biosensor for real-time direct detection of staphylococcal enterotoxin B (SEB).

    PubMed

    Yang, Minghui; Sun, Steven; Bruck, Hugh Alan; Kostov, Yordan; Rasooly, Avraham

    2010-08-15

    Electrical percolation-based biosensing is a new technology. This is the first report of an electrical percolation-based biosensor for real-time detection. The label-free biosensor is based on electrical percolation through a single-walled carbon nanotubes (SWNTs)-antibody complex that forms a network functioning as a "Biological Semiconductor" (BSC). The conductivity of a BSC is directly related to the number of contacts facilitated by the antibody-antigen "connectors" within the SWNT network. BSCs are fabricated by immobilizing a pre-functionalized SWNTs-antibody complex directly on a poly(methyl methacrylate) (PMMA) and polycarbonate (PC) surface. Each BSC is connected via silver electrodes to a computerized ohmmeter, thereby enabling a continuous electronic measurement of molecular interactions (e.g. antibody-antigen binding) via the change in resistance. Using anti-staphylococcal enterotoxin B (SEB) IgG to functionalize the BSC, we demonstrate that the biosensor was able to detect SEB at concentrations as low as 5 ng/mL at a signal to baseline (S/B) ratio of 2. Such measurements were performed on the chip in wet conditions. The actuation of the chip by SEB is immediate, permitting real-time signal measurements. In addition to this "direct" label-free detection mode, a secondary antibody can be used to "label" the target molecule bound to the BSC in a manner analogous to an immunological sandwich "indirect" detection-type assay. Although a secondary antibody is not needed for direct detection, the indirect mode of detection may be useful as an additional measurement to verify or amplify signals from direct detection in clinical, food safety and other critical assays. The BSC was used to measure SEB both in buffer and in milk, a complex matrix, demonstrating the potential of electrical percolation-based biosensors for real-time label-free multi-analyte detection in clinical and complex samples. Assembly of BSCs is simple enough that multiple sensors can be

  16. Effect of Detector Dead Time on the Performance of Optical Direct-Detection Communication Links

    NASA Technical Reports Server (NTRS)

    Chen, C.-C.

    1988-01-01

    Avalanche photodiodes (APDs) operating in the Geiger mode can provide a significantly improved single-photon detect ion sensitivity over conventional photodiodes. However, the quenching circuit required to remove the excess charge carriers after each photon event can introduce an undesirable dead time into the detection process. The effect of this detector dead time on the performance of a binary pulse-position-modulted (PPM) channel is studied by analyzing the error probability. It is shown that, when back- ground noise is negligible, the performance of the detector with dead time is similar to that o f a quantum-limited receiver. For systems with increasing background intensities, the error rate of the receiver starts to degrade rapidly with increasing dead time. The power penalty due to detector dead time is also evaluated and shown to depend critically on background intensity as well as dead time. Given the expected background strength in an optical channel, therefore, a constraint must be placed on the bandwidth of the receiver to limit the amount of power penalty due to detector dead time.

  17. Using a large area CMOS APS for direct chemiluminescence detection in Western blotting electrophoresis

    NASA Astrophysics Data System (ADS)

    Esposito, Michela; Newcombe, Jane; Anaxagoras, Thalis; Allinson, Nigel M.; Wells, Kevin

    2012-03-01

    Western blotting electrophoretic sequencing is an analytical technique widely used in Functional Proteomics to detect, recognize and quantify specific labelled proteins in biological samples. A commonly used label for western blotting is Enhanced ChemiLuminescence (ECL) reagents based on fluorescent light emission of Luminol at 425nm. Film emulsion is the conventional detection medium, but is characterized by non-linear response and limited dynamic range. Several western blotting digital imaging systems have being developed, mainly based on the use of cooled Charge Coupled Devices (CCDs) and single avalanche diodes that address these issues. Even so these systems present key drawbacks, such as a low frame rate and require operation at low temperature. Direct optical detection using Complementary Metal Oxide Semiconductor (CMOS) Active Pixel Sensors (APS)could represent a suitable digital alternative for this application. In this paper the authors demonstrate the viability of direct chemiluminescent light detection in western blotting electrophoresis using a CMOS APS at room temperature. Furthermore, in recent years, improvements in fabrication techniques have made available reliable processes for very large imagers, which can be now scaled up to wafer size, allowing direct contact imaging of full size western blotting samples. We propose using a novel wafer scale APS (12.8 cm×13.2 cm), with an array architecture using two different pixel geometries that can deliver an inherently low noise and high dynamic range image at the same time representing a dramatic improvement with respect to the current western blotting imaging systems.

  18. Direct Write Protein Patterns for Multiplexed Cytokine Detection From Live Cells Using Electron Beam Lithography

    PubMed Central

    Lau, Uland Y.; Saxer, Sina S.; Lee, Juneyoung; Bat, Erhan; Maynard, Heather D.

    2016-01-01

    Simultaneous detection of multiple biomarkers, such as extracellular signaling molecules, is a critical aspect in disease profiling and diagnostics. Precise positioning of antibodies on surfaces, especially at the micro- and nano- scale, is important for the improvement of assays, biosensors, and diagnostics on the molecular level, and therefore, the pursuit of device miniaturization for parallel, fast, low-volume assays is a continuing challenge. Here, we describe a multiplexed cytokine immunoassay utilizing electron beam lithography and a trehalose glycopolymer as a resist for the direct writing of antibodies on silicon substrates allowing for micro- and nano-scale precision of protein immobilization. Specifically, anti-interleukin 6 (IL-6) and anti-tumor necrosis factor alpha (TNFα) antibodies were directly patterned. Retention of the specific binding properties of the patterned antibodies was shown by the capture of secreted cytokines from stimulated RAW 264.7 macrophages. A sandwich immunoassay was employed using gold nanoparticles and enhancement with silver for the detection and visualization of bound cytokines to the patterns by localized surface plasmon resonance detected with dark field microscopy. Multiplexing with both IL-6 and TNFα on a single chip was also successfully demonstrated with high specificity and in relevant cell culture conditions and at different times after cell stimulation. The direct fabrication of capture antibody patterns for cytokine detection described here could be useful for biosensing applications. PMID:26679368

  19. Low cost direct modulation and coherent detection optical OFDM for metro applications

    NASA Astrophysics Data System (ADS)

    Sheffi, Nir; Sadot, Dan

    2011-01-01

    High speed transmission systems (> 10 Gb/s) for cost-sensitive applications such as metropolitan network have attracted extensive interest due to the explosive data traffic growth in such applications. Optical orthogonal frequency division multiplexing (OFDM) based on direct modulation and direct detection for single-mode fiber (SMF) and multi-mode fiber (MMF) without optical amplification and chromatic dispersion (CD) compensation was proposed. Recent research has also shown that optical OFDM can be used with electronic dispersion compensation using direct detection in SMF. However, laser frequency chirp has been identified as a key limiting factor of capacity-versus-reach performance. In this paper, we present a novel concept of low cost optical OFDM with direct modulation of distributed feedback (DFB) lasers and coherent detection at 51.4 Gb/s and 64 QAM. A comprehensive theoretical model of the proposed system is developed. The proposed optical OFDM system concept and performance is based upon using electronic precompensation of laser frequency response, and electronic post compensation of DFB laser frequency chirp and CD. A numerical simulation of the transmission performance of the aforementioned system is conducted using different fiber lengths (40 km, 60 km, 120 km) and chirp parameters, which shows its attractiveness for access and metro applications.

  20. First evidence of pep solar neutrinos by direct detection in Borexino.

    PubMed

    Bellini, G; Benziger, J; Bick, D; Bonetti, S; Bonfini, G; Bravo, D; Buizza Avanzini, M; Caccianiga, B; Cadonati, L; Calaprice, F; Carraro, C; Cavalcante, P; Chavarria, A; Chepurnov, A; D'Angelo, D; Davini, S; Derbin, A; Etenko, A; Fomenko, K; Franco, D; Galbiati, C; Gazzana, S; Ghiano, C; Giammarchi, M; Goeger-Neff, M; Goretti, A; Grandi, L; Guardincerri, E; Hardy, S; Ianni, Aldo; Ianni, Andrea; Korablev, D; Korga, G; Koshio, Y; Kryn, D; Laubenstein, M; Lewke, T; Litvinovich, E; Loer, B; Lombardi, F; Lombardi, P; Ludhova, L; Machulin, I; Manecki, S; Maneschg, W; Manuzio, G; Meindl, Q; Meroni, E; Miramonti, L; Misiaszek, M; Montanari, D; Mosteiro, P; Muratova, V; Oberauer, L; Obolensky, M; Ortica, F; Otis, K; Pallavicini, M; Papp, L; Perasso, L; Perasso, S; Pocar, A; Quirk, J; Raghavan, R S; Ranucci, G; Razeto, A; Re, A; Romani, A; Sabelnikov, A; Saldanha, R; Salvo, C; Schönert, S; Simgen, H; Skorokhvatov, M; Smirnov, O; Sotnikov, A; Sukhotin, S; Suvorov, Y; Tartaglia, R; Testera, G; Vignaud, D; Vogelaar, R B; von Feilitzsch, F; Winter, J; Wojcik, M; Wright, A; Wurm, M; Xu, J; Zaimidoroga, O; Zavatarelli, S; Zuzel, G

    2012-02-03

    We observed, for the first time, solar neutrinos in the 1.0-1.5 MeV energy range. We determined the rate of pep solar neutrino interactions in Borexino to be 3.1±0.6{stat}±0.3{syst}  counts/(day·100  ton). Assuming the pep neutrino flux predicted by the standard solar model, we obtained a constraint on the CNO solar neutrino interaction rate of <7.9  counts/(day·100  ton) (95% C.L.). The absence of the solar neutrino signal is disfavored at 99.97% C.L., while the absence of the pep signal is disfavored at 98% C.L. The necessary sensitivity was achieved by adopting data analysis techniques for the rejection of cosmogenic {11}C, the dominant background in the 1-2 MeV region. Assuming the Mikheyev-Smirnov-Wolfenstein large mixing angle solution to solar neutrino oscillations, these values correspond to solar neutrino fluxes of (1.6±0.3)×10{8}  cm{-2} s^{-1} and <7.7×10{8}  cm{-2} s{-1} (95% C.L.), respectively, in agreement with both the high and low metallicity standard solar models. These results represent the first direct evidence of the pep neutrino signal and the strongest constraint of the CNO solar neutrino flux to date.

  1. Monitoring the impact of litter in large vertebrates in the Mediterranean Sea within the European Marine Strategy Framework Directive (MSFD): constraints, specificities and recommendations.

    PubMed

    Galgani, F; Claro, F; Depledge, M; Fossi, C

    2014-09-01

    In its decision (2010/477/EU) relating to the European Marine Strategy Framework Directive (MSFD, 2008/56/EC), the European Commission identified the following points as focuses for monitoring: (i) 10.1.1: Trends in the amount, source and composition of litter washed ashore and/or deposited on coastlines, (ii) 10.1.2: Trends in the amount and composition of litter in the water column and accumulation on the sea floor, (iii) 10.1.3: Trends in the amount, distribution and composition of micro-particles (mainly microplastics), and (iv) 10.2.1: Trends in the amount and composition of litter ingested by marine animals. Monitoring the impacts of litter will be considered further in 2014. At that time, the strategy will be discussed in the context of the Mediterranean Sea, providing information on constraints, protocols, existing harm and research needed to support monitoring efforts. The definition of targets and acceptable levels of harm must take all factors into account, whether entanglement, ingestion, the transport and release of pollutants, the transport of alien species and socio-economic impacts. It must also reflect on the practical deployment of "ingestion" measures (10.2.1). The analysis of existing data will reveal the potential and suitability of some higher trophic level organisms (fish, turtles, birds and mammals) for monitoring the adverse effects of litter. Sea turtles appear to be useful indicator species, but the definition of an ecological quality objective is still needed, as well as research on alternative potential indicator species.

  2. Direct detection and drug-resistance profiling of bacteremias using inertial microfluidics.

    PubMed

    Hou, Han Wei; Bhattacharyya, Roby P; Hung, Deborah T; Han, Jongyoon

    2015-05-21

    Detection of bacteria in bloodstream infections and their antibiotic susceptibility patterns is critical to guide therapeutic decision-making for optimal patient care. Current culture-based assays are too slow (>48 h), leading to excessive up-front use of broad-spectrum antibiotics and/or incorrect antibiotic choices due to resistant bacteria, each with deleterious consequences for patient care and public health. To approach this problem, we describe a method to rapidly isolate bacteria from whole blood using inertial microfluidics and directly determine pathogen identity and antibiotic susceptibility with hybridization-based RNA detection. Using the principle of Dean flow fractionation, bacteria are separated from host blood cells in a label-free separation method with efficient recovery of even low abundance bacteria. Ribosomal RNA detection can then be applied for direct identification of low abundance pathogens (~100 per mL) from blood without culturing or enzymatic amplification. Messenger RNA detection of antibiotic-responsive transcripts after brief drug exposure permits rapid susceptibility determination from bacteria with minimal culturing (~10(5) per mL). This unique coupling of microfluidic cell separation with RNA-based molecular detection techniques represents significant progress towards faster diagnostics (~8 hours) to guide antibiotic therapy.

  3. Direct detection and drug-resistance profiling of bacteremias using inertial microfluidics

    PubMed Central

    Hou, Han Wei; Bhattacharyya, Roby P.; Hung, Deborah T.; Han, Jongyoon

    2015-01-01

    Detection of bacteria in bloodstream infections and their antibiotic susceptibility patterns is critical to guide therapeutic decision-making for optimal patient care. Current culture-based assays are too slow (>48 hrs), leading to excessive up-front use of broad-spectrum antibiotics and/or incorrect antibiotic choices due to resistant bacteria, each with deleterious consequences for patient care and public health. To approach this problem, we describe a method to rapidly isolate bacteria from whole blood using inertial microfluidics and directly determine pathogen identity and antibiotic susceptibility with hybridization-based RNA detection. Using the principle of Dean flow fractionation, bacteria are separated from host blood cells in a label-free separation method with efficient recovery of even low abundance bacteria. Ribosomal RNA detection can then be applied for direct identification of low abundance pathogens (~100/mL) from blood without culturing or enzymatic amplification. Messenger RNA detection of antibiotic-responsive transcripts after brief drug exposure permits rapid susceptibility determination from bacteria with minimal culturing (~105/mL). This unique coupling of microfluidic cell separation with RNA-based molecular detection techniques represents significant progress towards faster diagnostics (~8 hours) to guide antibiotic therapy. PMID:25882432

  4. Rapid, Portable, Multiplexed Detection of Bacterial Pathogens Directly from Clinical Sample Matrices

    PubMed Central

    Phaneuf, Christopher R.; Mangadu, Betty; Piccini, Matthew E.; Singh, Anup K.; Koh, Chung-Yan

    2016-01-01

    Enteric and diarrheal diseases are a major cause of childhood illness and death in countries with developing economies. Each year, more than half of a million children under the age of five die from these diseases. We have developed a portable, microfluidic platform capable of simultaneous, multiplexed detection of several of the bacterial pathogens that cause these diseases. This platform can perform fast, sensitive immunoassays directly from relevant, complex clinical matrices such as stool without extensive sample cleanup or preparation. Using only 1 µL of sample per assay, we demonstrate simultaneous multiplexed detection of four bacterial pathogens implicated in diarrheal and enteric diseases in less than 20 min. PMID:27669320

  5. Rapid, portable, multiplexed detection of bacterial pathogens directly from clinical sample matrices

    SciTech Connect

    Phaneuf, Christopher R.; Mangadu, Betty Lou Bosano; Piccini, Matthew E.; Singh, Anup K.; Koh, Chung -Yan

    2016-09-23

    Enteric and diarrheal diseases are a major cause of childhood illness and death in countries with developing economies. Each year, more than half of a million children under the age of five die from these diseases. We have developed a portable, microfluidic platform capable of simultaneous, multiplexed detection of several of the bacterial pathogens that cause these diseases. Furthermore, this platform can perform fast, sensitive immunoassays directly from relevant, complex clinical matrices such as stool without extensive sample cleanup or preparation. Using only 1 µL of sample per assay, we demonstrate simultaneous multiplexed detection of four bacterial pathogens implicated in diarrheal and enteric diseases in less than 20 min.

  6. Directional detection of Dark Matter with MIMAC: WIMP identification and track reconstruction

    NASA Astrophysics Data System (ADS)

    Billard, J.; Mayet, F.; Grignon, C.; Santos, D.

    2011-08-01

    Directional detection is a promising Dark Matter search strategy. Indeed, WIMP-induced recoils present a direction dependence toward the Cygnus constellation, while background-induced recoils exhibit an isotropic distribution in the galactic rest frame. Taking advantage on these characteristic features and even in the presence of a sizeable background, we show for the first time the possibility to constrain the WIMP properties, both from particle and galactic halo physics, leading to an identification of non-baryonic Dark Matter. However, such results need highly accurate track reconstruction which should be reachable by the MIMAC detector using a dedicated readout combined with a likelihood analysis of recoiling nuclei.

  7. Detection of Directions of Gravity by Organisms and Contributions to SmaggIce

    NASA Technical Reports Server (NTRS)

    Dill, Loren H.

    2003-01-01

    Research covers the following: In the Microgravity Environment and Telescience Branch, a study wasI extended thar focused upon a flagellated alga or other swimming microbe and the effect of gravity upon its swimming direction. It has long been known that many organisms tend to swim up or down on Earth. How organisms detect the direction of gravity is a question not fully resolved. The response of such organisms to reduced gravity or the absence of gravity is also of interest, particularly because the expected modified behavior may affect the health of astronauts.

  8. Pinning down inelastic dark matter in the Sun and in direct detection

    SciTech Connect

    Blennow, Mattias; Clementz, Stefan; Herrero-Garcia, Juan E-mail: scl@kth.se

    2016-04-01

    We study the solar capture rate of inelastic dark matter with endothermic and/or exothermic interactions. By assuming that an inelastic dark matter signal will be observed in next generation direct detection experiments we can set a lower bound on the capture rate that is independent of the local dark matter density, the velocity distribution, the galactic escape velocity as well as the scattering cross section. In combination with upper limits from neutrino observatories we can place upper bounds on the annihilation channels leading to neutrinos. We find that, while endothermic scattering limits are weak in the isospin-conserving case, strong bounds may be set for exothermic interactions, in particular in the spin-dependent case. Furthermore, we study the implications of observing two direct detection signals, in which case one can halo-independently obtain the dark matter mass and the mass splitting, and disentangle the endothermic/exothermic nature of the scattering. Finally we discuss isospin violation.

  9. Using Galaxy Simulations to Examine Dark Matter in the Solar Neighborhood with Implications for Direct Detection

    NASA Astrophysics Data System (ADS)

    Sloane, Jonathan D.

    2017-01-01

    Experiments aiming for the direct detection of dark matter have made great progress in recent years in exploring the WIMP mass - cross section parameter space. These experimental results are highly dependent on the assumed dark matter velocity distribution. I will show results comparing the conventional Maxwell-Boltzmann distribution to the dark matter velocity distribution in the Solar neighborhood from both dark matter-only simulations and simulations which include dark matter, gas, and stellar physics. It is well established that dark matter-only simulations do not support the Maxwell-Boltzmann assumption. I show that the inclusion of gas and stellar physics alters the dark matter velocity distribution in simulated Milky Way analogue galaxies. Further, I will examine the dependence of the dark matter velocity distribution on halo mass and resolution. The impact of observed differences between these distributions on selected direct detection results will be shown. I will also discuss the origins of the differences between the velocity distributions.

  10. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    NASA Technical Reports Server (NTRS)

    Generazio, Edward R.

    2008-01-01

    The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Directed design of experiments for probability of detection (DOEPOD) has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit- Miss or signal amplitude testing. Specifically, DOEPOD demands utilization of observance of occurrences. Directed DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required.

  11. Modeling the Performance of Direct-Detection Doppler Lidar Systems in Real Atmospheres

    NASA Technical Reports Server (NTRS)

    McGill, Matthew J.; Hart, William D.; McKay, Jack A.; Spinhirne, James D.

    1999-01-01

    Previous modeling of the performance of spaceborne direct-detection Doppler lidar systems has assumed extremely idealized atmospheric models. Here we develop a technique for modeling the performance of these systems in a more realistic atmosphere, based on actual airborne lidar observations. The resulting atmospheric model contains cloud and aerosol variability that is absent in other simulations of spaceborne Doppler lidar instruments. To produce a realistic simulation of daytime performance, we include solar radiance values that are based on actual measurements and are allowed to vary as the viewing scene changes. Simulations are performed for two types of direct-detection Doppler lidar systems: the double-edge and the multi-channel techniques. Both systems were optimized to measure winds from Rayleigh backscatter at 355 nm. Simulations show that the measurement uncertainty during daytime is degraded by only about 10-20% compared to nighttime performance, provided a proper solar filter is included in the instrument design.

  12. Direct detection of aptamer-thrombin binding via surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Pagba, Cynthia V.; Lane, Stephen M.; Cho, Hansang; Wachsmann-Hogiu, Sebastian

    2010-07-01

    In this study, we exploit the sensitivity offered by surface-enhanced Raman scattering (SERS) for the direct detection of thrombin using the thrombin-binding aptamer (TBA) as molecular receptor. The technique utilizes immobilized silver nanoparticles that are functionalized with thiolated thrombin-specific binding aptamer, a 15-mer (5'-GGTTGGTGTGGTTGG-3') quadruplex forming oligonucleotide. In addition to the Raman vibrational bands corresponding to the aptamer and blocking agent, new peaks (mainly at 1140, 1540, and 1635 cm-1) that are characteristic of the protein are observed upon binding of thrombin. These spectral changes are not observed when the aptamer-nanoparticle assembly is exposed to a nonbinding protein such as bovine serum albumin (BSA). This methodology could be further used for the development of label-free biosensors for direct detection of proteins and other molecules of interest for which aptamers are available.

  13. Direct detection of saponins in crude extracts of soapnuts by FTIR.

    PubMed

    Almutairi, Meshari Saad; Ali, Muhammad

    2015-01-01

    Direct detection of saponins in soapnuts (Sapindus mukorossi) using Fourier transform infrared (FTIR) spectroscopy is investigated in this project. Potassium bromide powder was mixed with extracted powder of soapnuts and compressed to a thin pellet for examination process. The outcome of the FTIR spectra of saponin demonstrated characteristic triterpenoid saponin absorptions of OH, C = O, C-H, and C = C, while the glycoside linkages to the sapogenins were indicated by the absorptions of C-O. The significance of this study is that saponin absorption peaks are directly detectable in crude aqueous and 95% ethanol extracts of soapnuts powder using FTIR spectroscopy, thereby eliminating the need of further expensive and exhaustive purification steps. The extracts of soapnuts were screened for saponins along with controls by phytochemical tests, and advanced spectroscopic techniques such as ultra fast liquid chromatography and ultra performance liquid chromatography quadrupole-time of flight-mass spectrometry were also implemented to validate the saponins.

  14. Reduced electrical bandwidth receivers for direct detection 4-ary PPM optical communication intersatellite links

    NASA Technical Reports Server (NTRS)

    Davidson, Frederic M.; Sun, Xiaoli

    1993-01-01

    One of the major sources of noise in a direct detection optical communication receiver is the shot noise due to the quantum nature of the photodetector. The shot noise is signal dependent and is neither Gaussian nor wide sense stationary. When a photomultiplier tube (PMT) or an avalanche photodiode (APD) is used, there is also a multiplicative excess noise due to the randomness of the internal photodetector gain. Generally speaking, the radio frequency (RF) communication theory cannot be applied to direct detection optical communication systems because noise in RF communication systems is usually additive and Gaussian. A receiver structure which is mathematically optimal for signal dependent shot noise is derived. Several suboptimal receiver structures are discussed and compared with the optimal receiver. The objective is to find a receiver structure which is easy to implement and gives close to optimal performance.

  15. Direct detection of the Yarkovsky effect by radar ranging to ateroid 6489 Golevka

    NASA Technical Reports Server (NTRS)

    Chesley, S. R.; Ostro, S. J.; Vokrouhlicky, D.; Capek, D.; Giorgini, J. D.; Nolan, M. C.; Margot, J. L.; Hine, A. A.; Benner, L. A. M.; Chamberlin, A. B.

    2003-01-01

    Radar ranging from Arecibo, Puerto Rico, to the 0.5-kilometer near-Earth asteroid 6489 Golevka unambiguously reveals a small nongravitational acceleration caused by the anisotropic thermal emission of absorbed sunlight. The magnitude of this perturbation, known as the Yarkovsky effect, is a function of the asteroid's mass and surface thermal characteristics. Direct detection of the Yarkovsky effect on asteroids will help constrain their physical properties, such as bulk density, and refine their orbital paths.

  16. Simplified polarization demultiplexing based on Stokes vector analysis for intensity-modulation direct-detection systems

    NASA Astrophysics Data System (ADS)

    Zhou, Xinyu; Yan, Lianshan; Chen, Zhiyu; Yi, Anlin; Pan, Yan; Jiang, Lin; Pan, Wei; Luo, Bin

    2016-10-01

    A simple and effective polarization demultiplexing method is proposed based on the improved Stokes vector analysis and digital signal processor algorithm for the intensity-modulation direct-detection optical communication systems. Such a scheme could significantly simplify optical receivers with low system cost. The experimental results demonstrate the feasibility of our proposed method and show that only 1- and 1.7-dB power penalties are measured for 10- and 25-km transmissions compared to back-to-back case.

  17. Neutron beam test of barium fluoride crystal for dark matter direct detection

    NASA Astrophysics Data System (ADS)

    Guo, C.; Ma, X. H.; Wang, Z. M.; Bao, J.; Dai, C. J.; Guan, M. Y.; Liu, J. C.; Li, Z. H.; Ren, J.; Ruan, X. C.; Yang, C. G.; Yu, Z. Y.; Zhong, W. L.

    2016-10-01

    In order to test the capabilities of Barium Fluoride (BaF2) crystal for dark matter direct detection, nuclear recoils are studied with mono-energetic neutron beam. The energy spectra of nuclear recoils, quenching factors for elastic scattering neutrons and discrimination capability between neutron inelastic scattering events and γ events are obtained for various recoil energies of the F content in BaF2.

  18. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  19. Engineering nanostructured porous SiO2 surfaces for bacteria detection via "direct cell capture".

    PubMed

    Massad-Ivanir, Naama; Shtenberg, Giorgi; Tzur, Adi; Krepker, Maksym A; Segal, Ester

    2011-05-01

    An optical label-free biosensing platform for bacteria detection ( Escherichia coli K12 as a model system) based on nanostructured oxidized porous silicon (PSiO(2)) is introduced. The biosensor is designed to directly capture the target bacteria cells on its surface with no prior sample processing (such as cell lysis). The optical reflectivity spectrum of the PSiO(2) nanostructure displays Fabry-Pérot fringes characteristic of thin-film interference, enabling direct, real-time observation of bacteria attachment within minutes. The PSiO(2) optical nanostructure is synthesized and used as the optical transducer element. The porous surface is conjugated with specific monoclonal antibodies (immunoglobulin G's) to provide the active component of the biosensor. The immobilization of the antibodies onto the biosensor system is confirmed by attenuated total reflectance Fourier transform infrared spectroscopy, fluorescent labeling experiments, and refractive interferometric Fourier transform spectroscopy. We show that the immobilized antibodies maintain their immunoactivity and specificity when attached to the sensor surface. Exposure of these nanostructures to the target bacteria results in "direct cell capture" onto the biosensor surface. These specific binding events induce predictable changes in the thin-film optical interference spectrum of the biosensor. Our preliminary studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations. The current detection limit of E. coli K12 bacteria is 10(4) cells/mL within several minutes.

