Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C
2014-11-14
Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.
Molecular characterization of an ependymin precursor from goldfish brain.
Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W
1989-01-01
Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.
ERIC Educational Resources Information Center
Winarno, Sri; Muthu, Kalaiarasi Sonai; Ling, Lew Sook
2018-01-01
Direct instruction approach has been widely used in higher education. Many studies revealed that direct instruction improved students' knowledge. The characteristics of direct instruction include the subject delivered through face-to-face interaction with the lecturers and materials that sequenced deliberately and taught explicitly. However,…
Cuddy, L L; Thompson, W F
1992-01-01
In a probe-tone experiment, two groups of listeners--one trained, the other untrained, in traditional music theory--rated the goodness of fit of each of the 12 notes of the chromatic scale to four-voice harmonic sequences. Sequences were 12 simplified excerpts from Bach chorales, 4 nonmodulating, and 8 modulating. Modulations occurred either one or two steps in either the clockwise or the counterclockwise direction on the cycle of fifths. A consistent pattern of probe-tone ratings was obtained for each sequence, with no significant differences between listener groups. Two methods of analysis (Fourier analysis and regression analysis) revealed a directional asymmetry in the perceived key movement conveyed by modulating sequences. For a given modulation distance, modulations in the counterclockwise direction effected a clearer shift in tonal organization toward the final key than did clockwise modulations. The nature of the directional asymmetry was consistent with results reported for identification and rating of key change in the sequences (Thompson & Cuddy, 1989a). Further, according to the multiple-regression analysis, probe-tone ratings did not merely reflect the distribution of tones in the sequence. Rather, ratings were sensitive to the temporal structure of the tonal organization in the sequence.
Ni, Xiangyang; Westpheling, Janet
1997-01-01
The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809
Human Promoters Are Intrinsically Directional
Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe
2015-01-01
Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469
Pollen, Alex A; Nowakowski, Tomasz J; Shuga, Joe; Wang, Xiaohui; Leyrat, Anne A; Lui, Jan H; Li, Nianzhen; Szpankowski, Lukasz; Fowler, Brian; Chen, Peilin; Ramalingam, Naveen; Sun, Gang; Thu, Myo; Norris, Michael; Lebofsky, Ronald; Toppani, Dominique; Kemp, Darnell W; Wong, Michael; Clerkson, Barry; Jones, Brittnee N; Wu, Shiquan; Knutsson, Lawrence; Alvarado, Beatriz; Wang, Jing; Weaver, Lesley S; May, Andrew P; Jones, Robert C; Unger, Marc A; Kriegstein, Arnold R; West, Jay A A
2014-10-01
Large-scale surveys of single-cell gene expression have the potential to reveal rare cell populations and lineage relationships but require efficient methods for cell capture and mRNA sequencing. Although cellular barcoding strategies allow parallel sequencing of single cells at ultra-low depths, the limitations of shallow sequencing have not been investigated directly. By capturing 301 single cells from 11 populations using microfluidics and analyzing single-cell transcriptomes across downsampled sequencing depths, we demonstrate that shallow single-cell mRNA sequencing (~50,000 reads per cell) is sufficient for unbiased cell-type classification and biomarker identification. In the developing cortex, we identify diverse cell types, including multiple progenitor and neuronal subtypes, and we identify EGR1 and FOS as previously unreported candidate targets of Notch signaling in human but not mouse radial glia. Our strategy establishes an efficient method for unbiased analysis and comparison of cell populations from heterogeneous tissue by microfluidic single-cell capture and low-coverage sequencing of many cells.
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Gruber, Barry L.; Couto, Ana Rita; Armas, Jácome Bruges; Brown, Matthew A.; Finzel, Kathleen; Terkeltaub, Robert A.
2015-01-01
This report describes a 32-year-old woman presenting since childhood with progressive calcium pyrophosphate disease (CPPD), characterized by severe arthropathy and chondrocalcinosis involving multiple peripheral joints and intervertebral disks. Because ANKH mutations have been previously described in familial CPPD, the proband’s DNA was assessed at this locus by direct sequencing of promoter and coding regions and revealed 3 sequence variants in ANKH. Sequences of exon 1 revealed a novel isolated nonsynonymous mutation (c.13 C>T), altering amino acid in codon 5 from proline to serine (CCG>TCG). Sequencing of parental DNA revealed an identical mutation in the proband’s father but not the mother. Subsequent clinical evaluation demonstrated extensive chondrocalcinosis and degenerative arthropathy in the proband’s father. In summary, we report a novel mutation, not previously described, in ANKH exon 1, wherein serine replaces proline, in a case of early-onset severe CPPD associated with metabolic abnormalities, with similar findings in the proband’s father. PMID:22647861
Gruber, Barry L; Couto, Ana Rita; Armas, Jácome Bruges; Brown, Matthew A; Finzel, Kathleen; Terkeltaub, Robert A
2012-06-01
This report describes a 32-year-old woman presenting since childhood with progressive calcium pyrophosphate disease (CPPD), characterized by severe arthropathy and chondrocalcinosis involving multiple peripheral joints and intervertebral disks. Because ANKH mutations have been previously described in familial CPPD, the proband's DNA was assessed at this locus by direct sequencing of promoter and coding regions and revealed 3 sequence variants in ANKH. Sequences of exon 1 revealed a novel isolated nonsynonymous mutation (c.13 C>T), altering amino acid in codon 5 from proline to serine (CCG>TCG). Sequencing of parental DNA revealed an identical mutation in the proband's father but not the mother. Subsequent clinical evaluation demonstrated extensive chondrocalcinosis and degenerative arthropathy in the proband's father. In summary, we report a novel mutation, not previously described, in ANKH exon 1, wherein serine replaces proline, in a case of early-onset severe CPPD associated with metabolic abnormalities, with similar findings in the proband's father.
Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8
DOE Office of Scientific and Technical Information (OSTI.GOV)
Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong
2010-02-19
Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less
Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito
2018-05-15
A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.
Dreissig, Steven; Fuchs, Jörg; Himmelbach, Axel; Mascher, Martin; Houben, Andreas
2017-01-01
Meiotic recombination is a fundamental mechanism to generate novel allelic combinations which can be harnessed by breeders to achieve crop improvement. The recombination landscape of many crop species, including the major crop barley, is characterized by a dearth of recombination in 65% of the genome. In addition, segregation distortion caused by selection on genetically linked loci is a frequent and undesirable phenomenon in double haploid populations which hampers genetic mapping and breeding. Here, we present an approach to directly investigate recombination at the DNA sequence level by combining flow-sorting of haploid pollen nuclei of barley with single-cell genome sequencing. We confirm the skewed distribution of recombination events toward distal chromosomal regions at megabase resolution and show that segregation distortion is almost absent if directly measured in pollen. Furthermore, we show a bimodal distribution of inter-crossover distances, which supports the existence of two classes of crossovers which are sensitive or less sensitive to physical interference. We conclude that single pollen nuclei sequencing is an approach capable of revealing recombination patterns in the absence of segregation distortion. PMID:29018459
Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi
2008-01-01
Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429
Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA
Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev
2012-01-01
B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350
Sun, Zichen; Stack, Colin; Šlapeta, Jan
2012-05-25
In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K. P.; Woo, Patrick C. Y.
2015-01-01
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10–49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n = 2), Pichia (Candida) norvegensis (n = 2), Candida tropicalis (n = 1) and Saccharomyces cerevisiae (n = 1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study. PMID:26506340
In situ multi-axial loading frame to probe elastomers using X-ray scattering.
Pannier, Yannick; Proudhon, Henry; Mocuta, Cristian; Thiaudière, Dominique; Cantournet, Sabine
2011-11-01
An in situ tensile-shear loading device has been designed to study elastomer crystallization using synchrotron X-ray scattering at the Synchrotron Soleil on the DiffAbs beamline. Elastomer tape specimens of thickness 2 mm can be elongated by up to 500% in the longitudinal direction and sheared by up to 200% in the transverse direction. The device is fully automated and plugged into the TANGO control system of the beamline allowing synchronization between acquisition and loading sequences. Experimental results revealing the evolution of crystallization peaks under load are presented for several tension/shear loading sequences.
Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G
1987-12-01
The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).
Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.
Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario
2011-04-01
Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.
Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William
2011-12-01
Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.
NASA Technical Reports Server (NTRS)
Ni, Jianjun (David)
2012-01-01
This presentation discusses an analysis approach to evaluate the interuser interference for Direct-Sequence Spread-Spectrum (DSSS) Systems for Space Network (SN) Users. Part I of this analysis shows that the correlation property of pseudo noise (PN) sequences is the critical factor which determines the interuser interference performance of the DSSS system. For non-standard DSSS systems in which PN sequence s period is much larger than one data symbol duration, it is the partial-period cross-correlation that determines the system performance. This study reveals through an example that a well-designed PN sequence set (e.g. Gold Sequence, in which the cross-correlation for a whole-period is well controlled) may have non-controlled partial-period cross-correlation which could cause severe interuser interference for a DSSS system. Since the analytical derivation of performance metric (bit error rate or signal-to-noise ratio) based on partial-period cross-correlation is prohibitive, the performance degradation due to partial-period cross-correlation will be evaluated using simulation in Part II of this analysis in the future.
Sequence periodicity in nucleosomal DNA and intrinsic curvature.
Nair, T Murlidharan
2010-05-17
Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.
ATAC-see reveals the accessible genome by transposase-mediated imaging and sequencing.
Chen, Xingqi; Shen, Ying; Draper, Will; Buenrostro, Jason D; Litzenburger, Ulrike; Cho, Seung Woo; Satpathy, Ansuman T; Carter, Ava C; Ghosh, Rajarshi P; East-Seletsky, Alexandra; Doudna, Jennifer A; Greenleaf, William J; Liphardt, Jan T; Chang, Howard Y
2016-12-01
Spatial organization of the genome plays a central role in gene expression, DNA replication, and repair. But current epigenomic approaches largely map DNA regulatory elements outside of the native context of the nucleus. Here we report assay of transposase-accessible chromatin with visualization (ATAC-see), a transposase-mediated imaging technology that employs direct imaging of the accessible genome in situ, cell sorting, and deep sequencing to reveal the identity of the imaged elements. ATAC-see revealed the cell-type-specific spatial organization of the accessible genome and the coordinated process of neutrophil chromatin extrusion, termed NETosis. Integration of ATAC-see with flow cytometry enables automated quantitation and prospective cell isolation as a function of chromatin accessibility, and it reveals a cell-cycle dependence of chromatin accessibility that is especially dynamic in G1 phase. The integration of imaging and epigenomics provides a general and scalable approach for deciphering the spatiotemporal architecture of gene control.
Köberl, Martina; White, Richard A.; Erschen, Sabine; ...
2015-08-06
Paenibacillus polymyxa strain Mc5Re-14 was isolated from the inner root tissue of Matricaria chamomilla (German chamomile). Mc5Re-14 revealed promising in vitro antagonistic activity against plant and opportunistic human pathogens. The 6.0-Mb draft genome reveals genes putatively involved in pathogen suppression and direct and indirect plant growth promotion.
Eliminating Late Recurrence to Eradicate Breast Cancer
2014-09-01
Chen GC, Lee JY, Tang HW, Debnath J, Thomas SM, Settleman J. Genetic interactions between Drosophila melanogaster Atg1 and paxillin reveal a role...and the generation of cell lines expressing shATGs have been described (1). The target sequences for hairpins directed against human ATG7 (NM_006395...are the Page 80 Lock et. al., CD-13-0841R, Supplemental Materials, page 4 primer sequences used: GAPDH; For: 5’-CATGTTCGTCATGGGTGTGAACCA-3’ Rev: 5
Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis
2003-11-01
The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.
Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai
2012-08-01
On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
Sequence periodicity in nucleosomal DNA and intrinsic curvature
2010-01-01
Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515
Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.
2015-01-01
CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421
Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24
Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan
2005-01-01
The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, Kelly P.
2013-10-03
This package assists in genome assembly. extendFromReads takes as input a set of Illumina (eg, MiSeq) DNA sequencing reads, a query seed sequence and a direction to extend the seed. The algorithm collects all seed-- ]matching reads (flipping reverse-- ]orientation hits), trims off the seed and additional sequence in the other direction, sorts the remaining sequences alphabetically, and prints them aligned without gaps from the point of seed trimming. This produces a visual display distinguishing the flanks of multi- ]copy seeds. A companion script hitMates.pl collects the mates of seed-- ]hi]ng reads, whose alignment reveals longer extensions from the seed.more » The collect/trim/sort strategy was made iterative and scaled up in the script denovo.pl, for de novo contig assembly. An index is pre-- ]built using indexReads.pl that for each unique 21-- ]mer found in all the reads, records its gfate h of extension (whether extendable, blocked by low coverage, or blocked by branching after a duplicated sequence) and other characteristics. Importantly, denovo.pl records all branchings that follow a branching contig endpoint, providing contig- ]extension information« less
Duarte, Gabriela Frois; Rosado, Alexandre Soares; Seldin, Lucy; de Araujo, Welington; van Elsas, Jan Dirk
2001-01-01
The selective effects of sulfur-containing hydrocarbons, with respect to changes in bacterial community structure and selection of desulfurizing organisms and genes, were studied in soil. Samples taken from a polluted field soil (A) along a concentration gradient of sulfurous oil and from soil microcosms treated with dibenzothiophene (DBT)-containing petroleum (FSL soil) were analyzed. Analyses included plate counts of total bacteria and of DBT utilizers, molecular community profiling via soil DNA-based PCR-denaturing gradient gel electrophoresis (PCR-DGGE), and detection of genes that encode enzymes involved in the desulfurization of hydrocarbons, i.e., dszA, dszB, and dszC.Data obtained from the A soil showed no discriminating effects of oil levels on the culturable bacterial numbers on either medium used. Generally, counts of DBT degraders were 10- to 100-fold lower than the total culturable counts. However, PCR-DGGE showed that the numbers of bands detected in the molecular community profiles decreased with increasing oil content of the soil. Analysis of the sequences of three prominent bands of the profiles generated with the highly polluted soil samples suggested that the underlying organisms were related to Actinomyces sp., Arthrobacter sp., and a bacterium of uncertain affiliation. dszA, dszB, and dszC genes were present in all A soil samples, whereas a range of unpolluted soils gave negative results in this analysis. Results from the study of FSL soil revealed minor effects of the petroleum-DBT treatment on culturable bacterial numbers and clear effects on the DBT-utilizing communities. The molecular community profiles were largely stable over time in the untreated soil, whereas they showed a progressive change over time following treatment with DBT-containing petroleum. Direct PCR assessment revealed the presence of dszB-related signals in the untreated FSL soil and the apparent selection of dszA- and dszC-related sequences by the petroleum-DBT treatment. PCR-DGGE applied to sequential enrichment cultures in DBT-containing sulfur-free basal salts medium prepared from the A and treated FSL soils revealed the selection of up to 10 distinct bands. Sequencing a subset of these bands provided evidence for the presence of organisms related to Pseudomonas putida, a Pseudomonas sp., Stenotrophomonas maltophilia, and Rhodococcus erythropolis. Several of 52 colonies obtained from the A and FSL soils on agar plates with DBT as the sole sulfur source produced bands that matched the migration of bands selected in the enrichment cultures. Evidence for the presence of dszB in 12 strains was obtained, whereas dszA and dszC genes were found in only 7 and 6 strains, respectively. Most of the strains carrying dszA or dszC were classified as R. erythropolis related, and all revealed the capacity to desulfurize DBT. A comparison of 37 dszA sequences, obtained via PCR from the A and FSL soils, from enrichments of these soils, and from isolates, revealed the great similarity of all sequences to the canonical (R. erythropolis strain IGTS8) dszA sequence and a large degree of internal conservation. The 37 sequences recovered were grouped in three clusters. One group, consisting of 30 sequences, was minimally 98% related to the IGTS8 sequence, a second group of 2 sequences was slightly different, and a third group of 5 sequences was 95% similar. The first two groups contained sequences obtained from both soil types and enrichment cultures (including isolates), but the last consisted of sequences obtained directly from the polluted A soil. PMID:11229891
Kim, Suk Kyeong; Kim, Dong-Lim; Han, Hye Seung; Kim, Wan Seop; Kim, Seung Ja; Moon, Won Jin; Oh, Seo Young; Hwang, Tae Sook
2008-06-01
Fine-needle aspiration biopsy (FNAB) is the primary means of distinguishing benign from malignant and of guiding therapeutic intervention in thyroid nodules. However, 10% to 30% of cases with indeterminate cytology in FNAB need other diagnostic tools to refine diagnosis. We compared the pyrosequencing method with the conventional direct DNA sequencing analysis and investigated the usefulness of preoperative BRAF mutation analysis as an adjunct diagnostic tool with routine FNAB. A total of 103 surgically confirmed patients' FNA slides were recruited and DNA was extracted after atypical cells were scraped from the slides. BRAF mutation was analyzed by pyrosequencing and direct DNA sequencing. Sixty-three (77.8%) of 81 histopathologically diagnosed malignant nodules revealed positive BRAF mutation on pyrosequencing analysis. In detail, 63 (84.0%) of 75 papillary thyroid carcinoma (PTC) samples showed positive BRAF mutation, whereas 3 follicular thyroid carcinomas, 1 anaplastic carcinoma, 1 medullary thyroid carcinoma, and 1 metastatic lung carcinoma did not show BRAF mutation. None of 22 benign nodules had BRAF mutation in both pyrosequencing and direct DNA sequencing. Out of 27 thyroid nodules classified as 'indeterminate' on cytologic examination preoperatively, 21 (77.8%) cases turned out to be malignant: 18 PTCs (including 2 follicular variant types) and 3 follicular thyroid carcinomas. Among these, 13 (61.9%) classic PTCs had BRAF mutation. None of 6 benign nodules, including 3 follicular adenomas and 3 nodular hyperplasias, had BRAF mutation. Among 63 PTCs with positive BRAF mutation detected by pyrosequencing analysis, 3 cases did not show BRAF mutation by direct DNA sequencing. Although it was not statistically significant, pyrosequencing was superior to direct DNA sequencing in detecting the BRAF mutation of thyroid nodules (P=0.25). Detecting BRAF mutation by pyrosequencing is more sensitive, faster, and less expensive than direct DNA sequencing and is proposed as an adjunct diagnostic tool in evaluating thyroid nodules of indeterminate cytology.
Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.
Reinl, Maren; Bartels, Andreas
2014-11-15
Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Brugnara, Milena; Gaudino, Rossella; Tedeschi, Silvana; Syrèn, Marie-Louise; Perrotta, Silverio; Maines, Evelina; Zaffanello, Marco
2014-09-01
We report the case of an infant boy with polyuria and a familial history of central diabetes insipidus. Laboratory blood tests disclosed hypokalemia, metabolic alkalosis, hyperreninemia, and hyperaldosteronism. Plasma magnesium concentration was slightly low. Urine analysis showed hypercalciuria, hyposthenuria, and high excretion of potassium. Such findings oriented toward type III Bartter syndrome (BSIII). Direct sequencing of the CLCNKB gene revealed no disease-causing mutations. The water deprivation test was positive. Magnetic resonance imaging showed a lack of posterior pituitary hyperintensity. Finally, direct sequencing of the AVP-NPII gene showed a point mutation (c.1884G>A) in a heterozygous state, confirming an autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI). This condition did not explain the patient's phenotype; thus, we investigated for Gitelman syndrome (GS). A direct sequencing of the SLC12A3 gene showed c.269A>C and c.1205C>A new mutations. In conclusion, the patient had a genetic combination of GS and adFNDI with a BSIII-like phenotype.
NASA Astrophysics Data System (ADS)
Rinaldi, Arlie J.; Lund, Paul E.; Blanco, Mario R.; Walter, Nils G.
2016-01-01
In response to intracellular signals in Gram-negative bacteria, translational riboswitches--commonly embedded in messenger RNAs (mRNAs)--regulate gene expression through inhibition of translation initiation. It is generally thought that this regulation originates from occlusion of the Shine-Dalgarno (SD) sequence upon ligand binding; however, little direct evidence exists. Here we develop Single Molecule Kinetic Analysis of RNA Transient Structure (SiM-KARTS) to investigate the ligand-dependent accessibility of the SD sequence of an mRNA hosting the 7-aminomethyl-7-deazaguanine (preQ1)-sensing riboswitch. Spike train analysis reveals that individual mRNA molecules alternate between two conformational states, distinguished by `bursts' of probe binding associated with increased SD sequence accessibility. Addition of preQ1 decreases the lifetime of the SD's high-accessibility (bursting) state and prolongs the time between bursts. In addition, ligand-jump experiments reveal imperfect riboswitching of single mRNA molecules. Such complex ligand sensing by individual mRNA molecules rationalizes the nuanced ligand response observed during bulk mRNA translation.
Structure-Function Analysis of Chloroplast Proteins via Random Mutagenesis Using Error-Prone PCR.
Dumas, Louis; Zito, Francesca; Auroy, Pascaline; Johnson, Xenie; Peltier, Gilles; Alric, Jean
2018-06-01
Site-directed mutagenesis of chloroplast genes was developed three decades ago and has greatly advanced the field of photosynthesis research. Here, we describe a new approach for generating random chloroplast gene mutants that combines error-prone polymerase chain reaction of a gene of interest with chloroplast complementation of the knockout Chlamydomonas reinhardtii mutant. As a proof of concept, we targeted a 300-bp sequence of the petD gene that encodes subunit IV of the thylakoid membrane-bound cytochrome b 6 f complex. By sequencing chloroplast transformants, we revealed 149 mutations in the 300-bp target petD sequence that resulted in 92 amino acid substitutions in the 100-residue target subunit IV sequence. Our results show that this method is suited to the study of highly hydrophobic, multisubunit, and chloroplast-encoded proteins containing cofactors such as hemes, iron-sulfur clusters, and chlorophyll pigments. Moreover, we show that mutant screening and sequencing can be used to study photosynthetic mechanisms or to probe the mutational robustness of chloroplast-encoded proteins, and we propose that this method is a valuable tool for the directed evolution of enzymes in the chloroplast. © 2018 American Society of Plant Biologists. All rights reserved.
Microbial Characterization of Qatari Barchan Sand Dunes
Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.
2016-01-01
This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399
Lang, Tiange; Yin, Kangquan; Liu, Jinyu; Cao, Kunfang; Cannon, Charles H; Du, Fang K
2014-01-01
Predicting protein domains is essential for understanding a protein's function at the molecular level. However, up till now, there has been no direct and straightforward method for predicting protein domains in species without a reference genome sequence. In this study, we developed a functionality with a set of programs that can predict protein domains directly from genomic sequence data without a reference genome. Using whole genome sequence data, the programming functionality mainly comprised DNA assembly in combination with next-generation sequencing (NGS) assembly methods and traditional methods, peptide prediction and protein domain prediction. The proposed new functionality avoids problems associated with de novo assembly due to micro reads and small single repeats. Furthermore, we applied our functionality for the prediction of leucine rich repeat (LRR) domains in four species of Ficus with no reference genome, based on NGS genomic data. We found that the LRRNT_2 and LRR_8 domains are related to plant transpiration efficiency, as indicated by the stomata index, in the four species of Ficus. The programming functionality established in this study provides new insights for protein domain prediction, which is particularly timely in the current age of NGS data expansion.
Pope, Welkin H.; Weigele, Peter R.; Chang, Juan; Pedulla, Marisa L.; Ford, Michael E.; Houtz, Jennifer M.; Jiang, Wen; Chiu, Wah; Hatfull, Graham F.; Hendrix, Roger W.; King, Jonathan
2010-01-01
Marine Synechococcus spp and marine Prochlorococcus spp are numerically dominant photoautotrophs in the open oceans and contributors to the global carbon cycle. Syn5 is a short-tailed cyanophage isolated from the Sargasso Sea on Synechococcus strain WH8109. Syn5 has been grown in WH8109 to high titer in the laboratory and purified and concentrated retaining infectivity. Genome sequencing and annotation of Syn5 revealed that the linear genome is 46,214bp with a 237bp terminal direct repeat. Sixty-one open reading frames (ORFs) were identified. Based on genomic organization and sequence similarity to known protein sequences within GenBank, Syn5 shares features with T7-like phages. The presence of a putative integrase suggests access to a temperate life-cycle. Assignment of eleven ORFs to structural proteins found within the phage virion was confirmed by mass-spectrometry and N-terminal sequencing. Eight of these identified structural proteins exhibited amino acid sequence similarity to enteric phage proteins. The remaining three virion proteins did not resemble any known phage sequences in GenBank as of August 2006. Cryoelectron micrographs of purified Syn5 virions revealed that the capsid has a single “horn”, a novel fibrous structure protruding from the opposing end of the capsid from the tail of the virion. The tail appendage displayed an apparent three-fold rather than six-fold symmetry. An 18Å-resolution icosahedral reconstruction of the capsid revealed a T=7 lattice, but with an unusual pattern of surface knobs. This phage/host system should allow detailed investigation of the physiology and biochemistry of phage propagation in marine photosynthetic bacteria. PMID:17383677
Smith, Gretchen N. L.; Conway, Christopher M.; Bauernschmidt, Althea; Pisoni, David B.
2015-01-01
Recent research suggests that language acquisition may rely on domain-general learning abilities, such as structured sequence processing, which is the ability to extract, encode, and represent structured patterns in a temporal sequence. If structured sequence processing supports language, then it may be possible to improve language function by enhancing this foundational learning ability. The goal of the present study was to use a novel computerized training task as a means to better understand the relationship between structured sequence processing and language function. Participants first were assessed on pre-training tasks to provide baseline behavioral measures of structured sequence processing and language abilities. Participants were then quasi-randomly assigned to either a treatment group involving adaptive structured visuospatial sequence training, a treatment group involving adaptive non-structured visuospatial sequence training, or a control group. Following four days of sequence training, all participants were assessed with the same pre-training measures. Overall comparison of the post-training means revealed no group differences. However, in order to examine the potential relations between sequence training, structured sequence processing, and language ability, we used a mediation analysis that showed two competing effects. In the indirect effect, adaptive sequence training with structural regularities had a positive impact on structured sequence processing performance, which in turn had a positive impact on language processing. This finding not only identifies a potential novel intervention to treat language impairments but also may be the first demonstration that structured sequence processing can be improved and that this, in turn, has an impact on language processing. However, in the direct effect, adaptive sequence training with structural regularities had a direct negative impact on language processing. This unexpected finding suggests that adaptive training with structural regularities might potentially interfere with language processing. Taken together, these findings underscore the importance of pursuing designs that promote a better understanding of the mechanisms underlying training-related changes, so that regimens can be developed that help reduce these types of negative effects while simultaneously maximizing the benefits to outcome measures of interest. PMID:25946222
Smith, Gretchen N L; Conway, Christopher M; Bauernschmidt, Althea; Pisoni, David B
2015-01-01
Recent research suggests that language acquisition may rely on domain-general learning abilities, such as structured sequence processing, which is the ability to extract, encode, and represent structured patterns in a temporal sequence. If structured sequence processing supports language, then it may be possible to improve language function by enhancing this foundational learning ability. The goal of the present study was to use a novel computerized training task as a means to better understand the relationship between structured sequence processing and language function. Participants first were assessed on pre-training tasks to provide baseline behavioral measures of structured sequence processing and language abilities. Participants were then quasi-randomly assigned to either a treatment group involving adaptive structured visuospatial sequence training, a treatment group involving adaptive non-structured visuospatial sequence training, or a control group. Following four days of sequence training, all participants were assessed with the same pre-training measures. Overall comparison of the post-training means revealed no group differences. However, in order to examine the potential relations between sequence training, structured sequence processing, and language ability, we used a mediation analysis that showed two competing effects. In the indirect effect, adaptive sequence training with structural regularities had a positive impact on structured sequence processing performance, which in turn had a positive impact on language processing. This finding not only identifies a potential novel intervention to treat language impairments but also may be the first demonstration that structured sequence processing can be improved and that this, in turn, has an impact on language processing. However, in the direct effect, adaptive sequence training with structural regularities had a direct negative impact on language processing. This unexpected finding suggests that adaptive training with structural regularities might potentially interfere with language processing. Taken together, these findings underscore the importance of pursuing designs that promote a better understanding of the mechanisms underlying training-related changes, so that regimens can be developed that help reduce these types of negative effects while simultaneously maximizing the benefits to outcome measures of interest.
Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.
Schollmeier, K; Hillen, W
1984-01-01
The nucleotide sequence of the central part of Tn10 has been determined from the rightmost HindIII site to IS10R. This sequence contains two open reading frames with opposite polarity. The in vivo transcription start points in this sequence have been determined by S1 mapping. These results define one minor and two major promoters. The transcription starts of the two major promoters are only 18 base pairs apart, and the transcripts show different polarity and overlap by 18 base pairs. The nucleotide sequence reveals two regions with palindromic symmetry which may serve as operators. Their possible involvement in the regulation of transcription of both genes is discussed. Taken together these results allow for a maximal coding capacity of 138 amino acids directed toward IS10R and 197 amino acids directed toward tetA. The possible function of these gene products is discussed. The accompanying article (Braus et al., J. Bacteriol. 160:504-509, 1984) presents evidence that these genes are expressed. Images PMID:6094471
Comparative RNA sequencing reveals substantial genetic variation in endangered primates
Perry, George H.; Melsted, Páll; Marioni, John C.; Wang, Ying; Bainer, Russell; Pickrell, Joseph K.; Michelini, Katelyn; Zehr, Sarah; Yoder, Anne D.; Stephens, Matthew; Pritchard, Jonathan K.; Gilad, Yoav
2012-01-01
Comparative genomic studies in primates have yielded important insights into the evolutionary forces that shape genetic diversity and revealed the likely genetic basis for certain species-specific adaptations. To date, however, these studies have focused on only a small number of species. For the majority of nonhuman primates, including some of the most critically endangered, genome-level data are not yet available. In this study, we have taken the first steps toward addressing this gap by sequencing RNA from the livers of multiple individuals from each of 16 mammalian species, including humans and 11 nonhuman primates. Of the nonhuman primate species, five are lemurs and two are lorisoids, for which little or no genomic data were previously available. To analyze these data, we developed a method for de novo assembly and alignment of orthologous gene sequences across species. We assembled an average of 5721 gene sequences per species and characterized diversity and divergence of both gene sequences and gene expression levels. We identified patterns of variation that are consistent with the action of positive or directional selection, including an 18-fold enrichment of peroxisomal genes among genes whose regulation likely evolved under directional selection in the ancestral primate lineage. Importantly, we found no relationship between genetic diversity and endangered status, with the two most endangered species in our study, the black and white ruffed lemur and the Coquerel's sifaka, having the highest genetic diversity among all primates. Our observations imply that many endangered lemur populations still harbor considerable genetic variation. Timely efforts to conserve these species alongside their habitats have, therefore, strong potential to achieve long-term success. PMID:22207615
Öncü, Ceren; Brinkmann, Annika; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Sarıkaya, Yasemen; Nitsche, Andreas; Linton, Yvonne-Marie; Alten, Bülent; Ergünay, Koray
2018-01-01
Mosquitoes are involved in the transmission and maintenance of several viral diseases with significant health impact. Biosurveillance efforts have also revealed insect-specific viruses, observed to cocirculate with pathogenic strains. This report describes the findings of flavivirus and rhabdovirus screening, performed in eastern Thrace and Aegean region of Anatolia during 2016, including and expanding on locations with previously-documented virus activity. A mosquito cohort of 1545 individuals comprising 14 species were collected and screened in 108 pools via generic and specific amplification and direct metagenomics by next generation sequencing. Seven mosquito pools (6.4%) were positive in the flavivirus screening. West Nile virus lineage 1 clade 1a sequences were characterized in a pool Culex pipiens sensu lato specimens, providing the initial virus detection in Aegean region following 2010 outbreak. In an Anopheles maculipennis sensu lato pool, sequences closely-related to Anopheles flaviviruses were obtained, with similarities to several African and Australian strains of this new insect-specific flavivirus clade. In pools comprising Uranotaenia unguiculata (n=3), Cx. pipiens s.l. (n=1) and Aedes caspius (n=1) mosquitoes, sequences of a novel flavivirus, distantly-related to Flavivirus AV2011, identified previously in Spain and Turkey, were characterized. Moreover, DNA forms of the novel flavivirus were detected in two Ur. unguiculata pools. These sequences were highly-similar to the sequences amplified from viral RNA, with undisrupted reading frames, suggest the occurrence of viral DNA forms in natural conditions within mosquito hosts. Rhabdovirus screening revealed sequences of a recently-described novel virus, named the Merida-like virus Turkey (MERDLVT) in 5 Cx. pipiens s.l. pools (4.6%). Partial L and N gene sequences of MERDLVT were well-conserved among strains, with evidence for geographical clustering in phylogenetic analyses. Metagenomics provided the near-full genomic sequence in a specimen, revealing an identical genome organization and limited divergence from the prototype MERDLVT isolate. Copyright © 2017 Elsevier B.V. All rights reserved.
The murine Cd48 gene: allelic polymorphism in the IgV-like region.
Cabrero, J G; Freeman, G J; Reiser, H
1998-12-01
The murine CD48 molecule is a member of the immunoglobulin superfamily which regulates the activation of T lymphocytes. prior cloning experiments using mRNA from two different mouse strains had yielded discrepant sequences within the IgV-like domain of murine CD48. To resolve this issue, we have directly sequenced genomic DNA of 10 laboratory strains and two inbred strains of wild origin. The results of our analysis reveal an allelic polymorphism within the IgV-like domain of murine CD48.
Tracking the origins and drivers of subclonal metastatic expansion in prostate cancer
Hong, Matthew K. H.; Macintyre, Geoff; Wedge, David C.; ...
2015-04-01
Tumour heterogeneity in primary prostate cancer is a well-established phenomenon. However, how the subclonal diversity of tumours changes during metastasis and progression to lethality is poorly understood. Here we reveal the precise direction of metastatic spread across four lethal prostate cancer patients using whole-genome and ultra-deep targeted sequencing of longitudinally collected primary and metastatic tumours. We find one case of metastatic spread to the surgical bed causing local recurrence, and another case of cross-metastatic site seeding combining with dynamic remoulding of subclonal mixtures in response to therapy. By ultra-deep sequencing end-stage blood, we detect both metastatic and primary tumour clones,more » even years after removal of the prostate. As a result, analysis of mutations associated with metastasis reveals an enrichment of TP53 mutations, and additional sequencing of metastases from 19 patients demonstrates that acquisition of TP53 mutations is linked with the expansion of subclones with metastatic potential which we can detect in the blood.« less
Tracking the origins and drivers of subclonal metastatic expansion in prostate cancer.
Hong, Matthew K H; Macintyre, Geoff; Wedge, David C; Van Loo, Peter; Patel, Keval; Lunke, Sebastian; Alexandrov, Ludmil B; Sloggett, Clare; Cmero, Marek; Marass, Francesco; Tsui, Dana; Mangiola, Stefano; Lonie, Andrew; Naeem, Haroon; Sapre, Nikhil; Phal, Pramit M; Kurganovs, Natalie; Chin, Xiaowen; Kerger, Michael; Warren, Anne Y; Neal, David; Gnanapragasam, Vincent; Rosenfeld, Nitzan; Pedersen, John S; Ryan, Andrew; Haviv, Izhak; Costello, Anthony J; Corcoran, Niall M; Hovens, Christopher M
2015-04-01
Tumour heterogeneity in primary prostate cancer is a well-established phenomenon. However, how the subclonal diversity of tumours changes during metastasis and progression to lethality is poorly understood. Here we reveal the precise direction of metastatic spread across four lethal prostate cancer patients using whole-genome and ultra-deep targeted sequencing of longitudinally collected primary and metastatic tumours. We find one case of metastatic spread to the surgical bed causing local recurrence, and another case of cross-metastatic site seeding combining with dynamic remoulding of subclonal mixtures in response to therapy. By ultra-deep sequencing end-stage blood, we detect both metastatic and primary tumour clones, even years after removal of the prostate. Analysis of mutations associated with metastasis reveals an enrichment of TP53 mutations, and additional sequencing of metastases from 19 patients demonstrates that acquisition of TP53 mutations is linked with the expansion of subclones with metastatic potential which we can detect in the blood.
Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I
2000-05-01
L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.
Gaia Reveals Evidence for Merged White Dwarfs
NASA Astrophysics Data System (ADS)
Kilic, Mukremin; Hambly, N. C.; Bergeron, P.; Genest-Beaulieu, C.; Rowell, N.
2018-06-01
We use Gaia Data Release 2 to identify 13,928 white dwarfs within 100 pc of the Sun. The exquisite astrometry from Gaia reveals for the first time a bifurcation in the observed white dwarf sequence in both Gaia and the Sloan Digital Sky Survey (SDSS) passbands. The latter is easily explained by a helium atmosphere white dwarf fraction of 36%. However, the bifurcation in the Gaia colour-magnitude diagram depends on both the atmospheric composition and the mass distribution. We simulate theoretical colour-magnitude diagrams for single and binary white dwarfs using a population synthesis approach and demonstrate that there is a significant contribution from relatively massive white dwarfs that likely formed through mergers. These include white dwarf remnants of main-sequence (blue stragglers) and post-main sequence mergers. The mass distribution of the SDSS subsample, including the spectroscopically confirmed white dwarfs, also shows this massive bump. This is the first direct detection of such a population in a volume-limited sample.
Andersson, P; Klein, M; Lilliebridge, R A; Giffard, P M
2013-09-01
Ultra-deep Illumina sequencing was performed on whole genome amplified DNA derived from a Chlamydia trachomatis-positive vaginal swab. Alignment of reads with reference genomes allowed robust SNP identification from the C. trachomatis chromosome and plasmid. This revealed that the C. trachomatis in the specimen was very closely related to the sequenced urogenital, serovar F, clade T1 isolate F-SW4. In addition, high genome-wide coverage was obtained for Prevotella melaninogenica, Gardnerella vaginalis, Clostridiales genomosp. BVAB3 and Mycoplasma hominis. This illustrates the potential of metagenome data to provide high resolution bacterial typing data from multiple taxa in a diagnostic specimen. ©2013 The Authors Clinical Microbiology and Infection ©2013 European Society of Clinical Microbiology and Infectious Diseases.
USDA-ARS?s Scientific Manuscript database
In order to identify amino acid residues crucial for the enzymatic activity of ^8-sphingolipid desaturases, a sequence comparison was performed among ^8-sphingolipid desaturases and ^6-fatty acid desaturase from various plants. In addition to the known conserved cytb5 (cytochrome b5) HPGG motif and...
Janssen, Aniek; Breuer, Gregory A.; Brinkman, Eva K.; ...
2016-07-15
Repair of DNA double-strand breaks (DSBs) must be properly orchestrated in diverse chromatin regions to maintain genome stability. The choice between two main DSB repair pathways, nonhomologous end-joining (NHEJ) and homologous recombination (HR), is regulated by the cell cycle as well as chromatin context. Pericentromeric heterochromatin forms a distinct nuclear domain that is enriched for repetitive DNA sequences that pose significant challenges for genome stability. Heterochromatic DSBs display specialized temporal and spatial dynamics that differ from euchromatic DSBs. Although HR is thought to be the main pathway used to repair heterochromatic DSBs, direct tests of this hypothesis are lacking. Here,more » we developed an in vivo single DSB system for both heterochromatic and euchromatic loci in Drosophila melanogaster. Live imaging of single DSBs in larval imaginal discs recapitulates the spatio-temporal dynamics observed for irradiation (IR)-induced breaks in cell culture. Importantly, live imaging and sequence analysis of repair products reveal that DSBs in euchromatin and heterochromatin are repaired with similar kinetics, employ both NHEJ and HR, and can use homologous chromosomes as an HR template. This direct analysis reveals important insights into heterochromatin DSB repair in animal tissues and provides a foundation for further explorations of repair mechanisms in different chromatin domains.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janssen, Aniek; Breuer, Gregory A.; Brinkman, Eva K.
Repair of DNA double-strand breaks (DSBs) must be properly orchestrated in diverse chromatin regions to maintain genome stability. The choice between two main DSB repair pathways, nonhomologous end-joining (NHEJ) and homologous recombination (HR), is regulated by the cell cycle as well as chromatin context. Pericentromeric heterochromatin forms a distinct nuclear domain that is enriched for repetitive DNA sequences that pose significant challenges for genome stability. Heterochromatic DSBs display specialized temporal and spatial dynamics that differ from euchromatic DSBs. Although HR is thought to be the main pathway used to repair heterochromatic DSBs, direct tests of this hypothesis are lacking. Here,more » we developed an in vivo single DSB system for both heterochromatic and euchromatic loci in Drosophila melanogaster. Live imaging of single DSBs in larval imaginal discs recapitulates the spatio-temporal dynamics observed for irradiation (IR)-induced breaks in cell culture. Importantly, live imaging and sequence analysis of repair products reveal that DSBs in euchromatin and heterochromatin are repaired with similar kinetics, employ both NHEJ and HR, and can use homologous chromosomes as an HR template. This direct analysis reveals important insights into heterochromatin DSB repair in animal tissues and provides a foundation for further explorations of repair mechanisms in different chromatin domains.« less
Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun
2015-03-13
The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.
Zhu, X Q; Gasser, R B
1998-06-01
In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.
Jaber, Tareq; Henderson, Gail; Li, Sumin; Perng, Guey-Chuen; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton
2009-10-01
The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected sensory neurons. In small animal models of infection, expression of the first 1.5 kb of LAT coding sequences is necessary and sufficient for wild-type reactivation from latency. The ability of LAT to inhibit apoptosis is important for reactivation from latency. Within the first 1.5 kb of LAT coding sequences and LAT promoter sequences, additional transcripts have been identified. For example, the anti-sense to LAT transcript (AL) is expressed in the opposite direction to LAT from the 5' end of LAT and LAT promoter sequences. In addition, the upstream of LAT (UOL) transcript is expressed in the LAT direction from sequences in the LAT promoter. Further examination of the first 1.5 kb of LAT coding sequences revealed two small ORFs that are anti-sense with respect to LAT (AL2 and AL3). A transcript spanning AL3 was detected in productively infected cells, mouse neuroblastoma cells stably expressing LAT and trigeminal ganglia (TG) of latently infected mice. Peptide-specific IgG directed against AL3 specifically recognized a protein migrating near 15 kDa in cells stably transfected with LAT, mouse neuroblastoma cells transfected with a plasmid containing the AL3 ORF and TG of latently infected mice. The inability to detect the AL3 protein during productive infection may have been because the 5' terminus of the AL3 transcript was downstream of the first in-frame methionine of the AL3 ORF during productive infection.
Functional MRI reveals expert-novice differences during sport-related anticipation.
Wright, Michael J; Bishop, Daniel T; Jackson, Robin C; Abernethy, Bruce
2010-01-27
We examined the effect of expertise on cortical activation during sports anticipation using functional MRI. In experiment 1, recreational players predicted badminton stroke direction and the pattern of active clusters was consistent with a proposed perception-of-action network. This pattern was not replicated in a stimulus-matched, action-unrelated control task. In experiment 2, players of three different skill levels anticipated stroke direction from clips occluded either 160 ms before or 80 ms after racquet-shuttle contact. Early-occluded sequences produced more activation than late-occluded sequences overall, in most cortical regions of interest, but experts showed an additional enhancement in medial, dorsolateral and ventrolateral frontal cortex. Anticipation in open-skill sports engages cortical areas integral to observing and understanding others' actions; such activity is enhanced in experts.
Ssengooba, Willy; de Jong, Bouke C; Joloba, Moses L; Cobelens, Frank G; Meehan, Conor J
2016-08-05
In the context of advanced immunosuppression, M. tuberculosis is known to cause detectable mycobacteremia. However, little is known about the intra-patient mycobacterial microevolution and the direction of seeding between the sputum and blood compartments. From a diagnostic study of HIV-infected TB patients, 51 pairs of concurrent blood and sputum M. tuberculosis isolates from the same patient were available. In a previous analysis, we identified a subset with genotypic concordance, based on spoligotyping and 24 locus MIRU-VNTR. These paired isolates with identical genotypes were analyzed by whole genome sequencing and phylogenetic analysis. Of the 25 concordant pairs (49 % of the 51 paired isolates), 15 (60 %) remained viable for extraction of high quality DNA for whole genome sequencing. Two patient pairs were excluded due to poor quality sequence reads. The median CD4 cell count was 32 (IQR; 16-101)/mm(3) and ten (77 %) patients were on ART. No drug resistance mutations were identified in any of the sequences analyzed. Three (23.1 %) of 13 patients had SNPs separating paired isolates from blood and sputum compartments, indicating evidence of microevolution. Using a phylogenetic approach to identify the ancestral compartment, in two (15 %) patients the blood isolate was ancestral to the sputum isolate, in one (8 %) it was the opposite, and ten (77 %) of the pairs were identical. Among HIV-infected patients with poor cellular immunity, infection with multiple strains of M. tuberculosis was found in half of the patients. In those patients with identical strains, whole genome sequencing indicated that M. tuberculosis intra-patient microevolution does occur in a few patients, yet did not reveal a consistent direction of spread between sputum and blood. This suggests that these compartments are highly connected and potentially seed each other repeatedly.
Lagares, Antonio; Hozbor, Daniela F.; Niehaus, Karsten; Otero, Augusto J. L. Pich; Lorenzen, Jens; Arnold, Walter; Pühler, Alfred
2001-01-01
The genetic characterization of a 5.5-kb chromosomal region of Sinorhizobium meliloti 2011 that contains lpsB, a gene required for the normal development of symbiosis with Medicago spp., is presented. The nucleotide sequence of this DNA fragment revealed the presence of six genes: greA and lpsB, transcribed in the forward direction; and lpsE, lpsD, lpsC, and lrp, transcribed in the reverse direction. Except for lpsB, none of the lps genes were relevant for nodulation and nitrogen fixation. Analysis of the transcriptional organization of lpsB showed that greA and lpsB are part of separate transcriptional units, which is in agreement with the finding of a DNA stretch homologous to a “nonnitrogen” promoter consensus sequence between greA and lpsB. The opposite orientation of lpsB with respect to its first downstream coding sequence, lpsE, indicated that the altered LPS and the defective symbiosis of lpsB mutants are both consequences of a primary nonpolar defect in a single gene. Global sequence comparisons revealed that the greA-lpsB and lrp genes of S. meliloti have a genetic organization similar to that of their homologous loci in R. leguminosarum bv. viciae. In particular, high sequence similarity was found between the translation product of lpsB and a core-related biosynthetic mannosyltransferase of R. leguminosarum bv. viciae encoded by the lpcC gene. The functional relationship between these two genes was demonstrated in genetic complementation experiments in which the S. meliloti lpsB gene restored the wild-type LPS phenotype when introduced into lpcC mutants of R. leguminosarum. These results support the view that S. meliloti lpsB also encodes a mannosyltransferase that participates in the biosynthesis of the LPS core. Evidence is provided for the presence of other lpsB-homologous sequences in several members of the family Rhizobiaceae. PMID:11157937
Whitfield, A E; Rotenberg, D; Aritua, V; Hogenhout, S A
2011-04-01
The corn planthopper, Peregrinus maidis, causes direct feeding damage to plants and transmits Maize mosaic rhabdovirus (MMV) in a persistent-propagative manner. MMV must cross several insect tissue layers for successful transmission to occur, and the gut serves as an important barrier for rhabdovirus transmission. In order to facilitate the identification of proteins that may interact with MMV either by facilitating acquisition or responding to virus infection, we generated and analysed the gut transcriptome of P. maidis. From two normalized cDNA libraries, we generated a P. maidis gut transcriptome composed of 20,771 expressed sequence tags (ESTs). Assembly of the sequences yielded 1860 contigs and 14,032 singletons, and biological roles were assigned to 5793 (36%). Comparison of P. maidis ESTs with other insect amino acid sequences revealed that P. maidis shares greatest sequence similarity with another hemipteran, the brown planthopper Nilaparvata lugens. We identified 202 P. maidis transcripts with putative homology to proteins associated with insect innate immunity, including those implicated in the Toll, Imd, JAK/STAT, Jnk and the small-interfering RNA-mediated pathways. Sequence comparisons between our P. maidis gut EST collection and the currently available National Center for Biotechnology Information EST database collection for Ni. lugens revealed that a pathogen recognition receptor in the Imd pathway, peptidoglycan recognition protein-long class (PGRP-LC), is present in these two members of the family Delphacidae; however, these recognition receptors are lacking in the model hemipteran Acyrthosiphon pisum. In addition, we identified sequences in the P. maidis gut transcriptome that share significant amino acid sequence similarities with the rhabdovirus receptor molecule, acetylcholine receptor (AChR), found in other hosts. This EST analysis sheds new light on immune response pathways in hemipteran guts that will be useful for further dissecting innate defence response pathways to rhabdovirus infection. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.
Lai, Yen-Ting; Cheng, Chao-Sheng; Liu, Yu-Nan; Liu, Yaw-Jen; Lyu, Ping-Chiang
2008-09-01
Plant nonspecific lipid transfer proteins (nsLTPs) are small, basic proteins constituted mainly of alpha-helices and stabilized by four conserved disulfide bridges. They are characterized by the presence of a tunnel-like hydrophobic cavity, capable of transferring various lipid molecules between lipid bilayers in vitro. In this study, molecular dynamics (MD) simulations were performed at room temperature to investigate the effects of lipid binding on the dynamic properties of rice nsLTP1. Rice nsLTP1, either in the free form or complexed with one or two lipids was subjected to MD simulations. The C-terminal loop was very flexible both before and after lipid binding, as revealed by calculating the root-mean-square fluctuation. After lipid binding, the flexibility of some residues that were not in direct contact with lipid molecules increased significantly, indicating an increase of entropy in the region distal from the binding site. Essential dynamics analysis revealed clear differences in motion between unliganded and liganded rice nsLTP1s. In the free form of rice nsLTP1, loop1 exhibited the largest directional motion. This specific essential motion mode diminished after binding one or two lipid molecules. To verify the origin of the essential motion observed in the free form of rice nsLTP1, we performed multiple sequence alignments to probe the intrinsic motion encoded in the primary sequence. We found that the amino acid sequence of loop1 is highly conserved among plant nsLTP1s, thus revealing its functional importance during evolution. Furthermore, the sequence of loop1 is composed mainly of amino acids with short side chains. In this study, we show that MD simulations, together with essential dynamics analysis, can be used to determine structural and dynamic differences of rice nsLTP1 upon lipid binding. 2008 Wiley-Liss, Inc.
Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio
2015-09-01
The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.
van der Leij, F R; Visser, R G; Ponstein, A S; Jacobsen, E; Feenstra, W J
1991-08-01
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type sequence with a cDNA sequence from the literature and a newly isolated cDNA revealed the presence of 13 introns, the first of which is located in the untranslated leader. The promoter contains a G-box-like sequence. The deduced amino acid sequence of the precursor of GBSS shows a high degree of identity with monocot waxy protein sequences in the region corresponding to the mature form of the enzyme. The transit peptide of 77 amino acids, required for routing of the precursor to the plastids, shows much less identity with the transit peptides of the other waxy preproteins, but resembles the hydropathic distributions of these peptides. Alignment of the amino acid sequences of the four mature starch synthases with the Escherichia coli glgA gene product revealed the presence of at least three conserved boxes; there is no homology with previously proposed starch-binding domains of other enzymes involved in starch metabolism. We report the use of chimeric constructs with wild-type and amf sequences to localize, via complementation experiments, the region of the amf allele in which the mutation resides. Direct sequencing of polymerase chain reaction products confirmed that the amf mutation is a deletion of a single AT basepair in the region coding for the transit peptide.(ABSTRACT TRUNCATED AT 250 WORDS)
USDA-ARS?s Scientific Manuscript database
Soybean is the second largest crop in the US. Its yield directly impacts US agricultural economics. Drought and flooding are two major causes for soybean yield loss. To better understand their underlying molecular regulatory mechanisms, we sequenced the transcriptomes of soybean grown in drought a...
Length polymorphism scanning is an efficient approach for revealing chloroplast DNA variation.
Matthew E. Horning; Richard C. Cronn
2006-01-01
Phylogeographic and population genetic screens of chloroplast DNA (cpDNA) provide insights into seedbased gene flow in angiosperms, yet studies are frequently hampered by the low mutation rate of this genome. Detection methods for intraspecific variation can be either direct (DNA sequencing) or indirect (PCR-RFLP), although no single method incorporates the best...
Harnessing Whole Genome Sequencing in Medical Mycology.
Cuomo, Christina A
2017-01-01
Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.
Ryan, Niamh M; Lihm, Jayon; Kramer, Melissa; McCarthy, Shane; Morris, Stewart W; Arnau-Soler, Aleix; Davies, Gail; Duff, Barbara; Ghiban, Elena; Hayward, Caroline; Deary, Ian J; Blackwood, Douglas H R; Lawrie, Stephen M; McIntosh, Andrew M; Evans, Kathryn L; Porteous, David J; McCombie, W Richard; Thomson, Pippa A
2018-06-07
Psychiatric disorders are a group of genetically related diseases with highly polygenic architectures. Genome-wide association analyses have made substantial progress towards understanding the genetic architecture of these disorders. More recently, exome- and whole-genome sequencing of cases and families have identified rare, high penetrant variants that provide direct functional insight. There remains, however, a gap in the heritability explained by these complementary approaches. To understand how multiple genetic variants combine to modify both severity and penetrance of a highly penetrant variant, we sequenced 48 whole genomes from a family with a high loading of psychiatric disorder linked to a balanced chromosomal translocation. The (1;11)(q42;q14.3) translocation directly disrupts three genes: DISC1, DISC2, DISC1FP and has been linked to multiple brain imaging and neurocognitive outcomes in the family. Using DNA sequence-level linkage analysis, functional annotation and population-based association, we identified common and rare variants in GRM5 (minor allele frequency (MAF) > 0.05), PDE4D (MAF > 0.2) and CNTN5 (MAF < 0.01) that may help explain the individual differences in phenotypic expression in the family. We suggest that whole-genome sequencing in large families will improve the understanding of the combined effects of the rare and common sequence variation underlying psychiatric phenotypes.
Stable chromosome condensation revealed by chromosome conformation capture
Eagen, Kyle P.; Hartl, Tom A.; Kornberg, Roger D.