  20. An intensity modulation and coherent balanced detection intersatellite microwave photonic link using polarization direction control

    NASA Astrophysics Data System (ADS)

    Li, Xuan; Zhu, Zihang; Zhao, Shanghong; Li, Yongjun; Han, Lei; Zhao, Jing

    2014-03-01

    A simple approach for high loss intersatellite microwave photonic link with intensity modulation and coherent balanced detection is proposed. In the transmitter, the double sideband-suppressed carrier (DSB-SC) modulated optical signal and optical carrier (OC) are combined by employing a polarization combiner to chose and control the signals polarization directions, while in the receiver, they are selected respectively by using a polarization splitter for they have orthogonal polarization directions. The separated DSB-SC signal and OC put into balanced detectors and the coherent detection is realized without a local oscillator (LO). At the output, the fundamental signal is augmented and the third-order distortion is suppressed for the DSB-SC modulation, the second-order distortion is removed for the balanced detection and the noise is reduced for the polarization direction control. The signal to noise and distortion ratio (SNDR) can be optimized by adjusting the power of OC and modulation index. The simulation results show that, a SNDR higher than 30 dB can be obtained for the proposed method, which is in agreement with the theoretical analysis.

  1. You can hide but you have to run: direct detection with vector mediators

    NASA Astrophysics Data System (ADS)

    D'Eramo, Francesco; Kavanagh, Bradley J.; Panci, Paolo

    2016-08-01

    We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some cases the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.

  2. Development of a 2-micron Pulsed Direct Detection IPDA Lidar for CO2 Measurement

    NASA Astrophysics Data System (ADS)

    Yu, J.; Petros, M.; Singh, U. N.

    2013-12-01

    NASA Langley is developing a 2-micron pulsed Integrated Path Differential Absorption (IPDA) lidar for atmospheric CO2 measurements. The high pulse energy, direct detection lidar operating at CO2 2-micron absorption band provides an alternate approach to measure CO2 concentrations with significant advantages. The objective of this development is to integrate an existing high energy double-pulsed 2-micron laser transmitter with a direct detection receiver and telescope to enable a first proof of principle demonstration of airborne direct detection CO2 measurements at 2-micron wavelength. It is expected to provide high-precision measurement capability by unambiguously eliminating contamination from aerosols and clouds that can bias the IPDA measurement. The system is scheduled to fly on NASA UC12 or B200 research aircrafts before the end of 2013. This paper will describe the design of the airborne 2-micron pulsed IPDA lidar system; the lidar operation parameters; the wavelength pair selection; laser transmitter energy, pulse rate, beam divergence, double pulse generation and accurate frequency control; detector characterization; telescope design; lidar structure design; and lidar signal to noise ratio estimation.

  3. How to detect the Granger-causal flow direction in the presence of additive noise?

    PubMed

    Vinck, Martin; Huurdeman, Lisanne; Bosman, Conrado A; Fries, Pascal; Battaglia, Francesco P; Pennartz, Cyriel M A; Tiesinga, Paul H

    2015-03-01

    Granger-causality metrics have become increasingly popular tools to identify directed interactions between brain areas. However, it is known that additive noise can strongly affect Granger-causality metrics, which can lead to spurious conclusions about neuronal interactions. To solve this problem, previous studies have proposed the detection of Granger-causal directionality, i.e. the dominant Granger-causal flow, using either the slope of the coherency (Phase Slope Index; PSI), or by comparing Granger-causality values between original and time-reversed signals (reversed Granger testing). We show that for ensembles of vector autoregressive (VAR) models encompassing bidirectionally coupled sources, these alternative methods do not correctly measure Granger-causal directionality for a substantial fraction of VAR models, even in the absence of noise. We then demonstrate that uncorrelated noise has fundamentally different effects on directed connectivity metrics than linearly mixed noise, where the latter may result as a consequence of electric volume conduction. Uncorrelated noise only weakly affects the detection of Granger-causal directionality, whereas linearly mixed noise causes a large fraction of false positives for standard Granger-causality metrics and PSI, but not for reversed Granger testing. We further show that we can reliably identify cases where linearly mixed noise causes a large fraction of false positives by examining the magnitude of the instantaneous influence coefficient in a structural VAR model. By rejecting cases with strong instantaneous influence, we obtain an improved detection of Granger-causal flow between neuronal sources in the presence of additive noise. These techniques are applicable to real data, which we demonstrate using actual area V1 and area V4 LFP data, recorded from the awake monkey performing a visual attention task.

  4. Electrical detection of magnetic domain walls by inverse and direct spin Hall effect

    NASA Astrophysics Data System (ADS)

    Pham, V. T.; Zahnd, G.; Marty, A.; Savero Torres, W.; Jamet, M.; Noël, P.; Vila, L.; Attané, J. P.

    2016-11-01

    Domain wall (DW) detection is a prerequisite to perform current-induced DW motion. In this letter, we demonstrate a detection method, based on the ability for a ferromagnetic nanowire, in which a DW is pinned, to inject or detect a pure spin current. The device consists of such a ferromagnetic nanowire in contact with an orthogonal spin Hall effect (SHE) nanowire. When a current flows along the ferromagnetic nanowire, and provided a DW is pinned, the pure spin current is transformed into a transverse voltage by inverse spin Hall effect (ISHE). In the reciprocal configuration, the pure spin current created by the direct SHE, generates a transverse voltage along the ferromagnetic wire. Finite element method (FEM) simulations allow estimating the Pt spin Hall angle (SHA) (7.5 ± 0.5%). This technique provides an electrical way to study the DW motion, a device akin to the ferromagnetic/spin Hall effect bilayers typically used for spin-orbit torques experiments.

  5. Direct molecule-specific glucose detection by Raman spectroscopy based on photonic crystal fiber.

    PubMed

    Yang, Xuan; Zhang, Alissa Y; Wheeler, Damon A; Bond, Tiziana C; Gu, Claire; Li, Yat

    2012-01-01

    This paper reports the first step toward the development of a glucose biosensor based on Raman spectroscopy and a photonic crystal fiber (PCF) probe. Historically, it has been very challenging to detect glucose directly by Raman spectroscopy due to its inherently small Raman scattering cross-section. In this work, we report the first quantitative glucose Raman detection in the physiological concentration range (0-25 mM) with a low laser power (2 mW), a short integration time (30 s), and an extremely small sampling volume (~50 nL) using the highly sensitive liquid-filled PCF probe. As a proof of concept, we also demonstrate the molecular specificity of this technique in the presence of a competing sugar, such as fructose. High sensitivity, flexibility, reproducibility, low cost, small sampling volume, and in situ remote sensing capability make PCF a very powerful platform for potential glucose detection based on Raman spectroscopy.

  6. Alamouti-Type Space-Time Coding for Free-Space Optical Communication with Direct Detection

    NASA Astrophysics Data System (ADS)

    Simon, M. K.; Vilnrotter, V.

    2003-11-01

    In optical communication systems employing direct detection at the receiver, intensity modulations such as on-off keying (OOK) or pulse-position modulation (PPM) are commonly used to convey the information. Consider the possibility of applying space-time coding in such a scenario, using, for example, an Alamouti-type coding scheme [1]. Implicit in the Alamouti code is the fact that the modulation that defines the signal set is such that it is meaningful to transmit and detect both the signal and its negative. While modulations such as phase-shift keying (PSK) and quadrature amplitude modulation (QAM) naturally fall into this class, OOK and PPM do not since the signal polarity (phase) would not be detected at the receiver. We investigate a modification of the Alamouti code to be used with such modulations that has the same desirable properties as the conventional Alamouti code but does not rely on the necessity of transmitting the negative of a signal.

  7. Sensitive and Direct Detection of Circulating Tumor Cells by Multimarker µ-Nuclear Magnetic Resonance12

    PubMed Central

    Ghazani, Arezou A; Castro, Cesar M; Gorbatov, Rostic; Lee, Hakho; Weissleder, Ralph

    2012-01-01

    Identifying circulating tumor cells (CTCs) with greater sensitivity could facilitate early detection of cancer and rapid assessment of treatment response. Most current technologies use EpCAM expression as a CTC identifier. However, given that a significant fraction of cancer patients have low or even absent EpCAM levels, there is a need for better detection methods. Here, we hypothesize that a multimarker strategy combined with direct sensing of CTC in whole blood would increase the detection of CTC in patients. Accordingly, molecular profiling of biopsies from a patient cohort revealed a four-marker set (EpCAM, HER-2, EGFR, and MUC-1) capable of effectively differentiating cancer cells from normal host cells. Using a point-of-care micro-nuclear magnetic resonance (µNMR) system, we consequently show that this multimarker combination readily detects individual CTC directly in whole blood without the need for primary purification. We also confirm these results in a comparative trial of patients with ovarian cancer. This platform could potentially benefit a broad range of applications in clinical oncology. PMID:22745585

  8. Hybrid Magnetic-DNA Directed Immobilisation Approach for Efficient Protein Capture and Detection on Microfluidic Platforms.

    PubMed

    Esmaeili, Elaheh; Ghiass, Mohammad Adel; Vossoughi, Manouchehr; Soleimani, Masoud

    2017-03-15

    In this study, a hybrid magnetic-DNA directed immobilisation approach is presented to enhance protein capture and detection on a microfluidic platform. DNA-modified magnetic nanoparticles are added in a solution to capture fluorescently labelled immunocomplexes to be detected optically. A magnetic set-up composed of cubic permanent magnets and a microchannel was designed and implemented based on finite element analysis results to efficiently concentrate the nanoparticles only over a defined area of the microchannel as the sensing zone. This in turn, led to the fluorescence emission localisation and the searching area reduction. Also, compared to processes in which the immunocomplex is formed directly on the surface, the proposed approach provides a lower steric hindrance, higher mass transfer, lower equilibrium time, and more surface concentration of the captured targets leading to a faster and more sensitive detection. As a proof-of-concept, the set-up is capable of detecting prostate-specific membrane antigen with concentrations down to 0.7 nM. Our findings suggest that the approach holds a great promise for applications in clinical assays and disease diagnosis.

  9. Investigation of photochemical reaction products of glucose formed during direct UV detection in CE.

    PubMed

    Schmid, Thomas; Himmelsbach, Markus; Buchberger, Wolfgang W

    2016-04-01

    In CE, saccharides are accessible to direct UV detection due to a photochemical reaction in the detection window of the separation capillary resulting in the formation of UV absorbing substances. Employing a CE method that allows long in-capillary irradiation with subsequent UV and MS detection, the present study could identify several reaction products of glucose. Among these were UV absorbing substances so far unknown to be formed during direct UV detection with the chemical formulas C4 H6 O2 , C5 H6 O4 , C5 H8 O3, and C6 H8 O5 . Investigations of the impact of the irradiation time revealed differences between these reaction products suggesting differing reaction mechanisms especially for the smallest products. More detailed information could be obtained by experiments with isotope-labeled substrates performed to determine the parts of glucose that are converted to the particular reaction products. In addition, structural formulas for the reaction products were suggested based on HPLC-MS/MS measurements of off-line irradiated glucose solutions which revealed the existence of functional groups such as carboxylic acid or aldehyde groups.

  10. Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

    PubMed Central

    Abrahão, Jônatas S; Lima, Larissa S; Assis, Felipe L; Alves, Pedro A; Silva-Fernandes, André T; Cota, Marcela MG; Ferreira, Vanessa M; Campos, Rafael K; Mazur, Carlos; Lobato, Zélia IP; Trindade, Giliane S; Kroon, Erna G

    2009-01-01

    Background Orthopoxvirus (OPV) and Parapoxvirus (PPV) have been associated with worldwide exanthematic outbreaks. Some species of these genera are able to infect humans and domestic animals, causing serious economic losses and public health impact. Rapid, useful and highly specific methods are required to detect and epidemiologically monitor such poxviruses. In the present paper, we describe the development of a nested-multiplex PCR method for the simultaneous detection of OPV and PPV species directly from exanthematic lesions, with no previous viral isolation or DNA extraction. Methods and Results The OPV/PPV nested-multiplex PCR was developed based on the evaluation and combination of published primer sets, and was applied to the detection of the target pathogens. The method showed high sensitivity, and the specificity was confirmed by amplicon sequencing. Exanthematic lesion samples collected during bovine vaccinia or contagious ecthyma outbreaks were submitted to OPV/PPV nested-multiplex PCR and confirmed its applicability. Conclusion These results suggest that the presented multiplex PCR provides a highly robust and sensitive method to detect OPV and PPV directly from clinical samples. The method can be used for viral identification and monitoring, especially in areas where OPV and PPV co-circulate. PMID:19747382

  11. Readout strategies for directional dark matter detection beyond the neutrino background

    NASA Astrophysics Data System (ADS)

    O'Hare, Ciaran A. J.; Green, Anne M.; Billard, Julien; Figueroa-Feliciano, Enectali; Strigari, Louis E.

    2015-09-01

    The search for weakly interacting massive particles (WIMPs) by direct detection faces an encroaching background due to coherent neutrino-nucleus scattering. As the sensitivity of these experiments improves, the question of how to best distinguish a dark matter signal from neutrinos will become increasingly important. A proposed method of overcoming this so-called "neutrino floor" is to utilize the directional signature that both neutrino- and dark-matter-induced recoils possess. We show that directional experiments can indeed probe WIMP-nucleon cross sections below the neutrino floor with little loss in sensitivity due to the neutrino background. In particular we find at low WIMP masses (around 6 GeV) the discovery limits for directional detectors penetrate below the nondirectional limit by several orders of magnitude. For high WIMP masses (around 100 GeV), the nondirectional limit is overcome by a factor of a few. Furthermore we show that even for directional detectors which can only measure one- or two-dimensional projections of the three-dimensional recoil track, the discovery potential is only reduced by a factor of 3 at most. We also demonstrate that while the experimental limitations of directional detectors, such as sense recognition and finite angular resolution, have a detrimental effect on the discovery limits, it is still possible to overcome the ultimate neutrino background faced by nondirectional detectors.

  12. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    PubMed

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  13. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR

    PubMed Central

    Araújo, Cristina P.; Osório, Ana Luiza A.R.; Jorge, Klaudia S.G.; Ramos, Carlos A.N.; Souza Filho, Antonio F.; Vidal, Carlos E.S.; Vargas, Agueda P.C.; Roxo, Eliana; Rocha, Adalgiza S.; Suffys, Philip N.; Fonseca, Antônio A.; Silva, Marcio R.; Barbosa Neto, José D.; Cerqueira, Valíria D.; Araújo, Flábio R.

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis. PMID:25242951

  14. Detection of Bi-Directionality in Strain-Gage Balance Calibration Data

    NASA Technical Reports Server (NTRS)

    Ulbrich, Norbert

    2012-01-01

    An indicator variable was developed for both visualization and detection of bi-directionality in wind tunnel strain-gage balance calibration data. First, the calculation of the indicator variable is explained in detail. Then, a criterion is discussed that may be used to decide which gage outputs of a balance have bi- directional behavior. The result of this analysis could be used, for example, to justify the selection of certain absolute value or other even function terms in the regression model of gage outputs whenever the Iterative Method is chosen for the balance calibration data analysis. Calibration data of NASA s MK40 Task balance is analyzed to illustrate both the calculation of the indicator variable and the application of the proposed criterion. Finally, bi directionality characteristics of typical multi piece, hybrid, single piece, and semispan balances are determined and discussed.

  15. Detection of the insulating gap and conductive filament growth direction in resistive memories.

    PubMed

    Yalon, E; Karpov, I; Karpov, V; Riess, I; Kalaev, D; Ritter, D

    2015-10-07

    Filament growth is a key aspect in the operation of bipolar resistive random access memory (RRAM) devices, yet there are conflicting reports in the literature on the direction of growth of conductive filaments in valence change RRAM devices. We report here that an insulating gap between the filament and the semiconductor electrode can be detected by the metal-insulator-semiconductor bipolar transistor structure, and thus provide information on the filament growth direction. Using this technique, we show how voltage polarity and electrode chemistry control the filament growth direction during electro-forming. The experimental results and the nature of a gap between the filament and an electrode are discussed in light of possible models of filament formation.

  16. A telephoto camera system with shooting direction control by gaze detection

    NASA Astrophysics Data System (ADS)

    Teraya, Daiki; Hachisu, Takumi; Yendo, Tomohiro

    2015-05-01

    For safe driving, it is important for driver to check traffic conditions such as traffic lights, or traffic signs as early as soon. If on-vehicle camera takes image of important objects to understand traffic conditions from long distance and shows these to driver, driver can understand traffic conditions earlier. To take image of long distance objects clearly, the focal length of camera must be long. When the focal length is long, on-vehicle camera doesn't have enough field of view to check traffic conditions. Therefore, in order to get necessary images from long distance, camera must have long-focal length and controllability of shooting direction. In previous study, driver indicates shooting direction on displayed image taken by a wide-angle camera, a direction controllable camera takes telescopic image, and displays these to driver. However, driver uses a touch panel to indicate the shooting direction in previous study. It is cause of disturb driving. So, we propose a telephoto camera system for driving support whose shooting direction is controlled by driver's gaze to avoid disturbing drive. This proposed system is composed of a gaze detector and an active telephoto camera whose shooting direction is controlled. We adopt non-wear detecting method to avoid hindrance to drive. The gaze detector measures driver's gaze by image processing. The shooting direction of the active telephoto camera is controlled by galvanometer scanners and the direction can be switched within a few milliseconds. We confirmed that the proposed system takes images of gazing straight ahead of subject by experiments.

  17. High dynamic range detection of Chlamydia trachomatis growth by direct quantitative PCR of the infected cells.

    PubMed

    Eszik, Ildikó; Lantos, Ildikó; Önder, Kamil; Somogyvári, Ferenc; Burián, Katalin; Endrész, Valéria; Virok, Dezső P

    2016-01-01

    Chlamydiae are obligate intracellular bacteria developing in an intracytoplasmic niche, the inclusion. Chlamydia growth measurement by inclusion counting is a key task in the development of novel antichlamydial antibiotics and in vaccine studies. Most of the current counting methods rely on the immunofluorescent staining of the inclusions and either manual or automatic microscopy detection and enumeration. The manual method is highly labor intensive, while the automatic methods are either medium-throughput or require automatic microscopy. The sensitive and specific PCR technology could be an effective method for growth related chlamydial DNA detection; however the currently described PCR approaches have a major limitation, the requirement of purification of DNA or RNA from the infected cells. This limitation makes this approach unfeasible for high-throughput screenings. To overcome this, we developed a quantitative PCR (qPCR) method for the detection of Chlamydia trachomatis DNA directly from the infected HeLa cells. With our method we were able to detect the bacterial growth in a 4 log scale (multiplicity of infection (MOI): 64 to 0.0039), with high correlation between the biological and technical replicates. As a further proof of the method, we applied the direct qPCR for antibiotic minimum inhibitory concentration (MIC) measurements. The measured MICs of moxifloxacin, tetracycline, clarithromycin and compound PCC00213 were 0.031 μg/ml, 0.031 μg/ml, 0.0039 μg/ml and 6.2 μg/ml respectively, identical or close to the already published MIC values. Our direct qPCR method for chlamydial growth and antibiotic MIC determination is less time-consuming, more objective and more sensitive than the currently applied manual or automatic fluorescent microscopy- based methods.

  18. Paper-based fluorescence resonance energy transfer assay for directly detecting nucleic acids and proteins.

    PubMed

    Li, Hua; Fang, Xueen; Cao, Hongmei; Kong, Jilie

    2016-06-15

    Paper-based fluorescence resonance energy transfer assay (FRET) is gaining great interest in detecting macro-biological molecule. It is difficult to achieve conveniently and fast detection for macro-biological molecule. Herein, a graphene oxide (GO)-based paper chip (glass fiber) integrated with fluorescence labeled single-stranded DNA (ssDNA) for fast, inexpensive and direct detection of biological macromolecules (proteins and nucleic acids) has been developed. In this paper, we employed the Cy3/FAM-labeled ssDNA as the reporter and the GO as quencher and the original glass fiber paper as data acquisition substrates. The chip which was designed and fabricated by a cutting machine is a miniature biosensor that monitors fluorescence recovery from resonance energy transfer. The hybridization assays and fluorescence detection were all simplified, and the surface of the chip did not require immobilization or washing. A Nikon Eclipse was employed as excited resource and a commercial digital camera was employed for capturing digital images. This paper-based microfluidics chip has been applied in the detection of proteins and nucleic acids. The biosensing capability meets many potential requirements for disease diagnosis and biological analysis.

  19. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  20. Ultrasensitive Plasmonic Biosensors for Direct Detection of Biomarker Proteins with The Naked Eye

    NASA Astrophysics Data System (ADS)

    Yanik, Ahmet Ali; Connor, John; Shvets, Gennady; Altug, Hatice

    2012-02-01

    We introduce an ultrasensitive label free biodetection technique based on asymmetric plasmonic Fano resonances. Our sensors bring a number of advantages: (i) ultrasensitive detection limits surpassing gold standard Kretschmann configuration plasmon sensors, (ii) detection of biomarker molecules with ``the naked eye'', (iii) massive multiplexing capabilities. By exploiting extraordinary light transmission phenomena through high quality factor sub-radiant dark modes, we experimentally demonstrate record high figures of merits for intrinsic detection limits surpassing the gold standard BiaCore devices. Our experiments show an order of magnitude improved device performances over the state of art metamaterial and other plasmonic biosensors. Steep dispersion of the plasmonic Fano resonance profiles in engineered plasmonic sensors exhibit dramatic light intensity changes to the slightest perturbations within their local environment. As a spectacular demonstration, we show direct detection of a single monolayer of biomolecules with naked eye using these Fano resonances and the associated Wood's anomalies. The demonstrated sensing platform offers point-of-care diagnostics in resource poor settings by eliminating the need for fluorescent labeling and optical detection instrumentation (such camera, spectrometer, etc.).

  1. Direct and long-term detection of gene doping in conventional blood samples.

    PubMed

    Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

    2011-03-01

    The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

  2. Poker Face of Inelastic Dark Matter: Prospects at Upcoming Direct Detection Experiments

    SciTech Connect

    Alves, Daniele S.M.; Lisanti, Mariangela; Wacker, Jay G.; /SLAC

    2011-08-12

    The XENON100 and CRESST experiments will directly test the inelastic dark matter explanation for DAMA's 8.9{sigma} anomaly. This article discusses how predictions for direct detection experiments depend on uncertainties in quenching factor measurements, the dark matter interaction with the Standard Model and the halo velocity distribution. When these uncertainties are accounted for, an order of magnitude variation is found in the number of expected events at CRESST and XENON100. The process of testing the DAMA anomaly highlights many of the challenges inherent to direct detection experiments. In addition to determining the properties of the unknown dark matter particle, direct detection experiments must also consider the unknown flux of the incident dark matter, as well as uncertainties in converting a signal from one target nucleus to another. The predictions for both the CRESST 2009 run and XENON100 2010 run show an order of magnitude uncertainty. The nuclear form factor for {sup 184}W, when combined with additional theoretical and experimental uncertainties, will likely prevent CRESST from refuting the iDM hypothesis with an exposure of {Omicron}(100 kg-d) in a model-independent manner. XENON100, on the other hand, will be able to make a definitive statement about a spin-independent, inelastically scattering dark matter candidate. Still, the CRESST 2009 data can potentially confirm iDM for a large range of parameter space. In case of a positive signal, the combined data from CRESST and XENON100 will start probing the properties of the Milky Way DM profile and the interaction of the SM with the dark matter.

  3. Did IBEX detect interstellar neutral helium or oxygen from anti-ram direction?

    NASA Astrophysics Data System (ADS)

    Galli, André; Wurz, Peter; Park, Jeewoo; Kucharek, Harald; Möbius, Eberhard; Schwadron, Nathan A.; Bzowski, Maciej; Sokól, Justyna M.; Kubiak, Marzena A.; Swaczyna, Pawel; Fuselier, Stephen A.; McComas, Dave J.

    2015-04-01

    The Interstellar Boundary EXplorer (IBEX) directly measures the inflow of interstellar neutral (ISN) matter into the heliosphere. Inverting the signal strength and location of the neutral species (mainly helium, hydrogen, and oxygen) measured from Earth orbit allows to determine the flow velocity, direction, and temperature of the interstellar matter. So far, only observations from ram-directions when IBEX was moving toward the inflow direction (February and March of each year) showed a clear interstellar signal. Inverting these observations represents a partially degenerate problem; a unique solution for flow velocity, direction, and temperature cannot be found, and the uncertainty of the various fit parameters depends on each other. The detection of the anti-ram signal in October and November, when IBEX is moving away from the interstellar signal, would narrow the range of possible parameters of the interstellar neutral flow. This study presents a rigorous search for the fall signal during the first three years of IBEX data. The absence of an unambiguous fall signal translates into an upper observational limit with implications on the interstellar flow.

  4. Adaptive optics for direct detection of extrasolar planets: the Gemini Planet Imager

    NASA Astrophysics Data System (ADS)

    Macintosh, Bruce; Graham, James; Palmer, David; Doyon, Rene; Gavel, Don; Larkin, James; Oppenheimer, Ben; Saddlemyer, Leslie; Wallace, J. Kent; Bauman, Brian; Erikson, Darren; Poyneer, Lisa; Sivaramakrishnan, Anand; Soummer, Rémi; Veran, Jean-Pierre

    2007-04-01

    The direct detection of photons emitted or reflected by extrasolar planets, spatially resolved from their parent star, is a major frontier in the study of other solar systems. Direct detection will provide statistical information on planets in 5 50 AU orbits, inaccessible to current Doppler searches, and allow spectral characterization of radius, temperature, surface gravity, and perhaps composition. Achieving this will require new, dedicated, high-contrast instruments. One such system under construction is the Gemini Planet Imager (GPI). This combines a high-order/high-speed adaptive optics system to control wavefront errors from the Earth's atmosphere, an advanced coronagraph to block diffraction, ultrasmooth optics, a precision infrared interferometer to measure and correct systematic errors, and a integral field spectrograph/polarimeter to image and characterize target planetary systems. We predict that GPI will be able to detect planets with brightness less than 10-7 of their parent star, sufficient to observe warm self-luminous planets around a large population of targets. To cite this article: B. Macintosh et al., C. R. Physique 8 (2007).

  5. Signatures of Earth-scattering in the direct detection of Dark Matter

    NASA Astrophysics Data System (ADS)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation of this `Earth-scattering' effect in the regime where DM particles scatter at most once before reaching the detector. We perform the calculation self-consistently, taking into account not only those particles which are scattered away from the detector, but also those particles which are deflected towards the detector. Taking into account a realistic model of the Earth and allowing for a range of DM-nucleon interactions, we present the EARTHSHADOW code, which we make publicly available, for calculating the DM velocity distribution after Earth-scattering. Focusing on low-mass DM, we find that Earth-scattering reduces the direct detection rate at certain detector locations while increasing the rate in others. The Earth's rotation induces a daily modulation in the rate, which we find to be highly sensitive to the detector latitude and to the form of the DM-nucleon interaction. These distinctive signatures would allow us to unambiguously detect DM and perhaps even identify its interactions in regions of the parameter space within the reach of current and future experiments.

  6. Fabrication of SERS swab for direct detection of trace explosives in fingerprints.

    PubMed

    Gong, Zhengjun; Du, Hongjie; Cheng, Fansheng; Wang, Cong; Wang, Canchen; Fan, Meikun

    2014-12-24

    Swab sampling is of great importance in surface contamination analysis. A cotton swab (cotton Q-tip) was successfully transformed into surface-enhanced Raman scattering (SERS) substrate (SERS Q-tip) through a bottom-up strategy, where Ag NPs were first self-assembled onto the Q-tip followed by in situ growing. The capability for direct swab detection of Raman probe Nile Blue A (NBA) and a primary explosive marker 2,4-dinitrotoluene (2,4-DNT) using the SERS Q-tip was explored. It was found that at optimum conditions, a femotogram of NBA on glass surface could be swab-detected. The lowest detectable amount for 2,4-DNT is only ∼1.2 ng/cm(2) (total amount of 5 ng) on glass surface, 2 orders of magnitude more sensitive than similar surface analysis achieved with infrared technique, and comparable even with that obtained by ion mobility spectrometry-mass spectrometry. Finally, 2,4-DNT left on fingerprints was also analyzed. It was found that SERS signal of 2,4-DNT from 27th fingerprint after touching 2,4-DNT powder can still be clearly identified by swabbing with the SERS Q-tip. We believe this is the first direct SERS swabbing test of explosives on fingerprint on glass. Considering its relative long shelf life (>30 d), the SERS Q-tip may find great potential in future homeland security applications when combined with portable Raman spectrometers.

  7. Direct detection of the hydrolysis of nerve agent model compounds using a fluorescent probe.

    PubMed

    Zheng, Xueying; Okolotowicz, Karl; Wang, Beilin; Macdonald, Mary; Cashman, John R; Zhang, Jun

    2010-09-06

    Nerve agents are highly toxic organophosphorus compounds (OPs) that are used as chemical warfare agents. Developing a catalytic bioscavenger to efficiently detoxify nerve agents in the bloodstream of affected individuals has been recognized as an attractive approach to prevent nerve agent toxicity. However, the search for nerve agent catalysts has been hindered by the lack of efficient direct assays for nerve agent hydrolysis. In addition, authentic nerve agents are restricted and access to use for experiments by the general research community is prohibited. Herein we report development of a method that combines use of novel nerve agent model compounds possessing a thiocholine leaving group that reacts with the fluorescent thio-detection probe, BES-Thio, to afford detection of sub-micromolar amounts of nerve agent model compounds hydrolysis products. The detection sensitivity of BES-Thio assay was approximately 10 times better than the Ellman assay. This developed method is useful as a direct, sensitive screening method for evaluating OP hydrolysis efficiency from catalytic cholinesterases. When the assay was assembled in the presence of oxime, OP-inhibited cholinesterases that were able to be reactivated by specific oxime showed oxime-assisted enzyme-mediated OP hydrolysis. Therefore, this method is also useful to screen oxime analogs to identify novel agents that can reactivate OP-inhibited cholinesterases or to screen various enzymes to identify pseudo-catalytic bioscavengers that can be readily reactivated by clinically approved oximes.

  8. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    PubMed

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  9. Direct RNA-based detection of CTX-M β-lactamases in human blood samples.

    PubMed

    Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Pletz, Mathias W

    2015-05-01

    Bloodstream infections with ESBL-producers are associated with increased mortality, which is due to delayed appropriate treatment resulting in clinical failure. Current routine diagnostics for detection of bloodstream infections consists of blood culture followed by species identification and susceptibility testing. In attempts to improve and accelerate diagnostic procedures, PCR-based methods have been developed. These methods focus on species identification covering only a limited number of ESBL coding genes. Therefore, they fail to cover the steadily further evolving genetic diversity of clinically relevant β-lactamases. We have recently designed a fast and novel RNA targeting method to detect and specify CTX-M alleles from bacterial cultures, based on an amplification-pyrosequencing approach. We further developed this assay towards a diagnostic tool for clinical use and evaluated its sensitivity and specificity when applied directly to human blood samples. An optimized protocol for mRNA isolation allows detection of specific CTX-M groups from as little as 100 CFU/mL blood via reverse transcription, amplification, and pyrosequencing directly from human EDTA blood samples as well as from pre-incubated human blood cultures with a turnaround time for test results of <7 h.

  10. Adaptive Optics for Direct Detection of Extrasolar Planets: The Gemini Planet Imager

    SciTech Connect

    Macintosh, B; Graham, J; Palmer, D; Doyon, R; Gavel, D; Larkin, J; Oppenheimer, B; Saddlemyer, L; Wallace, J K; Bauman, B; Erikson, D; Poyneer, L; Sivaramakrishnan, A; Soummer, R; Veran, J

    2007-04-24

    The direct detection of photons emitted or reflected by extrasolar planets, spatially resolved from their parent star, is a major frontier in the study of other solar systems. Direct detection will provide statistical information on planets in 5-50 AU orbits, inaccessible to current Doppler searches, and allow spectral characterization of radius, temperature, surface gravity, and perhaps composition. Achieving this will require new dedicated high-contrast instruments. One such system under construction is the Gemini Planet Imager (GPI.) This combines a high-order/high-speed adaptive optics system to control wavefront errors from the Earth's atmosphere, an advanced coronagraph to block diffraction, ultrasmooth optics, a precision infrared interferometer to measure and correct systematic errors, and a integral field spectrograph/polarimeter to image and characterize target planetary systems. We predict that GPI will be able to detect planets with brightness less than 10{sup -7} of their parent star, sufficient to observe warm self-luminous planets around a large population of targets.

  11. Directional support value of Gaussian transformation for infrared small target detection.

    PubMed

    Yang, Changcai; Ma, Jiayi; Qi, Shengxiang; Tian, Jinwen; Zheng, Sheng; Tian, Xin

    2015-03-20

    Robust small target detection is one of the key techniques in IR search and tracking systems for self-defense or attacks. In this paper we present a robust solution for small target detection in a single IR image. The key ideas of the proposed method are to use the directional support value of Gaussian transform (DSVoGT) to enhance the targets, and use the multiscale representation provided by DSVoGT to reduce the false alarm rate. The original image is decomposed into sub-bands in different orientations by convolving the image with the directional support value filters, which are deduced from the weighted mapped least-squares-support vector machines (LS-SVMs). Based on the sub-band images, a support value of Gaussian matrix is constructed, and the trace of this matrix is then defined as the target measure. The corresponding multiscale correlations of the target measures are computed for enhancing target signal while suppressing the background clutter. We demonstrate the advantages of the proposed method on real IR images and compare the results against those obtained from standard detection approaches, including the top-hat filter, max-mean filter, max-median filter, min-local-Laplacian of Gaussian (LoG) filter, as well as LS-SVM. The experimental results on various cluttered background images show that the proposed method outperforms other detectors.

  12. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

    PubMed

    Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

    2014-01-01

    Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings.

  13. Piezoelectric immunosensor for direct and rapid detection of staphylococcal enterotoxin A (SEA) at the ng level.

    PubMed

    Salmain, Michèle; Ghasemi, Mahsa; Boujday, Souhir; Spadavecchia, Jolanda; Técher, Clarisse; Val, Florence; Le Moigne, Vincent; Gautier, Michel; Briandet, Romain; Pradier, Claire-Marie

    2011-11-15

    A direct, label-free immunosensor was designed for the rapid detection and quantification of staphylococcal enterotoxin A (SEA) in buffered solutions using quartz crystal microbalance with dissipation (QCM-D) as transduction method. The sensing layer including the anti-SEA antibody was constructed by chemisorption of a self-assembled monolayer of cysteamine on the gold electrodes placed over the quartz crystal sensor followed by activation of the surface amino groups with the rigid homobifunctional cross-linker 1,4-phenylene diisothiocyanate (PDITC) and covalent linking of binding protein (protein A or protein G). Four anti-SEA antibodies (two of which from commercial source) have been selected to set up the most sensitive detection device. With the optimized sensing layer, a standard curve for the direct assay of SEA was established from QCM-D responses within a working range of 50-1000 or 2000 ngml(-1) with a detection limit of 20 ngml(-1). The total time for analysis was 15 min. Using a sandwich type assay, the response was ca. twice higher and consequently the lowest measurable concentration dropped down to 7 ngml(-1) for a total assay time of 25 min.

  14. Tailored magnetic nanoparticles for direct and sensitive detection of biomolecules in biological samples.

    PubMed

    Fornara, Andrea; Johansson, Petter; Petersson, Karolina; Gustafsson, Stefan; Qin, Jian; Olsson, Eva; Ilver, Dag; Krozer, Anatol; Muhammed, Mamoun; Johansson, Christer

    2008-10-01

    We developed nanoparticles with tailored magnetic properties for direct and sensitive detection of biomolecules in biological samples in a single step. Thermally blocked nanoparticles obtained by thermal hydrolysis, functionalized with specific ligands, are mixed with sample solutions, and the variation of the magnetic relaxation due to surface binding is used to detect the presence of biomolecules. The binding significantly increases the hydrodynamic volume of nanoparticles, thus changing their Brownian relaxation frequency which is measured by a specifically developed AC susceptometer. The system was tested for the presence of Brucella antibodies, a dangerous pathogen causing brucellosis with severe effects both on humans and animals, in serum samples from infected cows and the surface of the nanoparticles was functionalized with lipopolysaccharides (LPS) from Brucella abortus. The hydrodynamic volume of LPS-functionalized particles increased by 25-35% as a result of the binding of the antibodies, measured by changes in the susceptibility in an alternating magnetic field. The method has shown high sensitivity, with detection limit of 0.05 microg x mL(-1) of antibody in the biological samples without any pretreatment. This magnetic-based assay is very sensitive, cost-efficient, and versatile, giving a direct indication whether the animal is infected or not, making it suitable for point-of-care applications. The functionalization of tailored magnetic nanoparticles can be modified to suit numerous homogeneous assays for a wide range of applications.

  15. Assessing the sensitivity of diffusion MRI to detect neuronal activity directly

    PubMed Central

    Bai, Ruiliang; Stewart, Craig V.; Plenz, Dietmar; Basser, Peter J.

    2016-01-01

    Functional MRI (fMRI) is widely used to study brain function in the neurosciences. Unfortunately, conventional fMRI only indirectly assesses neuronal activity via hemodynamic coupling. Diffusion fMRI was proposed as a more direct and accurate fMRI method to detect neuronal activity, yet confirmative findings have proven difficult to obtain. Given that the underlying relation between tissue water diffusion changes and neuronal activity remains unclear, the rationale for using diffusion MRI to monitor neuronal activity has yet to be clearly established. Here, we studied the correlation between water diffusion and neuronal activity in vitro by simultaneous calcium fluorescence imaging and diffusion MR acquisition. We used organotypic cortical cultures from rat brains as a biological model system, in which spontaneous neuronal activity robustly emerges free of hemodynamic and other artifacts. Simultaneous fluorescent calcium images of neuronal activity are then directly correlated with diffusion MR signals now free of confounds typically encountered in vivo. Although a simultaneous increase of diffusion-weighted MR signals was observed together with the prolonged depolarization of neurons induced by pharmacological manipulations (in which cell swelling was demonstrated to play an important role), no evidence was found that diffusion MR signals directly correlate with normal spontaneous neuronal activity. These results suggest that, whereas current diffusion MR methods could monitor pathological conditions such as hyperexcitability, e.g., those seen in epilepsy, they do not appear to be sensitive or specific enough to detect or follow normal neuronal activity. PMID:26941239

  16. Improving the emergency department detection rate of domestic violence using direct questioning.

    PubMed

    Morrison, L J; Allan, R; Grunfeld, A

    2000-08-01

    The purpose of this study was to compare the domestic violence (DV) rate identified with simple direct questioning to a historical cohort of patients receiving routine emergency department (ED) care. One thousand ED charts of female patients were retrospectively reviewed. Each patient in the prospective cohort was asked five DV specific questions. The historical cohort revealed a DV prevalence rate of 0.4%. The prospective study group of 302 patients identified 11 (3.6%) patients who admitted to acute DV on direct questioning. Ten of these patients accepted help. Twenty (6.6%) were identified as probable DV and 12 (4%) admitted to past violence. The total number of victims of DV, past, present, and probable was 43 (14.2%). This increase in detection from 0.4% (4/1000) to 14.2% (43/302) is significant at p < 0.001. Only 1.3% of patients refused to participate in the DV specific questions. The conclusion of the study indicated that the use of simple, direct questioning significantly improves the detection rate of DV in the ED.

  17. Direct detection of iodine oxide and glyoxal over the open tropical Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Volkamer, R.; Coburn, S.; Dix, B. K.; Sinreich, R.

    2009-12-01

    A novel Ship Multi AXis DOAS (CU SMAX-DOAS) instrument, developed at CU Boulder’s Atmospheric Trace Molecule Spectroscopy Laboratory (AMTOSpeclab), was deployed from October 2008 to January 2009 on board NOAA’s RV Ronald H. Brown over the Eastern Pacific Ocean to directly probe the column abundance of iodine oxide (IO), iodine dioxide (OIO), bromine oxide (BrO), nitrogen dioxide (NO2), glyoxal (CHOCHO), and formaldehyde (HCHO), water vapor (H2O) and oxygen dimers (O4, an indicator for aerosol optical depth) as part of the VOCALS-REx field campaign. This contribution presents spectral proof for the direct detection of iodine oxide and CHOCHO in elevated concentrations concentrations over biologically active upwelling regions of the Pacific Ocean more than 3000km from the West Coast of South America. To our knowledge this is the first direct and simultaneous detection of IO and CHOCHO over the open ocean. Our measurements demonstrate that CHOCHO and IO are located inside the marine boundary layer, and can not be explained by continental outflow of precursor gases emitted over land. We discuss a possible source mechanism that is compatible with our observations, and points to an open ocean source that is not currently represented in atmospheric models.

  18. Assessing the sensitivity of diffusion MRI to detect neuronal activity directly.

    PubMed

    Bai, Ruiliang; Stewart, Craig V; Plenz, Dietmar; Basser, Peter J

    2016-03-22

    Functional MRI (fMRI) is widely used to study brain function in the neurosciences. Unfortunately, conventional fMRI only indirectly assesses neuronal activity via hemodynamic coupling. Diffusion fMRI was proposed as a more direct and accurate fMRI method to detect neuronal activity, yet confirmative findings have proven difficult to obtain. Given that the underlying relation between tissue water diffusion changes and neuronal activity remains unclear, the rationale for using diffusion MRI to monitor neuronal activity has yet to be clearly established. Here, we studied the correlation between water diffusion and neuronal activity in vitro by simultaneous calcium fluorescence imaging and diffusion MR acquisition. We used organotypic cortical cultures from rat brains as a biological model system, in which spontaneous neuronal activity robustly emerges free of hemodynamic and other artifacts. Simultaneous fluorescent calcium images of neuronal activity are then directly correlated with diffusion MR signals now free of confounds typically encountered in vivo. Although a simultaneous increase of diffusion-weighted MR signals was observed together with the prolonged depolarization of neurons induced by pharmacological manipulations (in which cell swelling was demonstrated to play an important role), no evidence was found that diffusion MR signals directly correlate with normal spontaneous neuronal activity. These results suggest that, whereas current diffusion MR methods could monitor pathological conditions such as hyperexcitability, e.g., those seen in epilepsy, they do not appear to be sensitive or specific enough to detect or follow normal neuronal activity.

  19. Guidelines for the Direct Detection of Anaplasma spp. in Diagnosis and Epidemiological Studies.

    PubMed

    Silaghi, Cornelia; Santos, Ana Sofia; Gomes, Jacinto; Christova, Iva; Matei, Ioana Adriana; Walder, Gernot; Domingos, Ana; Bell-Sakyi, Lesley; Sprong, Hein; von Loewenich, Friederike D; Oteo, José A; de la Fuente, José; Dumler, J Stephen

    2017-01-01

    The genus Anaplasma (Rickettsiales: Anaplasmataceae) comprises obligate intracellular Gram-negative bacteria that are mainly transmitted by ticks, and currently includes six species: Anaplasma bovis, Anaplasma centrale, Anaplasma marginale, Anaplasma phagocytophilum, Anaplasma platys, and Anaplasma ovis. These have long been known as etiological agents of veterinary diseases that affect domestic and wild animals worldwide. A zoonotic role has been recognized for A. phagocytophilum, but other species can also be pathogenic for humans. Anaplasma infections are usually challenging to diagnose, clinically presenting with nonspecific symptoms that vary greatly depending on the agent involved, the affected host, and other factors such as immune status and coinfections. The substantial economic impact associated with livestock infection and the growing number of human cases along with the risk of transfusion-transmitted infections, determines the need for accurate laboratory tests. Because hosts are usually seronegative in the initial phase of infection and serological cross-reactions with several Anaplasma species are observed after seroconversion, direct tests are the best approach for both case definition and epidemiological studies. Blood samples are routinely used for Anaplasma spp. screening, but in persistently infected animals with intermittent or low-level bacteremia, other tissues might be useful. These guidelines have been developed as a direct outcome of the COST action TD1303 EURNEGVEC ("European Network of Neglected Vectors and Vector-Borne Diseases"). They review the direct laboratory tests (microscopy, nucleic acid-based detection and in vitro isolation) currently used for Anaplasma detection in ticks and vertebrates and their application.

  20. Protein, carbohydrate, lipid concentrations and HSP 70-HSP 90 (stress protein) expression over an annual cycle: useful tools to detect feeding constraints in a benthic suspension feeder

    NASA Astrophysics Data System (ADS)

    Rossi, Sergio; Snyder, Mark J.; Gili, Josep-Marìa

    2006-03-01

    In the present paper we suggest an effect of seasonal variations in food availability on two ecophysiological parameters in a warm temperate benthic suspension feeder: the tissue concentrations of proteins, carbohydrates and lipids on the one hand, and the expression of stress proteins (HSP 70 and 90, inducible and/or constitutive) on the other hand. The concentrations of biomacromolecules have already been used to describe bentho-pelagic and reproductive processes, but this is the first time that stress protein expression is suggested to be directly related with food constraints in marine organisms. Paramuricea clavata (Cnidaria: Gorgonacea) express HSP 70 and 90 (constitutive and/or inducible) throughout the seasonal cycle, and HSP 70 levels are twice as high as the levels of HSP 90. In summer and autumn, when seston availability to suspension feeders was low, P. clavata showed low levels of carbohydrates and lipids, but high levels of HSPs expression. The levels of HSP 70 and 90 expression fit with negative exponential functions of carbohydrate and lipid concentrations. We suggest a direct effect of food availability on the studied ecophysiological parameters while the effect of temperature may be rather indirect. HSP expression as well as the tissue concentrations of carbohydrate and lipids may be used as biomarkers of environmental changes and seston availability to benthic suspension feeders.

  1. Direct Detection of Burkholderia cepacia in Susceptible Pharmaceutical Products Using Semi-Nested PCR.

    PubMed

    Attia, Mohamed A; Ali, Amal E; Essam, Tamer M; Amin, Magdy A

    2016-01-01

    Burkholderia cepaciahas recently received a considerable attention as one of the major risks in susceptible pharmaceutical products. This microorganism can easily propagate and cause vast and severe contamination, especially to the water supplies for pharmaceutical companies. Moreover, it proliferates within the products and can cause severe infections for humans. Therefore, fast and sensitive detection of these bacteria is of a great demand. The present study introduces improved application of a polymerase chain reaction assay with relatively high sensitivity and specificity for the direct detection ofB. cepaciafrom the aqueous pharmaceutical products. A semi-nested polymerase chain reaction approach using the primer set BCR1/BCR2 followed by BCR1/Mr yielding a 465 bp fragment of the recA gene was applied and tested using both crude lysate from isolated colonies and DNA directly extracted from artificially prepared and spiked reference syrup. The polymerase chain reaction assay showed no interference with other bacterial reference and environmental strains tested, includingStaphylococcus aureusATCC® 6538,Pseudomonas aeruginosaATCC® 9027,Escherichia coliATCC® 8739,Salmonella abonyNCTC® 6017,Bacillus subtilisATCC® 6633,Micrococcus luteus, Staphylococcus warneri, Pseudomonas fluorescens, Pseudomonas putida, andRalstonia pickettii Moreover, this semi-nested assay showed a detection limit of around 10 colony-forming units per sample and could detectB. cepaciastrains isolated from a municipal pre-treated potable water tank. Comparing the results for detection ofB. cepaciain 100 randomly collected commercial syrup preparations using both conventional standard method and polymerase chain reaction assay revealed thatB. cepaciawas detected in two samples using polymerase chain reaction assay while all samples showed negative results by conventional culturing and biochemical methods. These results highlight the advantage of using this polymerase chain reaction assay to

  2. Dark matter direct detection rate in a generic model with micrOMEGAs_2.2

    NASA Astrophysics Data System (ADS)

    Bélanger, G.; Boudjema, F.; Pukhov, A.; Semenov, A.

    2009-05-01

    We present a new module of the micrOMEGAs package for the calculation of WIMP-nuclei elastic scattering cross sections relevant for the direct detection of dark matter through its interaction with nuclei in a large detector. With this new module, the computation of the direct detection rate is performed automatically for a generic model of new physics which contains a WIMP candidate. This model needs to be implemented within micrOMEGAs 2.2. Program summaryProgram title: micrOMEGAs2.2 Catalogue identifier: ADQR_v2_2 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADQR_v2_2.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 206 949 No. of bytes in distributed program, including test data, etc.: 2 245 230 Distribution format: tar.gz Programming language: C and Fortran Computer: PC, Alpha, Mac Operating system: UNIX (Linux, OSF1, Darwin, Cygwin) RAM: 17 MB depending on the number of processes required Classification: 1.9, 11.6 Catalogue identifier of previous version: ADQR_v2_1 Journal reference of previous version: Comput. Phys. Comm. 177 (2007) 894 Does the new version supersede the previous version?: Yes Nature of problem: Calculation of the relic density and of direct and indirect detection rates of the lightest stable particle in a generic new model of particle physics. Solution method: In numerically solving the evolution equation for the density of darkmatter, relativistic formulae for the thermal average are used. All tree-level processes for annihilation and coannihilation of new particles in the model are included. The cross-sections for all processes are calculated exactly with CalcHEP after definition of a model file. Higher-order QCD corrections to Higgs couplings to quark pairs are included. The coefficients of the effective Lagrangian which describes the

  3. The Direct Detection of Lyman Continuum Emission from Star-forming Galaxies at z~3

    NASA Astrophysics Data System (ADS)

    Shapley, Alice E.; Steidel, Charles C.; Pettini, Max; Adelberger, Kurt L.; Erb, Dawn K.

    2006-11-01

    We present the results of rest-frame UV spectroscopic observations of a sample of 14 z~3 star-forming galaxies in the SSA 22a field. These spectra are characterized by unprecedented depth in the Lyman continuum region. For the first time, we have detected escaping ionizing radiation from individual galaxies at high redshift, with 2 of the 14 objects showing significant emission below the Lyman limit. We also measured the ratio of emergent flux density at 1500 Å to that in the Lyman continuum region, for the individual detections (C49 and D3) and the sample average. If a correction for the average IGM opacity is applied to the spectra of the objects C49 and D3, we find f1500/f900,corr,C49=4.5 and f1500/f900,corr,D3=2.9. The average emergent flux density ratio in our sample is =22, implying an escape fraction ~4.5 times lower than inferred from the composite spectrum from Steidel and coworkers. If this new estimate is representative of LBGs, their contribution to the metagalactic ionizing radiation field is Jν(900)~2.6×10-22 ergs s-1 cm-2 Hz-1 sr-1, comparable to the contribution of optically selected quasars at the same redshift. The sum of the contributions from galaxies and quasars is consistent with recent estimates of the level of the ionizing background at z~3, inferred from the H I Lyα forest optical depth. There is significant variance among the emergent far-UV spectra in our sample, yet the factors controlling the detection or nondetection of Lyman continuum emission from galaxies are not well determined. Because we do not yet understand the source of this variance, significantly larger samples will be required to obtain robust constraints on the galaxy contribution to the ionizing background at z~3 and beyond. Based, in part, on data obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and NASA and was made possible by the

  4. The impact of baryons on the direct detection of dark matter

    NASA Astrophysics Data System (ADS)

    Kelso, Chris; Savage, Christopher; Valluri, Monica; Freese, Katherine; Stinson, Gregory S.; Bailin, Jeremy

    2016-08-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic especially at large heliocentric velocities, thereby making the SHM a better fit. We also note that we do not find a significant disk-like rotating dark matter component in either of the two galaxy halos with baryons that we examine, suggesting that dark disks are not a generic prediction of cosmological hydrodynamical simulations. We conclude that in the Solar neighborhood, the SHM is in fact a good approximation to the true dark matter distribution in these cosmological simulations (with baryons) which are reasonable representations of the Milky Way, and hence can also be used for the purpose of dark matter direct detection calculations.

  5. Design and Development of a Scanning Airborne Direct Detection Doppler Lidar System

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce; McGill, Matthew; Schwemmer, Geary; Hardesty, Michael; Brewer, Alan; Wilkerson, Thomas; Atlas, Robert; Sirota, Marcos; Lindemann, Scott

    2006-01-01

    In the fall of 2005 we began developing an airborne scanning direct detection molecular Doppler lidar. The instrument is being built as part of the Tropospheric Wind Lidar Technology Experiment (TWiLiTE), a three year project selected by the NASA Earth Sun Technology Office under the Instrument Incubator Program. The TWiLiTE project is a collaboration involving scientists and engineers from NASA Goddard Space Flight Center, NOAA ESRL, Utah State University Space Dynamics Lab, Michigan Aerospace Corporation and Sigma Space Corporation. The TWiLiTE instrument will leverage significant research and development investments made by NASA Goddard and it's partners in the past several years in key lidar technologies and sub-systems (lasers, telescopes, scanning systems, detectors and receivers) required to enable spaceborne global wind lidar measurement. These sub-systems will be integrated into a complete molecular direct detection Doppler wind lidar system designed for autonomous operation on a high altitude aircraft, such as the NASA WB57. The WB57 flies at an altitude of 18 km and from this vantage point the nadir viewing Doppler lidar will be able to profile winds through the full troposphere. The TWiLiTE integrated airborne Doppler lidar instrument will be the first demonstration of a airborne scanning direct detection Doppler lidar and will serve as a critical milestone on the path to a future spaceborne tropospheric wind system. In addition to being a technology testbed for space based tropospheric wind lidar, when completed the TWiLiTE high altitude airborne lidar will be used for studying mesoscale dynamics and storm research (e.g. winter storms, hurricanes) and could be used for calibration and validation of satellite based wind systems such as ESA's Aeolus Atmospheric Dynamics Mission. The TWiLiTE Doppler lidar will have the capability to profile winds in clear air from the aircraft altitude of 18 km to the surface with 250 m vertical resolution and < 2mls

  6. Online Direct Density-Ratio Estimation Applied to Inlier-Based Outlier Detection.

    PubMed

    du Plessis, Marthinus Christoffel; Shiino, Hiroaki; Sugiyama, Masashi

    2015-09-01

    Many machine learning problems, such as nonstationarity adaptation, outlier detection, dimensionality reduction, and conditional density estimation, can be effectively solved by using the ratio of probability densities. Since the naive two-step procedure of first estimating the probability densities and then taking their ratio performs poorly, methods to directly estimate the density ratio from two sets of samples without density estimation have been extensively studied recently. However, these methods are batch algorithms that use the whole data set to estimate the density ratio, and they are inefficient in the online setup, where training samples are provided sequentially and solutions are updated incrementally without storing previous samples. In this letter, we propose two online density-ratio estimators based on the adaptive regularization of weight vectors. Through experiments on inlier-based outlier detection, we demonstrate the usefulness of the proposed methods.

  7. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction.