2015-01-01
SUMMARY Chemical cross-linking and DNA sequencing have revealed regions of intra-chromosomal interaction, referred to as topologically associating domains (TADs), interspersed with regions of little or no interaction, in interphase nuclei. We find that TADs and the regions between them correspond with the bands and interbands of polytene chromosomes of Drosophila. We further establish the conservation of TADs between polytene and diploid cells of Drosophila. From direct measurements on light micrographs of polytene chromosomes, we then deduce the states of chromatin folding in the diploid cell nucleus. Two states of folding, fully extended fibers containing regulatory regions and promoters, and fibers condensed up to ten-fold containing coding regions of active genes, constitute the euchromatin of the nuclear interior. Chromatin fibers condensed up to 30-fold, containing coding regions of inactive genes, represent the heterochromatin of the nuclear periphery. A convergence of molecular analysis with direct observation thus reveals the architecture of interphase chromosomes. PMID:26544940
Barnes, Kayla G; Weedall, Gareth D; Ndula, Miranda; Irving, Helen; Mzihalowa, Themba; Hemingway, Janet; Wondji, Charles S
2017-02-01
Insecticide resistance in mosquito populations threatens recent successes in malaria prevention. Elucidating patterns of genetic structure in malaria vectors to predict the speed and direction of the spread of resistance is essential to get ahead of the 'resistance curve' and to avert a public health catastrophe. Here, applying a combination of microsatellite analysis, whole genome sequencing and targeted sequencing of a resistance locus, we elucidated the continent-wide population structure of a major African malaria vector, Anopheles funestus. We identified a major selective sweep in a genomic region controlling cytochrome P450-based metabolic resistance conferring high resistance to pyrethroids. This selective sweep occurred since 2002, likely as a direct consequence of scaled up vector control as revealed by whole genome and fine-scale sequencing of pre- and post-intervention populations. Fine-scaled analysis of the pyrethroid resistance locus revealed that a resistance-associated allele of the cytochrome P450 monooxygenase CYP6P9a has swept through southern Africa to near fixation, in contrast to high polymorphism levels before interventions, conferring high levels of pyrethroid resistance linked to control failure. Population structure analysis revealed a barrier to gene flow between southern Africa and other areas, which may prevent or slow the spread of the southern mechanism of pyrethroid resistance to other regions. By identifying a genetic signature of pyrethroid-based interventions, we have demonstrated the intense selective pressure that control interventions exert on mosquito populations. If this level of selection and spread of resistance continues unabated, our ability to control malaria with current interventions will be compromised.
Eibofner, Frank; Martirosian, Petros; Würslin, Christian; Graf, Hansjörg; Syha, Roland; Clasen, Stephan
2015-11-01
In interventional magnetic resonance imaging, instruments can be equipped with conducting wires for visualization by current application. The potential of sequence triggered application of transient direct currents in balanced steady-state free precession (bSSFP) imaging is demonstrated. A conductor and a modified catheter were examined in water phantoms and in an ex vivo porcine liver. The current was switched by a trigger pulse in the bSSFP sequence in an interval between radiofrequency pulse and signal acquisition. Magnitude and phase images were recorded. Regions with transient field alterations were evaluated by a postprocessing algorithm. A phase mask was computed and overlaid with the magnitude image. Transient field alterations caused continuous phase shifts, which were separated by the postprocessing algorithm from phase jumps due to persistent field alterations. The overlaid images revealed the position of the conductor. The modified catheter generated visible phase offset in all orientations toward the static magnetic field and could be unambiguously localized in the ex vivo porcine liver. The application of a sequence triggered, direct current in combination with phase imaging allows conspicuous localization of interventional devices with a bSSFP sequence.
Grandpaternal mosaicism in a family with isolated haemophilia A.
Casey, G J; Rodgers, S E; Hall, J R; Rudzki, Z; Lloyd, J V
1999-12-01
About one third of cases of haemophilia A have no family history of the disorder, and 20% are thought to be due to a new mutation. In the family reported here, a 3 bp deletion was detected in DNA from the proband at the 3' end of exon 15. Direct sequencing of genomic DNA prepared from blood and buccal cells of the grandfather revealed both normal and mutant sequences, suggesting that he is a mosaic for this mutation. This highlights the usefulness of mutation detection, both for accurate genetic counselling and to determine the origin of new mutations of haemophilia.
Design of multi-phase dynamic chemical networks
NASA Astrophysics Data System (ADS)
Chen, Chenrui; Tan, Junjun; Hsieh, Ming-Chien; Pan, Ting; Goodwin, Jay T.; Mehta, Anil K.; Grover, Martha A.; Lynn, David G.
2017-08-01
Template-directed polymerization reactions enable the accurate storage and processing of nature's biopolymer information. This mutualistic relationship of nucleic acids and proteins, a network known as life's central dogma, is now marvellously complex, and the progressive steps necessary for creating the initial sequence and chain-length-specific polymer templates are lost to time. Here we design and construct dynamic polymerization networks that exploit metastable prion cross-β phases. Mixed-phase environments have been used for constructing synthetic polymers, but these dynamic phases emerge naturally from the growing peptide oligomers and create environments suitable both to nucleate assembly and select for ordered templates. The resulting templates direct the amplification of a phase containing only chain-length-specific peptide-like oligomers. Such multi-phase biopolymer dynamics reveal pathways for the emergence, self-selection and amplification of chain-length- and possibly sequence-specific biopolymers.
Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection
NASA Astrophysics Data System (ADS)
Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc
2009-09-01
DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.
Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.
Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R
2001-11-23
Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.
Park, Jeong-Hoon; Park, Jong-Hun; Je Seong, Hoon; Sul, Woo Jun; Jin, Kang-Hyun; Park, Hee-Deung
2018-07-01
To provide insight into direct interspecies electron transfer via granular activated carbon (GAC), the effect of GAC supplementation on anaerobic digestion was evaluated. Compared to control samples, the GAC supplementation increased the total amount of methane production and its production rate by 31% and 72%, respectively. 16S rDNA sequencing analysis revealed a shift in the archaeal community composition; the Methanosarcina proportion decreased 17%, while the Methanosaeta proportion increased 5.6%. Metagenomic analyses based on shotgun sequencing demonstrated that the abundance of pilA and omcS genes belonging to Geobacter species decreased 69.4% and 29.4%, respectively. Furthermore, the analyses suggested a carbon dioxide reduction pathway rather than an acetate decarboxylation pathway for methane formation. Taken together, these results suggest that GAC improved methane production performance by shifting the microbial community and altering functional genes associated with direct interspecies electron transfer via conductive materials. Copyright © 2018 Elsevier Ltd. All rights reserved.
Putkinen, Anuliina; Larmola, Tuula; Tuomivirta, Tero; Siljanen, Henri M P; Bodrossy, Levente; Tuittila, Eeva-Stiina; Fritze, Hannu
2014-06-01
Sphagnum-associated methanotrophs (SAM) are an important sink for the methane (CH4) formed in boreal peatlands. We aimed to reveal how peatland succession, which entails a directional change in several environmental variables, affects SAM and their activity. Based on the pmoA microarray results, SAM community structure changes when a peatland develops from a minerotrophic fen to an ombrotrophic bog. Methanotroph subtypes Ia, Ib, and II showed slightly contrasting patterns during succession, suggesting differences in their ecological niche adaptation. Although the direct DNA-based analysis revealed a high diversity of type Ib and II methanotrophs throughout the studied peatland chronosequence, stable isotope probing (SIP) of the pmoA gene indicated they were active mainly during the later stages of succession. In contrast, type Ia methanotrophs showed active CH4 consumption in all analyzed samples. SIP-derived (13)C-labeled 16S rRNA gene clone libraries revealed a high diversity of SAM in every succession stage including some putative Methylocella/Methyloferula methanotrophs that are not detectable with the pmoA-based approach. In addition, a high diversity of 16S rRNA gene sequences likely representing cross-labeled nonmethanotrophs was discovered, including a significant proportion of Verrucomicrobia-related sequences. These results help to predict the effects of changing environmental conditions on SAM communities and activity. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Rhizobium etli asparaginase II
Huerta-Saquero, Alejandro; Evangelista-Martínez, Zahaed; Moreno-Enriquez, Angélica; Perez-Rueda, Ernesto
2013-01-01
Bacterial l-asparaginase has been a universal component of therapies for childhood acute lymphoblastic leukemia since the 1970s. Two principal enzymes derived from Escherichia coli and Erwinia chrysanthemi are the only options clinically approved to date. We recently reported a study of recombinant l-asparaginase (AnsA) from Rhizobium etli and described an increasing type of AnsA family members. Sequence analysis revealed four conserved motifs with notable differences with respect to the conserved regions of amino acid sequences of type I and type II l-asparaginases, particularly in comparison with therapeutic enzymes from E. coli and E. chrysanthemi. These differences suggested a distinct immunological specificity. Here, we report an in silico analysis that revealed immunogenic determinants of AnsA. Also, we used an extensive approach to compare the crystal structures of E. coli and E. chrysantemi asparaginases with a computational model of AnsA and identified immunogenic epitopes. A three-dimensional model of AsnA revealed, as expected based on sequence dissimilarities, completely different folding and different immunogenic epitopes. This approach could be very useful in transcending the problem of immunogenicity in two major ways: by chemical modifications of epitopes to reduce drug immunogenicity, and by site-directed mutagenesis of amino acid residues to diminish immunogenicity without reduction of enzymatic activity. PMID:22895060
Rhizobium etli asparaginase II: an alternative for acute lymphoblastic leukemia (ALL) treatment.
Huerta-Saquero, Alejandro; Evangelista-Martínez, Zahaed; Moreno-Enriquez, Angélica; Perez-Rueda, Ernesto
2013-01-01
Bacterial L-asparaginase has been a universal component of therapies for childhood acute lymphoblastic leukemia since the 1970s. Two principal enzymes derived from Escherichia coli and Erwinia chrysanthemi are the only options clinically approved to date. We recently reported a study of recombinant L-asparaginase (AnsA) from Rhizobium etli and described an increasing type of AnsA family members. Sequence analysis revealed four conserved motifs with notable differences with respect to the conserved regions of amino acid sequences of type I and type II L-asparaginases, particularly in comparison with therapeutic enzymes from E. coli and E. chrysanthemi. These differences suggested a distinct immunological specificity. Here, we report an in silico analysis that revealed immunogenic determinants of AnsA. Also, we used an extensive approach to compare the crystal structures of E. coli and E. chrysantemi asparaginases with a computational model of AnsA and identified immunogenic epitopes. A three-dimensional model of AsnA revealed, as expected based on sequence dissimilarities, completely different folding and different immunogenic epitopes. This approach could be very useful in transcending the problem of immunogenicity in two major ways: by chemical modifications of epitopes to reduce drug immunogenicity, and by site-directed mutagenesis of amino acid residues to diminish immunogenicity without reduction of enzymatic activity.
Cloning and characterization of an autonomous replication sequence from Coxiella burnetii.
Suhan, M; Chen, S Y; Thompson, H A; Hoover, T A; Hill, A; Williams, J C
1994-01-01
A Coxiella burnetii chromosomal fragment capable of functioning as an origin for the replication of a kanamycin resistance (Kanr) plasmid was isolated by use of origin search methods utilizing an Escherichia coli host. The 5.8-kb fragment was subcloned into phagemid vectors and was deleted progressively by an exonuclease III-S1 technique. Plasmids containing progressively shorter DNA fragments were then tested for their capability to support replication by transformation of an E. coli polA strain. A minimal autonomous replication sequence (ARS) was delimited to 403 bp. Sequencing of the entire 5.8-kb region revealed that the minimal ARS contained two consensus DnaA boxes, three A + T-rich 21-mers, a transcriptional promoter leading rightwards, and potential integration host factor and factor of inversion stimulation binding sites. Database comparisons of deduced amino acid sequences revealed that open reading frames located around the ARS were homologous to genes often, but not always, found near bacterial chromosomal origins; these included identities with rpmH and rnpA in E. coli and identities with the 9K protein and 60K membrane protein in E. coli and Pseudomonas species. These and direct hybridization data suggested that the ARS was chromosomal and not associated with the resident plasmid QpH1. Two-dimensional agarose gel electrophoresis did not reveal the presence of initiating intermediates, indicating that the ARS did not initiate chromosome replication during laboratory growth of C. burnetii. Images PMID:8071197
Direct Detection of Drug-Resistant Hepatitis B Virus in Serum Using a Dendron-Modified Microarray
Kim, Doo Hyun; Kang, Hong Seok; Hur, Seong-Suk; Sim, Seobo; Ahn, Sung Hyun; Park, Yong Kwang; Park, Eun-Sook; Lee, Ah Ram; Park, Soree; Kwon, So Young; Lee, Jeong-Hoon
2018-01-01
Background/Aims Direct sequencing is the gold standard for the detection of drug-resistance mutations in hepatitis B virus (HBV); however, this procedure is time-consuming, labor-intensive, and difficult to adapt to high-throughput screening. In this study, we aimed to develop a dendron-modified DNA microarray for the detection of genotypic resistance mutations and evaluate its efficiency. Methods The specificity, sensitivity, and selectivity of dendron-modified slides for the detection of representative drug-resistance mutations were evaluated and compared to those of conventional slides. The diagnostic accuracy was validated using sera obtained from 13 patients who developed viral breakthrough during lamivudine, adefovir, or entecavir therapy and compared with the accuracy of restriction fragment mass polymorphism and direct sequencing data. Results The dendron-modified slides significantly outperformed the conventional microarray slides and were able to detect HBV DNA at a very low level (1 copy/μL). Notably, HBV mutants could be detected in the chronic hepatitis B patient sera without virus purification. The validation of our data revealed that this technique is fully compatible with sequencing data of drug-resistant HBV. Conclusions We developed a novel diagnostic technique for the simultaneous detection of several drug-resistance mutations using a dendron-modified DNA microarray. This technique can be directly applied to sera from chronic hepatitis B patients who show resistance to several nucleos(t)ide analogues. PMID:29271185
Booher, Nicholas J.; Carpenter, Sara C. D.; Sebra, Robert P.; Wang, Li; Salzberg, Steven L.; Leach, Jan E.
2015-01-01
Pathogen-injected, direct transcriptional activators of host genes, TAL (transcription activator-like) effectors play determinative roles in plant diseases caused by Xanthomonas spp. A large domain of nearly identical, 33–35 aa repeats in each protein mediates DNA recognition. This modularity makes TAL effectors customizable and thus important also in biotechnology. However, the repeats render TAL effector (tal) genes nearly impossible to assemble using next-generation, short reads. Here, we demonstrate that long-read, single molecule real-time (SMRT) sequencing solves this problem. Taking an ensemble approach to first generate local, tal gene contigs, we correctly assembled de novo the genomes of two strains of the rice pathogen X. oryzae completed previously using the Sanger method and even identified errors in those references. Sequencing two more strains revealed a dynamic genome structure and a striking plasticity in tal gene content. Our results pave the way for population-level studies to inform resistance breeding, improve biotechnology and probe TAL effector evolution. PMID:27148456
Livingston, B T; Shaw, R; Bailey, A; Wilt, F
1991-12-01
In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.
Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang
2013-01-01
IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127
MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.
Ozaki, Haruka; Iwasaki, Wataru
2016-08-01
As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Komisarczuk, Anna Z; Kongshaug, Heidi; Nilsen, Frank
2018-02-01
Na + /K + -ATPase has a key function in a variety of physiological processes including membrane excitability, osmoregulation, regulation of cell volume, and transport of nutrients. While knowledge about Na + /K + -ATPase function in osmoregulation in crustaceans is extensive, the role of this enzyme in other physiological and developmental processes is scarce. Here, we report characterization, transcriptional distribution and likely functions of the newly identified L. salmonis Na + /K + -ATPase (LsalNa + /K + -ATPase) α subunit in various developmental stages. The complete mRNA sequence was identified, with 3003 bp open reading frame encoding a putative protein of 1001 amino acids. Putative protein sequence of LsalNa + /K + -ATPase revealed all typical features of Na + /K + -ATPase and demonstrated high sequence identity to other invertebrate and vertebrate species. Quantitative RT-PCR analysis revealed higher LsalNa + /K + -ATPase transcript level in free-living stages in comparison to parasitic stages. In situ hybridization analysis of copepodids and adult lice revealed LsalNa + /K + -ATPase transcript localization in a wide variety of tissues such as nervous system, intestine, reproductive system, and subcuticular and glandular tissue. RNAi mediated knock-down of LsalNa + /K + -ATPase caused locomotion impairment, and affected reproduction and feeding. Morphological analysis of dsRNA treated animals revealed muscle degeneration in larval stages, severe changes in the oocyte formation and maturation in females and abnormalities in tegmental glands. Thus, the study represents an important foundation for further functional investigation and identification of physiological pathways in which Na + /K + -ATPase is directly or indirectly involved. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhou, Zhenxing; Xu, Qingqing; Bu, Qingting; Guo, Yuanyang; Liu, Shuiping; Liu, Yu; Du, Yiling; Li, Yongquan
2015-02-09
Genomic sequencing of actinomycetes has revealed the presence of numerous gene clusters seemingly capable of natural product biosynthesis, yet most clusters are cryptic under laboratory conditions. Bioinformatics analysis of the completely sequenced genome of Streptomyces chattanoogensis L10 (CGMCC 2644) revealed a silent angucycline biosynthetic gene cluster. The overexpression of a pathway-specific activator gene under the constitutive ermE* promoter successfully triggered the expression of the angucycline biosynthetic genes. Two novel members of the angucycline antibiotic family, chattamycins A and B, were further isolated and elucidated. Biological activity assays demonstrated that chattamycin B possesses good antitumor activities against human cancer cell lines and moderate antibacterial activities. The results presented here provide a feasible method to activate silent angucycline biosynthetic gene clusters to discover potential new drug leads. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Evaluating, Comparing, and Interpreting Protein Domain Hierarchies
2014-01-01
Abstract Arranging protein domain sequences hierarchically into evolutionarily divergent subgroups is important for investigating evolutionary history, for speeding up web-based similarity searches, for identifying sequence determinants of protein function, and for genome annotation. However, whether or not a particular hierarchy is optimal is often unclear, and independently constructed hierarchies for the same domain can often differ significantly. This article describes methods for statistically evaluating specific aspects of a hierarchy, for probing the criteria underlying its construction and for direct comparisons between hierarchies. Information theoretical notions are used to quantify the contributions of specific hierarchical features to the underlying statistical model. Such features include subhierarchies, sequence subgroups, individual sequences, and subgroup-associated signature patterns. Underlying properties are graphically displayed in plots of each specific feature's contributions, in heat maps of pattern residue conservation, in “contrast alignments,” and through cross-mapping of subgroups between hierarchies. Together, these approaches provide a deeper understanding of protein domain functional divergence, reveal uncertainties caused by inconsistent patterns of sequence conservation, and help resolve conflicts between competing hierarchies. PMID:24559108
Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C
2015-03-11
A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Leys, Natalie M. E. J.; Ryngaert, Annemie; Bastiaens, Leen; Verstraete, Willy; Top, Eva M.; Springael, Dirk
2004-01-01
Bacterial strains of the genus Sphingomonas are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAH) as the sole source of carbon and energy. The direct detection of Sphingomonas strains in contaminated soils, either indigenous or inoculated, is, as such, of interest for bioremediation purposes. In this study, a culture-independent PCR-based detection method using specific primers targeting the Sphingomonas 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) was developed to assess Sphingomonas diversity in PAH-contaminated soils. PCR using the new primer pair on a set of template DNAs of different bacterial genera showed that the method was selective for bacteria belonging to the family Sphingomonadaceae. Single-band DGGE profiles were obtained for most Sphingomonas strains tested. Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. Inoculated strains could be detected at a cell concentration of 104 CFU g of soil−1. The analysis of Sphingomonas population structures of several PAH-contaminated soils by the new PCR-DGGE method revealed that soils containing the highest phenanthrene concentrations showed the lowest Sphingomonas diversity. Sequence analysis of cloned PCR products amplified from soil DNA revealed new 16S rRNA gene Sphingomonas sequences significantly different from sequences from known cultivated isolates (i.e., sequences from environmental clones grouped phylogenetically with other environmental clone sequences available on the web and that possibly originated from several potential new species). In conclusion, the newly designed Sphingomonas-specific PCR-DGGE detection technique successfully analyzed the Sphingomonas communities from polluted soils at the species level and revealed different Sphingomonas members not previously detected by culture-dependent detection techniques. PMID:15066784
Conservation of tubulin-binding sequences in TRPV1 throughout evolution.