    PubMed

    Pisal, R V; Hrebíková, H; Chvátalová, J; Kunke, D; Filip, S; Mokrý, J

    2016-01-01

    Ensuring mycoplasma-free cell culture is of prime importance as they severely affect cellular characteristics leading to experimental artefacts and spurious results. Various methods persist for mycoplasma detection; out of the whole array of methods polymerase chain reaction (PCR) is the most favoured one because it is highly sensitive, specific and quick. The PCR-based detection procedure involves three steps: cell culture supernatant collection, DNA isolation, and PCR. We have modified this procedure so that cell culture supernatant can directly be used for PCR without the need for DNA extraction. This modification makes the procedure quicker and more sensitive because loss of mycoplasma DNA is prevented and this loss becomes more significant when the level of mycoplasma contamination is very low.

  8. Direct detection of x-rays for protein crystallography employing a thick, large area CCD

    DOEpatents

    Atac, Muzaffer; McKay, Timothy

    1999-01-01

    An apparatus and method for directly determining the crystalline structure of a protein crystal. The crystal is irradiated by a finely collimated x-ray beam. The interaction of the x-ray beam with the crystal produces scattered x-rays. These scattered x-rays are detected by means of a large area, thick CCD which is capable of measuring a significant number of scattered x-rays which impact its surface. The CCD is capable of detecting the position of impact of the scattered x-ray on the surface of the CCD and the quantity of scattered x-rays which impact the same cell or pixel. This data is then processed in real-time and the processed data is outputted to produce a image of the structure of the crystal. If this crystal is a protein the molecular structure of the protein can be determined from the data received.

  9. Direct detection of lower hybrid wave using a reflectometer on Alcator C-Moda)

    NASA Astrophysics Data System (ADS)

    Shiraiwa, S.; Baek, S.; Dominguez, A.; Marmar, E.; Parker, R.; Kramer, G. J.

    2010-10-01

    The possibility of directly detecting a density perturbation produced by lower hybrid (LH) waves using a reflectometer is presented. We investigate the microwave scattering of reflectometer probe beams by a model density fluctuation produced by short wavelength LH waves in an Alcator C-Mod experimental condition. In the O-mode case, the maximum response of phase measurement is found to occur when the density perturbation is approximately centimeters in front of the antenna, where Bragg scattering condition is satisfied. In the X-mode case, the phase measurement is predicted to be more sensitive to the density fluctuation close to the cut-off layer. A feasibility test was carried out using a 50 GHz O-mode reflectometer on the Alcator C-Mod tokamak, and positive results including the detection of 4.6 GHz pump wave and parametric decay instabilities were obtained.

  10. Rapid, portable, multiplexed detection of bacterial pathogens directly from clinical sample matrices

    DOE PAGES

    Phaneuf, Christopher R.; Mangadu, Betty Lou Bosano; Piccini, Matthew E.; ...

    2016-09-23

    Enteric and diarrheal diseases are a major cause of childhood illness and death in countries with developing economies. Each year, more than half of a million children under the age of five die from these diseases. We have developed a portable, microfluidic platform capable of simultaneous, multiplexed detection of several of the bacterial pathogens that cause these diseases. Furthermore, this platform can perform fast, sensitive immunoassays directly from relevant, complex clinical matrices such as stool without extensive sample cleanup or preparation. Using only 1 µL of sample per assay, we demonstrate simultaneous multiplexed detection of four bacterial pathogens implicated inmore » diarrheal and enteric diseases in less than 20 min.« less

  11. High throughput PCR detection of Xylella fastidiosa directly from almond tissues.

    PubMed

    Chen, Jianchi; Livingston, Sam; Groves, Russell; Civerolo, Edwin L

    2008-04-01

    Xylella fastidiosa, the causal agent of almond leaf scorch disease (ALSD), is currently re-emerging as a serious concern in California. Efficient pathogen detection is critical for ALSD epidemiological studies, particularly when a large sample size is involved. We here report a PCR procedure to detect X. fastidiosa directly from infected almond tissue without the laborious DNA extraction. Plant samples were prepared by freeze-drying and pulverized. Appropriate dilutions of the pulverized freeze-dried tissue (PFT) were determined to minimize the effect of enzyme inhibitors from plant tissue and retain PCR detection of X. fastdiosa cells at a single digit number level. This PFT-PCR procedure was evaluated by comparing to the in vitro cultivation method using 102 symptomatic samples and resulted in a predictive value of 90.8%. PFT-PCR was further applied to monitor the seasonal occurrence of X. fastidiosa from four selected almond trees in two orchards in 2005. The results matched with those of the cultivation method at 92.3%. Considering the simplicity and reliability, we conclude that PFT-PCR is a valuable option for high throughput rapid detection of X. fastidiosa.

  12. Effects of transcranial direct current stimulation of primary somatosensory cortex on vibrotactile detection and discrimination.

    PubMed

    Labbé, Sara; Meftah, El-Mehdi; Chapman, C Elaine

    2016-04-01

    Anodal transcranial direct current stimulation (a-tDCS) of primary somatosensory cortex (S1) has been shown to enhance tactile spatial acuity, but there is little information as to the underlying neuronal mechanisms. We examined vibrotactile perception on the distal phalanx of the middle finger before, during, and after contralateral S1 tDCS [a-, cathodal (c)-, and sham (s)-tDCS]. The experiments tested our shift-gain hypothesis, which predicted that a-tDCS would decrease vibrotactile detection and discrimination thresholds (leftward shift of the stimulus-response function with increased gain/slope) relative to s-tDCS, whereas c-tDCS would have the opposite effects (relative to s-tDCS). The results showed that weak a-tDCS (1 mA, 20 min) led to a reduction in both vibrotactile detection and discrimination thresholds to 73-76% of baseline during the application of the stimulation in subjects categorized as responders. These effects persisted after the end of a-tDCS but were absent 30 min later. Most, but not all, subjects showed a decrease in threshold (8/12 for detection; 9/12 for discrimination). Intersubject variability was explained by a ceiling effect in the discrimination task. c-tDCS had no significant effect on either detection or discrimination threshold. Taken together, our results supported our shift-gain hypothesis for a-tDCS but not c-tDCS.

  13. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  14. Direct Measurement of Mammographic X-Ray Spectra with a Digital CdTe Detection System

    PubMed Central

    Abbene, Leonardo; Gerardi, Gaetano; Principato, Fabio; Sordo, Stefano Del; Raso, Giuseppe

    2012-01-01

    In this work we present a detection system, based on a CdTe detector and an innovative digital pulse processing (DPP) system, for high-rate X-ray spectroscopy in mammography (1–30 keV). The DPP system performs a height and shape analysis of the detector pulses, sampled and digitized by a 14-bit, 100 MHz ADC. We show the results of the characterization of the detection system both at low and high photon counting rates by using monoenergetic X-ray sources and a nonclinical X-ray tube. The detection system exhibits excellent performance up to 830 kcps with an energy resolution of 4.5% FWHM at 22.1 keV. Direct measurements of clinical molybdenum X-ray spectra were carried out by using a pinhole collimator and a custom alignment device. A comparison with the attenuation curves and the half value layer values, obtained from the measured and simulated spectra, from an ionization chamber and from a solid state dosimeter, also shows the accuracy of the measurements. These results make the proposed detection system a very attractive tool for both laboratory research, calibration of dosimeters and advanced quality controls in mammography. PMID:22969406

  15. In-line interferometer for direction-sensitive displacement measurements by optical feedback detection

    SciTech Connect

    Tarun, Alvarado; Jecong, Julius; Saloma, Caesar

    2005-12-01

    We demonstrate a compact in-line interferometer for direction-sensitive displacement measurement by optical feedback detection with a semiconductor laser (SL) light source. Two reflected beams from a semitransparent reference mirror and a reflecting test object interfere in the SL medium, causing a variation in its output power. The reference mirror is located between the SL output facet and the test object. The performance of the interferometer is investigated numerically and experimentally to determine its optimal operating conditions. We have verified the operating conditions where the behavior of the SL output power profile could indicate accurately the displacement magnitude and direction of the moving test object. The profile behavior is robust against variations in optical feedback and scale of the interferometer configuration.

  16. Detecting direct collapse black holes: making the case for CR7

    NASA Astrophysics Data System (ADS)

    Agarwal, Bhaskar; Johnson, Jarrett L.; Zackrisson, Erik; Labbe, Ivo; van den Bosch, Frank C.; Natarajan, Priyamvada; Khochfar, Sadegh

    2016-08-01

    We propose that one of the sources in the recently detected system CR7 by Sobral et al. through spectrophotometric measurements at z = 6.6 harbours a direct collapse black hole (DCBH). We argue that the LW radiation field required for direct collapse in source A is provided by sources B and C. By tracing the LW production history and star formation rate over cosmic time for the halo hosting CR7 in a ΛCDM universe, we demonstrate that a DCBH could have formed at z ˜ 20. The spectrum of source A is well fit by nebular emission from primordial gas around a BH with MBH ˜4.4 × 106 M⊙ accreting at a 40 per cent of the Eddington rate, which strongly supports our interpretation of the data. Combining these lines of evidence, we argue that CR7 might well be the first DCBH candidate.

  17. Assessment of absolute added correlative coding in optical intensity modulation and direct detection channels

    NASA Astrophysics Data System (ADS)

    Dong-Nhat, Nguyen; Elsherif, Mohamed A.; Malekmohammadi, Amin

    2016-06-01

    The performance of absolute added correlative coding (AACC) modulation format with direct detection has been numerically and analytically reported, targeting metro data center interconnects. Hereby, the focus lies on the performance of the bit error rate, noise contributions, spectral efficiency, and chromatic dispersion tolerance. The signal space model of AACC, where the average electrical and optical power expressions are derived for the first time, is also delineated. The proposed modulation format was also compared to other well-known signaling, such as on-off-keying (OOK) and four-level pulse-amplitude modulation, at the same bit rate in a directly modulated vertical-cavity surface-emitting laser-based transmission system. The comparison results show a clear advantage of AACC in achieving longer fiber delivery distance due to the higher dispersion tolerance.

  18. Low energy electron/recoil discrimination for directional Dark Matter detection

    SciTech Connect

    Billard, J.; Mayet, F.; Santos, D. E-mail: mayet@lpsc.in2p3.fr

    2012-07-01

    Directional detection is a promising Dark Matter search strategy. Even though it could accommodate to a sizeable background contamination, electron/recoil discrimination remains a key and challenging issue as for direction-insensitive detectors. The measurement of the 3D track may be used to discriminate electrons from nuclear recoils. While a high rejection power is expected above 20 keV ionization, a dedicated data analysis is needed at low energy. After identifying discriminant observables, a multivariate analysis, namely a Boosted Decision Tree, is proposed, enabling an efficient event tagging for Dark Matter search. We show that it allows us to optimize rejection while keeping a rather high efficiency which is compulsory for rare event search.With respect to a sequential analysis, the rejection is about ∼ 20 times higher with a multivariate analysis, for the same Dark Matter exclusion limit.

  19. Direct detection of spontaneous polarization in wurtzite GaAs nanowires

    SciTech Connect

    Bauer, Benedikt Hubmann, Joachim; Lohr, Matthias; Reiger, Elisabeth; Bougeard, Dominique; Zweck, Josef

    2014-05-26

    We demonstrate the direct detection of spontaneous polarization in the wurtzite crystal phase of gallium-arsenide (GaAs) nanowires. Using differential phase contrast microscopy (DPC) in a scanning transmission electron microscope, we map the differences in charge distribution between the zinc-blende and wurtzite crystal phases and use twin defects in the zinc-blende phase to quantify the polarization strength. The value of 2.7 × 10{sup −3} C/m{sup 2} found for the polarization strength matches well with theoretical predictions.

  20. Wavelet packet transform-based optical orthogonal frequency-division multiplexing transmission using direct detection

    NASA Astrophysics Data System (ADS)

    Zhang, Hongbo; Yi, Xingwen; Chen, Lei; Zhang, Jing; Deng, Mingliang; Qiu, Kun

    2012-10-01

    As an alternate to fast Fourier transform-based orthogonal frequency-division multiplexing (OFDM), wavelet packet transform (WPT)-based OFDM (WPT-OFDM) does not require cyclic prefix to avoid inter-symbol-interference. The wavelet has many varieties and therefore, it can provide more freedom for system design to suit different applications. We propose a real-valued WPT-OFDM that uses intensity modulation/direct detection. We also conduct an experiment to verify its performance through a 75-km standard single-mode fiber.

  1. Wind Profiles Obtained with a Molecular Direct Detection Doppler Lidar During IHOP-2002

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce M.; Chen, Huai-Lin; Li, Steven X.; Mathur, Savyasachee; Dobler, Jeremy; Hasselbrack, William; Comer, Joseph

    2004-01-01

    The Goddard Lidar Observatory for Winds (GLOW) is a mobile direct detection Doppler lidar system which uses the double edge technique to measure the Doppler shift of the molecular backscattered laser signal at a wavelength of 355 nm. In the spring of 2002 GLOW was deployed to the western Oklahoma profiling site (36 deg 33.500 min. N, 100 deg. 36.371 min. W) to participate in the International H2O Project (IHOP). During the IHOP campaign over 240 hours of wind profiles were obtained with the GLOW lidar in support of a variety of scientific investigations.

  2. Nuclear recoil energy scale in liquid xenon with application to the direct detection of dark matter

    SciTech Connect

    Sorensen, P; Dahl, C E

    2011-02-14

    We show for the first time that the quenching of electronic excitation from nuclear recoils in liquid xenon is well-described by Lindhard theory, if the nuclear recoil energy is reconstructed using the combined (scintillation and ionization) energy scale proposed by Shutt et al.. We argue for the adoption of this perspective in favor of the existing preference for reconstructing nuclear recoil energy solely from primary scintillation. We show that signal partitioning into scintillation and ionization is well-described by the Thomas-Imel box model. We discuss the implications for liquid xenon detectors aimed at the direct detection of dark matter.

  3. ISOLATION AND DETECTION OF GIARDIA CYSTS FROM WATER USING DIRECT IMMUNOFLUORESCENCE.

    USGS Publications Warehouse

    Sorenson, Stephen K.; Riggs, John L.; Dileanis, Peter D.; Suk, Thomas J.

    1986-01-01

    A water-sampling apparatus used for the isolation and detection of Giardia cysts in water has been designed and tested. The sampling apparatus uses one of a variety of pumps or waterline pressure to move water through a filter. Two of the optional pumps are lightweight enough to make the apparatus portable and thus suitable for sampling in remote areas. This technique of sample processing produces good cyst recovery in much less time than is required with previously established methods. Giardia cysts are identified using direct immunofluorescence.

  4. Fluorescent In Situ Hybridization: A New Tool for the Direct Identification and Detection of F. psychrophilum

    PubMed Central

    Strepparava, Nicole; Wahli, Thomas; Segner, Helmut; Polli, Bruno; Petrini, Orlando

    2012-01-01

    F. psychrophilum is the causative agent of Bacterial Cold Water Disease (BCW) and Rainbow Trout Fry Syndrome (RTFS). To date, diagnosis relies mainly on direct microscopy or cultural methods. Direct microscopy is fast but not very reliable, whereas cultural methods are reliable but time-consuming and labor-intensive. So far fluorescent in situ hybridization (FISH) has not been used in the diagnosis of flavobacteriosis but it has the potential to rapidly and specifically detect F. psychrophilum in infected tissues. Outbreaks in fish farms, caused by pathogenic strains of Flavobacterium species, are increasingly frequent and there is a need for reliable and cost-effective techniques to rapidly diagnose flavobacterioses. This study is aimed at developing a FISH that could be used for the diagnosis of F. psychrophilum infections in fish. We constructed a generic probe for the genus Flavobacterium (“Pan-Flavo”) and two specific probes targeting F. psychrophilum based on 16S rRNA gene sequences. We tested their specificity and sensitivity on pure cultures of different Flavobacterium and other aquatic bacterial species. After assessing their sensitivity and specificity, we established their limit of detection and tested the probes on infected fresh tissues (spleen and skin) and on paraffin-embedded tissues. The results showed high sensitivity and specificity of the probes (100% and 91% for the Pan-Flavo probe and 100% and 97% for the F. psychrophilum probe, respectively). FISH was able to detect F. psychrophilum in infected fish tissues, thus the findings from this study indicate this technique is suitable as a fast and reliable method for the detection of Flavobacterium spp. and F. psychrophilum. PMID:23152887

  5. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    PubMed

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples.

  6. Combined Direct and Indirect CT Venography (Combined CTV) in Detecting Lower Extremity Deep Vein Thrombosis

    PubMed Central

    Shi, Wan-Yin; Wang, Li-Wei; Wang, Shao-Juan; Yin, Xin-Dao; Gu, Jian-Ping

    2016-01-01

    Abstract This study aimed to evaluate the diagnostic accuracy of combined direct and indirect CT venography (combined CTV) in the detection of lower extremity deep vein thrombosis (LEDVT). The institutional review board approved the study protocol, and patients or qualifying family members provided informed consent. A total of 96 consecutive patients undergoing combined CTV were prospectively enrolled. A combined examination with digital subtraction angiography (DSA) plus duplex ultrasonography (US) was used as the criterion standard. Three observers were blinded to clinical, DSA, and US results, and they independently analyzed all combined CTV datasets. Interobserver agreement was expressed in terms of the Cohen k value for categorical variables. Accuracy, sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of combined CTV in the detection of LEDVT were determined by using patient- and location-based evaluations. Of the 96 patients, DSA plus US revealed LEDVT in 125 segmental veins in 63 patients. Patient-based evaluation with combined CTV yielded an accuracy of 96.9% to 97.9%, a sensitivity of 95.2% to 96.8%, a specificity of 100% to 100%, a PPV of 100% to 100%, and an NPV of 91.7% to 94.3% in the detection of LEDVT. Location-based evaluation yielded similar results. Through combined direct and indirect CTV, patients obtained a combined CT angiogram on the diseased limb and an indirect CT angiogram on the opposite side. The image quality of combined CTV was superior to an indirect venogram. Combined CTV shows promising diagnostic accuracy in the detection of LEDVT with 3-dimensional modeling of the lower limb venous system. PMID:26986113

  7. Combined Direct and Indirect CT Venography (Combined CTV) in Detecting Lower Extremity Deep Vein Thrombosis.

    PubMed

    Shi, Wan-Yin; Wang, Li-Wei; Wang, Shao-Juan; Yin, Xin-Dao; Gu, Jian-Ping

    2016-03-01

    This study aimed to evaluate the diagnostic accuracy of combined direct and indirect CT venography (combined CTV) in the detection of lower extremity deep vein thrombosis (LEDVT). The institutional review board approved the study protocol, and patients or qualifying family members provided informed consent. A total of 96 consecutive patients undergoing combined CTV were prospectively enrolled. A combined examination with digital subtraction angiography (DSA) plus duplex ultrasonography (US) was used as the criterion standard. Three observers were blinded to clinical, DSA, and US results, and they independently analyzed all combined CTV datasets. Interobserver agreement was expressed in terms of the Cohen k value for categorical variables. Accuracy, sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of combined CTV in the detection of LEDVT were determined by using patient- and location-based evaluations. Of the 96 patients, DSA plus US revealed LEDVT in 125 segmental veins in 63 patients. Patient-based evaluation with combined CTV yielded an accuracy of 96.9% to 97.9%, a sensitivity of 95.2% to 96.8%, a specificity of 100% to 100%, a PPV of 100% to 100%, and an NPV of 91.7% to 94.3% in the detection of LEDVT. Location-based evaluation yielded similar results. Through combined direct and indirect CTV, patients obtained a combined CT angiogram on the diseased limb and an indirect CT angiogram on the opposite side. The image quality of combined CTV was superior to an indirect venogram. Combined CTV shows promising diagnostic accuracy in the detection of LEDVT with 3-dimensional modeling of the lower limb venous system.

  8. [Image quality and detection performance of a direct digital radiography system].

    PubMed

    Ideguchi, Tadamitsu; Matsuda, Katsuhiko; Himuro, Kazuhiko; Kuwahara, Rie; Miyazaki, Hidetsune; Hazeyama, Hiroyuki; Kumazawa, Seiji; Kawaji, Yasuyuki; Yoshida, Akira; Matsumoto, Masao; Higashida, Yoshiharu

    2006-03-20

    The physical characteristics of a direct amorphous Selenium (a-Se) digital fluoroscopy and radiography system were investigated. Pre-sampled modulation transfer functions (MTF) were measured using a slit method. Noise power spectra were determined for different input exposures by fast Fourier transform of uniformly exposed samples. The MTFs of direct digital radiography systems showed significantly higher values than those of indirect digital radiography and screen-film systems. The direct digital radiography systems showed higher noise levels compared with those of indirect systems under roughly the same exposure conditions. Contrast-detail analysis was performed to compare detection by direct digital radiography systems with that of the screen-film (FUJI HG-M2/UR2) systems. The average contrast-detail curves of digital and film images were obtained from the results of observation. Image quality figures (IQF) were also calculated from the individual observer performance tests. The results indicated that digital contrast-detail curves and IQF are, on average, are equal those of the screen-film system.

  9. Assessing alternatives for directional detection of a halo of weakly interacting massive particles

    NASA Astrophysics Data System (ADS)

    Copi, Craig J.; Krauss, Lawrence M.; Simmons-Duffin, David; Stroiney, Steven R.

    2007-01-01

    The future of direct terrestrial WIMP detection lies on two fronts: new, much larger low background detectors sensitive to energy deposition, and detectors with directional sensitivity. The former can explore a large range of WIMP parameter space using well-tested technology while the latter may be necessary if one is to disentangle particle physics parameters from astrophysical halo parameters. Because directional detectors will be quite difficult to construct it is worthwhile exploring in advance generally which experimental features will yield the greatest benefits at the lowest costs. We examine the sensitivity of directional detectors with varying angular tracking resolution with and without the ability to distinguish forward versus backward recoils, and compare these to the sensitivity of a detector where the track is projected onto a two-dimensional plane. The latter detector regardless of where it is placed on the Earth, can be oriented to produce a significantly better discrimination signal than a 3D detector without this capability, and with sensitivity within a factor of 2 of a full 3D tracking detector. Required event rates to distinguish signals from backgrounds for a simple isothermal halo range from the low teens in the best case to many thousands in the worst.

  10. Assessing alternatives for directional detection of a halo of weakly interacting massive particles

    SciTech Connect

    Copi, Craig J.; Krauss, Lawrence M.; Simmons-Duffin, David; Stroiney, Steven R.

    2007-01-15

    The future of direct terrestrial WIMP detection lies on two fronts: new, much larger low background detectors sensitive to energy deposition, and detectors with directional sensitivity. The former can explore a large range of WIMP parameter space using well-tested technology while the latter may be necessary if one is to disentangle particle physics parameters from astrophysical halo parameters. Because directional detectors will be quite difficult to construct it is worthwhile exploring in advance generally which experimental features will yield the greatest benefits at the lowest costs. We examine the sensitivity of directional detectors with varying angular tracking resolution with and without the ability to distinguish forward versus backward recoils, and compare these to the sensitivity of a detector where the track is projected onto a two-dimensional plane. The latter detector regardless of where it is placed on the Earth, can be oriented to produce a significantly better discrimination signal than a 3D detector without this capability, and with sensitivity within a factor of 2 of a full 3D tracking detector. Required event rates to distinguish signals from backgrounds for a simple isothermal halo range from the low teens in the best case to many thousands in the worst.

  11. Prospects for direct detection of dark matter in an effective theory approach

    SciTech Connect

    Catena, Riccardo

    2014-07-01

    We perform the first comprehensive analysis of the prospects for direct detection of dark matter with future ton-scale detectors in the general 11-dimensional effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. The theory includes 8 momentum and velocity dependent dark matter-nucleon interaction operators, besides the familiar spin-independent and spin-dependent operators. From a variegated sample of 27 benchmark points selected in the parameter space of the theory, we simulate independent sets of synthetic data for ton-scale Germanium and Xenon detectors. From the synthetic data, we then extract the marginal posterior probability density functions and the profile likelihoods of the model parameters. The associated Bayesian credible regions and frequentist confidence intervals allow us to assess the prospects for direct detection of dark matter at the 27 benchmark points. First, we analyze the data assuming the knowledge of the correct dark matter nucleon-interaction type, as it is commonly done for the familiar spin-independent and spin-dependent interactions. Then, we analyze the simulations extracting the dark matter-nucleon interaction type from the data directly, in contrast to standard analyses. This second approach requires an extensive exploration of the full 11-dimensional parameter space of the dark matter-nucleon effective theory. Interestingly, we identify 5 scenarios where the dark matter mass and the dark matter-nucleon interaction type can be reconstructed from the data simultaneously. We stress the importance of extracting the dark matter nucleon-interaction type from the data directly, discussing the main challenges found addressing this complex 11-dimensional problem.

  12. Direct, Specific and Rapid Detection of Staphylococcal Proteins and Exotoxins Using a Multiplex Antibody Microarray

    PubMed Central

    Stieber, Bettina; Monecke, Stefan; Müller, Elke; Büchler, Joseph; Ehricht, Ralf

    2015-01-01

    Background S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins. Methods In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays. Results 110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate. Conclusions The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers. PMID:26624622

  13. Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles.

    PubMed

    Liandris, Emmanouil; Gazouli, Maria; Andreadou, Margarita; Comor, Mirjana; Abazovic, Nadica; Sechi, Leonardo A; Ikonomopoulos, John

    2009-09-01

    Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 microl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples.

  14. First direct detection limits on sub-GeV dark matter from XENON10.

    PubMed

    Essig, Rouven; Manalaysay, Aaron; Mardon, Jeremy; Sorensen, Peter; Volansky, Tomer

    2012-07-13

    The first direct detection limits on dark matter in the MeV to GeV mass range are presented, using XENON10 data. Such light dark matter can scatter with electrons, causing ionization of atoms in a detector target material and leading to single- or few-electron events. We use 15  kg day of data acquired in 2006 to set limits on the dark-matter-electron scattering cross section. The strongest bound is obtained at 100 MeV where σ(e)<3×10(-38)  cm2 at 90% C.L., while dark-matter masses between 20 MeV and 1 GeV are bounded by σ(e)<10(-37)  cm2 at 90% C.L. This analysis provides a first proof of principle that direct detection experiments can be sensitive to dark-matter candidates with masses well below the GeV scale.

  15. Detection of steering direction using EEG recordings based on sample entropy and time-frequency analysis.

    PubMed

    Caldero-Bardaji, P; Longfei, X; Jaschke, S; Reermann, J; Mideska, K G; Schmidt, G; Deuschl, G; Muthuraman, M

    2016-08-01

    Monitoring driver's intentions beforehand is an ambitious aim, which will bring a huge impact on the society by preventing traffic accidents. Hence, in this preliminary study we recorded high resolution electroencephalography (EEG) from 5 subjects while driving a car under real conditions along with an accelerometer which detects the onset of steering. Two sensor-level analyses, sample entropy and time-frequency analysis, have been implemented to observe the dynamics before the onset of steering. Thus, in order to classify the steering direction we applied a machine learning algorithm consisting of: dimensionality reduction and classification using principal-component-analysis (PCA) and support-vector-machine (SVM), respectively. The results showed an increase of the sample entropy and the estimated power values in the theta and alpha frequency bands, 100 ms before the onset of steering. The detection of steering direction depicted that sample entropy gives a higher classification accuracy (73.5% ±6.8) as compared to that of using the estimated power for theta and alpha frequency bands (62.6% ±5.6).

  16. Direct electron detection yields cryo-EM reconstructions at resolutions beyond ¾ Nyquist frequency

    PubMed Central

    Bammes, Benjamin E.; Rochat, Ryan H.; Jakana, Joanita; Chen, Dong-Hua; Chiu, Wah

    2012-01-01

    One limitation in electron cryo-microscopy (cryo-EM) is the inability to recover high-resolution signal from the image-recording media at the full-resolution limit of the transmission electron microscope. Direct electron detection using CMOS-based sensors for digitally recording images has the potential to alleviate this shortcoming. Here, we report a practical performance evaluation of a Direct Detection Device (DDD) for biological cryo-EM at two different microscope voltages: 200 and 300 kV. Our DDD images of amorphous and graphitized carbon show strong per-pixel contrast with image resolution near the theoretical sampling limit of the data. Single-particle reconstructions of two frozen-hydrated bacteriophages, P22 and ε15, establish that the DDD is capable of recording usable signal for 3-D reconstructions at about 4/5 of the Nyquist frequency, which is a vast improvement over the performance of conventional imaging media. We anticipate the unparalleled performance of this digital recording device will dramatically benefit cryo-EM for routine tomographic and single-particle structural determination of biological specimens. PMID:22285189

  17. Form factor effects in the direct detection of isospin-violating dark matter

    SciTech Connect

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen E-mail: malkuth@sjtu.edu.cn

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of {sup 208}Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to f{sub n}/f{sub p}=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with f{sub n}/f{sub p}=-0.7.

  18. Form factor effects in the direct detection of isospin-violating dark matter

    NASA Astrophysics Data System (ADS)

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of 208Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to fn/fp=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with fn/fp=-0.7.

  19. Quantifying (dis)agreement between direct detection experiments in a halo-independent way

    SciTech Connect

    Feldstein, Brian; Kahlhoefer, Felix E-mail: felix.kahlhoefer@physics.ox.ac.uk

    2014-12-01

    We propose an improved method to study recent and near-future dark matter direct detection experiments with small numbers of observed events. Our method determines in a quantitative and halo-independent way whether the experiments point towards a consistent dark matter signal and identifies the best-fit dark matter parameters. To achieve true halo independence, we apply a recently developed method based on finding the velocity distribution that best describes a given set of data. For a quantitative global analysis we construct a likelihood function suitable for small numbers of events, which allows us to determine the best-fit particle physics properties of dark matter considering all experiments simultaneously. Based on this likelihood function we propose a new test statistic that quantifies how well the proposed model fits the data and how large the tension between different direct detection experiments is. We perform Monte Carlo simulations in order to determine the probability distribution function of this test statistic and to calculate the p-value for both the dark matter hypothesis and the background-only hypothesis.

  20. Blind symbol synchronization for direct detection optical OFDM using a reduced number of virtual subcarriers.

    PubMed

    Bouziane, R; Killey, R I

    2015-03-09

    Symbol synchronization constitutes a major component in optical OFDM transceivers. In this paper, we propose reducing the complexity of a blind symbol synchronization technique for direct detection OFDM receivers based on virtual subcarriers by optimizing the number and location of the virtual subcarriers. Compared to the system design in our previous study, this new technique offers a reduction of 92% in the number of virtual subcarriers (from 26 to 2 in a system with 50 data carrying subchannels) resulting in significant savings in complexity with a minimal penalty. Moreover, it offers an increase in the system capacity as more subcarriers can be used to transmit data. The technique was assessed experimentally using a transmission system of direct detection 16-QAM optical OFDM operating at a data rate of 30.65 Gb/s over 23.3 km SSMF with BER of 10(-3). Negligible penalty was observed at high received powers. However, at low received powers, the number of averaging symbols had to be increased in order to improve the robustness of the method.

  1. Tropospheric and stratospheric wind profiling with a direct detection Doppler lidar

    NASA Technical Reports Server (NTRS)

    Abreu, Vincent J.; Barnes, John E.; Fischer, Ken W.; Skinner, Wilbert R.; Mcgill, Matt J.

    1992-01-01

    The Space Physics Research Laboratory at the University of Michigan has been operating a direct detection, high resolution Doppler Lidar (HRDL) to measure winds in the boundary layer, free troposphere and lower stratosphere. A direct detection Doppler lidar measures the Doppler shift of the aerosol or Rayleigh backscattered signal, from which the wind velocity vector can be retrieved (Benedetti-Michelangeli et al, 1972, 1974; Chanin et al., 1989; Abreu et al., 1992). The system components are shown. The transmitting system is a Continuum NY-60 Nd:YAG laser frequency doubled to a wavelength of 532 nm. The laser is injection seeded for single line mode operation yielding a linewidth of 0.0045 cm(exp -1) (135 MHz) with excellent shot-to-shot frequency stability. The laser produces 60 mJ pulses and operates at a 50 Hz repetition rate for an effective output power of 3.0 W. A description of the University of Michigan's Doppler lidar is given with examples of wind profiles for the boundary layer, free troposphere, and for the lower stratosphere. The system provides a reliable method of remotely measuring the wind. The wind error is smallest in regions of high aerosols. The system also produces aerosol extinction profiles versus altitude which can be determined by the shape of the spectra. The system has been installed in a trailor so that measurements can be made for field campaigns. Winds and aerosol data are available immediately at the site for use in forecasting.

  2. Direct competitive chemiluminescence immunoassays based on gold-coated magnetic particles for detection of chloramphenicol.

    PubMed

    Liang, Xiaohui; Fang, Xiangyi; Yao, Manwen; Yang, Yucong; Li, Junfeng; Liu, Hongjun; Wang, Linyu

    2016-02-01

    Direct competitive chemiluminescence immunoassays (CLIA) based on gold-coated magnetic nanospheres (Au-MNPs) were developed for rapid analysis of chloramphenicol (CAP). The Au-MNPs were modified with carboxyl groups and amino groups by 11-mercaptoundecanoic acid (MUA) and cysteamine respectively, and then were respectively conjugated with CAP base and CAP succinate via an activating reaction using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). NSP-DMAE-NHS, a new and effective luminescence reagent, was employed to label anti-CAP antibody (mAb) as a tracer in direct CLIA for CAP detection using a 'homemade' luminescent measurement system that was set up with a photomultiplier tube (PMT) and a photon counting unit linked to a computer. The sensitivities and limits of detection (LODs) of the two methods were obtained and compared according to the inhibition curves. The 50% inhibition concentration (IC50 ) values of the two methods were about 0.044 ng/mL and 0.072 ng/mL respectively and LODs were approximately 0.001 ng/mL and 0.006 ng/mL respectively. To our knowledge, they were much more sensitive than any traditional enzyme-linked immunosorbent assay (ELISA) ever reported. Moreover, the new luminescence reagent NSP-DMAE-NHS is much more sensitive and stable than luminol and its derivatives, contributing to the sensitivity enhancement.

  3. Site-directed immobilisation of antibody fragments for detection of C-reactive protein.

    PubMed

    Vikholm-Lundin, Inger; Albers, Willem M

    2006-01-15

    C-reactive protein, CRP antibody Fab'-fragments have been attached on pre-cleaned gold slides and protein repellent polymers have been used to block the remaining free space in between the antibody fragments. At optimal conditions the antibody fragments are site-directly immobilised on the surface and non-specific binding is reduced. The amount of Fab'-fragments in the polymer host monolayer has been optimised for various buffers. Binding of CRP to Fab'-fragment/polymer layers produced in phosphate buffered saline decreased with NaCl salt concentration. In a 1M NaCl phosphate buffer, the antibodies seem to be randomly oriented on the surface with a similar response to CRP as that of an antibody F(ab)(2)-fragment layer. In a 150 mM NaCl phosphate buffer, on the other hand, the fragments seem to be site-directly oriented and the response to CRP was fivefold. The highest response to CRP was obtained to a layer with a Fab'-fragment concentration of 60 microg/ml. CRP could be detected in a concentration range of 1 ng/ml to 50 microg/ml from a standard solution in phosphate buffer and in a range of 4 ng/ml to 50 microg/ml from serum/PBS. CRP was, moreover, successfully detected in patient samples with good reproducibility. The layer would thus be sensitive enough to analyse the CRP concentration in human serum for predicting cardiovascular disease.

  4. Rapid detection of haloarchaeal carotenoids via liquid-liquid microextraction enabled direct TLC MALDI-MS.

    PubMed

    Manikandan, Muthu; Hasan, Nazim; Wu, Hui-Fen

    2013-03-30

    For the first time, we demonstrate the use of TiO2 nanoparticles (NPs) for enhancing the carotenoid production by the extremophilic haloarchea, Haloferax mediterranei. TiO2 NPs at optimal concentration of 375 mg/L results in a 95% increase in the production of carotenoid pigment compared to the control (no TiO2 NPs). The carotenoid pigments extracted from TiO2 NPs treated H. mediterranei cells, were separated using thin layer chromatography (TLC). The separated carotenoid spots were subjected directly for MALDI MS detection. To limit the sample diffusion during matrix addition on TLC plates, a simple bordering mode was exercised. Using this method we were able to detect the pigments successfully using MALDI-MS, directly from TLC plates after separation. In addition, we also applied the Pt NPs capped with ODT via Liquid-liquid microextraction (LLME) for extracting the pigment molecules from the halobacteria in MALDI-MS. These novel NP approaches possess numerous advantages such as; rapidity, ease in synthesis, high sensitivity and low cost.

  5. THE TRENDS HIGH-CONTRAST IMAGING SURVEY. II. DIRECT DETECTION OF THE HD 8375 TERTIARY

    SciTech Connect

    Crepp, Justin R.; Johnson, John Asher; Yantek, Scott M.; Howard, Andrew W.; Marcy, Geoff W.; Isaacson, Howard; Fischer, Debra A.; Wright, Jason T.; Feng Ying

    2013-07-01

    We present the direct imaging detection of a faint tertiary companion to the single-lined spectroscopic binary HD 8375 AB. Initially noticed as an 53 m s{sup -1} yr{sup -1} Doppler acceleration by Bowler et al., we have obtained high-contrast adaptive optics observations at Keck using NIRC2 that spatially resolve HD 8375 C from its host(s). Astrometric measurements demonstrate that the companion shares a common proper-motion. We detect orbital motion in a clockwise direction. Multiband relative photometry measurements are consistent with an early M-dwarf spectral type ({approx}M1V). Our combined Doppler and imaging observations place a lower-limit of m {>=} 0.297 M{sub Sun} on its dynamical mass. We also provide a refined orbit for the inner pair using recent radial velocity measurements obtained with the High Resolution Echelle Spectrometer. HD 8375 is one of many triple-star systems that are apparently missing in the solar neighborhood.

  6. Patterned electrode-based amperometric gas sensor for direct nitric oxide detection within microfluidic devices.

    PubMed

    Cha, Wansik; Tung, Yi-Chung; Meyerhoff, Mark E; Takayama, Shuichi

    2010-04-15

    This article describes a thin amperometric nitric oxide (NO) sensor that can be microchannel embedded to enable direct real-time detection of NO produced by cells cultured within the microdevice. A key for achieving the thin ( approximately 1 mm) planar sensor configuration required for sensor-channel integration is the use of gold/indium-tin oxide patterned electrode directly on a porous polymer membrane (pAu/ITO) as the base working electrode. The electrochemically deposited Au-hexacyanoferrate layer on pAu/ITO is used to catalyze NO oxidation to nitrite at lower applied potentials (0.65-0.75 V vs Ag/AgCl) and stabilize current output. Furthermore, use of a gas-permeable membrane to separate internal sensor compartments from the sample phase imparts excellent NO selectivity over common interfering agents (e.g., nitrite, ascorbate, ammonia, etc.) present in culture media and biological fluids. The optimized sensor design reversibly detects NO down to the approximately 1 nM level in stirred buffer and <10 nM in flowing buffer when integrated within a polymeric microfluidic device. We demonstrate utility of the channel-embedded sensor by monitoring NO generation from macrophages cultured within non-gas-permeable microchannels, as they are stimulated with endotoxin.

  7. Turbine Reliability and Operability Optimization through the use of Direct Detection Lidar Final Technical Report

    SciTech Connect

    Johnson, David K; Lewis, Matthew J; Pavlich, Jane C; Wright, Alan D; Johnson, Kathryn E; Pace, Andrew M

    2013-02-01

    The goal of this Department of Energy (DOE) project is to increase wind turbine efficiency and reliability with the use of a Light Detection and Ranging (LIDAR) system. The LIDAR provides wind speed and direction data that can be used to help mitigate the fatigue stress on the turbine blades and internal components caused by wind gusts, sub-optimal pointing and reactionary speed or RPM changes. This effort will have a significant impact on the operation and maintenance costs of turbines across the industry. During the course of the project, Michigan Aerospace Corporation (MAC) modified and tested a prototype direct detection wind LIDAR instrument; the resulting LIDAR design considered all aspects of wind turbine LIDAR operation from mounting, assembly, and environmental operating conditions to laser safety. Additionally, in co-operation with our partners, the National Renewable Energy Lab and the Colorado School of Mines, progress was made in LIDAR performance modeling as well as LIDAR feed forward control system modeling and simulation. The results of this investigation showed that using LIDAR measurements to change between baseline and extreme event controllers in a switching architecture can reduce damage equivalent loads on blades and tower, and produce higher mean power output due to fewer overspeed events. This DOE project has led to continued venture capital investment and engagement with leading turbine OEMs, wind farm developers, and wind farm owner/operators.

  8. Multiplex PCR for colony direct detection of Gram-positive histamine- and tyramine-producing bacteria.

    PubMed

    Coton, Emmanuel; Coton, Monika

    2005-12-01

    Formation of biogenic amines (BA) may occur in fermented foods and beverages due to the amino acid decarboxylase activities of Gram-positive bacteria. These compounds may cause food poisoning and therefore could imply food exportation problems. A set of consensual primers based on histidine decarboxylase gene (hdc) sequences of different bacteria was designed for the detection of histamine-producing Gram-positive bacteria. A multiplex PCR based on these hdc primers and recently designed primers targeting the tyrosine decarboxylase (tyrdc) gene was created. A third set of primers targeting the 16S rRNA gene of eubacteria was also used as an internal control. This multiplex PCR was performed on extracted DNA as well as directly on cell colonies. The results obtained show that this new molecular tool allowed for the detection of Gram-positive histamine- and/or tyramine-producing bacteria. The use of this molecular tool for early and rapid detection of Gram-positive BA-producing bacteria is of interest in evaluating the potential of cultured indigenous strains to produce biogenic amines in a fermented food product as well as to validate the innocuity of potential starter strains in the food industry.

  9. Digital quantification of miRNA directly in plasma using integrated comprehensive droplet digital detection.

    PubMed

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N; Zell, Jason A; Digman, Michelle A; Gratton, Enrico; Li, Jinghong; Zhao, Weian

    2015-11-07

    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the 'Integrated Comprehensive Droplet Digital Detection' (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10 000 copies per mL in ≤3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing.

  10. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    NASA Technical Reports Server (NTRS)

    Generazio, Edward R.

    2015-01-01

    Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD) Manual v.1.2 The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Design of experiments for validating probability of detection capability of nondestructive evaluation (NDE) systems (DOEPOD) is a methodology that is implemented via software to serve as a diagnostic tool providing detailed analysis of POD test data, guidance on establishing data distribution requirements, and resolving test issues. DOEPOD demands utilization of observance of occurrences. The DOEPOD capability has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required. DOEPOD applications for supporting inspector qualifications is included.

  11. NEAR-IR DIRECT DETECTION OF WATER VAPOR IN TAU BOÖTIS b

    SciTech Connect

    Lockwood, Alexandra C.; Johnson, John A.; Blake, Geoffrey A.; Bender, Chad F.; Richert, Alexander J. W.; Carr, John S.; Barman, Travis

    2014-03-10

    We use high dynamic range, high-resolution L-band spectroscopy to measure the radial velocity (RV) variations of the hot Jupiter in the τ Boötis planetary system. The detection of an exoplanet by the shift in the stellar spectrum alone provides a measure of the planet's minimum mass, with the true mass degenerate with the unknown orbital inclination. Treating the τ Boo system as a high flux ratio double-lined spectroscopic binary permits the direct measurement of the planet's true mass as well as its atmospheric properties. After removing telluric absorption and cross-correlating with a model planetary spectrum dominated by water opacity, we measure a 6σ detection of the planet at K{sub p} = 111 ± 5 km s{sup –1}, with a 1σ upper limit on the spectroscopic flux ratio of 10{sup –4}. This RV leads to a planetary orbital inclination of i=45{sub −4}{sup +3}° and a mass of M{sub P}=5.90{sub −0.20}{sup +0.35} M{sub Jup}. We report the first detection of water vapor in the atmosphere of a non-transiting hot Jupiter, τ Boo b.

  12. Marking of specific sequences in double-stranded DNA molecules—SNP detection and direct observation

    PubMed Central

    Shigemori, Yasushi; Haruta, Hirotaka; Okada, Takao; Oishi, Michio

    2004-01-01

    In this study, we describe a simple method to mark specific sequences in double-stranded DNA molecules. For the marking, we used two specifically designed oligonucleotides, one of which is complementary to the sequence to be marked and the other, serving as a splint, to make the marking stable and detectable by subsequent various analytical means. In the presence of the two deoxyoligonucleotides, whereas RecA protein-mediated reaction converts the sequence to be marked to a regional triple-stranded structure with the complementary (probing) oligonucleotide, DNA ligase transforms it to a stable multi- (possibly quintuple) stranded structure with the splint oligonucleotide. The whole marking process is simple and completed in a single reaction mixture. Because RecA protein makes the marking to proceed with high fidelity, we were able to mark (detect) SNPs in complex genomes like human's. Furthermore, the structure of the marked sequence is stable and quite distinct enough to be readily detectable by biochemical means or direct observation by scanning probe microscopy. PMID:15574826

  13. Control of propranolol intake by direct chromatographic detection of alpha-naphthoxylactic acid in urine.

    PubMed

    Ruiz-Angel, M J; Fernández-López, P; Murillo-Pulgarín, J A; García-Alvarez-Coque, M C

    2002-02-15

    A rapid chromatographic procedure with a C18 column, a mobile phase of 0.15 M sodium dodecyl sulfate (SDS)-10% (v/v) 1-propanol at pH 3 (0.01 M phosphate buffer), and fluorimetric detection, is reported for the control of propranolol (PPL) intake in urine samples, which are injected directly without any other treatment than filtration. The peak of PPL was only observed in samples taken a few hours after ingestion of the drug due to its extensive conjugation and metabolisation. The detection of several unconjugated PPL metabolites was therefore considered: desisopropylpropranolol (DIP), propranolol glycol (PPG), alpha-naphthoxylactic acid (NLT) and alpha-naphthoxyacetic acid (NAC). NLT showed the best characteristics: it eluted at a much shorter retention time than PPL, its concentration in urine samples was greater and it did not present any interference from endogeneous compounds in urine, common drugs or drugs administered in combination with PPL. The limit of quantification, measured as the concentration of analyte providing a relative standard deviation of 20%, was 24 ng/ml, and the day-to-day imprecision was below 4% for concentrations above 200 ng/ml. The procedure allows the routine control of PPL at therapeutic urine levels. Urinary excretion studies showed that the detection of NLT is possible at least up to 20-30 h after oral administration.

  14. Direct, label-free, selective, and sensitive microbial detection using a bacteriorhodopsin-based photoelectric immunosensor.

    PubMed

    Chen, Hsiu-Mei; Jheng, Kai-Ru; Yu, An-Dih

    2017-05-15

    A photoelectric immunosensor using purple membranes (PM) as the transducer, which contains photoactive bacteriorhodopsin, is here first demonstrated for direct and label-free microbial detection. Biotinylated polyclonal antibodies against Escherichia coli were immobilized on a PM-coated electrode through further surface biotinylation and bridging avidin or NeutrAvidin. The photocurrent generated by the antibody-coated sensor was reduced after incubation with E. coli K-12 cultures, with the reduction level increased with the culture populations. The immunosensor prepared via NeutrAvidin exhibited much better selectivity than the one prepared via avidin, recognizing almost none of the tested Gram-positive bacteria. Cultures with populations ranging from 1 to 10(7)CFU/10mL were detected in a single step without any preprocessing. Both AFM and Raman analysis confirmed the layer-by-layer fabrication of the antibody-coated substrates as well as the binding of microorganisms. By investigating the effect of illumination orientation and simulating the photocurrent responses with an equivalent circuit model containing a chemical capacitance, we suggest that the photocurrent reduction was primarily caused by the light-shielding effect of the captured bacteria. Using the current fabrication technique, versatile bacteriorhodopsin-based photoelectric immunosensors can be readily prepared to detect a wide variety of biological cells.

  15. Direct determination of hydrogen cyanide in cigarette mainstream smoke by ion chromatography with pulsed amperometric detection.

    PubMed

    Zhang, Zi-Wei; Xu, Ying-Bo; Wang, Cheng-Hui; Chen, Kai-Bo; Tong, Hong-Wu; Liu, Shao-Min

    2011-02-18

    The determination of hydrogen cyanide in cigarette mainstream smoke has been achieved by ion chromatography (IC) with pulsed amperometric detection (PAD). The proposed method of totally trapping whole cigarette mainstream smoke by Cambridge filters, which are treated with sodium hydroxide/ethanol solution, possesses the advantage of fast analysis time over the widespread used solution absorption method. The possible co-existing interferents are evaluated under the optimized detection conditions and excellent recoveries of cyanide are obtained. The cyanide content of absorption solution can be directly determined by the optimized IC-PAD method without any pretreatments. The linear range is 0.0147-2.45 μg/mL with R² value of 0.9997. The limit of the detection is 3 μg/L for a 25 μL injection loop. The overall relative standard deviation of the method is less than 5.20% and the recovery range from 94.3% to 101.0%. The results obtained from the developed method are in good agreement with that of continuous flow analyzer (CFA) method.

  16. Carbon microarrays for the direct impedimetric detection of Bacillus anthracis using Gamma phages as probes.

    PubMed

    Shabani, Arghavan; Marquette, Christophe A; Mandeville, Rosemonde; Lawrence, Marcus F

    2013-03-07

    A direct and efficient impedimetric method is presented for the detection of Bacillus anthracis Sterne vegetative cells, using Gamma phages as probes attached to screen-printed carbon electrode microarrays. The carbon electrodes were initially functionalized through cyclic-voltammetric reduction of a nitro-aryl diazonium moiety, followed by further reduction of nitro groups to amino groups, and finally by treatment with glutaraldehyde. Functionalization (probe immobilization) using Gamma phages was verified by XPS and TOF-SIM experiments. The Gamma phage-modified microarrays were then used to detect B. anthracis Sterne bacteria in aqueous electrolyte media. Faradaic impedimetric detection of bacteria in KCl solution containing the ferri/ferro cyanide redox couple shows a gradual increase in Z' (real impedance) values, taken from the extrapolation of the linear portion of Nyquist plots in the low frequency range, for sensors placed in contact with increasing concentrations of B. anthracis. ΔZ' values vary from 700 to 5300 Ohms for bacteria concentrations ranging from 10(2) to 10(8) cfu mL(-1). These shifts in Z' are attributed to a decrease in diffusion controlled charge transfer to the electrode surface following capture of intact B. anthracis. No significant ΔZ' was observed for control experiments using E. coli. K12 as a non-specific target, even at a concentration of 10(8) cfu mL(-1).

  17. GEM-based TPC with CCD imaging for directional dark matter detection

    NASA Astrophysics Data System (ADS)

    Phan, N. S.; Lauer, R. J.; Lee, E. R.; Loomba, D.; Matthews, J. A. J.; Miller, E. H.

    2016-11-01

    The most mature directional dark matter experiments at present all utilize low-pressure gas Time Projection Chamber (TPC) technologies. We discuss some of the challenges for this technology, for which balancing the goal of achieving the best sensitivity with that of cost effective scale-up requires optimization over a large parameter space. Critical for this are the precision measurements of the fundamental properties of both electron and nuclear recoil tracks down to the lowest detectable energies. Such measurements are necessary to provide a benchmark for background discrimination and directional sensitivity that could be used for future optimization studies for directional dark matter experiments. In this paper we describe a small, high resolution, high signal-to-noise GEM-based TPC with a 2D CCD readout designed for this goal. The performance of the detector was characterized using alpha particles, X-rays, gamma-rays, and neutrons, enabling detailed measurements of electron and nuclear recoil tracks. Stable effective gas gains of greater than 1 × 105 were obtained in 100 Torr of pure CF4 by a cascade of three standard CERN GEMs each with a 140 μm pitch. The high signal-to-noise and sub-millimeter spatial resolution of the GEM amplification and CCD readout, together with low diffusion, allow for excellent background discrimination between electron and nuclear recoils down below ∼10 keVee (∼23 keVr fluorine recoil). Even lower thresholds, necessary for the detection of low mass WIMPs for example, might be achieved by lowering the pressure and utilizing full 3D track reconstruction. These and other paths for improvements are discussed, as are possible fundamental limitations imposed by the physics of energy loss.

  18. Detection of magnetic fields in both B-type components of the ɛ Lupi system: a new constraint on the origin of fossil fields?

    NASA Astrophysics Data System (ADS)

    Shultz, M.; Wade, G. A.; Alecian, E.; BinaMIcS Collaboration

    2015-11-01

    High-resolution circular spectropolarimetric observations, obtained with ESPaDOnS in the context of the BinaMIcS Large Program, have revealed a magnetic field in the B3V secondary component of the SB2 binary system ɛ Lupi (B2/B3). As the B2V primary is already known to be magnetic, this is the first detection of a magnetic field in both components of an early-type binary system. The longitudinal magnetic field of the primary is ˜ -200 G; that of the secondary ˜ +100 G. Observations can be approximately reproduced by a model assuming the magnetic axes of the two stars are anti-aligned, and roughly parallel to their respective rotation axes. Estimated magnetospheric radii indicate a high probability that their magnetospheres are interacting. As many of the arguments for the different proposed formation scenarios of fossil magnetic fields rely upon evidence drawn from investigations of close binaries, in particular the rarity of magnetic ABO stars in close binaries and the previous absence of any known close binary with two magnetic, massive stars, this discovery may be an important new constraint on the origin of fossil magnetic fields.

  19. Detection of particle flow patterns in tumor by directional spatial frequency analysis

    NASA Astrophysics Data System (ADS)

    Russell, Stewart; Camara, Hawa; Shi, Lingyan; Hoopes, P. Jack; Kaufman, Peter; Pogue, Brian; Alfano, Robert

    2016-04-01

    Drug delivery to tumors is well known to be chaotic and limited, partly from dysfunctional vasculature, but also because of microscopic regional variations in composition. Modeling the of transport of nanoparticle therapeutics, therefore must include not only a description of vascular permeability, but also of the movement of the drug as suspended in tumor interstitial fluid (TIF) once it leaves the blood vessel. Understanding of this area is limited because we currently lack the tools and analytical methods to characterize it. We have previously shown that directional anisotropy of drug delivery can be detected using Directional Fourier Spatial Frequency (DFSF) Analysis. Here we extend this approach to generate flow line maps of nanoparticle transport in TIF relative to tumor ultrastructure, and show that features of tumor spatial heterogeneity can be identified that are directly related to local flow isometries. The identification of these regions of limited flow may be used as a metric for determining response to therapy, or for the optimization of adjuvant therapies such as radiation pre-treatment, or enzymatic degradation.

  20. Markov chain Monte Carlo analysis to constrain dark matter properties with directional detection

    SciTech Connect

    Billard, J.; Mayet, F.; Santos, D.