Sardar, Puspendu; Kumar, Abhishek; Bhandari, Anita; Goswami, Chandan
2012-01-01
Transient Receptor Potential Vanilloid sub type 1 (TRPV1), commonly known as capsaicin receptor can detect multiple stimuli ranging from noxious compounds, low pH, temperature as well as electromagnetic wave at different ranges. In addition, this receptor is involved in multiple physiological and sensory processes. Therefore, functions of TRPV1 have direct influences on adaptation and further evolution also. Availability of various eukaryotic genomic sequences in public domain facilitates us in studying the molecular evolution of TRPV1 protein and the respective conservation of certain domains, motifs and interacting regions that are functionally important. Using statistical and bioinformatics tools, our analysis reveals that TRPV1 has evolved about ∼420 million years ago (MYA). Our analysis reveals that specific regions, domains and motifs of TRPV1 has gone through different selection pressure and thus have different levels of conservation. We found that among all, TRP box is the most conserved and thus have functional significance. Our results also indicate that the tubulin binding sequences (TBS) have evolutionary significance as these stretch sequences are more conserved than many other essential regions of TRPV1. The overall distribution of positively charged residues within the TBS motifs is conserved throughout evolution. In silico analysis reveals that the TBS-1 and TBS-2 of TRPV1 can form helical structures and may play important role in TRPV1 function. Our analysis identifies the regions of TRPV1, which are important for structure-function relationship. This analysis indicates that tubulin binding sequence-1 (TBS-1) near the TRP-box forms a potential helix and the tubulin interactions with TRPV1 via TBS-1 have evolutionary significance. This interaction may be required for the proper channel function and regulation and may also have significance in the context of Taxol®-induced neuropathy.
Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.
Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi
2012-04-01
Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.
van Hal, Sebastiaan J.; Steen, Jason A.; Espedido, Björn A.; Grimmond, Sean M.; Cooper, Matthew A.; Holden, Matthew T. G.; Bentley, Stephen D.; Gosbell, Iain B.; Jensen, Slade O.
2014-01-01
Objectives To obtain an expanded understanding of antibiotic resistance evolution in vivo, particularly in the context of vancomycin exposure. Methods The whole genomes of six consecutive methicillin-resistant Staphylococcus aureus blood culture isolates (ST239-MRSA-III) from a single patient exposed to various antimicrobials (over a 77 day period) were sequenced and analysed. Results Variant analysis revealed the existence of non-susceptible sub-populations derived from a common susceptible ancestor, with the predominant circulating clone(s) selected for by type and duration of antimicrobial exposure. Conclusions This study highlights the dynamic nature of bacterial evolution and that non-susceptible sub-populations can emerge from clouds of variation upon antimicrobial exposure. Diagnostically, this has direct implications for sample selection when using whole-genome sequencing as a tool to guide clinical therapy. In the context of bacteraemia, deep sequencing of bacterial DNA directly from patient blood samples would avoid culture ‘bias’ and identify mutations associated with circulating non-susceptible sub-populations, some of which may confer cross-resistance to alternate therapies. PMID:24047554
van Hal, Sebastiaan J; Steen, Jason A; Espedido, Björn A; Grimmond, Sean M; Cooper, Matthew A; Holden, Matthew T G; Bentley, Stephen D; Gosbell, Iain B; Jensen, Slade O
2014-02-01
To obtain an expanded understanding of antibiotic resistance evolution in vivo, particularly in the context of vancomycin exposure. The whole genomes of six consecutive methicillin-resistant Staphylococcus aureus blood culture isolates (ST239-MRSA-III) from a single patient exposed to various antimicrobials (over a 77 day period) were sequenced and analysed. Variant analysis revealed the existence of non-susceptible sub-populations derived from a common susceptible ancestor, with the predominant circulating clone(s) selected for by type and duration of antimicrobial exposure. This study highlights the dynamic nature of bacterial evolution and that non-susceptible sub-populations can emerge from clouds of variation upon antimicrobial exposure. Diagnostically, this has direct implications for sample selection when using whole-genome sequencing as a tool to guide clinical therapy. In the context of bacteraemia, deep sequencing of bacterial DNA directly from patient blood samples would avoid culture 'bias' and identify mutations associated with circulating non-susceptible sub-populations, some of which may confer cross-resistance to alternate therapies.
Andrulis, Mindaugas; Capper, David; Luft, Thomas; Hartmann, Christian; Zentgraf, Hanswalter; von Deimling, Andreas
2010-08-01
Sequencing of the acute myeloid leukemia genome revealed somatic mutations in isocitrate dehydrogenase-1. Acute myeloid leukemia frequently develops from myelodysplastic syndrome. In order to test whether myelodysplastic syndrome also carries isocitrate dehydrogenase-1 mutations, we stained a series of bone marrow samples from patients with myelodysplastic syndrome using an antibody specific for the R132H mutation. Three out of 71 patients exhibited antibody binding to myeloid precursor cells. The presence of the R132H mutation was confirmed by DNA sequencing. We demonstrated that isocitrate dehydrogenase-1 mutations occur in myelodysplasia preceding acute myeloid leukemia and that the R132H alteration can be detected by immunohistochemistry. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Chara, Osvaldo; Borges, Augusto; Milhiet, Pierre-Emmanuel; Nöllmann, Marcelo; Cattoni, Diego I
2018-03-27
Transport of cellular cargo by molecular motors requires directionality to ensure proper biological functioning. During sporulation in Bacillus subtilis, directionality of chromosome transport is mediated by the interaction between the membrane-bound DNA translocase SpoIIIE and specific octameric sequences (SRS). Whether SRS regulate directionality by recruiting and orienting SpoIIIE or by simply catalyzing its translocation activity is still unclear. By using atomic force microscopy and single-round fast kinetics translocation assays we determined the localization and dynamics of diffusing and translocating SpoIIIE complexes on DNA with or without SRS. Our findings combined with mathematical modelling revealed that SpoIIIE directionality is not regulated by protein recruitment to SRS but rather by a fine-tuned balance among the rates governing SpoIIIE-DNA interactions and the probability of starting translocation modulated by SRS. Additionally, we found that SpoIIIE can start translocation from non-specific DNA, providing an alternative active search mechanism for SRS located beyond the exploratory length defined by 1D diffusion. These findings are relevant in vivo in the context of chromosome transport through an open channel, where SpoIIIE can rapidly explore DNA while directionality is modulated by the probability of translocation initiation upon interaction with SRS versus non-specific DNA.
Golden Ratio Versus Pi as Random Sequence Sources for Monte Carlo Integration
NASA Technical Reports Server (NTRS)
Sen, S. K.; Agarwal, Ravi P.; Shaykhian, Gholam Ali
2007-01-01
We discuss here the relative merits of these numbers as possible random sequence sources. The quality of these sequences is not judged directly based on the outcome of all known tests for the randomness of a sequence. Instead, it is determined implicitly by the accuracy of the Monte Carlo integration in a statistical sense. Since our main motive of using a random sequence is to solve real world problems, it is more desirable if we compare the quality of the sequences based on their performances for these problems in terms of quality/accuracy of the output. We also compare these sources against those generated by a popular pseudo-random generator, viz., the Matlab rand and the quasi-random generator ha/ton both in terms of error and time complexity. Our study demonstrates that consecutive blocks of digits of each of these numbers produce a good random sequence source. It is observed that randomly chosen blocks of digits do not have any remarkable advantage over consecutive blocks for the accuracy of the Monte Carlo integration. Also, it reveals that pi is a better source of a random sequence than theta when the accuracy of the integration is concerned.
Limitations and potentials of current motif discovery algorithms
Hu, Jianjun; Li, Bin; Kihara, Daisuke
2005-01-01
Computational methods for de novo identification of gene regulation elements, such as transcription factor binding sites, have proved to be useful for deciphering genetic regulatory networks. However, despite the availability of a large number of algorithms, their strengths and weaknesses are not sufficiently understood. Here, we designed a comprehensive set of performance measures and benchmarked five modern sequence-based motif discovery algorithms using large datasets generated from Escherichia coli RegulonDB. Factors that affect the prediction accuracy, scalability and reliability are characterized. It is revealed that the nucleotide and the binding site level accuracy are very low, while the motif level accuracy is relatively high, which indicates that the algorithms can usually capture at least one correct motif in an input sequence. To exploit diverse predictions from multiple runs of one or more algorithms, a consensus ensemble algorithm has been developed, which achieved 6–45% improvement over the base algorithms by increasing both the sensitivity and specificity. Our study illustrates limitations and potentials of existing sequence-based motif discovery algorithms. Taking advantage of the revealed potentials, several promising directions for further improvements are discussed. Since the sequence-based algorithms are the baseline of most of the modern motif discovery algorithms, this paper suggests substantial improvements would be possible for them. PMID:16284194
Piddington, C S; Kovacevich, B R; Rambosek, J
1995-01-01
Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP. PMID:7574582
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.
Newsome, A L; McLean, J W; Lively, M O
1992-01-01
Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959
Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P
2000-05-01
Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.
Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi
2013-11-20
With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.
Postel, Alexander; Jha, Vijay C; Schmeiser, Stefanie; Becher, Paul
2013-01-01
Classical swine fever (CSF) is a major constraint to pig production worldwide, and in many developing countries, the epidemiological status is unknown. Here, for the first time, molecular identification and characterization of CSFV isolates from two recent outbreaks in Nepal are presented. Analysis of full-length E2-encoding sequences revealed that these isolates belonged to CSFV subgenotype 2.2 and had highest genetic similarity to isolates from India. Hence, for CSFV, Nepal and India should be regarded as one epidemiological unit. Both Nepalese isolates exhibited significant sequence differences, excluding a direct epidemiological connection and suggesting that CSFV is endemic in that country.
Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M
2017-10-01
Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.
The proximal-to-distal sequence in upper-limb motions on multiple levels and time scales.
Serrien, Ben; Baeyens, Jean-Pierre
2017-10-01
The proximal-to-distal sequence is a phenomenon that can be observed in a large variety of motions of the upper limbs in both humans and other mammals. The mechanisms behind this sequence are not completely understood and motor control theories able to explain this phenomenon are currently incomplete. The aim of this narrative review is to take a theoretical constraints-led approach to the proximal-to-distal sequence and provide a broad multidisciplinary overview of relevant literature. This sequence exists at multiple levels (brain, spine, muscles, kinetics and kinematics) and on multiple time scales (motion, motor learning and development, growth and possibly even evolution). We hypothesize that the proximodistal spatiotemporal direction on each time scale and level provides part of the organismic constraints that guide the dynamics at the other levels and time scales. The constraint-led approach in this review may serve as a first onset towards integration of evidence and a framework for further experimentation to reveal the dynamics of the proximal-to-distal sequence. Copyright © 2017 Elsevier B.V. All rights reserved.
Köberl, Martina; White, Richard A.; Erschen, Sabine; ...
2015-08-06
Streptomyces sp. strain Wb2n-11, isolated from native desert soil, exhibited broad-spectrum antagonism against plant pathogenic fungi, bacteria, and nematodes. The 8.2-Mb draft genome reveals genes putatively responsible for its promising biocontrol activity and genes which enable the soil bacterium to directly interact beneficially with plants.
USDA-ARS?s Scientific Manuscript database
The Brachyspira hyodysenteriae B204 genome sequence revealed three VSH-1 tail genes hvp31, hvp60, and hvp37, in a 3.6 kb cluster. The location and transcription direction of these genes relative to the previously described VSH-1 16.3 kb gene operon indicate that the gene transfer agent VSH-1 has a ...
Measurement of Electromagnetic Energy Flow Through a Sparse Particulate Medium: A Perspective
NASA Technical Reports Server (NTRS)
Mishchenko, Michael I.
2013-01-01
First-principle analysis of the functional design of a well-collimated radiometer (WCR) reveals that in general, this instrument does not record the instantaneous directional flow of electromagnetic energy. Only in special cases can a sequence of measurements with a WCR yield the magnitude and direction of the local time-averaged Poynting vector. Our analysis demonstrates that it is imperative to clearly formulate the physical nature of the actual measurement afforded by a directional radiometer rather than presume desirable measurement capabilities. Only then can the directional radiometer be considered a legitimate part of physically based remote sensing and radiation-budget applications. We also emphasize the need for a better understanding of the nature of measurements with panoramic radiometers.
Communicating the Benefits of a Full Sequence of High School Science Courses
NASA Astrophysics Data System (ADS)
Nicholas, Catherine Marie
High school students are generally uninformed about the benefits of enrolling in a full sequence of science courses, therefore only about a third of our nation's high school graduates have completed the science sequence of Biology, Chemistry and Physics. The lack of students completing a full sequence of science courses contributes to the deficit in the STEM degree production rate needed to fill the demand of the current job market and remain competitive as a nation. The purpose of the study was to make a difference in the number of students who have access to information about the benefits of completing a full sequence of science courses. This dissertation study employed qualitative research methodology to gain a broad perspective of staff through a questionnaire and document review and then a deeper understanding through semi-structured interview protocol. The data revealed that a universal sequence of science courses in the high school district did not exist. It also showed that not all students had access to all science courses; students were sorted and tracked according to prerequisites that did not necessarily match the skill set needed for the courses. In addition, the study showed a desire for more support and direction from the district office. It was also apparent that there was a disconnect that existed between who staff members believed should enroll in a full sequence of science courses and who actually enrolled. Finally, communication about science was shown to occur mainly through counseling and peers. A common science sequence, detracking of science courses, increased communication about the postsecondary and academic benefits of a science education, increased district direction and realistic mathematics alignment were all discussed as solutions to the problem.
Low, Van Lun; Chen, Chee Dhang; Lim, Phaik Eem; Lee, Han Lim; Lim, Yvonne Ai Lian; Tan, Tiong Kai; Sofian-Azirun, Mohd
2013-12-01
Given that there is limited available information on the insensitive acetylcholinesterase in insect species in Malaysia, the present study aims to detect the presence of G119S mutation in the acetylcholinesterase gene of Culex quinquefasciatus from 14 residential areas across 13 states and a federal territory in Malaysia. The ace-1 sequence and PCR-RFLP test revealed the presence of glycine-serine ace-1 mutation in the wild populations of Cx. quinquefasciatus. Both direct sequencing and PCR-RFLP methods demonstrated similar results and revealed the presence of a heterozygous genotype at a very low frequency (18 out of 140 individuals), while a homozygous resistant genotype was not detected across any study site in Malaysia. In addition, statistical analysis also revealed that malathion resistance is associated with the frequency of ace-1(R) in Cx. quinquefasciatus populations. This study has demonstrated the first field-evolved instance of G119S mutation in Malaysian populations. Molecular identification of insensitive acetylcholinesterase provides significant insights into the evolution and adaptation of the Malaysian Cx. quinquefasciatus populations. © 2013 Society of Chemical Industry.
Efficient parallel and out of core algorithms for constructing large bi-directed de Bruijn graphs.