    2011-04-01

    Directional detection is a promising dark matter search strategy. Indeed, weakly interacting massive particle (WIMP)-induced recoils would present a direction dependence toward the Cygnus constellation, while background-induced recoils exhibit an isotropic distribution in the Galactic rest frame. Taking advantage of these characteristic features, and even in the presence of a sizeable background, it has recently been shown that data from forthcoming directional detectors could lead either to a competitive exclusion or to a conclusive discovery, depending on the value of the WIMP-nucleon cross section. However, it is possible to further exploit these upcoming data by using the strong dependence of the WIMP signal with: the WIMP mass and the local WIMP velocity distribution. Using a Markov chain Monte Carlo analysis of recoil events, we show for the first time the possibility to constrain the unknown WIMP parameters, both from particle physics (mass and cross section) and Galactic halo (velocity dispersion along the three axis), leading to an identification of non-baryonic dark matter.

  1. Direct detection of extrasolar planets with the eXtreme Adaptive Optics Planet Imager

    NASA Astrophysics Data System (ADS)

    Macintosh, B. A.; Graham, J. R.; Duchene, G.; Jones, S.; Kalas, P.; Lloyd, J.; Makidon, R. B.; Olivier, S.; Palmer, D.; Perrin, M.; Poyneer, L.; Sheinis, A.; Sivaramakrishnan, A.; Severson, S.; Sommargren, G.; Troy, M.; Wallace, J. K.

    2003-05-01

    Current radial-velocity searches for extrasolar planets, though powerful, are fundamentally constrained in the range of orbits they can access by the need for a near-complete orbital period: the largest detectable semi-major axis only grows with time to the 2/3 power. In the next several decades, radial velocity detection will barely reach planets with orbits comparable to Saturn. However, planets in our solar system exist at wider separations and dusty disks frequently exceed 100 AU, some with evidence for perturbing planets in wide orbits. To probe the 5-100 AU range different techniques are needed. Direct detection of photons emitted by extrasolar planets is one such technique, but requires contrast levels of 107-109 at near-infrared wavelengths. We have designed an adaptive optics (AO) system capable of reaching these contrasts. XAOPI, the eXtreme Adaptive Optics Planet Imager, is a proposed 4096-actuator adaptive optics system for an 8-10m telescope. It will achieve Strehl ratios >0.9, and is optimized to remove scattered light from 0.2-1 arcseconds, even light scattered by errors in a segmented primary mirror. Simulations predict that it will achieve contrast ratios of 107 -108 for target stars with R<7. Monte Carlo analysis of target samples shows that this allows detection of near-IR emission from warm extrasolar planets younger and/or more massive than Jupiter around a significant sample of target stars. We will examine the scientific rationale for, and capabilities of, this proposed instrument. This work has been supported by the National Science Foundation Science and Technology Center for Adaptive Optics, managed by the University of California at Santa Cruz under cooperative agreement No. AST - 987 Portions of this work were also performed under the auspices of the U.S. Department of Energy, National Nuclear Security Administration by the University of California, Lawrence Livermore National Laboratory under contract No. W-7405-Eng-48.

  2. Halo-independent tests of dark matter direct detection signals: local DM density, LHC, and thermal freeze-out

    SciTech Connect

    Blennow, Mattias; Herrero-Garcia, Juan; Schwetz, Thomas; Vogl, Stefan E-mail: juhg@kth.se E-mail: stefan.vogl@fysik.su.se

    2015-08-01

    From an assumed signal in a Dark Matter (DM) direct detection experiment a lower bound on the product of the DM-nucleon scattering cross section and the local DM density is derived, which is independent of the local DM velocity distribution. This can be combined with astrophysical determinations of the local DM density. Within a given particle physics model the bound also allows a robust comparison of a direct detection signal with limits from the LHC. Furthermore, the bound can be used to formulate a condition which has to be fulfilled if the particle responsible for the direct detection signal is a thermal relic, regardless of whether it constitutes all DM or only part of it. We illustrate the arguments by adopting a simplified DM model with a Z' mediator and assuming a signal in a future xenon direct detection experiment.

  3. Halo-independent tests of dark matter direct detection signals: local DM density, LHC, and thermal freeze-out

    SciTech Connect

    Blennow, Mattias; Herrero-Garcia, Juan; Schwetz, Thomas; Vogl, Stefan

    2015-08-19

    From an assumed signal in a Dark Matter (DM) direct detection experiment a lower bound on the product of the DM-nucleon scattering cross section and the local DM density is derived, which is independent of the local DM velocity distribution. This can be combined with astrophysical determinations of the local DM density. Within a given particle physics model the bound also allows a robust comparison of a direct detection signal with limits from the LHC. Furthermore, the bound can be used to formulate a condition which has to be fulfilled if the particle responsible for the direct detection signal is a thermal relic, regardless of whether it constitutes all DM or only part of it. We illustrate the arguments by adopting a simplified DM model with a Z{sup ′} mediator and assuming a signal in a future xenon direct detection experiment.

  4. Effect of gravitational focusing on annual modulation in dark-matter direct-detection experiments.

    PubMed

    Lee, Samuel K; Lisanti, Mariangela; Peter, Annika H G; Safdi, Benjamin R

    2014-01-10

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10)  GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  5. Hypercharged dark matter and direct detection as a probe of reheating.

    PubMed

    Feldstein, Brian; Ibe, Masahiro; Yanagida, Tsutomu T

    2014-03-14

    The lack of new physics at the LHC so far weakens the argument for TeV scale thermal dark matter. On the other hand, heavier, nonthermal dark matter is generally difficult to test experimentally. Here we consider the interesting and generic case of hypercharged dark matter, which can allow for heavy dark matter masses without spoiling testability. Planned direct detection experiments will be able to see a signal for masses up to an incredible 1010  GeV, and this can further serve to probe the reheating temperature up to about 109  GeV, as determined by the nonthermal dark matter relic abundance. The Z-mediated nature of the dark matter scattering may be determined in principle by comparing scattering rates on different detector nuclei, which in turn can reveal the dark matter mass. We will discuss the extent to which future experiments may be able to make such a determination.

  6. High speed QPPM direct detection optical communication receivers for FSDD intersatellite links

    NASA Technical Reports Server (NTRS)

    Davidson, Frederic M.; Sun, Xiaoli

    1993-01-01

    This final report consists of four separate reports, one for each project involved in this contract. The first report is entitled '325 Mbps QPPM (quaternary pulse position modulation) Direct Detection Free Space Optical Communication Encoder and Receiver,' which was our primary work. The second report is entitled 'Test Results of the 325 Mbps QPPM High Speed Data Transmission GaAs ASICs,' which describes our work in connection with Galaxy Microsystems, Inc. who produced these ASICs for NASA. The third report, 'Receiver Performance Analysis of BPPM Optical Communication Systems Using 1.3 micron Wavelength Transmitter and InGaAs PIN Photodiodes,' was prepared at the request of the NASA/Photonics Branch for their efforts in upgrading the 1773 optical fiber data bus. The fourth report, 'Photomultiplier Tubes for Use at 1.064 micron Wavelength,' was also prepared at the request of the NASA/Photonics Branch as a research project.

  7. Direct detection of resonant electron pitch angle scattering by whistler waves in a laboratory plasma.

    PubMed

    Van Compernolle, B; Bortnik, J; Pribyl, P; Gekelman, W; Nakamoto, M; Tao, X; Thorne, R M

    2014-04-11

    Resonant interactions between energetic electrons and whistler mode waves are an essential ingredient in the space environment, and in particular in controlling the dynamic variability of Earth's natural radiation belts, which is a topic of extreme interest at the moment. Although the theory describing resonant wave-particle interaction has been present for several decades, it has not been hitherto tested in a controlled laboratory setting. In the present Letter we report on the first laboratory experiment to directly detect resonant pitch angle scattering of energetic (∼keV) electrons due to whistler mode waves. We show that the whistler mode wave deflects energetic electrons at precisely the predicted resonant energy, and that varying both the maximum beam energy, and the wave frequency, alters the energetic electron beam very close to the resonant energy.

  8. Mathematical morphology: detection and characterization of directed axonal growth in vitro

    NASA Astrophysics Data System (ADS)

    Gonzalez, M. A.; Ballarin, V. L.; Rapacioli, M.; Rodríguez Celín, A.; Sánchez, V.; Flores, V.

    2011-12-01

    Neurite growth in vitro, neuritogenesis, is a widespread methodology in the field of developmental neurobiology. Morphological analysis of growing neurites is usually a difficult task because of their thinness and their low contrast that makes it difficult to observe clearly their shape, number, length and spatial orientation. This paper presents the use of the granulometric size distribution function to obtain, automatically, information about the shape, size and spatial orientation of growing axons in tissue cultures. The results presented show the efficiency of the granulometric size distribution for this application. The automatic detection of growing axons and the precise characterization of a relevant parameter, indicative of the axonal growth spatial orientation, was obtained by this morphological tool. The developed algorithms facilitates the analysis of these images by automatically quantifying the angle of deviation of the direction of growth, which is important given the large number of images that need to be processed for this type of study.

  9. NASA/GSFC program in direct detection optical communications for intersatellite links

    NASA Astrophysics Data System (ADS)

    Fitzmaurice, M.; Bruno, R.

    1989-10-01

    NASA-Goddard has undertaken the development of direct-detection optical communications for space applications at the Gbps data rate channel capability level. The primary challenges to optical communications designers lie in the development of reliable optical power sources, as well as of high performance pointing/acquisition/tracking systems required by the narrow widths of the transmitted optical beams. GaAlAs diodes and their arrays are currently the most attractive technology for optical transmitters; pioneering work has also been conducted on dichroic and grating techniques for combining the power of several laser diodes. Attention is given to the performance obtained for an optical link acquisition and submicroradian tracking/pointing system.

  10. Direct detection of molluscum contagiosum virus in clinical specimens by dot blot hybridization.

    PubMed Central

    Hurst, J W; Forghani, B; Chan, C S; Oshiro, L; Darai, G

    1991-01-01

    A dot blot hybridization protocol was developed for the direct detection of molluscum contagiosum virus (MCV) DNA in clinical specimens submitted for virus isolation. Samples were concentrated by high-speed centrifugation and treated with proteinase K; this was followed by a single phenol-chloroform extraction step. The DNA was denatured, and the entire volume was spotted onto a nitrocellulose membrane. A biotinylated DNA probe specific for the BamHI-C region of MCV type 1 was used for hybridization. Evidence of MCV DNA was visualized by using streptavidin alkaline phosphatase conjugate and 5-bromo-4-chloro-3-indolyl phosphate-nitroblue tetrazolium as the substrate. Results showed that nonspecific hybridization does not occur with herpes simplex virus- or orf virus-infected clinical specimens and that dot blotting is more sensitive and reproducible than electron microscopy. Images PMID:1774321

  11. A comparative study of optimum and suboptimum direct-detection laser ranging receivers

    NASA Technical Reports Server (NTRS)

    Abshire, J. B.

    1978-01-01

    A summary of previously proposed receiver strategies for direct-detection laser ranging receivers is presented. Computer simulations are used to compare performance of candidate implementation strategies in the 1- to 100-photoelectron region. Under the condition of no background radiation, the maximum-likelihood and minimum mean-square error estimators were found to give the same performance for both bell-shaped and rectangular optical-pulse shapes. For signal energies greater than 100 photoelectrons, the root-mean-square range error is shown to decrease as Q to the -1/2 power for bell-shaped pulses and Q to the -1 power for rectangular pulses, where Q represents the average pulse energy. Of several receiver implementations presented, the matched-filter peak detector was found to be preferable. A similar configuration, using a constant-fraction discriminator, exhibited a signal-level dependent time bias.

  12. Fiber-optic Michelson interferometer fixed in a tilted tube for direction-dependent ultrasonic detection

    NASA Astrophysics Data System (ADS)

    Gang, Tingting; Hu, Manli; Qiao, Xueguang; Li, JiaCheng; Shao, Zhihua; Tong, Rongxin; Rong, Qiangzhou

    2017-01-01

    A fiber-optic interferometer is proposed and demonstrated experimentally for ultrasonic detection. The sensor consists of a compact Michelson interferometer (MI), which is fixed in a tilted-tube end-face (45°). Thin gold films are used for the reflective coatings of two arms and one of the interference arms is etched serving as the sensing arm. The spectral sideband filter technique is used to interrogate the continuous and pulse ultrasonic signals (with frequency of 300 KHz). Furthermore, because of the asymmetrical structure of the sensor, it presents strong direction-dependent ultrasonic sensitivity, such that the sensor can be considered a vector detector. The experimental results show that the sensor is highly sensitive to ultrasonic signals, and thus it can be a candidate for ultrasonic imaging of seismic physical models.

  13. First direct sulfuric acid detection in the exhaust plume of a jet aircraft in flight

    NASA Astrophysics Data System (ADS)

    Curtius, J.; Sierau, B.; Arnold, F.; Baumann, R.; Busen, R.; Schulte, P.; Schumann, U.

    Sulfuric acid (SA) was for the first time directly detected in the exhaust plume of a jet aircraft in flight. The measurements were made by a novel aircraft-based VACA (Volatile Aerosol Component Analyzer) instrument of MPI-K Heidelberg while the research aircraft Falcon was chasing another research aircraft ATTAS. The VACA measures the total SA in the gas and in volatile submicron aerosol particles. During the chase the engines of the ATTAS alternatively burned sulfur-poor and sulfur-rich fuel. In the sulfur-rich plume very marked enhancements of total SA were observed of up to 1300 pptv which were closely correlated with ΔCO2 and ΔT and were far above the local ambient atmospheric background-level of typically 15-50 pptv. Our observations indicate a lower limit for the efficiency ɛ for fuel-sulfur conversion to SA of 0.34 %.

  14. 2-Micron Pulsed Direct Detection IPDA Lidar for Atmospheric CO2 Measurement

    NASA Technical Reports Server (NTRS)

    Yu, Jirong; Petros, Mulugeta; Refaat, Tamer; Reithmaier, Karl; Remus, Ruben; Singh, Upendra; Johnson, Will; Boyer, Charlie; Fay, James; Johnston, Susan; Murchison, Luke

    2014-01-01

    A 2-micron high energy, pulsed Integrated Path Differential Absorption (IPDA) lidar has been developed for atmospheric CO2 measurements. Development of this lidar heavily leverages the 2-micron laser technologies developed in LaRC over the last decade. The high pulse energy, direct detection lidar operating at CO2 2-micron absorption band provides an alternate approach to measure CO2 concentrations. This new 2-micron pulsed IPDA lidar has been flown in spring of this year for total ten flights with 27 flight hours. It is able to make measurements of the total amount of atmospheric CO2 from the aircraft to the ground or cloud. It is expected to provide high-precision measurement capability by unambiguously eliminating contamination from aerosols and clouds that can bias the IPDA measurement.

  15. Theoretical and experimental investigation of direct detection optical OFDM transmission using beat interference cancellation receiver.

    PubMed

    Nezamalhosseini, S Alireza; Chen, Lawrence R; Zhuge, Qunbi; Malekiha, Mahdi; Marvasti, Farokh; Plant, David V

    2013-07-01

    We theoretically and experimentally evaluate a beat interference cancellation receiver (BICR) for direct detection optical orthogonal frequency-division multiplexing (DD-OFDM) systems that improves the spectral efficiency (SE) by reducing the guard band between the optical carrier and the optical OFDM signal while mitigating the impact of signal-signal mixing interference (SSMI). Experimental results show that the bit-error-rate (BER) is improved by about three orders of magnitude compared to the conventional receiver after 320 km single-mode fiber (SMF) transmission for 10 Gb/s data with a 4-QAM modulation using reduced guard band single-sideband OFDM (RSSB-OFDM) signal with 1.67 bits/s/Hz SE.

  16. Investigation of PMD in direct-detection optical OFDM with zero padding.

    PubMed

    Li, Xiang; Alphones, Arokiaswami; Zhong, Wen-De; Yu, Changyuan

    2013-09-09

    We investigate the polarization-mode dispersion (PMD) effect of zero padding OFDM (ZP-OFDM) in direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) systems. We first study the conventional equalization method for ZP-OFDM. Then an equalization method based on sorted QR decomposition is proposed to further improve the performance. It is found that the performance improvement of ZP-OFDM is due to the frequency domain oversampling (FDO) induced inter-carrier interference (ICI). Numerical simulation results show that compared with cyclic prefix OFDM (CP-OFDM), ZP-OFDM has a significantly higher tolerance to PMD in DDO-OFDM systems when the channel spectral nulls occur at certain differential group delay (DGD) values.

  17. Application of order cyclostationary demodulation to damage detection in a direct-driven wind turbine bearing

    NASA Astrophysics Data System (ADS)

    Liu, Xiaofeng; Bo, Lin; Peng, Chang

    2014-02-01

    This paper presents a method of fault detection and isolation for a direct-driven wind turbine (DWT) bearing. Computed order tracking is employed to convert the non-stationary envelope signal in the time domain into a quasi-stationary signal in the angular domain by even-angle resampling. Cyclostationary demodulation is then utilized to expose the orders related to fault characteristics in the demodulation spectrum. In order to realize the automatic fault diagnosis and emit a stable alarm about bearing damage, the peak value of the demodulation spectrum is scaled and compared to a defined threshold. The significant advantage of the proposed method is the implementation of an automatic algorithm for DWT bearing diagnostics under randomly varying speed and highly alternating load. Practical applications are provided to show that the proposed approach is able to achieve reliable failure warning in the bearing condition monitoring of a DWT.

  18. DIRECT DETECTION OF SEASONAL CHANGES ON TRITON WITH HUBBLE SPACE TELESCOPE

    SciTech Connect

    Bauer, James M.; Buratti, Bonnie J.; Mosher, Joel A.; Hicks, Michael D.; Goguen, Jay D.; Li Jianyang; Schmidt, Britney E. E-mail: Bonnie.Buratti@jpl.nasa.go E-mail: hicksm@scn.jpl.nasa.go E-mail: jyli@astro.umd.ed

    2010-11-01

    Triton is one of the few bodies in the solar system with observed cryo-volcanic activity, in the form of plumes at its south pole, which suggests large-scale surface volatile transport over time. Triton's large variations in obliquity have motivated prior predictions of changing atmospheric column densities of several orders of magnitude, driven by seasonal evaporation of surface volatiles. Using the Hubble Space Telescope, we directly imaged Triton's surface and have detected large-scale differences in increased and decreased reflectance when compared with Voyager data at UV, visual, and methane-band wavelengths. Our surface map shows regions of increased brightness at near-equatorial latitudes and near the Neptune-facing side, and darkened regions near longitudes of {+-}180{sup 0}, indicating the presence of ongoing seasonal volatile transport.

  19. Direct Detection Doppler Lidar Wind Measurements Obtained During the 2002 International H2O Project (IHOP)

    NASA Technical Reports Server (NTRS)

    Gentry, Bruce; Li, Steven; Chen, Huai-Lin; Comer, Joseph; Mathur, Savyasachee; Bobler, Jeremy

    2005-01-01

    The Goddard Lidar Observatory for Winds (GLOW) is a mobile Doppler lidar system that uses direct detection techniques for profiling winds in the troposphere and lower stratosphere. In May and June of 2002 GLOW was deployed to the Southern Great Plains of the US to participate in the International H2O Project (IHOP). GLOW was located at the Homestead profiling site in the Oklahoma panhandle about 15 km east of the SPOL radar. Several other Goddard lidars, the Scanning Raman Lidar (SRL) and HARLIE, as well as radars and passive instruments were permanently operated from the Homestead site during the IHOP campaign providing a unique cluster of observations. During the IHOP observation period (May 14, 2002 to June 25, 2002) over 240 hours of wind profile measurements were obtained with GLOW. In this paper we will describe the GLOW instrument as it was configured for the IHOP campaign and we will present examples of wind profiles obtained.

  20. Effect of Gravitational Focusing on Annual Modulation in Dark-Matter Direct-Detection Experiments

    NASA Astrophysics Data System (ADS)

    Lee, Samuel K.; Lisanti, Mariangela; Peter, Annika H. G.; Safdi, Benjamin R.

    2014-01-01

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10) GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  1. Direct Detection of Pure ac Spin Current by X-Ray Pump-Probe Measurements

    NASA Astrophysics Data System (ADS)

    Li, J.; Shelford, L. R.; Shafer, P.; Tan, A.; Deng, J. X.; Keatley, P. S.; Hwang, C.; Arenholz, E.; van der Laan, G.; Hicken, R. J.; Qiu, Z. Q.

    2016-08-01

    Despite recent progress in spin-current research, the detection of spin current has mostly remained indirect. By synchronizing a microwave waveform with synchrotron x-ray pulses, we use the ferromagnetic resonance of the Py (Ni81Fe19 ) layer in a Py /Cu /Cu75Mn25/Cu /Co multilayer to pump a pure ac spin current into the Cu75Mn25 and Co layers, and then directly probe the spin current within the Cu75Mn25 layer and the spin dynamics of the Co layer by x-ray magnetic circular dichroism. This element-resolved pump-probe measurement unambiguously identifies the ac spin current in the Cu75Mn25 layer.

  2. Directed Design of Experiments for Validating Probability of Detection Capability of a Testing System

    NASA Technical Reports Server (NTRS)

    Generazio, Edward R. (Inventor)

    2012-01-01

    A method of validating a probability of detection (POD) testing system using directed design of experiments (DOE) includes recording an input data set of observed hit and miss or analog data for sample components as a function of size of a flaw in the components. The method also includes processing the input data set to generate an output data set having an optimal class width, assigning a case number to the output data set, and generating validation instructions based on the assigned case number. An apparatus includes a host machine for receiving the input data set from the testing system and an algorithm for executing DOE to validate the test system. The algorithm applies DOE to the input data set to determine a data set having an optimal class width, assigns a case number to that data set, and generates validation instructions based on the case number.

  3. Digital EPR with an arbitrary waveform generator and direct detection at the carrier frequency.

    PubMed

    Tseitlin, Mark; Quine, Richard W; Rinard, George A; Eaton, Sandra S; Eaton, Gareth R

    2011-12-01

    A digital EPR spectrometer was constructed by replacing the traditional bridge with an arbitrary waveform generator (AWG) to produce excitation patterns and a high-speed digitizer for direct detection of the spin system response at the carrier frequency. Digital down-conversion produced baseband signals in quadrature with very precise orthogonality. Real-time resonator tuning was performed by monitoring the Fourier transforms of signals reflected from the resonator during frequency sweeps generated by the AWG. The capabilities of the system were demonstrated by rapid magnetic field scans at 256 MHz carrier frequency, and FID and spin echo experiments at 1 and 10 GHz carrier frequencies. For the rapid scan experiments the leakage through a cross-loop resonator was compensated by adjusting the amplitude and phase of a sinusoid at the carrier frequency that was generated with another AWG channel.

  4. Construction of Protein-Based Biosensors Using Ligand-Directed Chemistry for Detecting Analyte Binding.

    PubMed

    Yamaura, Kei; Kiyonaka, Shigeki; Hamachi, Itaru

    2017-01-01

    Protein-based fluorescent biosensors are powerful tools for quantitative detection of biomolecules or drugs with high sensitivity under physiological conditions. However, conventional methods for construction of biosensors require structural data with high resolution or amino acid sequence information in most cases, which hampers applicability of this method to structurally complicated receptor proteins. To sidestep such limitations, we recently developed a new method that employs ligand-directed chemistry coupled with a bimolecular fluorescence quenching and recovery system, which enabled the conversion of various kinds of membrane-bound receptors to "turn-on" type fluorescent sensors. Here, we describe a protocol for construction of "turn-on" type fluorescent biosensors based on the GABAA receptor which permits quantitative analysis of the ligand affinity.

  5. Direct detection of antibody concentration and affinity in human serum using microscale thermophoresis.

    PubMed

    Lippok, Svenja; Seidel, Susanne A I; Duhr, Stefan; Uhland, Kerstin; Holthoff, Hans-Peter; Jenne, Dieter; Braun, Dieter

    2012-04-17

    The direct quantification of both the binding affinity and absolute concentration of disease-related biomarkers in biological fluids is particularly beneficial for differential diagnosis and therapy monitoring. Here, we extend microscale thermophoresis to target immunological questions. Optically generated thermal gradients were used to deplete fluorescently marked antigens in 2- and 10-fold-diluted human serum. We devised and validated an autocompetitive strategy to independently fit the concentration and dissociation constant of autoimmune antibodies against the cardiac β1-adrenergic receptor related to dilated cardiomyopathy. As an artificial antigen, the peptide COR1 was designed to mimic the second extracellular receptor loop. Thermophoresis resolved antibody concentrations from 2 to 200 nM and measured the dissociation constant as 75 nM. The approach quantifies antibody binding in its native serum environment within microliter volumes and without any surface attachments. The simplicity of the mix and probe protocol minimizes systematic errors, making thermophoresis a promising detection method for personalized medicine.

  6. NASA/GSFC program in direct detection optical communications for intersatellite links

    NASA Technical Reports Server (NTRS)

    Fitzmaurice, M.; Bruno, R.

    1989-01-01

    NASA-Goddard has undertaken the development of direct-detection optical communications for space applications at the Gbps data rate channel capability level. The primary challenges to optical communications designers lie in the development of reliable optical power sources, as well as of high performance pointing/acquisition/tracking systems required by the narrow widths of the transmitted optical beams. GaAlAs diodes and their arrays are currently the most attractive technology for optical transmitters; pioneering work has also been conducted on dichroic and grating techniques for combining the power of several laser diodes. Attention is given to the performance obtained for an optical link acquisition and submicroradian tracking/pointing system.

  7. Direct-detection optical communication with color coded pulse position modulation signaling

    NASA Technical Reports Server (NTRS)

    Davidson, F.

    1985-01-01

    The performance characteristics of a direct-detection optical communication system which is based on a laser transmitter which produces single light pulses at selected nonoverlapping optical center frequencies are discussed. The signal format, called color coded pulse position modulation (CCPPM), uses more of the total available response bandwidth characteristics of the photodetector than does ordinary PPM signaling. The advantages of CCPPM signaling are obtained at the expense of an increased optical bandwidth of the transmitted signal and a more complicated transmitter and receiver structure. When the signal format is used in conjunction with block length Reed-Solomon codes, high data rates and reliable high-speed optical communications under conditions of optimal energy efficiency are obtained.

  8. Digital baseband predistortion for SSII cancellation in EAM-based direct-detection OFDM systems

    NASA Astrophysics Data System (ADS)

    Yang, Pengfei; Shi, Hu; Chen, Xue

    2017-01-01

    To increase the available bandwidth of electro-absorption modulator (EAM)-based direct-detection orthogonal frequency division multiplexing (DD-OFDM) systems, which suffers from dispersion- and chirp-induced power fading, the multiband subcarrier allocation scheme and adaptive modulation formats are adopted. However, the subcarrier-to-subcarrier intermixing interference (SSII) would degrade signal-to-noise ratio on the increased bandwidth and become a bottleneck of the multiband systems. In this paper, a novel digital baseband predistortion is proposed to minimize the penalty of SSII. The experimental results show that a 30 Gbps EAM-based DD-OFDM system with the proposed technique could improve 3 dB receiver sensitivity compared with the system without the technique over 100 km long single mode fiber transmission and only decreases 1.0 dB in comparison with the back-to-back situation.

  9. Electroweak Symmetry Breaking from the Soft Portal into Dark Matter and Prediction for Direct Detection

    SciTech Connect

    Kadastik, Mario; Kannike, Kristjan; Racioppi, Antonio; Raidal, Martti

    2010-05-21

    Scalar dark matter (DM) can have dimensionful coupling to the Higgs boson - the soft portal into DM - which is predicted to be unsuppressed by the underlying SO(10) grand unified theory (GUT). The dimensionful coupling can be large, {mu}/v>>1, without spoiling the perturbativity of low energy theory up to the GUT scale. We show that the soft portal into DM naturally triggers radiative electroweak symmetry breaking (EWSB) via large 1-loop DM corrections to the effective potential. In this scenario, EWSB, the DM thermal freeze-out cross section, and DM scattering on nuclei are all dominated by the same coupling, predicting the DM mass range to be 700 GeVdirect detection cross section is predicted to be just below the present experimental bounds.