Kundeti, Vamsi K; Rajasekaran, Sanguthevar; Dinh, Hieu; Vaughn, Matthew; Thapar, Vishal
2010-11-15
Assembling genomic sequences from a set of overlapping reads is one of the most fundamental problems in computational biology. Algorithms addressing the assembly problem fall into two broad categories - based on the data structures which they employ. The first class uses an overlap/string graph and the second type uses a de Bruijn graph. However with the recent advances in short read sequencing technology, de Bruijn graph based algorithms seem to play a vital role in practice. Efficient algorithms for building these massive de Bruijn graphs are very essential in large sequencing projects based on short reads. In an earlier work, an O(n/p) time parallel algorithm has been given for this problem. Here n is the size of the input and p is the number of processors. This algorithm enumerates all possible bi-directed edges which can overlap with a node and ends up generating Θ(nΣ) messages (Σ being the size of the alphabet). In this paper we present a Θ(n/p) time parallel algorithm with a communication complexity that is equal to that of parallel sorting and is not sensitive to Σ. The generality of our algorithm makes it very easy to extend it even to the out-of-core model and in this case it has an optimal I/O complexity of Θ(nlog(n/B)Blog(M/B)) (M being the main memory size and B being the size of the disk block). We demonstrate the scalability of our parallel algorithm on a SGI/Altix computer. A comparison of our algorithm with the previous approaches reveals that our algorithm is faster--both asymptotically and practically. We demonstrate the scalability of our sequential out-of-core algorithm by comparing it with the algorithm used by VELVET to build the bi-directed de Bruijn graph. Our experiments reveal that our algorithm can build the graph with a constant amount of memory, which clearly outperforms VELVET. We also provide efficient algorithms for the bi-directed chain compaction problem. The bi-directed de Bruijn graph is a fundamental data structure for any sequence assembly program based on Eulerian approach. Our algorithms for constructing Bi-directed de Bruijn graphs are efficient in parallel and out of core settings. These algorithms can be used in building large scale bi-directed de Bruijn graphs. Furthermore, our algorithms do not employ any all-to-all communications in a parallel setting and perform better than the prior algorithms. Finally our out-of-core algorithm is extremely memory efficient and can replace the existing graph construction algorithm in VELVET.
Niemiec, Emilia; Borry, Pascal; Pinxten, Wim; Howard, Heidi Carmen
2016-12-01
Whole exome sequencing (WES) and whole genome sequencing (WGS) have become increasingly available in the research and clinical settings and are now also being offered by direct-to-consumer (DTC) genetic testing (GT) companies. This offer can be perceived as amplifying the already identified concerns regarding adequacy of informed consent (IC) for both WES/WGS and the DTC GT context. We performed a qualitative content analysis of Websites of four companies offering WES/WGS DTC regarding the following elements of IC: pre-test counseling, benefits and risks, and incidental findings (IFs). The analysis revealed concerns, including the potential lack of pre-test counseling in three of the companies studied, missing relevant information in the risks and benefits sections, and potentially misleading information for consumers. Regarding IFs, only one company, which provides opportunistic screening, provides basic information about their management. In conclusion, some of the information (and related practices) present on the companies' Web pages salient to the consent process are not adequate in reference to recommendations for IC for WGS or WES in the clinical context. Requisite resources should be allocated to ensure that commercial companies are offering high-throughput sequencing under responsible conditions, including an adequate consent process. © 2016 WILEY PERIODICALS, INC.
Tan, Wei L; Li, Chun X; Wang, Zhong M; Liu, Mei D; Dong, Yan D; Feng, Xiang Y; Wu, Zhi M; Guo, Xiao X; Xing, Dan; Zhang, Ying M; Wang, Zhong C; Zhao, Tong Y
2012-09-01
To investigate knockdown resistance (kdr)-like mutations associated with pyrethroid resistance in Anopheles sinensis (Wiedemann, 1828), from Guangxi province, southwest China, a segment of a sodium channel gene was sequenced and genotyped using three new genotyping assays. Direct sequencing revealed the presence of TTG-to-TCG and TG-to-TTT mutations at allele position L1014, which led to L1014S and L1014F substitutions in a few individual and two novel substitutions of N1013S and L1014W in two DNA templates. A low frequency of the kdr allele mostly in the heterozygous state of L1014S and L1014F was observed in this mosquito population. In this study, the genotyping of An. sinensis using three polymerase chain reaction-based methods generated consistent results, which agreed with the results of DNA sequencing. In total, 52 mosquitoes were genotyped using a direct sequencing assay. The number of mosquitoes and their genotypes were as follows: L/L = 24, L/S = 19, L/F = 8, and F/W = 1. The allelic frequency of L1014, 1014S, and 1014F were 72, 18, and 9%, respectively.
Transcriptome and Small RNA Deep Sequencing Reveals Deregulation of miRNA Biogenesis in Human Glioma
Moore, Lynette M.; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N.; Zhang, Wei; Nykter, Matti
2013-01-01
Altered expression of oncogenic and tumor-suppressing microRNAs (miRNAs) is widely associated with tumorigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumors. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and interrogated expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression. PMID:23007860
Plourde, Marie; Gingras, Hélène; Roy, Gaétan; Lapointe, Andréanne; Leprohon, Philippe; Papadopoulou, Barbara; Corbeil, Jacques; Ouellette, Marc
2014-01-01
Gene amplification of specific loci has been described in all kingdoms of life. In the protozoan parasite Leishmania, the product of amplification is usually part of extrachromosomal circular or linear amplicons that are formed at the level of direct or inverted repeated sequences. A bioinformatics screen revealed that repeated sequences are widely distributed in the Leishmania genome and the repeats are chromosome-specific, conserved among species, and generally present in low copy number. Using sensitive PCR assays, we provide evidence that the Leishmania genome is continuously being rearranged at the level of these repeated sequences, which serve as a functional platform for constitutive and stochastic amplification (and deletion) of genomic segments in the population. This process is adaptive as the copy number of advantageous extrachromosomal circular or linear elements increases upon selective pressure and is reversible when selection is removed. We also provide mechanistic insights on the formation of circular and linear amplicons through RAD51 recombinase-dependent and -independent mechanisms, respectively. The whole genome of Leishmania is thus stochastically rearranged at the level of repeated sequences, and the selection of parasite subpopulations with changes in the copy number of specific loci is used as a strategy to respond to a changing environment. PMID:24844805
Alpha Power Modulates Perception Independently of Endogenous Factors.
Brüers, Sasskia; VanRullen, Rufin
2018-01-01
Oscillations are ubiquitous in the brain. Alpha oscillations in particular have been proposed to play an important role in sensory perception. Past studies have shown that the power of ongoing EEG oscillations in the alpha band is negatively correlated with visual outcome. Moreover, it also co-varies with other endogenous factors such as attention, vigilance, or alertness. In turn, these endogenous factors influence visual perception. Therefore, it remains unclear how much of the relation between alpha and perception is indirectly mediated by such endogenous factors, and how much reflects a direct causal influence of alpha rhythms on sensory neural processing. We propose to disentangle the direct from the indirect causal routes by introducing modulations of alpha power, independently of any fluctuations in endogenous factors. To this end, we use white-noise sequences to constrain the brain activity of 20 participants. The cross-correlation between the white-noise sequences and the concurrently recorded EEG reveals the impulse response function (IRF), a model of the systematic relationship between stimulation and brain response. These IRFs are then used to reconstruct rather than record the brain activity linked with new random sequences (by convolution). Interestingly, this reconstructed EEG only contains information about oscillations directly linked to the white-noise stimulation; fluctuations in attention and other endogenous factors may still modulate brain alpha rhythms during the task, but our reconstructed EEG is immune to these factors. We found that the detection of near-perceptual threshold targets embedded within these new white-noise sequences depended on the power of the ~10 Hz reconstructed EEG over parieto-occipital channels. Around the time of presentation, higher power led to poorer performance. Thus, fluctuations in alpha power, induced here by random luminance sequences, can directly influence perception: the relation between alpha power and perception is not a mere consequence of fluctuations in endogenous factors.
Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A
1997-05-01
The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.
Zaboikin, Michail; Zaboikina, Tatiana; Freter, Carl; Srinivasakumar, Narasimhachar
2017-01-01
Genome editing using transcription-activator like effector nucleases or RNA guided nucleases allows one to precisely engineer desired changes within a given target sequence. The genome editing reagents introduce double stranded breaks (DSBs) at the target site which can then undergo DNA repair by non-homologous end joining (NHEJ) or homology directed recombination (HDR) when a template DNA molecule is available. NHEJ repair results in indel mutations at the target site. As PCR amplified products from mutant target regions are likely to exhibit different melting profiles than PCR products amplified from wild type target region, we designed a high resolution melting analysis (HRMA) for rapid identification of efficient genome editing reagents. We also designed TaqMan assays using probes situated across the cut site to discriminate wild type from mutant sequences present after genome editing. The experiments revealed that the sensitivity of the assays to detect NHEJ-mediated DNA repair could be enhanced by selection of transfected cells to reduce the contribution of unmodified genomic DNA from untransfected cells to the DNA melting profile. The presence of donor template DNA lacking the target sequence at the time of genome editing further enhanced the sensitivity of the assays for detection of mutant DNA molecules by excluding the wild-type sequences modified by HDR. A second TaqMan probe that bound to an adjacent site, outside of the primary target cut site, was used to directly determine the contribution of HDR to DNA repair in the presence of the donor template sequence. The TaqMan qPCR assay, designed to measure the contribution of NHEJ and HDR in DNA repair, corroborated the results from HRMA. The data indicated that genome editing reagents can produce DSBs at high efficiency in HEK293T cells but a significant proportion of these are likely masked by reversion to wild type as a result of HDR. Supplying a donor plasmid to provide a template for HDR (that eliminates a PCR amplifiable target) revealed these cryptic DSBs and facilitated the determination of the true efficacy of genome editing reagents. The results indicated that in HEK293T cells, approximately 40% of the DSBs introduced by genome editing, were available for participation in HDR.
The microbiome of Brazilian mangrove sediments as revealed by metagenomics.
Andreote, Fernando Dini; Jiménez, Diego Javier; Chaves, Diego; Dias, Armando Cavalcante Franco; Luvizotto, Danice Mazzer; Dini-Andreote, Francisco; Fasanella, Cristiane Cipola; Lopez, Maryeimy Varon; Baena, Sandra; Taketani, Rodrigo Gouvêa; de Melo, Itamar Soares
2012-01-01
Here we embark in a deep metagenomic survey that revealed the taxonomic and potential metabolic pathways aspects of mangrove sediment microbiology. The extraction of DNA from sediment samples and the direct application of pyrosequencing resulted in approximately 215 Mb of data from four distinct mangrove areas (BrMgv01 to 04) in Brazil. The taxonomic approaches applied revealed the dominance of Deltaproteobacteria and Gammaproteobacteria in the samples. Paired statistical analysis showed higher proportions of specific taxonomic groups in each dataset. The metabolic reconstruction indicated the possible occurrence of processes modulated by the prevailing conditions found in mangrove sediments. In terms of carbon cycling, the sequences indicated the prevalence of genes involved in the metabolism of methane, formaldehyde, and carbon dioxide. With respect to the nitrogen cycle, evidence for sequences associated with dissimilatory reduction of nitrate, nitrogen immobilization, and denitrification was detected. Sequences related to the production of adenylsulfate, sulfite, and H(2)S were relevant to the sulphur cycle. These data indicate that the microbial core involved in methane, nitrogen, and sulphur metabolism consists mainly of Burkholderiaceae, Planctomycetaceae, Rhodobacteraceae, and Desulfobacteraceae. Comparison of our data to datasets from soil and sea samples resulted in the allotment of the mangrove sediments between those samples. The results of this study add valuable data about the composition of microbial communities in mangroves and also shed light on possible transformations promoted by microbial organisms in mangrove sediments.
The Microbiome of Brazilian Mangrove Sediments as Revealed by Metagenomics
Andreote, Fernando Dini; Jiménez, Diego Javier; Chaves, Diego; Dias, Armando Cavalcante Franco; Luvizotto, Danice Mazzer; Dini-Andreote, Francisco; Fasanella, Cristiane Cipola; Lopez, Maryeimy Varon; Baena, Sandra; Taketani, Rodrigo Gouvêa; de Melo, Itamar Soares
2012-01-01
Here we embark in a deep metagenomic survey that revealed the taxonomic and potential metabolic pathways aspects of mangrove sediment microbiology. The extraction of DNA from sediment samples and the direct application of pyrosequencing resulted in approximately 215 Mb of data from four distinct mangrove areas (BrMgv01 to 04) in Brazil. The taxonomic approaches applied revealed the dominance of Deltaproteobacteria and Gammaproteobacteria in the samples. Paired statistical analysis showed higher proportions of specific taxonomic groups in each dataset. The metabolic reconstruction indicated the possible occurrence of processes modulated by the prevailing conditions found in mangrove sediments. In terms of carbon cycling, the sequences indicated the prevalence of genes involved in the metabolism of methane, formaldehyde, and carbon dioxide. With respect to the nitrogen cycle, evidence for sequences associated with dissimilatory reduction of nitrate, nitrogen immobilization, and denitrification was detected. Sequences related to the production of adenylsulfate, sulfite, and H2S were relevant to the sulphur cycle. These data indicate that the microbial core involved in methane, nitrogen, and sulphur metabolism consists mainly of Burkholderiaceae, Planctomycetaceae, Rhodobacteraceae, and Desulfobacteraceae. Comparison of our data to datasets from soil and sea samples resulted in the allotment of the mangrove sediments between those samples. The results of this study add valuable data about the composition of microbial communities in mangroves and also shed light on possible transformations promoted by microbial organisms in mangrove sediments. PMID:22737213
Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing
Kwak, Hojoong; Fuda, Nicholas J.; Core, Leighton J.; Lis, John T.
2014-01-01
Transcription regulation occurs frequently through promoter-associated pausing of RNA polymerase II (Pol II). We developed a Precision nuclear Run-On and sequencing assay (PRO-seq) to map the genome-wide distribution of transcriptionally-engaged Pol II at base-pair resolution. Pol II accumulates immediately downstream of promoters, at intron-exon junctions that are efficiently used for splicing, and over 3' poly-adenylation sites. Focused analyses of promoters reveal that pausing is not fixed relative to initiation sites nor is it specified directly by the position of a particular core promoter element or the first nucleosome. Core promoter elements function beyond initiation, and when optimally positioned they act collectively to dictate the position and strength of pausing. We test this ‘Complex Interaction’ model with insertional mutagenesis of the Drosophila Hsp70 core promoter. PMID:23430654
Subburaj, Saminathan; Chung, Sung Jin; Lee, Choongil; Ryu, Seuk-Min; Kim, Duk Hyoung; Kim, Jin-Soo; Bae, Sangsu; Lee, Geung-Joo
2016-07-01
Site-directed mutagenesis of nitrate reductase genes using direct delivery of purified Cas9 protein preassembled with guide RNA produces mutations efficiently in Petunia × hybrida protoplast system. The clustered, regularly interspaced, short palindromic repeat (CRISPR)-CRISPR associated endonuclease 9 (CRISPR/Cas9) system has been recently announced as a powerful molecular breeding tool for site-directed mutagenesis in higher plants. Here, we report a site-directed mutagenesis method targeting Petunia nitrate reductase (NR) gene locus. This method could create mutations efficiently using direct delivery of purified Cas9 protein and single guide RNA (sgRNA) into protoplast cells. After transient introduction of RNA-guided endonuclease (RGEN) ribonucleoproteins (RNPs) with different sgRNAs targeting NR genes, mutagenesis at the targeted loci was detected by T7E1 assay and confirmed by targeted deep sequencing. T7E1 assay showed that RGEN RNPs induced site-specific mutations at frequencies ranging from 2.4 to 21 % at four different sites (NR1, 2, 4 and 6) in the PhNR gene locus with average mutation efficiency of 14.9 ± 2.2 %. Targeted deep DNA sequencing revealed mutation rates of 5.3-17.8 % with average mutation rate of 11.5 ± 2 % at the same NR gene target sites in DNA fragments of analyzed protoplast transfectants. Further analysis from targeted deep sequencing showed that the average ratio of deletion to insertion produced collectively by the four NR-RGEN target sites (NR1, 2, 4, and 6) was about 63:37. Our results demonstrated that direct delivery of RGEN RNPs into protoplast cells of Petunia can be exploited as an efficient tool for site-directed mutagenesis of genes or genome editing in plant systems.
Genomic Investigation of a Legionellosis Outbreak in a Persistently Colonized Hotel.
Sánchez-Busó, Leonor; Guiral, Silvia; Crespi, Sebastián; Moya, Víctor; Camaró, María L; Olmos, María P; Adrián, Francisco; Morera, Vicente; González-Morán, Francisco; Vanaclocha, Hermelinda; González-Candelas, Fernando
2015-01-01
A long-lasting legionellosis outbreak was reported between November 2011 and July 2012 in a hotel in Calpe (Spain) affecting 44 patients including six deaths. Intensive epidemiological and microbiological investigations were performed in order to detect the reservoirs. Clinical and environmental samples were tested for the presence and genetic characterization of Legionella pneumophila. Six of the isolates were subjected to whole-genome sequencing. Sequencing of 14 clinical and 260 environmental samples revealed sequence type (ST) 23 as the main responsible strain for the infections. This ST was found in the spa pool, from where it spread to other hotel public spaces, explaining the ST23 clinical cases, including guests who had not visited the spa. Uncultured clinical specimens showed profiles compatible with ST23, ST578, and mixed patterns. Profiles compatible with ST578 were obtained by direct sequencing from biofilm samples collected from the domestic water system, which provided evidence for the source of infection for non ST23 patients. Whole genome data from five ST23 strains and the identification of different STs and Legionella species showed that different hotel premises were likely colonized since the hotel opening thus explaining how different patients had been infected by distinct STs. Both epidemiological and molecular data are essential in the investigation of legionellosis outbreaks. Whole-genome sequencing data revealed significant intra-ST variability and allowed to make further inference on the short-term evolution of a local colonization of L. pneumophila.
Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, W.M.; Sylvester, J.E.
1994-09-01
In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less
Polkinghorne, A.; Miller, T. L.; Groff, J. M.; LaPatra, S. E.; Nowak, B. F.
2013-01-01
Three cohorts of farmed yellowtail kingfish (Seriola lalandi) from South Australia were examined for Chlamydia-like organisms associated with epitheliocystis. To characterize the bacteria, 38 gill samples were processed for histopathology, electron microscopy, and 16S rRNA amplification, sequencing, and phylogenetic analysis. Microscopically, the presence of membrane-enclosed cysts was observed within the gill lamellae. Also observed was hyperplasia of the epithelial cells with cytoplasmic vacuolization and fusion of the gill lamellae. Transmission electron microscopy revealed morphological features of the reticulate and intermediate bodies typical of members of the order Chlamydiales. A novel 1,393-bp 16S chlamydial rRNA sequence was amplified from gill DNA extracted from fish in all cohorts over a 3-year period that corresponded to the 16S rRNA sequence amplified directly from laser-dissected cysts. This sequence was only 87% similar to the reported “Candidatus Piscichlamydia salmonis” (AY462244) from Atlantic salmon and Arctic charr. Phylogenetic analysis of this sequence against 35 Chlamydia and Chlamydia-like bacteria revealed that this novel bacterium belongs to an undescribed family lineage in the order Chlamydiales. Based on these observations, we propose this bacterium of yellowtail kingfish be known as “Candidatus Parilichlamydia carangidicola” and that the new family be known as “Candidatus Parilichlamydiaceae.” PMID:23275507
Genomic Investigation of a Legionellosis Outbreak in a Persistently Colonized Hotel
Sánchez-Busó, Leonor; Guiral, Silvia; Crespi, Sebastián; Moya, Víctor; Camaró, María L.; Olmos, María P.; Adrián, Francisco; Morera, Vicente; González-Morán, Francisco; Vanaclocha, Hermelinda; González-Candelas, Fernando
2016-01-01
Objectives: A long-lasting legionellosis outbreak was reported between November 2011 and July 2012 in a hotel in Calpe (Spain) affecting 44 patients including six deaths. Intensive epidemiological and microbiological investigations were performed in order to detect the reservoirs. Methods: Clinical and environmental samples were tested for the presence and genetic characterization of Legionella pneumophila. Six of the isolates were subjected to whole-genome sequencing. Results: Sequencing of 14 clinical and 260 environmental samples revealed sequence type (ST) 23 as the main responsible strain for the infections. This ST was found in the spa pool, from where it spread to other hotel public spaces, explaining the ST23 clinical cases, including guests who had not visited the spa. Uncultured clinical specimens showed profiles compatible with ST23, ST578, and mixed patterns. Profiles compatible with ST578 were obtained by direct sequencing from biofilm samples collected from the domestic water system, which provided evidence for the source of infection for non ST23 patients. Whole genome data from five ST23 strains and the identification of different STs and Legionella species showed that different hotel premises were likely colonized since the hotel opening thus explaining how different patients had been infected by distinct STs. Conclusions: Both epidemiological and molecular data are essential in the investigation of legionellosis outbreaks. Whole-genome sequencing data revealed significant intra-ST variability and allowed to make further inference on the short-term evolution of a local colonization of L. pneumophila. PMID:26834713
NASA Astrophysics Data System (ADS)
Soszynski, I.; Udalski, A.; Kubiak, M.; Szymanski, M. K.; Pietrzynski, G.; Zebrun, K.; Szewczyk, O.; Wyrzykowski, L.; Dziembowski, W. A.
2004-12-01
We used the OGLE-II and OGLE-III photometry of red giants in the Large Magellanic Cloud to select and study objects revealing ellipsoidal variability. We detected 1546 candidates for long period ellipsoidal variables and 121 eclipsing binary systems with clear ellipsoidal modulation. The ellipsoidal red giants follow a period--luminosity (PL) relationship (sequence E), and the scatter of the relation is correlated with the amplitude of variability: the larger the amplitude, the smaller the scatter. We note that some of the ellipsoidal candidates exhibit simultaneously OGLE Small Amplitude Red Giants pulsations. Thus, in some cases the Long Secondary Period (LSP) phenomenon can be explained by the ellipsoidal modulation. We also select about 1600 red giants with distinct LSP, which are not ellipsoidal variables. We discover that besides the sequence D in the PL diagram known before, the LSP giants form additional less numerous sequence for longer periods. We notice that the PL sequence of the ellipsoidal candidates is a direct continuation of the LSP sequence toward fainter stars, what might suggest that the LSP phenomenon is related to binarity but there are strong arguments against such a possibility. About 10% of the presented light curves reveal clear deformation by the eccentricity of the system orbits. The largest estimated eccentricity in our sample is about 0.4. All presented data, including individual BVI observations and finding charts are available from the OGLE Internet archive.
Feng, Fan; Qi, Weiwei; Lv, Yuanda; Yan, Shumei; Xu, Liming; Yang, Wenyao; Yuan, Yue; Chen, Yihan
2018-01-01
Maize (Zea mays) endosperm is a primary tissue for nutrient storage and is highly differentiated during development. However, the regulatory networks of endosperm development and nutrient metabolism remain largely unknown. Maize opaque11 (o11) is a classic seed mutant with a small and opaque endosperm showing decreased starch and protein accumulation. We cloned O11 and found that it encodes an endosperm-specific bHLH transcription factor (TF). Loss of function of O11 significantly affected transcription of carbohydrate/amino acid metabolism and stress response genes. Genome-wide binding site analysis revealed 9885 O11 binding sites distributed over 6033 genes. Using chromatin immunoprecipitation sequencing (ChIP-seq) coupled with RNA sequencing (RNA-seq) assays, we identified 259 O11-modulated target genes. O11 was found to directly regulate key TFs in endosperm development (NKD2 and ZmDOF3) and nutrient metabolism (O2 and PBF). Moreover, O11 directly regulates cyPPDKs and multiple carbohydrate metabolic enzymes. O11 is an activator of ZmYoda, suggesting its regulatory function through the MAPK pathway in endosperm development. Many stress-response genes are also direct targets of O11. In addition, 11 O11-interacting proteins were identified, including ZmIce1, which coregulates stress response targets and ZmYoda with O11. Therefore, this study reveals an endosperm regulatory network centered around O11, which coordinates endosperm development, metabolism and stress responses. PMID:29436476
Idiopathic slow transit constipation and megacolon are not associated with neurturin mutations.
Chen, B; Knowles, C H; Scott, M; Anand, P; Williams, N S; Milbrandt, J; Tam, P K H
2002-10-01
Chronic idiopathic slow-transit constipation (ISTC) and idiopathic megacolon (IMC) are early-onset gastrointestinal motility disorders of unknown aetiology. The gene encoding the neurotrophic factor neurturin may be a candidate for these disorders, as neurturin-deficient mice have a similar enteric phenotype. In the present study, we tested this hypothesis. Genomic DNA from 26 cases of chronic idiopathic STC [with a family history of constipation in 15 (58%) and Hirschsprung's disease in two (8%)], and five cases of IMC [two familial (40%)] was screened by direct DNA sequencing using the fluorescent dideoxy terminator method. Results were compared with published sequence data and 24 control DNAs. Our results revealed several previously unreported common sequence polymorphisms, but overall frequencies were comparable between patients and controls. We conclude that mutation of neurturin is not a frequent cause of ISTC or IMC.
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.
Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G
2010-06-01
The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.
Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin
2014-02-25
Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.
Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki
2014-01-01
Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Structural Heterogeneity of Doubly-Charged Peptide b-Ions
NASA Astrophysics Data System (ADS)
Li, Xiaojuan; Huang, Yiqun; O'Connor, Peter B.; Lin, Cheng
2011-02-01
Performing collisionally activated dissociation (CAD) and electron capture dissociation (ECD) in tandem has shown great promise in providing comprehensive sequence information that was otherwise unobtainable by using either fragmentation method alone or in duet. However, the general applicability of this MS3 approach in peptide sequencing may be undermined by the formation of non-direct sequence ions, as sometimes observed under CAD, particularly when multiple stages of CAD are involved. In this study, varied-sized doubly-charged b-ions from three tachykinin peptides were investigated by ECD. Sequence scrambling was observed in ECD of all b-ions from neurokinin A (HKTDSFVGLM-NH2), suggesting the presence of N- and C-termini linked macro-cyclic conformers. On the contrary, none of the b-ions from eledoisin (pEPSKDAFIGLM-NH2) produced non-direct sequence ions under ECD, as it does not contain a free N-terminal amino group. ECD of several b-ions from Substance P (RPKPQQFFGLM-NH2) showed series of cm-Lys fragment ions which suggested that the macro-cyclic structure may also be formed by connecting the C-terminal carbonyl group and the ɛ-amino group of the lysine side chain. Theoretical investigation of selected Substance P b-ions revealed several low energy conformers, including both linear oxazolones and macro-ring structures, in corroboration with the experimental observation. This study showed that a b-ion may exist as a mixture of several forms, with their propensities influenced by its N-terminus, length, and certain side-chain groups. Further, the presence of several macro-cyclic structures may result in erroneous sequence assignment when the combined CAD and ECD methods are used in peptide sequencing.
Structural Heterogeneity of Doubly-Charged Peptide b-Ions
Li, Xiaojuan; Huang, Yiqun; O’Connor, Peter B.; Lin, Cheng
2011-01-01
Performing collisionally activated dissociation (CAD) and electron capture dissociation (ECD) in tandem has shown great promise in providing comprehensive sequence information that was otherwise unobtainable by using either fragmentation method alone or in duet. However, the general applicability of this MS3 approach in peptide sequencing may be undermined by the formation of non-direct sequence ions, as sometimes observed under CAD, particularly when multiple stages of CAD are involved. In this study, varied-sized doubly-charged b-ions from three tachykinin peptides were investigated by ECD. Sequence scrambling was observed in ECD of all b-ions from neurokinin A (HKTDSFVGLM-NH2), suggesting the presence of N- and C-termini linked macro-cyclic conformers. On the contrary, none of the b-ions from eledoisin (pEPSKDAFIGLM-NH2) produced non-direct sequence ions under ECD, as it does not contain a free N-terminal amino group. ECD of several b-ions from Substance P (RPKPQQFFGLM-NH2) showed series of cm-Lys fragment ions which suggested that the macro-cyclic structure may also be formed by connecting the C-terminal carbonyl group and the ε-amino group of the lysine side chain. Theoretical investigation of selected Substance P b-ions revealed several low energy conformers, including both linear oxazolones and macro-ring structures, in corroboration with the experimental observation. This study showed that a b-ion may exist as a mixture of several forms, with their propensities influenced by its N-terminus, length, and certain side-chain groups. Further, the presence of several macro-cyclic structures may result in erroneous sequence assignment when the combined CAD and ECD methods are used in peptide sequencing. PMID:21472584
Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge
2018-03-09
We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.
NASA Astrophysics Data System (ADS)
Takeda, Haruhiko; Ueda, Yoshihide; Inuzuka, Tadashi; Yamashita, Yukitaka; Osaki, Yukio; Nasu, Akihiro; Umeda, Makoto; Takemura, Ryo; Seno, Hiroshi; Sekine, Akihiro; Marusawa, Hiroyuki
2017-03-01
Resistance-associated variant (RAV) is one of the most significant clinical challenges in treating HCV-infected patients with direct-acting antivirals (DAAs). We investigated the viral dynamics in patients receiving DAAs using third-generation sequencing technology. Among 283 patients with genotype-1b HCV receiving daclatasvir + asunaprevir (DCV/ASV), 32 (11.3%) failed to achieve sustained virological response (SVR). Conventional ultra-deep sequencing of HCV genome was performed in 104 patients (32 non-SVR, 72 SVR), and detected representative RAVs in all non-SVR patients at baseline, including Y93H in 28 (87.5%). Long contiguous sequences spanning NS3 to NS5A regions of each viral clone in 12 sera from 6 representative non-SVR patients were determined by third-generation sequencing, and showed the concurrent presence of several synonymous mutations linked to resistance-associated substitutions in a subpopulation of pre-existing RAVs and dominant isolates at treatment failure. Phylogenetic analyses revealed close genetic distances between pre-existing RAVs and dominant RAVs at treatment failure. In addition, multiple drug-resistant mutations developed on pre-existing RAVs after DCV/ASV in all non-SVR cases. In conclusion, multi-drug resistant viral clones at treatment failure certainly originated from a subpopulation of pre-existing RAVs in HCV-infected patients. Those RAVs were selected for and became dominant with the acquisition of multiple resistance-associated substitutions under DAA treatment pressure.
Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors
NASA Astrophysics Data System (ADS)
Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.
2011-09-01
DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; McLoughlin, Kevin; Be, Nicholas A.
Venezuelan equine encephalitis virus (VEEV) is a mosquito-borne alphavirus that has caused large outbreaks of severe illness in both horses and humans. New approaches are needed to rapidly infer the origin of a newly discovered VEEV strain, estimate its equine amplification and resultant epidemic potential, and predict human virulence phenotype. We performed whole genome single nucleotide polymorphism (SNP) analysis of all available VEE antigenic complex genomes, verified that a SNP-based phylogeny accurately captured the features of a phylogenetic tree based on multiple sequence alignment, and developed a high resolution genome-wide SNP microarray. We used the microarray to analyze a broadmore » panel of VEEV isolates, found excellent concordance between array- and sequence-based SNP calls, genotyped unsequenced isolates, and placed them on a phylogeny with sequenced genomes. The microarray successfully genotyped VEEV directly from tissue samples of an infected mouse, bypassing the need for viral isolation, culture and genomic sequencing. Lastly, we identified genomic variants associated with serotypes and host species, revealing a complex relationship between genotype and phenotype.« less
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio
2009-08-01
Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.
Camunas-Soler, Joan; Kertesz, Michael; De Vlaminck, Iwijn; Koh, Winston; Pan, Wenying; Martin, Lance; Neff, Norma F.; Okamoto, Jennifer; Wong, Ronald J.; Kharbanda, Sandhya; El-Sayed, Yasser; Blumenfeld, Yair; Stevenson, David K.; Shaw, Gary M.; Wolfe, Nathan D.; Quake, Stephen R.
2017-01-01
Blood circulates throughout the human body and contains molecules drawn from virtually every tissue, including the microbes and viruses which colonize the body. Through massive shotgun sequencing of circulating cell-free DNA from the blood, we identified hundreds of new bacteria and viruses which represent previously unidentified members of the human microbiome. Analyzing cumulative sequence data from 1,351 blood samples collected from 188 patients enabled us to assemble 7,190 contiguous regions (contigs) larger than 1 kbp, of which 3,761 are novel with little or no sequence homology in any existing databases. The vast majority of these novel contigs possess coding sequences, and we have validated their existence both by finding their presence in independent experiments and by performing direct PCR amplification. When their nearest neighbors are located in the tree of life, many of the organisms represent entirely novel taxa, showing that microbial diversity within the human body is substantially broader than previously appreciated. PMID:28830999
The rRNA evolution and procaryotic phylogeny
NASA Technical Reports Server (NTRS)
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
Continuities in stone flaking technology at Liang Bua, Flores, Indonesia.
Moore, M W; Sutikna, T; Jatmiko; Morwood, M J; Brumm, A
2009-11-01
This study examines trends in stone tool reduction technology at Liang Bua, Flores, Indonesia, where excavations have revealed a stratified artifact sequence spanning 95k.yr. The reduction sequence practiced throughout the Pleistocene was straightforward and unchanging. Large flakes were produced off-site and carried into the cave where they were reduced centripetally and bifacially by four techniques: freehand, burination, truncation, and bipolar. The locus of technological complexity at Liang Bua was not in knapping products, but in the way techniques were integrated. This reduction sequence persisted across the Pleistocene/Holocene boundary with a minor shift favoring unifacial flaking after 11ka. Other stone-related changes occurred at the same time, including the first appearance of edge-glossed flakes, a change in raw material selection, and more frequent fire-induced damage to stone artifacts. Later in the Holocene, technological complexity was generated by "adding-on" rectangular-sectioned stone adzes to the reduction sequence. The Pleistocene pattern is directly associated with Homo floresiensis skeletal remains and the Holocene changes correlate with the appearance of Homo sapiens. The one reduction sequence continues across this hominin replacement.
Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B
1989-01-01
The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501
Precision of working memory for visual motion sequences and transparent motion surfaces
Zokaei, Nahid; Gorgoraptis, Nikos; Bahrami, Bahador; Bays, Paul M; Husain, Masud
2012-01-01
Recent studies investigating working memory for location, colour and orientation support a dynamic resource model. We examined whether this might also apply to motion, using random dot kinematograms (RDKs) presented sequentially or simultaneously. Mean precision for motion direction declined as sequence length increased, with precision being lower for earlier RDKs. Two alternative models of working memory were compared specifically to distinguish between the contributions of different sources of error that corrupt memory (Zhang & Luck (2008) vs. Bays et al (2009)). The latter provided a significantly better fit for the data, revealing that decrease in memory precision for earlier items is explained by an increase in interference from other items in a sequence, rather than random guessing or a temporal decay of information. Misbinding feature attributes is an important source of error in working memory. Precision of memory for motion direction decreased when two RDKs were presented simultaneously as transparent surfaces, compared to sequential RDKs. However, precision was enhanced when one motion surface was prioritized, demonstrating that selective attention can improve recall precision. These results are consistent with a resource model that can be used as a general conceptual framework for understanding working memory across a range of visual features. PMID:22135378
Fisher, R P; Topper, J N; Clayton, D A
1987-07-17
Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.
2009-01-01
Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416
Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg
2009-08-06
Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.
Classification of Plant Associated Bacteria Using RIF, a Computationally Derived DNA Marker
Schneider, Kevin L.; Marrero, Glorimar; Alvarez, Anne M.; Presting, Gernot G.
2011-01-01
A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF). Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS). Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF sequences obtained from unknown strains in both chromatogram and FASTA format. PMID:21533033
Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.
Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello
2016-04-01
Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.
A long natural-antisense RNA is accumulated in the conidia of Aspergillus oryzae.
Tsujii, Masaru; Okuda, Satoshi; Ishi, Kazutomo; Madokoro, Kana; Takeuchi, Michio; Yamagata, Youhei
2016-01-01
Analysis of expressed sequence tag libraries from various culture conditions revealed the existence of conidia-specific transcripts assembled to putative conidiation-specific reductase gene (csrA) in Aspergillus oryzae. However, the all transcripts were transcribed with opposite direction to the gene csrA. The sequence analysis of the transcript revealed that the RNA overlapped mRNA of csrA with 3'-end, and did not code protein longer than 60 amino acid residues. We designated the transcript Conidia Specific Long Natural-antisense RNA (CSLNR). The real-time PCR analysis demonstrated that the CSLNR is conidia-specific transcript, which cannot be transcribed in the absence of brlA, and the amount of CSLNR was much more than that of the transcript from csrA in conidia. Furthermore, the csrA deletion, also lacking coding region of CSLNR in A. oryzae reduced the number of conidia. Overexpression of CsrA demonstrated the inhibition of growth and conidiation, while CSLNR did not affect conidiation.