  10. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    NASA Astrophysics Data System (ADS)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  11. Experimental evaluation of pilot pattern design in direct-detection optical OFDM transmission

    NASA Astrophysics Data System (ADS)

    Liu, Lilong; Yang, Xuelin; Hu, Weisheng

    2013-05-01

    Pilot patterns are experimentally investigated to characterize the frequency/time dependence of the optical orthogonal frequency division multiplexing (OFDM) signal transmission. The optical signal performance is evaluated in terms of error vector magnitude (EVM). It is shown that, the quality of the OFDM signals can be improved up to 4 dB in EVM, for 10 Gb/s, 16-QAM-encoded OFDM signals after 20 km single mode fiber (SMF) transmission with intensity-modulation and direct-detection (IMDD). The best performance is obtained by applying pilot tones for all subcarriers, which implies that the optical OFDM transmission is relatively quasi-static with respect to the subcarrier frequencies. The noise of the OFDM signals originated mainly from the amplitude/phase fluctuation of optical signal with time.

  12. Electronic polarization-division demultiplexing based on digital signal processing in intensity-modulation direct-detection optical communication systems.

    PubMed

    Kikuchi, Kazuro

    2014-01-27

    We propose a novel configuration of optical receivers for intensity-modulation direct-detection (IM · DD) systems, which can cope with dual-polarization (DP) optical signals electrically. Using a Stokes analyzer and a newly-developed digital signal-processing (DSP) algorithm, we can achieve polarization tracking and demultiplexing in the digital domain after direct detection. Simulation results show that the power penalty stemming from digital polarization manipulations is negligibly small.

  13. Rapid Detection of Thrombin and Other Protease Activity Directly in Whole Blood

    NASA Astrophysics Data System (ADS)

    Yu, Johnson Chung Sing

    Thrombin is a serine protease that plays a key role in the clotting cascade to promote hemostasis following injury to the endothelium. From a clinical diagnostic perspective, in-vivo thrombin activity is linked to various blood clotting disorders, as well as cardiovascular disease (DVT, arteriosclerosis, etc). Thus, the ability to rapidly measure protease activity directly in whole blood will provide important new diagnostics, and clinical researchers with a powerful tool to further elucidate the relationship between circulating protease levels and disease. The ultimate goal is to design novel point of care (POC) diagnostic devices that are capable of monitoring protease activities directly in whole blood and biological sample. A charge-changing substrate specific to the thrombin enzyme was engineered and its functionality was confirmed by a series of experiments. This led to the preliminary design, construction, and testing of two device platforms deemed fully functional for the electrophoretic separation and focusing of charged peptide fragments. The concept of using the existing charge-changing substrate platform for bacterial protease detection was also investigated. Certain strains of E coli are associated with severe symptoms such as abdominal cramps, bloody diarrhea, and vomiting. The OmpT protease is expressed on the outer membrane of E coli and plays a role in the cleavage of antimicrobial peptides, the degradation of recombinant heterologous proteins, and the activation of plasminogen in the host. Thus, a synthetic peptide substrate specific to the OmpT protease was designed and modeled for the purpose of detecting E coli in biological sample.

  14. Atypical sensors for direct and rapid neuronal detection of bacterial pathogens.

    PubMed

    Lim, Ji Yeon; Choi, Seung-In; Choi, Geunyeol; Hwang, Sun Wook

    2016-03-09

    Bacterial infection can threaten the normal biological functions of a host, often leading to a disease. Hosts have developed complex immune systems to cope with the danger. Preceding the elimination of pathogens, selective recognition of the non-self invaders is necessary. At the forefront of the body's defenses are the innate immune cells, which are equipped with particular sensor molecules that can detect common exterior patterns of invading pathogens and their secreting toxins as well as with phagocytic machinery. Inflammatory mediators and cytokines released from these innate immune cells and infected tissues can boost the inflammatory cascade and further recruit adaptive immune cells to maximize the elimination and resolution. The nervous system also seems to interact with this process, mostly known to be affected by the inflammatory mediators through the binding of neuronal receptors, consequently activating neural circuits that tune the local and systemic inflammatory states. Recent research has suggested new contact points: direct interactions of sensory neurons with pathogens. Latest findings demonstrated that the sensory neurons not only share pattern recognition mechanisms with innate immune cells, but also utilize endogenous and exogenous electrogenic components for bacterial pathogen detection, by which the electrical firing prompts faster information flow than what could be achieved when the immune system is solely involved. As a result, rapid pain generation and active accommodation of the immune status occur. Here we introduced the sensory neuron-specific detector molecules for directly responding to bacterial pathogens and their signaling mechanisms. We also discussed extended issues that need to be explored in the future.

  15. Direct magnetic resonance detection of myelin and prospects for quantitative imaging of myelin density

    PubMed Central

    Wilhelm, Michael J.; Ong, Henry H.; Tsai, Ping-Huei; Hackney, David B.; Wehrli, Felix W.

    2012-01-01

    Magnetic resonance imaging has previously demonstrated its potential for indirectly mapping myelin density, either by relaxometric detection of myelin water or magnetization transfer. Here, we investigated whether myelin can be detected and possibly quantified directly. We identified the spectrum of myelin in the spinal cord in situ as well as in myelin lipids extracted via a sucrose gradient method, and investigated its spectral properties. High-resolution solution NMR spectroscopy showed the extract composition to be in agreement with myelin’s known chemical make-up. The 400-MHz 1H spectrum of the myelin extract, at 20 °C (room temperature) and 37 °C, consists of a narrow water resonance superimposed on a broad envelope shifted ∼3.5 ppm upfield, suggestive of long-chain methylene protons. Superimposed on this signal are narrow components resulting from functional groups matching the chemical shifts of the constituents making up myelin lipids. The spectrum could be modeled as a sum of super-Lorentzians with a T2* distribution covering a wide range of values (0.008–26 ms). Overall, there was a high degree of similarity between the spectral properties of extracted myelin lipids and those found in neural tissue. The normalized difference spectrum had the hallmarks of membrane proteins, not present in the myelin extract. Using 3D radially ramp-sampled proton MRI, with a combination of adiabatic inversion and echo subtraction, the feasibility of direct myelin imaging in situ is demonstrated. Last, the integrated signal from myelin suspensions is shown, both spectroscopically and by imaging, to scale with concentration, suggesting the potential for quantitative determination of myelin density. PMID:22628562

  16. Direct exoplanet detection and characterization using the ANDROMEDA method: Performance on VLT/NaCo data

    NASA Astrophysics Data System (ADS)

    Cantalloube, F.; Mouillet, D.; Mugnier, L. M.; Milli, J.; Absil, O.; Gomez Gonzalez, C. A.; Chauvin, G.; Beuzit, J.-L.; Cornia, A.

    2015-10-01

    Context. The direct detection of exoplanets with high-contrast imaging requires advanced data processing methods to disentangle potential planetary signals from bright quasi-static speckles. Among them, angular differential imaging (ADI) permits potential planetary signals with a known rotation rate to be separated from instrumental speckles that are either statics or slowly variable. The method presented in this paper, called ANDROMEDA for ANgular Differential OptiMal Exoplanet Detection Algorithm, is based on a maximum likelihood approach to ADI and is used to estimate the position and the flux of any point source present in the field of view. Aims: In order to optimize and experimentally validate this previously proposed method, we applied ANDROMEDA to real VLT/NaCo data. In addition to its pure detection capability, we investigated the possibility of defining simple and efficient criteria for automatic point source extraction able to support the processing of large surveys. Methods: To assess the performance of the method, we applied ANDROMEDA on VLT/NaCo data of TYC-8979-1683-1 which is surrounded by numerous bright stars and on which we added synthetic planets of known position and flux in the field. In order to accommodate the real data properties, it was necessary to develop additional pre-processing and post-processing steps to the initially proposed algorithm. We then investigated its skill in the challenging case of a well-known target, β Pictoris, whose companion is close to the detection limit and we compared our results to those obtained by another method based on principal component analysis (PCA). Results: Application on VLT/NaCo data demonstrates the ability of ANDROMEDA to automatically detect and characterize point sources present in the image field. We end up with a robust method bringing consistent results with a sensitivity similar to the recently published algorithms, with only two parameters to be fine tuned. Moreover, the companion flux

  17. Evaluation of three simple direct or indirect carbonyl detection methods for characterization of oxidative modifications of proteins.

    PubMed

    Vásquez-Garzón, Verónica R; Rouimi, Patrick; Jouanin, Isabelle; Waeg, Georg; Zarkovic, Neven; Villa-Treviño, Saul; Guéraud, Françoise

    2012-05-01

    Among disruptions induced by oxidative stress, modifications of proteins, particularly irreversible carbonylation, are associated with the development of several diseases, including cardiovascular diseases, neurodegenerative diseases, and cancer. Carbonylation of proteins can occur directly or indirectly through the adduction of lipid oxidation products. In this study, three classical and easy-to-perform techniques to detect direct or indirect carbonylation of proteins were compared. A model protein apomyoglobin and a complex mixture of rat liver cytosolic proteins were exposed to cumene hydroperoxide oxidation or adduction to the lipid peroxidation product 4-hydroxynonenal in order to test direct or indirect carbonylation, respectively. The technique using a specific anti-4-hydroxynonenal-histidine adduct antibody was effective to detect in vitro modification of model apomyoglobin and cytosolic proteins by 4-hydroxynonenal but not by direct carbonylation which was achieved by techniques using biotin-coupled hydrazide or dinitrophenylhydrazine derivatization of carbonyls. Sequential use of these methods enabled the detection of both direct and indirect carbonyl modification in proteins, although constitutively biotinylated proteins were detected by biotin-hydrazide. Although rather classical and efficient, methods for carbonyl detection on proteins in oxidative stress studies may be biased by some artifactual detections and complicated by proteins multimerizations. The use of more and more specific available antibodies is recommended to complete detection of lipid peroxidation product adducts on proteins.

  18. Electrophoretic Separation-Mass Spectrometric Detection on Polymer Microchip Directly Integrated with a Nanospray Tip

    NASA Astrophysics Data System (ADS)

    Kitagawa, Fumihiko; Shinohara, Hidetoshi; Mizuno, Jun; Otsuka, Koji; Shoji, Shuichi

    We fabricated a polymer chip for microchip electrophoresis-mass spectrometry (MCE—MS). As a substrate material, cycloolefin polymer (COP) was selected due to its high chemical durability and easy metallization for the electrode. A COP microchip with a conventional cross-type channel configuration for the MCE separation was fabricated by hot embossing. After bonding with a rid substrate, a nano electrospray ionization (nano-ESI) tip structure for MS detection was machined directly at the opening of the separation channel end. A gold electrode to keep the electric contact for ESI was deposited around the nanospray tip by electron beam evaporation. When the voltage of 3.0 and 2.0 kV was applied to the inlet and the ESI electrode, respectively, the formation of Taylor cone and stable electrospray were observed at the channel opening. In infusion analysis of caffeine, the MS spectrum with parent mass number of 195, which accords with that of the protonated caffeine, was successfully obtained in the positive mode. Furthermore, the MCE separation and ESI-MS detection of caffeine and arginine was also successfully achieved with resolution of 1.0. Therefore, these results demonstrated that the fabricated microchip integrated with the nano-ESI tip can be employed as the MCE—ESI-MS device.

  19. An impedimetric immunosensor for the detection of autoantibodies directed against gliadins.

    PubMed

    Balkenhohl, T; Lisdat, F

    2007-04-01

    An immunosensor has been developed for the detection of autoantibodies directed against wheat gliadin, a protein fraction of cereal gluten which is involved in celiac disease. The immunosensor is based on the immobilization of gliadins onto gold electrodes covered with a polyelectrolyte layer of poly(4-styrenesulfonic acid sodium salt). The immobilization was monitored by quartz crystal microbalance (QCM) analysis. The antigen-antibody interaction signal was amplified by an incubation step with peroxidase-labeled immunoglobulins and subsequent peroxidase-catalyzed oxidation of 3-amino-9-ethylcarbazole (AEC). Changes in the insulating properties of the electrode layer were measured by electrochemical impedance spectroscopy (EIS) in the presence of ferri/ferro-cyanide. Impedance spectra could be fitted to a Randles equivalent circuit with high accuracy. Exposing the sensor electrodes to various antigliadin antibody concentrations resulted in proportional changes in the charge transfer resistance. A calibration graph for the detection of antigliadin antibodies was established for antibody concentrations between 10(-8) and 10(-6) M. Finally, the sensor was used for the determination of antigliadin autoantibodies of the IgG and IgA type in several human sera.

  20. Digital Quantification of miRNA directly in plasma using Integrated Comprehensive Droplet Digital Detection

    PubMed Central

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M. Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N.; Zell, Jason A.; Digman, Michelle A.; Gratton, Enrico

    2015-01-01

    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the ‘Integrated Comprehensive Droplet Digital Detection’ (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10,000 copies/mL in ≤ 3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing. PMID:26387763

  1. Design and characterization of a direct ELISA for the detection and quantification of leucomalachite green.

    PubMed

    Singh, Gurmit; Koerner, Terence; Gelinas, Jean-Marc; Abbott, Michael; Brady, Beth; Huet, Anne-Catherine; Charlier, Caroline; Delahaut, Philippe; Godefroy, Samuel Benrejeb

    2011-06-01

    Malachite green (MG), a member of the N-methylated triphenylmethane class of dyes, has long been used to control fungal and protozoan infections in fish. MG is easily absorbed by fish during waterborne exposure and is rapidly metabolized into leucomalachite green (LMG), which is known for its long residence time in edible fish tissue. This paper describes the development of an enzyme-linked immunosorbent assay (ELISA) for the detection and quantification of LMG in fish tissue. This development includes a simple and versatile method for the conversion of LMG to monodesmethyl-LMG, which is then conjugated to bovine serum albumin (BSA) to produce an immunogenic material. Rabbit polyclonal antibodies are generated against this immunogen, purified and used to develop a direct competitive enzyme-linked immunosorbent assay (ELISA) for the screening and quantification of LMG in fish tissue. The assay performed well, with a limit of detection (LOD) and limit of quantification (LOQ) of 0.1 and 0.3 ng g(-1) of fish tissue, respectively. The average extraction efficiency from a matrix of tilapia fillets was approximately 73% and the day-to-day reproducibility for these extractions in the assay was between 5 and 10%.

  2. DIRECT IMAGING DETECTION OF METHANE IN THE ATMOSPHERE OF GJ 504 b

    SciTech Connect

    Janson, Markus; Brandt, Timothy D.; Kuzuhara, Masayuki; Spiegel, David S.; Thalmann, Christian; Currie, Thayne; Bonnefoy, Mickaël; Zimmerman, Neil; Schlieder, Joshua; Brandner, Wolfgang; Feldt, Markus; Sorahana, Satoko; Kotani, Takayuki; Hashimoto, Jun; Kusakabe, Nobuhiko; Kudo, Tomoyuki; Egner, Sebastian; Abe, Lyu; Carson, Joseph C.; Goto, Miwa; and others

    2013-11-20

    Most exoplanets detected by direct imaging thus far have been characterized by relatively hot (≳1000 K) and cloudy atmospheres. A surprising feature in some of their atmospheres has been a distinct lack of methane, possibly implying non-equilibrium chemistry. Recently, we reported the discovery of a planetary companion to the Sun-like star GJ 504 using Subaru/HiCIAO within the Strategic Exploration of Exoplanets and Disks with Subaru survey. The planet is substantially colder (<600 K) than previously imaged planets, and has indications of fewer clouds, which implies that it represents a new class of planetary atmospheres with expected similarities to late T-type brown dwarfs in the same temperature range. If so, one might also expect the presence of significant methane absorption, which is characteristic of such objects. Here, we report the detection of deep methane absorption in the atmosphere of GJ 504 b, using the Spectral Differential Imaging mode of HiCIAO to distinguish the absorption features around 1.6 μm. We also report updated JHK photometry based on new K {sub s}-band data and a re-analysis of the existing data. The results support the notion that GJ 504 b has atmospheric properties distinct from other imaged exoplanets, and will become a useful reference object for future planets in the same temperature range.

  3. Application of CdSe quantum dots for the direct detection of TNT.

    PubMed

    Yi, Kui-Yu

    2016-02-01

    CdSe quantum dots were synthesized through a simple, green organic-phase method. Paraffin was used as the reaction solvent and a reducing agent, oleic acid was the reaction ligand, and oleyl amine was the stabilizer. Based on the phenomenon of TNT quenched oil-soluble CdSe quantum dot fluorescence, a simple, fast, and direct method of TNT detection was established. Under optimum conditions, the degree of fluorescence quenching of oil-soluble CdSe quantum dots had a good linear correlation with TNT concentration in the 1.0×10(-7)-5.0×10(-5) mol/L range, and the correlation coefficient was 0.9990. TNT detection limit was 2.1×10(-8)mol/L. The method was successfully used to determine TNT-explosion dust samples, results were satisfactory. The fluorescence quenching mechanism of oil-soluble CdSe quantum dots by TNT was also discussed.

  4. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    PubMed

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  5. Direct-detection optical OFDM superchannel for long-reach PON using pilot regeneration.

    PubMed

    Hu, Rong; Yang, Qi; Xiao, Xiao; Gui, Tao; Li, Zhaohui; Luo, Ming; Yu, Shaohua; You, Shanhong

    2013-11-04

    We demonstrate a novel long-reach PON downstream scheme based on the regenerated pilot assisted direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) superchannel transmission. We use the optical comb source to form DDO-OFDM superchannel, and reserve the center carrier as a seed pilot. The seed pilot is further tracked and reused to generate multiple optical carriers at the local exchange. Each regenerated pilot carrier is selected to beat with an adjacent OFDM sub-band at ONU, so that the electrical bandwidth limitation can be much released compared to the conventional DDO-OFDM superchannel detection. With the proposed proof-of-concept architecture, we experimentally demonstrated a 116.7 Gb/s superchannel OFDM-PON system with transmission reach of 100 km, and 1:64 splitting ratio. We analyze the impact of carrier-to-sideband power ratio (CSPR) on system performance. The experiment result shows that, 5 dB power margin is still remained at ONU using such technique.

  6. Direct In Vivo Electrochemical Detection of Haemoglobin in Red Blood Cells

    NASA Astrophysics Data System (ADS)

    Toh, Rou Jun; Peng, Weng Kung; Han, Jongyoon; Pumera, Martin

    2014-08-01

    The electrochemical behavior of iron ion in haemoglobin provides insight to the chemical activity in the red blood cell which is important in the field of hematology. Herein, the detection of haemoglobin in human red blood cells on glassy carbon electrode (GC) was demonstrated. Red blood cells or raw blood cells was immobilized on a glassy carbon electrode surface with Nafion films employed to sandwich the layer of biological sample firmly on the electrode surface. Cyclic voltammetry (CV) analyses revealed a well-defined reduction peak for haemoglobin at about -0.30 V (vs. Ag/AgCl) at the red blood cell (GC-Nf-RBC-3Nf) and blood (GC-Nf-B-3Nf) film modified GCE in a pH 3.5 phosphate buffer solution. We further demonstrated that the complex biological conditions of a human red blood cell displayed no interference with the detection of haemoglobin. Such findings shall have an implication on the possibilities of studying the electrochemical behaviour of haemoglobin directly from human blood, for various scientific and clinical purposes.

  7. Lenslet Array to Further Suppress Star Light for Direct Exoplanet Detection

    NASA Technical Reports Server (NTRS)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-01-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  8. Bino variations: Effective field theory methods for dark matter direct detection

    NASA Astrophysics Data System (ADS)

    Berlin, Asher; Robertson, Denis S.; Solon, Mikhail P.; Zurek, Kathryn M.

    2016-05-01

    We apply effective field theory methods to compute bino-nucleon scattering, in the case where tree-level interactions are suppressed and the leading contribution is at loop order via heavy flavor squarks or sleptons. We find that leading log corrections to fixed-order calculations can increase the bino mass reach of direct detection experiments by a factor of 2 in some models. These effects are particularly large for the bino-sbottom coannihilation region, where bino dark matter as heavy as 5-10 TeV may be detected by near future experiments. For the case of stop- and selectron-loop mediated scattering, an experiment reaching the neutrino background will probe thermal binos as heavy as 500 and 300 GeV, respectively. We present three key examples that illustrate in detail the framework for determining weak scale coefficients, and for mapping onto a low-energy theory at hadronic scales, through a sequence of effective theories and renormalization group evolution. For the case of a squark degenerate with the bino, we extend the framework to include a squark degree of freedom at low energies using heavy particle effective theory, thus accounting for large logarithms through a "heavy-light current." Benchmark predictions for scattering cross sections are evaluated, including complete leading order matching onto quark and gluon operators, and a systematic treatment of perturbative and hadronic uncertainties.

  9. Direct In Vivo Electrochemical Detection of Haemoglobin in Red Blood Cells

    PubMed Central

    Toh, Rou Jun; Peng, Weng Kung; Han, Jongyoon; Pumera, Martin

    2014-01-01

    The electrochemical behavior of iron ion in haemoglobin provides insight to the chemical activity in the red blood cell which is important in the field of hematology. Herein, the detection of haemoglobin in human red blood cells on glassy carbon electrode (GC) was demonstrated. Red blood cells or raw blood cells was immobilized on a glassy carbon electrode surface with Nafion films employed to sandwich the layer of biological sample firmly on the electrode surface. Cyclic voltammetry (CV) analyses revealed a well-defined reduction peak for haemoglobin at about −0.30 V (vs. Ag/AgCl) at the red blood cell (GC-Nf-RBC-3Nf) and blood (GC-Nf-B-3Nf) film modified GCE in a pH 3.5 phosphate buffer solution. We further demonstrated that the complex biological conditions of a human red blood cell displayed no interference with the detection of haemoglobin. Such findings shall have an implication on the possibilities of studying the electrochemical behaviour of haemoglobin directly from human blood, for various scientific and clinical purposes. PMID:25163492

  10. Direct Imaging Detection of Methane in the Atmosphere of GJ 504 b

    NASA Technical Reports Server (NTRS)

    Janson, Markus; Brandt, Timothy; Kuzuhara, Masayuki; Spiegel, David; Thalmann, Christian; Currie, Thayne; Bonnefoy, Mickael; Zimmerman, Neil; Sorahana, Satoko; Kotani, Takayuki; Schlieder, Joshua; Hashimoto, Jun; Kudo, Tomoyuki; Kusakabe, Nobuhiko; Abe, Lyu; Brandner, Wolfgang; Carson, Joseph; Egner, Sebastian; Feldt, Markus; Goto, Miwa; Grady, Carol; Guyon, Olivier; Hayano, Yutaka; Hayashi, Masahiko; McElwain, Michael

    2013-01-01

    Most exoplanets detected by direct imaging so far have been characterized by relatively hot (approximately greater than1000 K) and cloudy atmospheres. A surprising feature in some of their atmospheres has been a distinct lack of methane, possibly implying non-equilibrium chemistry. Recently, we reported the discovery of a planetary companion to the Sun-like star GJ 504 using Subaru/HiCIAO within the SEEDS survey. The planet is substantially colder (less than 600 K) than previously imaged planets, and has indications of fewer clouds, which implies that it represents a new class of planetary atmospheres with expected similarities to late T-type brown dwarfs in the same temperature range. If so, one might also expect the presence of significant methane absorption, which is characteristic of such objects. Here, we report the detection of deep methane absorption in the atmosphere of GJ 504 b, using the Spectral Differential Imaging mode of HiCIAO to distinguish the absorption feature around 1.6 micrometers. We also report updated JHK photometry based on new K(sub s)-band data and a re-analysis of the existing data. The results support the notion that GJ 504 b has atmospheric properties distinct from other imaged exoplanets, and will become a useful reference object for future planets in the same temperature range.

  11. Direct-detection Free-space Laser Transceiver Test-bed

    NASA Technical Reports Server (NTRS)

    Krainak, Michael A.; Chen, Jeffrey R.; Dabney, Philip W.; Ferrara, Jeffrey F.; Fong, Wai H.; Martino, Anthony J.; McGarry Jan. F.; Merkowitz, Stephen M.; Principe, Caleb M.; Sun, Siaoli; Zagwodzki, Thomas W.

    2008-01-01

    NASA Goddard Space Flight Center is developing a direct-detection free-space laser communications transceiver test bed. The laser transmitter is a master-oscillator power amplifier (MOPA) configuration using a 1060 nm wavelength laser-diode with a two-stage multi-watt Ytterbium fiber amplifier. Dual Mach-Zehnder electro-optic modulators provide an extinction ratio greater than 40 dB. The MOPA design delivered 10-W average power with low-duty-cycle PPM waveforms and achieved 1.7 kW peak power. We use pulse-position modulation format with a pseudo-noise code header to assist clock recovery and frame boundary identification. We are examining the use of low-density-parity-check (LDPC) codes for forward error correction. Our receiver uses an InGaAsP 1 mm diameter photocathode hybrid photomultiplier tube (HPMT) cooled with a thermo-electric cooler. The HPMT has 25% single-photon detection efficiency at 1064 nm wavelength with a dark count rate of 60,000/s at -22 degrees Celsius and a single-photon impulse response of 0.9 ns. We report on progress toward demonstrating a combined laser communications and ranging field experiment.

  12. Design and characterization of a direct ELISA for the detection and quantification of leucomalachite green

    PubMed Central

    Singh, Gurmit; Koerner, Terence; Gelinas, Jean-Marc; Abbott, Michael; Brady, Beth; Huet, Anne-Catherine; Charlier, Caroline; Delahaut, Philippe; Godefroy, Samuel Benrejeb

    2011-01-01

    Malachite green (MG), a member of the N-methylated triphenylmethane class of dyes, has long been used to control fungal and protozoan infections in fish. MG is easily absorbed by fish during waterborne exposure and is rapidly metabolized into leucomalachite green (LMG), which is known for its long residence time in edible fish tissue. This paper describes the development of an enzyme-linked immunosorbent assay (ELISA) for the detection and quantification of LMG in fish tissue. This development includes a simple and versatile method for the conversion of LMG to monodesmethyl-LMG, which is then conjugated to bovine serum albumin (BSA) to produce an immunogenic material. Rabbit polyclonal antibodies are generated against this immunogen, purified and used to develop a direct competitive enzyme-linked immunosorbent assay (ELISA) for the screening and quantification of LMG in fish tissue. The assay performed well, with a limit of detection (LOD) and limit of quantification (LOQ) of 0.1 and 0.3 ng g−1 of fish tissue, respectively. The average extraction efficiency from a matrix of tilapia fillets was approximately 73% and the day-to-day reproducibility for these extractions in the assay was between 5 and 10%. PMID:21623496

  13. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    PubMed

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  14. Syntax-directed content analysis of videotext: application to a map detection recognition system

    NASA Astrophysics Data System (ADS)

    Aradhye, Hrishikesh; Herson, James A.; Myers, Gregory

    2003-01-01

    Video is an increasingly important and ever-growing source of information to the intelligence and homeland defense analyst. A capability to automatically identify the contents of video imagery would enable the analyst to index relevant foreign and domestic news videos in a convenient and meaningful way. To this end, the proposed system aims to help determine the geographic focus of a news story directly from video imagery by detecting and geographically localizing political maps from news broadcasts, using the results of videotext recognition in lieu of a computationally expensive, scale-independent shape recognizer. Our novel method for the geographic localization of a map is based on the premise that the relative placement of text superimposed on a map roughly corresponds to the geographic coordinates of the locations the text represents. Our scheme extracts and recognizes videotext, and iteratively identifies the geographic area, while allowing for OCR errors and artistic freedom. The fast and reliable recognition of such maps by our system may provide valuable context and supporting evidence for other sources, such as speech recognition transcripts. The concepts of syntax-directed content analysis of videotext presented here can be extended to other content analysis systems.

  15. Controlled fabrication of nanopores using a direct focused ion beam approach with back face particle detection.

    PubMed

    Patterson, N; Adams, D P; Hodges, V C; Vasile, M J; Michael, J R; Kotula, P G

    2008-06-11

    We report a direct, ion drilling technique that enables the reproducible fabrication and placement of nanopores in membranes of different thickness. Using a 30 keV focused Ga ion beam column combined with an in situ, back face, multi-channelplate particle detector, nanopores are sputtered in Si(3)N(4) and W/Si(3)N(4) to have diameters as small as 12 nm. Transmission electron microscopy shows that focused ion beam-drilled holes are near-conical with the diameter decreasing from entry to exit side. By monitoring the detector signal during ion exposure, the drilled hole width can be minimized such that the exit-side diameter is smaller than the full width at half-maximum of the nominally Gaussian-shaped incident beam. Judicious choice of the beam defining aperture combined with back face particle detection allows for reproducible exit-side hole diameters between 18 and 100 nm. The nanopore direct drilling technique does not require potentially damaging broad area exposure to tailor hole sizes. Moreover, this technique successfully achieves breakthrough despite the effects of varying membrane thickness, redeposition, polycrystalline grain structure, and slight ion beam current fluctuations.

  16. RadSensor: Xray Detection by Direct Modulation of an Optical Probe Beam

    SciTech Connect

    Lowry, M E; Bennett, C V; Vernon, S P; Bond, T; Welty, R; Behymer, E; Petersen, H; Krey, A; Stewart, R; Kobayashi, N P; Sperry, V; Stephan, P; Reinhardt, C; Simpson, S; Stratton, P; Bionta, R; McKernan, M; Ables, E; Ott, L; Bond, S; Ayers, J.; Landen, O L; Bell, P M

    2003-08-01

    We present a new x-ray detection technique based on optical measurement of the effects of x-ray absorption and electron hole pair creation in a direct band-gap semiconductor. The electron-hole pairs create a frequency dependent shift in optical refractive index and absorption. This is sensed by simultaneously directing an optical carrier beam through the same volume of semiconducting medium that has experienced an xray induced modulation in the electron-hole population. If the operating wavelength of the optical carrier beam is chosen to be close to the semiconductor band-edge, the optical carrier will be modulated significantly in phase and amplitude. This approach should be simultaneously capable of very high sensitivity and excellent temporal response, even in the difficult high-energy xray regime. At xray photon energies near 10 keV and higher, we believe that sub-picosecond temporal responses are possible with near single xray photon sensitivity. The approach also allows for the convenient and EMI robust transport of high-bandwidth information via fiber optics. Furthermore, the technology can be scaled to imaging applications. The basic physics of the detector, implementation considerations, and preliminary experimental data are presented and discussed.

  17. Viscosity-density sensor with resonant torsional paddle for direct detection in liquid.

    PubMed

    Li, H; Wang, J; Li, X; Chen, D

    2011-12-01

    A novel micro-machined biosensor based on the resonant torsional paddle with electromagnetic excitation which can work in liquid directly is presented. The sensor designed consists of two paddles with resonant torsional mode, in which the energy loss of the resonator during the vibration is so lower that it can be suitable for detection in liquid. Finite element method analysis was carried out to guarantee the sensitivity of the sensor. Micro electro-mechanical system (MEMS) bulk silicon processes were adopted to accomplish the fabrication. A positive-feedback circuit with energy compensation is designed to improve the characteristics of the sensor in liquid. Experiments show that the resonant torsional paddle can work directly in liquid and the Q-factor of the sensor in liquid can be improved from 2.65 to 40 with energy compensation. Viscosity tests and density tests for the sensor show that the decrease in frequency and the decrease in Q-factor are related to density and viscosity of the solutions, respectively.

  18. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    PubMed Central

    Soler, Maria; Estevez, M.-Carmen; Alvarez, Mar; Otte, Marinus A.; Sepulveda, Borja; Lechuga, Laura M.

    2014-01-01

    Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis. PMID:24481229

  19. A Mode Detection Method Using the Azimuthal Directivity of a Turbofan Model

    NASA Technical Reports Server (NTRS)

    Thomas, R. H.; Farassat, F.; Clark, L. R.; Gerhold, C. H.; Kelly, J. J.; Becker, L. E.

    1999-01-01

    The azimuthal, far field directivity of a scale fan model was measured in high resolution. The model is a 12 inch diameter rotor with 16 blades followed by 40 stator vanes. The tests were conducted at the nominal 100% speed corresponding to a tip speed of 905 ft/sec. Measurement of the radiated sound field, forward of the fan, was made in an anechoic chamber with an inflow control device and a baffle separating the aft and forward radiated interaction noise. The acoustic field was surveyed with a circular hoop array of 16 microphones which was moved to 14 axial stations. At each axial station the hoop was rotated in half-degree increments to take 736 points in the azimuthal angle. In addition to sound pressure level, the phase angle relative to a reference microphone was measured at each point. The sound pressure level is shown to vary in patterns by 10-15 dB especially for the fundamental tone but also for the first and second harmonic. A far field mode detection method has been developed and used with the data which determines the modes generated by the fan and which then interact to form the azimuthal directivity.

  20. Direct biosensor detection of botulinum neurotoxin endopeptidase activity in sera from patients with type A botulism.

    PubMed

    Lévêque, Christian; Ferracci, Géraldine; Maulet, Yves; Mazuet, Christelle; Popoff, Michel; Seagar, Michael; El Far, Oussama

    2014-07-15

    Botulinum neurotoxin A (BoNT/A) has intrinsic endoprotease activity specific for SNAP-25, a key protein for presynaptic neurotransmitter release. The inactivation of SNAP-25 by BoNT/A underlies botulism, a rare but potentially fatal disease. There is a crucial need for a rapid and sensitive in vitro serological test for BoNT/A to replace the current in vivo mouse bioassay. Cleavage of SNAP-25 by BoNT/A generates neo-epitopes which can be detected by binding of a monoclonal antibody (mAb10F12) and thus measured by surface plasmon resonance (SPR). We have explored two SPR assay formats, with either mAb10F12 or His6-SNAP-25 coupled to the biosensor chip. When BoNT/A was incubated with SNAP-25 in solution and the reaction products were captured on a mAb-coated chip, a sensitivity of 5 fM (0.1LD50/ml serum) was obtained. However, this configuration required prior immunoprecipitation of BoNT/A. A sensitivity of 0.5 fM in 10% serum (0.1 LD50/ml serum) was attained when SNAP-25 was coupled directly to the chip, followed by sequential injection of BoNT/A samples and mAb10F12 into the flow system to achieve on-chip cleavage and detection, respectively. This latter format detected BoNT/A endoprotease activity in 50-100 µl serum samples from all patients (11/11) with type A botulism within 5h. No false positives occurred in sera from healthy subjects or patients with other neurological diseases. The automated chip-based procedure has excellent specificity and sensitivity, with significant advantages over the mouse bioassay in terms of rapidity, required sample volume and animal ethics.

  1. Direct detection of orchid viruses using nanorod-based fiber optic particle plasmon resonance immunosensor.

    PubMed

    Lin, Hsing-Ying; Huang, Chen-Han; Lu, Sin-Hong; Kuo, I-Ting; Chau, Lai-Kwan

    2014-01-15

    A fiber optic particle plasmon resonance (FOPPR) immunosensor is developed for label-free detection of orchid viruses that use gold nanorods (AuNRs) as the sensing material. The AuNRs are employed to create a near-infrared sensing window to solve the color interference problem of sample matrix for direct sensing of target analyte. This work cannot be achieved using gold nanospheres (AuNSs) because the signal of sample color absorption largely overlaps the signal of molecular recognition events in the visible spectrum, making the signal interpretation much more difficult. The AuNRs are immobilized on the unclad fiber core surface, and functionalized by antibodies which can specifically recognize the corresponding Cymbidium mosaic virus (CymMV) or Odontoglossum ringspot virus (ORSV) for rapid viral infection diagnosis. The refractive index resolution of the AuNR-FOPPR sensor is estimated to be 8×10(-6) RIU. The limits of detection (LODs) for CymMV and ORSV in leaf saps are 48 and 42 pg/mL, respectively, which are better than the LODs of 1200 pg/mL for both viruses obtained by enzyme-linked immunosorbent assay (ELISA). Exploiting the AuNR-FOPPR sensing strategy not only solves the color interference problem encountered by using AuNSs, but provides faster analysis, better reproducibility, and lower detection limit than ELISA. The sensor can distinguish between healthy and infected orchids in 10 min, and can further provide the quantitative analysis of infection level. It is potentially applicable to the quality control of orchid cultivation industry, but not limited to this, especially for creating special spectral sensing window for particular samples.

  2. Optimisation of a direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores.

    PubMed

    Henczka, Marek; Djas, Małgorzata; Filipek, Katarzyna

    2013-01-01

    A direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores has been optimised. The results of the application of four types of growth media (BAT agar, YSG agar, K agar and SK agar) regarding the recovery and enumeration of A. acidoterrestris spores were compared. The influence of the type of applied growth medium, heat shock conditions, incubation temperature, incubation time, plating technique and the presence of apple juice in the sample on the accuracy of the detection and enumeration of A. acidoterrestris spores was investigated. Among the investigated media, YSG agar was the most sensitive medium, and its application resulted in the highest recovery of A. acidoterrestris spores, while K agar and BAT agar were the least suitable media. The effect of the heat shock time on the recovery of spores was negligible. When there was a low concentration of spores in a sample, the membrane filtration method was superior to the spread plating method. The obtained results show that heat shock carried out at 80°C for 10 min and plating samples in combination with membrane filtration on YSG agar, followed by incubation at 46°C for 3 days provided the optimal conditions for the detection and enumeration of A. acidoterrestris spores. Application of the presented method allows highly efficient, fast and sensitive identification and enumeration of A. acidoterrestris spores in food products. This methodology will be useful for the fruit juice industry for identifying products contaminated with A. acidoterrestris spores, and its practical application may prevent economic losses for manufacturers.

  3. Molecular detection and typing of duck hepatitis A virus directly from clinical specimens.

    PubMed

    Fu, Yu; Pan, Meng; Wang, Xiaoyan; Xu, Yongliang; Yang, Hanchun; Zhang, Dabing

    2008-10-15

    To develop a new approach for the detection and typing of duck hepatitis A virus (DHAV), a pair of non-degenerate primers was designed to amplify a approximately 250-bp genomic region in the 5'UTR. 3 reference strains and 6 duck embryo-derived isolates from various regions in China, involving 2 serotypes, were successfully amplified with the primer set. By determining the nucleotide sequence of the amplicon, a molecular typing method was developed. If isolate sequences were compared to DHAV 5'UTR sequences available in public databases, nucleotide identity was > or =94% with homologous serotype and < or =73% with heterologous serotypes. Phylogenetic analysis revealed monophyletic clustering of 5'UTR sequences of a homologous serotype, confirming the new classification of DHAV (serotype 1 and the two new serotypes recently described in Taiwan and South Korea, respectively) into three genotypes (A, B and C) defined by the capsid coding region. Analysis of the results showed that the primer pair should aid in the detection of DHAV, and that the amplicon sequence contains type-specific information and can be used for effective and rapid molecular typing. The molecular methods proved their utility through the detection and typing of DHAV directly from 28 liver specimens collected from dead ducklings during duck viral hepatitis outbreaks in different regions of China between 2001 and 2007. The results confirmed the presence of DHAV in all of the 28 samples and demonstrated that genotypes A (13/28) and C (15/28) of DHAV are co-circulating in China.

  4. Multitarget PCR Assay for Direct Detection of Penicillinase-Producing Neisseria gonorrhoeae for Enhanced Surveillance of Gonococcal Antimicrobial Resistance

    PubMed Central

    Buckley, Cameron; Trembizki, Ella; Baird, Robert W.; Chen, Marcus; Donovan, Basil; Freeman, Kevin; Goire, Namraj; Guy, Rebecca; Lahra, Monica M.; Regan, David

    2015-01-01

    A multitarget PCR was developed for the direct detection of penicillinase-producing Neisseria gonorrhoeae (PPNG). The assay was validated by testing 342 PPNG isolates and 415 clinical samples. The method is suitable for routine detection of PPNG strains. Its multitarget approach reduces the potential for false-negative results caused by sequence variations. PMID:25994166

  5. Development of a modular directional and spectral neutron detection system using solid-state detectors

    NASA Astrophysics Data System (ADS)

    Weltz, A.; Torres, B.; McElwain, L.; Dahal, R.; Huang, J.; Bhat, I.; Lu, J.; Danon, Y.

    2015-08-01

    A detection system using room-temperature, microstructured solid-state thermal neutron detectors with very low leakage current has been developed at Rensselaer Polytechnic Institute (RPI) with the ability to provide positional and spectral information about an unknown neutron source. The Directional and Spectral Neutron Detection System (DSNDS) utilizes a set of small-but-scalable, zero-bias solid-state thermal neutron detectors which have demonstrated high thermal neutron efficiency and adequate gamma insensitivity. The DSNDS can gather spectral information about an unknown neutron source with a relatively small number of detectors, simplifying the detector electronics and minimizing cost; however, the DSNDS is modular in design, providing the capability to increase the detection efficiency and angular resolution. The system used in this paper was comprised of a stack of five high-density polyethylene (HDPE) disks with a thickness of 5 cm and a diameter of 30 cm, the middle disk containing 16 detectors positioned as one internal (moderated) and one external (unmoderated) ring of solid-state neutron detectors. These two detector rings provide the ability to determine the directionality of a neutron source. The system gathers spectral information about a neutron source in two ways: by measuring the relative responses of the internal ring of detectors as well as measuring the ratio of the internal-to-external detector responses. Experiments were performed with variable neutron spectra: a 252Cf spontaneous fission neutron source which was HDPE moderated, HDPE reflected, lead (Pb) shielded, and bare in order to benchmark the system for spectral sensitivity. Simulations were performed in order to characterize the neutron spectra corresponding to each of the source configurations and showed agreement with experimental measurements. The DSNDS demonstrates the ability to determine the relative angle of the source and the hardness of the neutron spectrum. By using the

  6. High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device

    DOEpatents

    Atac, Muzaffer; McKay, Timothy A.

    1998-01-01

    An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD.

  7. High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device

    DOEpatents

    Atac, M.; McKay, T.A.

    1998-04-21

    An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD. 13 figs.

  8. Goal-Directed Modulation of Neural Memory Patterns: Implications for fMRI-Based Memory Detection.

    PubMed

    Uncapher, Melina R; Boyd-Meredith, J Tyler; Chow, Tiffany E; Rissman, Jesse; Wagner, Anthony D

    2015-06-03

    Remembering a past event elicits distributed neural patterns that can be distinguished from patterns elicited when encountering novel information. These differing patterns can be decoded with relatively high diagnostic accuracy for individual memories using multivoxel pattern analysis (MVPA) of fMRI data. Brain-based memory detection--if valid and reliable--would have clear utility beyond the domain of cognitive neuroscience, in the realm of law, marketing, and beyond. However, a significant boundary condition on memory decoding validity may be the deployment of "countermeasures": strategies used to mask memory signals. Here we tested the vulnerability of fMRI-based memory detection to countermeasures, using a paradigm that bears resemblance to eyewitness identification. Participants were scanned while performing two tasks on previously studied and novel faces: (1) a standard recognition memory task; and (2) a task wherein they attempted to conceal their true memory state. Univariate analyses revealed that participants were able to strategically modulate neural responses, averaged across trials, in regions implicated in memory retrieval, including the hippocampus and angular gyrus. Moreover, regions associated with goal-directed shifts of attention and thought substitution supported memory concealment, and those associated with memory generation supported novelty concealment. Critically, whereas MVPA enabled reliable classification of memory states when participants reported memory truthfully, the ability to decode memory on individual trials was compromised, even reversing, during attempts to conceal memory. Together, these findings demonstrate that strategic goal states can be deployed to mask memory-related neural patterns and foil memory decoding technology, placing a significant boundary condition on their real-world utility.

  9. Highly sensitive disposable nucleic acid biosensors for direct bioelectronic detection in raw biological samples

    PubMed Central

    Kuralay, Filiz; Campuzano, Susana; Haake, David A.; Wang, Joseph

    2015-01-01

    The development of rapid, low-cost and reliable diagnostic methods is crucial for the identification and treatment of many diseases. Screen-printed gold electrodes (Au/SPEs), coated with a ternary monolayer interface, involving hexanedithiol (HDT), a specific thiolated capture probe (SHCP), and 6-mercapto-1 hexanol (MCH) (SHCP/HDT/MCH) are shown here to offer direct and sensitive detection of nucleic acid hybridization events in untreated raw biological samples (serum, urine and crude bacterial lysate solutions). The composition of the ternary monolayer was modified and tailored to the surface of the Au/SPE. The resulting SHCP/HDT/MCH monolayer has demonstrated to be extremely useful for enhancing the performance of disposable nucleic acid sensors based on screen-printed electrodes. Compared to common SHCP/MCH binary interfaces, the new ternary self-assembled monolayer (SAM) resulted in a 10-fold improvement in the signal (S)-to-noise (N) ratio (S/N) for 1 nM target DNA. The SHCP/HDT/MCH-modified Au/SPEs allowed the direct quantification of the target DNA down to 25 pM (0.25 fmol) and 100 pM (1 fmol) in undiluted/untreated serum and urine samples, respectively, and of 16S rRNA Escherichia coli (E. coli) corresponding to 3000 CFU μL−1 in raw cell lysate samples. The new SAM-coated screen-printed electrodes also displayed favorable non-fouling properties after a 24 h exposure to raw human serum and urine samples, offering great promise as cost-effective nucleic acid sensors for a wide range of decentralized genetic tests. PMID:21807191

  10. Global constraints on vector-like WIMP effective interactions

    SciTech Connect

    Blennow, Mattias; Coloma, Pilar; Fernandez-Martinez, Enrique

    2016-04-07

    In this work we combine information from relic abundance, direct detection, cosmic microwave background, positron fraction, gamma rays, and colliders to explore the existing constraints on couplings between Dark Matter and Standard Model constituents when no underlying model or correlation is assumed. For definiteness, we include independent vector-like effective interactions for each Standard Model fermion. Our results show that low Dark Matter masses below 20 GeV are disfavoured at the 3 σ  level with respect to higher masses, due to the tension between the relic abundance requirement and upper constraints on the Dark Matter couplings. Lastly, large couplings are typically only allowed in combinations which avoid effective couplings to the nuclei used in direct detection experiments.

  11. Global constraints on vector-like WIMP effective interactions

    SciTech Connect

    Blennow, Mattias; Coloma, Pilar; Fernández-Martínez, Enrique; Machado, Pedro A.N.; Zaldívar, Bryan E-mail: pcoloma@fnal.gov E-mail: pedro.machado@uam.es

    2016-04-01

    In this work we combine information from relic abundance, direct detection, cosmic microwave background, positron fraction, gamma rays, and colliders to explore the existing constraints on couplings between Dark Matter and Standard Model constituents when no underlying model or correlation is assumed. For definiteness, we include independent vector-like effective interactions for each Standard Model fermion. Our results show that low Dark Matter masses below 20 GeV are disfavoured at the 3 σ  level with respect to higher masses, due to the tension between the relic abundance requirement and upper constraints on the Dark Matter couplings. Furthermore, large couplings are typically only allowed in combinations which avoid effective couplings to the nuclei used in direct detection experiments.

  12. Global constraints on vector-like WIMP effective interactions

    DOE PAGES

    Blennow, Mattias; Coloma, Pilar; Fernandez-Martinez, Enrique; ...

    2016-04-07

    In this work we combine information from relic abundance, direct detection, cosmic microwave background, positron fraction, gamma rays, and colliders to explore the existing constraints on couplings between Dark Matter and Standard Model constituents when no underlying model or correlation is assumed. For definiteness, we include independent vector-like effective interactions for each Standard Model fermion. Our results show that low Dark Matter masses below 20 GeV are disfavoured at the 3 σ  level with respect to higher masses, due to the tension between the relic abundance requirement and upper constraints on the Dark Matter couplings. Lastly, large couplings are typically onlymore » allowed in combinations which avoid effective couplings to the nuclei used in direct detection experiments.« less

  13. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    PubMed Central

    2009-01-01

    Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay

  14. Detection of inhomogeneities in precipitation time series in Portugal using direct sequential simulation

    NASA Astrophysics Data System (ADS)

    Ribeiro, Sara; Caineta, Júlio; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2016-05-01

    Climate data homogenisation is of major importance in climate change monitoring, validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. The reason is that non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on a geostatistical simulation technique (DSS - direct sequential simulation), where local probability density functions (pdfs) are calculated at candidate monitoring stations using spatial and temporal neighbouring observations, which then are used for the detection of inhomogeneities. Such approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). That study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneity detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall, Wald-Wolfowitz runs, Von Neumann ratio, Pettitt, Buishand range test, and standard normal homogeneity test (SNHT) for a single break). Moreover, a sensitivity analysis is performed to investigate the number of simulated realisations which should be used to infer the local pdfs with more accuracy. Accordingly, the number of simulations per iteration was increased from 50 to 500, which resulted in a more representative local pdf. As in the previous study, the results are compared with those from the

  15. Inhomogeneities detection in annual precipitation time series in Portugal using direct sequential simulation

    NASA Astrophysics Data System (ADS)

    Caineta, Júlio; Ribeiro, Sara; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2014-05-01

    Climate data homogenisation is of major importance in monitoring climate change, the validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. This happens because non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on geostatistical simulation (DSS - direct sequential simulation), where local probability density functions (pdf) are calculated at candidate monitoring stations, using spatial and temporal neighbouring observations, and then are used for detection of inhomogeneities. This approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). This study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneities detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall test, Wald-Wolfowitz runs test, Von Neumann ratio test, Standard normal homogeneity test (SNHT) for a single break, Pettit test, and Buishand range test). Moreover, a sensibility analysis is implemented to investigate the number of simulated realisations that should be used to accurately infer the local pdfs. Accordingly, the number of simulations per iteration is increased from 50 to 500, which resulted in a more representative local pdf. A set of default and recommended settings is provided, which will help

  16. Prospects for detection of target-dependent annual modulation in direct dark matter searches

    SciTech Connect

    Nobile, Eugenio Del; Gelmini, Graciela B.; Witte, Samuel J. E-mail: gelmini@physics.ucla.edu

    2016-02-01

    Earth's rotation about the Sun produces an annual modulation in the expected scattering rate at direct dark matter detection experiments. The annual modulation as a function of the recoil energy E{sub R} imparted by the dark matter particle to a target nucleus is expected to vary depending on the detector material. However, for most interactions a change of variables from E{sub R} to v{sub min}, the minimum speed a dark matter particle must have to impart a fixed E{sub R} to a target nucleus, produces an annual modulation independent of the target element. We recently showed that if the dark matter-nucleus cross section contains a non-factorizable target and dark matter velocity dependence, the annual modulation as a function of v{sub min} can be target dependent. Here we examine more extensively the necessary conditions for target-dependent modulation, its observability in present-day experiments, and the extent to which putative signals could identify a dark matter-nucleus differential cross section with a non-factorizable dependence on the dark matter velocity.

  17. Assessing compatibility of direct detection data: halo-independent global likelihood analyses

    SciTech Connect

    Gelmini, Graciela B.; Huh, Ji-Haeng; Witte, Samuel J.

    2016-10-18

    We present two different halo-independent methods to assess the compatibility of several direct dark matter detection data sets for a given dark matter model using a global likelihood consisting of at least one extended likelihood and an arbitrary number of Gaussian or Poisson likelihoods. In the first method we find the global best fit halo function (we prove that it is a unique piecewise constant function with a number of down steps smaller than or equal to a maximum number that we compute) and construct a two-sided pointwise confidence band at any desired confidence level, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a “constrained parameter goodness-of-fit” test statistic, whose p-value we then use to define a “plausibility region” (e.g. where p≥10%). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. p<10%). We illustrate these methods by applying them to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic spin-independent isospin-conserving interactions or exothermic spin-independent isospin-violating interactions.

  18. Chemical sensing of in situ extracted organics by direct detection of mode-filtered light

    NASA Astrophysics Data System (ADS)

    Synovec, Robert E.; Bruckner, Carsten A.; Burgess, Lloyd W.; Foster, M. D.

    1994-10-01

    A novel chemical analyzer is described in which an optical fiber is inserted into a transparent capillary tube, such that the inner diameter of the tube is only a few microns larger than the outer diameter of the fiber cladding. This configuration is referred to as a torus column. When a sample volume is introduced to the torus column at a low flow rate, propagated light is mode-filtered due to a change in the critical angle at the core/clad interface, as a result of in-situ extracted chemical species. Conventionally, chemical species extracted into the cladding are sensed as a change in the transmitted light at the end of the fiber. An alternative approach, measuring this mode-filtered light directly along the side of the fiber, is reported. The new approach has a signal-to-noise advantage over the conventional approach. The result is a low volume sensor that temporally separates, as well as detects, chemical species that partition into the fiber cladding. The temporal information enhances sensor performance, providing first order information for subsequent data analysis. We have examined the modulation of the critical angle by chemical species of interest at steady-state concentrations, and as transient concentration profiles that were shifted in time. In summary, the analyzer has chemical selectivity provided by differences in the refractive index, distribution coefficient, and transient time of the concentration profile of each chemical species in a sample. The chemical analyzer should be a promising tool for process and environmental monitoring.

  19. Development of a front end ASIC for Dark Matter directional detection with MIMAC

    NASA Astrophysics Data System (ADS)

    Richer, J. P.; Bosson, G.; Bourrion, O.; Grignon, C.; Guillaudin, O.; Mayet, F.; Santos, D.

    2010-08-01

    A front end ASIC (BiCMOS-SiGe 0.35μm) has been developed within the framework of the MIMAC detector project, which aims at directional detection of non-baryonic Dark Matter. This search strategy requires 3D reconstruction of low energy (a few keV) tracks with a gaseous μTPC. The development of this front end ASIC is a key point of the project, allowing the 3D track reconstruction. Each ASIC monitors 16 strips of pixels with charge preamplifiers and their time over threshold is provided in real time by current discriminators via two serializing LVDS links working at 320 MHz. The charge is summed over the 16 strips and provided via a shaper. These specifications have been chosen in order to build an auto triggered electronics. An acquisition board and the related software were developed in order to validate this methodology on a prototype chamber. The prototype detector presents an anode where 2×96 strips of pixels are monitored.

  20. A powerful weighted statistic for detecting group differences of directed biological networks

    PubMed Central

    Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Xu, Jing; Ma, Daoxin; Xue, Fuzhong

    2016-01-01

    Complex disease is largely determined by a number of biomolecules interwoven into networks, rather than a single biomolecule. Different physiological conditions such as cases and controls may manifest as different networks. Statistical comparison between biological networks can provide not only new insight into the disease mechanism but statistical guidance for drug development. However, the methods developed in previous studies are inadequate to capture the changes in both the nodes and edges, and often ignore the network structure. In this study, we present a powerful weighted statistical test for group differences of directed biological networks, which is independent of the network attributes and can capture the changes in both the nodes and edges, as well as simultaneously accounting for the network structure through putting more we