NASA Astrophysics Data System (ADS)
Mereuta, Loredana; Roy, Mahua; Asandei, Alina; Lee, Jong Kook; Park, Yoonkyung; Andricioaei, Ioan; Luchian, Tudor
2014-01-01
The microscopic details of how peptides translocate one at a time through nanopores are crucial determinants for transport through membrane pores and important in developing nano-technologies. To date, the translocation process has been too fast relative to the resolution of the single molecule techniques that sought to detect its milestones. Using pH-tuned single-molecule electrophysiology and molecular dynamics simulations, we demonstrate how peptide passage through the α-hemolysin protein can be sufficiently slowed down to observe intermediate single-peptide sub-states associated to distinct structural milestones along the pore, and how to control residence time, direction and the sequence of spatio-temporal state-to-state dynamics of a single peptide. Molecular dynamics simulations of peptide translocation reveal the time- dependent ordering of intermediate structures of the translocating peptide inside the pore at atomic resolution. Calculations of the expected current ratios of the different pore-blocking microstates and their time sequencing are in accord with the recorded current traces.
Jiang, Lulu; Hindmarch, Charles C. T.; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W.; Welsh, Gavin I.
2016-01-01
Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or ‘podocytes’, the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes. PMID:27774996
Blankenstein, O; Mühlenberg, R; Kim, C; Wüller, S; Pfäffle, R; Heimann, G
2001-01-01
We describe a newborn with clinical signs of severe hypothyroidism and combined pituitary hormone deficiency due to a new mutation in the PIT-1 gene. Endocrine stimulation test revealed a deficiency for PRL, TSH and GH, suggesting a defect in the pituitary transcription factor PIT-1. Genetic analysis of the PIT-1 gene was performed by exon-specific PCR, followed by SSCP mutation screening and DNA sequencing of the abnormal migrating fragments. DNA sequencing revealed a new mutation (V272ter) in direct neighborhood to a known mutational hot spot (R271W) in the C-terminal part of the PIT-1 molecule. Whereas the R271W mutation has a dominant negative effect on the mutant protein, the newly described mutation is inherited in an autosomal-recessive way. The biological consequences of these two different mutations are discussed. Copyright 2002 S. Karger AG, Basel
Intrinsic transcriptional heterogeneity in B cells controls early class switching to IgE
Wu, Yee Ling; Teichmann, Sarah A.
2017-01-01
Noncoding transcripts originating upstream of the immunoglobulin constant region (I transcripts) are required to direct activation-induced deaminase to initiate class switching in B cells. Differential regulation of Iε and Iγ1 transcription in response to interleukin 4 (IL-4), hence class switching to IgE and IgG1, is not fully understood. In this study, we combine novel mouse reporters and single-cell RNA sequencing to reveal the heterogeneity in IL-4–induced I transcription. We identify an early population of cells expressing Iε but not Iγ1 and demonstrate that early Iε transcription leads to switching to IgE and occurs at lower activation levels than Iγ1. Our results reveal how probabilistic transcription with a lower activation threshold for Iε directs the early choice of IgE versus IgG1, a key physiological response against parasitic infestations and a mediator of allergy and asthma. PMID:27994069
Lake Vostok: An earthly analogue for the geomicrobiology on Europa
NASA Astrophysics Data System (ADS)
Priscu, J. C.; Christner, B. C.
2007-12-01
The recent discovery of more than 150 subglacial lakes beneath the Antarctic ice sheet has important implications in our search for liquid water and associated life on other icy worlds. The largest of these lakes is Lake Vostok, which has a surface area of 14000 square km and a depth of 1000 m, making it one of the largest lakes on Earth. Although we have yet to sample directly the liquid water from any of the Antarctic subglacial lakes, refrozen lakewater (accretion ice) has been sampled just above the surface of Lake Vostok. Genomic and geochemical analysis of this ice reveals that the surface lake water supports a microbial assemblage with a density approaching 1000 cells per milliliter. Sequencing and phylogenetic analysis of the 900 to 1000 base pair small subunit rRNA gene sequences obtained revealed a low diversity of clones that classify within the beta, gamma and delta subdivisions of the phylum Proteobacteria. Nearest phylogenetic neighbor analysis of these gene sequences imply that the lake contains an aerobic and anaerobic consortium of bacteria with metabolisms dedicated to iron and sulfur respiration or oxidation indicating that these metals play a role in the bioenergetics of microorganisms that occur in Lake Vostok. Sequence analysis further revealed that heterotrophic life in the lake can be sustained by chemolithotrophic production of new carbon supplemented by dissolved organic carbon released from the overlying ice sheet. Data obtained from orbiters have revealed that a deep ocean of liquid water lies under a thick chaotic ice cover on Europa where organic matter derived from comets and oxidants provided by radiation from Jupiter's magnetosphere may provide a habitat for life and a reservoir of endogenous and exogenous substances much like we observe in Lake Vostok. Future studies of Antarctic subglacial lake environments will play a crucial role in our understanding of life on Europa and other frozen worlds.
Skopelitou, Katholiki; Muleta, Abdi W; Pavli, Ourania; Skaracis, Georgios N; Flemetakis, Emmanouil; Papageorgiou, Anastassios C; Labrou, Nikolaos E
2012-03-01
In the present work, we describe the characterisation of the glutathione transferase (GST) gene family from Agrobacterium tumefaciens C58. A genome survey revealed the presence of eight GST-like proteins in A. tumefaciens (AtuGSTs). Comparison by multiple sequence alignment generated a dendrogram revealing the phylogenetic relationships of AtuGSTs-like proteins. The beta and theta classes identified in other bacterial species are represented by five members in A. tumefaciens C58. In addition, there are three "orphan" sequences that do not fit into any previously recognised GST classes. The eight GST-like genes were cloned, expressed in Escherichia coli and their substrate specificity was determined towards 17 different substrates. The results showed that AtuGSTs catalyse a broad range of reactions, with different members of the family exhibiting quite varied substrate specificity. The 3D structures of AtuGSTs were predicted using molecular modelling. The use of comparative sequence and structural analysis of the AtuGST isoenzymes allowed us to identify local sequence and structural characteristics between different GST isoenzymes and classes. Gene expression profiling was conducted under normal culture conditions as well as under abiotic stress conditions (addition of xenobiotics, osmotic stress and cold and heat shock) to induce and monitor early stress-response mechanisms. The results reveal the constitutive expression of GSTs in A. tumefaciens and a modulation of GST activity after treatments, indicating that AtuGSTs presumably participate in a wide range of functions, many of which are important in counteracting stress conditions. These functions may be relevant to maintaining cellular homeostasis as well as in the direct detoxification of toxic compounds.
Kammermeier, Jochen; Drury, Suzanne; James, Chela T; Dziubak, Robert; Ocaka, Louise; Elawad, Mamoun; Beales, Philip; Lench, Nicholas; Uhlig, Holm H; Bacchelli, Chiara; Shah, Neil
2014-11-01
Multiple monogenetic conditions with partially overlapping phenotypes can present with inflammatory bowel disease (IBD)-like intestinal inflammation. With novel genotype-specific therapies emerging, establishing a molecular diagnosis is becoming increasingly important. We have introduced targeted next-generation sequencing (NGS) technology as a prospective screening tool in children with very early onset IBD (VEOIBD). We evaluated the coverage of 40 VEOIBD genes in two separate cohorts undergoing targeted gene panel sequencing (TGPS) (n=25) and whole exome sequencing (WES) (n=20). TGPS revealed causative mutations in four genes (IL10RA, EPCAM, TTC37 and SKIV2L) discovered unexpected phenotypes and directly influenced clinical decision making by supporting as well as avoiding haematopoietic stem cell transplantation. TGPS resulted in significantly higher median coverage when compared with WES, fewer coverage deficiencies and improved variant detection across established VEOIBD genes. Excluding or confirming known VEOIBD genotypes should be considered early in the disease course in all cases of therapy-refractory VEOIBD, as it can have a direct impact on patient management. To combine both described NGS technologies would compensate for the limitations of WES for disease-specific application while offering the opportunity for novel gene discovery in the research setting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi
2016-05-24
Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.
EuroPineDB: a high-coverage web database for maritime pine transcriptome
2011-01-01
Background Pinus pinaster is an economically and ecologically important species that is becoming a woody gymnosperm model. Its enormous genome size makes whole-genome sequencing approaches are hard to apply. Therefore, the expressed portion of the genome has to be characterised and the results and annotations have to be stored in dedicated databases. Description EuroPineDB is the largest sequence collection available for a single pine species, Pinus pinaster (maritime pine), since it comprises 951 641 raw sequence reads obtained from non-normalised cDNA libraries and high-throughput sequencing from adult (xylem, phloem, roots, stem, needles, cones, strobili) and embryonic (germinated embryos, buds, callus) maritime pine tissues. Using open-source tools, sequences were optimally pre-processed, assembled, and extensively annotated (GO, EC and KEGG terms, descriptions, SNPs, SSRs, ORFs and InterPro codes). As a result, a 10.5× P. pinaster genome was covered and assembled in 55 322 UniGenes. A total of 32 919 (59.5%) of P. pinaster UniGenes were annotated with at least one description, revealing at least 18 466 different genes. The complete database, which is designed to be scalable, maintainable, and expandable, is freely available at: http://www.scbi.uma.es/pindb/. It can be retrieved by gene libraries, pine species, annotations, UniGenes and microarrays (i.e., the sequences are distributed in two-colour microarrays; this is the only conifer database that provides this information) and will be periodically updated. Small assemblies can be viewed using a dedicated visualisation tool that connects them with SNPs. Any sequence or annotation set shown on-screen can be downloaded. Retrieval mechanisms for sequences and gene annotations are provided. Conclusions The EuroPineDB with its integrated information can be used to reveal new knowledge, offers an easy-to-use collection of information to directly support experimental work (including microarray hybridisation), and provides deeper knowledge on the maritime pine transcriptome. PMID:21762488
Sequence selection by dynamical symmetry breaking in an autocatalytic binary polymer model
NASA Astrophysics Data System (ADS)
Fellermann, Harold; Tanaka, Shinpei; Rasmussen, Steen
2017-12-01
Template-directed replication of nucleic acids is at the essence of all living beings and a major milestone for any origin of life scenario. We present an idealized model of prebiotic sequence replication, where binary polymers act as templates for their autocatalytic replication, thereby serving as each others reactants and products in an intertwined molecular ecology. Our model demonstrates how autocatalysis alters the qualitative and quantitative system dynamics in counterintuitive ways. Most notably, numerical simulations reveal a very strong intrinsic selection mechanism that favors the appearance of a few population structures with highly ordered and repetitive sequence patterns when starting from a pool of monomers. We demonstrate both analytically and through simulation how this "selection of the dullest" is caused by continued symmetry breaking through random fluctuations in the transient dynamics that are amplified by autocatalysis and eventually propagate to the population level. The impact of these observations on related prebiotic mathematical models is discussed.
Genome Sequencing and Analysis of the Tasmanian Devil and Its Transmissible Cancer
Murchison, Elizabeth P.; Schulz-Trieglaff, Ole B.; Ning, Zemin; Alexandrov, Ludmil B.; Bauer, Markus J.; Fu, Beiyuan; Hims, Matthew; Ding, Zhihao; Ivakhno, Sergii; Stewart, Caitlin; Ng, Bee Ling; Wong, Wendy; Aken, Bronwen; White, Simon; Alsop, Amber; Becq, Jennifer; Bignell, Graham R.; Cheetham, R. Keira; Cheng, William; Connor, Thomas R.; Cox, Anthony J.; Feng, Zhi-Ping; Gu, Yong; Grocock, Russell J.; Harris, Simon R.; Khrebtukova, Irina; Kingsbury, Zoya; Kowarsky, Mark; Kreiss, Alexandre; Luo, Shujun; Marshall, John; McBride, David J.; Murray, Lisa; Pearse, Anne-Maree; Raine, Keiran; Rasolonjatovo, Isabelle; Shaw, Richard; Tedder, Philip; Tregidgo, Carolyn; Vilella, Albert J.; Wedge, David C.; Woods, Gregory M.; Gormley, Niall; Humphray, Sean; Schroth, Gary; Smith, Geoffrey; Hall, Kevin; Searle, Stephen M.J.; Carter, Nigel P.; Papenfuss, Anthony T.; Futreal, P. Andrew; Campbell, Peter J.; Yang, Fengtang; Bentley, David R.; Evers, Dirk J.; Stratton, Michael R.
2012-01-01
Summary The Tasmanian devil (Sarcophilus harrisii), the largest marsupial carnivore, is endangered due to a transmissible facial cancer spread by direct transfer of living cancer cells through biting. Here we describe the sequencing, assembly, and annotation of the Tasmanian devil genome and whole-genome sequences for two geographically distant subclones of the cancer. Genomic analysis suggests that the cancer first arose from a female Tasmanian devil and that the clone has subsequently genetically diverged during its spread across Tasmania. The devil cancer genome contains more than 17,000 somatic base substitution mutations and bears the imprint of a distinct mutational process. Genotyping of somatic mutations in 104 geographically and temporally distributed Tasmanian devil tumors reveals the pattern of evolution and spread of this parasitic clonal lineage, with evidence of a selective sweep in one geographical area and persistence of parallel lineages in other populations. PaperClip PMID:22341448
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
Watching diagnoses develop: Eye movements reveal symptom processing during diagnostic reasoning.
Scholz, Agnes; Krems, Josef F; Jahn, Georg
2017-10-01
Finding a probable explanation for observed symptoms is a highly complex task that draws on information retrieval from memory. Recent research suggests that observed symptoms are interpreted in a way that maximizes coherence for a single likely explanation. This becomes particularly clear if symptom sequences support more than one explanation. However, there are no existing process data available that allow coherence maximization to be traced in ambiguous diagnostic situations, where critical information has to be retrieved from memory. In this experiment, we applied memory indexing, an eye-tracking method that affords rich time-course information concerning memory-based cognitive processing during higher order thinking, to reveal symptom processing and the preferred interpretation of symptom sequences. Participants first learned information about causes and symptoms presented in spatial frames. Gaze allocation to emptied spatial frames during symptom processing and during the diagnostic response reflected the subjective status of hypotheses held in memory and the preferred interpretation of ambiguous symptoms. Memory indexing traced how the diagnostic decision developed and revealed instances of hypothesis change and biases in symptom processing. Memory indexing thus provided direct online evidence for coherence maximization in processing ambiguous information.
Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T
1998-12-08
A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.
The innate capacity of proteins to protect against reactive radical species.
Hamdy, Omar M; Alizadeh, Arman; Julian, Ryan R
2015-08-07
Maintaining redox homeostasis, or the balance of oxidant and antioxidant forces, is essential for proper cellular functioning in biology. Although the antioxidant nature of many small molecules such as vitamin c and glutathione have been thoroughly investigated, contributions to redox homeostasis from larger biomolecules have received less attention. Evidence has shown that some proteins are antioxidant (in a non-catalytic sense), but large scale examination of this property for a diverse set of proteins has proven difficult. Herein, radical-directed dissociation mass spectrometry (RDD-MS) is used to examine the antioxidant capacity of a series of proteins with diverse biological roles, persistence intervals, and localizations. Digestion of these proteins reveals that all contain antioxidant peptide regions. Examination of the amino acid content of the antioxidant peptides does not reveal significant differences relative to normal peptides, suggesting that sequence may be more important than residue content. Sequence homology analysis across organisms reveals that antioxidant regions are frequently conserved, although many of these regions are also known to have other functions which may have influenced evolutionary pressure. Regardless of the origin, it is clear that many proteins may play secondary roles as sacrificial antioxidants within the cellular milieu.
Marschner, Linda; Pannasch, Sebastian; Schulz, Johannes; Graupner, Sven-Thomas
2015-08-01
In social communication, the gaze direction of other persons provides important information to perceive and interpret their emotional response. Previous research investigated the influence of gaze by manipulating mutual eye contact. Therefore, gaze and body direction have been changed as a whole, resulting in only congruent gaze and body directions (averted or directed) of another person. Here, we aimed to disentangle these effects by using short animated sequences of virtual agents posing with either direct or averted body or gaze. Attention allocation by means of eye movements, facial muscle response, and emotional experience to agents of different gender and facial expressions were investigated. Eye movement data revealed longer fixation durations, i.e., a stronger allocation of attention, when gaze and body direction were not congruent with each other or when both were directed towards the observer. This suggests that direct interaction as well as incongruous signals increase the demands of attentional resources in the observer. For the facial muscle response, only the reaction of muscle zygomaticus major revealed an effect of body direction, expressed by stronger activity in response to happy expressions for direct compared to averted gaze when the virtual character's body was directed towards the observer. Finally, body direction also influenced the emotional experience ratings towards happy expressions. While earlier findings suggested that mutual eye contact is the main source for increased emotional responding and attentional allocation, the present results indicate that direction of the virtual agent's body and head also plays a minor but significant role. Copyright © 2015 Elsevier B.V. All rights reserved.
Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.
Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A
2018-04-06
Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.
Template-Directed Copolymerization, Random Walks along Disordered Tracks, and Fractals
NASA Astrophysics Data System (ADS)
Gaspard, Pierre
2016-12-01
In biology, template-directed copolymerization is the fundamental mechanism responsible for the synthesis of DNA, RNA, and proteins. More than 50 years have passed since the discovery of DNA structure and its role in coding genetic information. Yet, the kinetics and thermodynamics of information processing in DNA replication, transcription, and translation remain poorly understood. Challenging issues are the facts that DNA or RNA sequences constitute disordered media for the motion of polymerases or ribosomes while errors occur in copying the template. Here, it is shown that these issues can be addressed and sequence heterogeneity effects can be quantitatively understood within a framework revealing universal aspects of information processing at the molecular scale. In steady growth regimes, the local velocities of polymerases or ribosomes along the template are distributed as the continuous or fractal invariant set of a so-called iterated function system, which determines the copying error probabilities. The growth may become sublinear in time with a scaling exponent that can also be deduced from the iterated function system.
In vitro selection of functional nucleic acids
NASA Technical Reports Server (NTRS)
Wilson, D. S.; Szostak, J. W.
1999-01-01
In vitro selection allows rare functional RNA or DNA molecules to be isolated from pools of over 10(15) different sequences. This approach has been used to identify RNA and DNA ligands for numerous small molecules, and recent three-dimensional structure solutions have revealed the basis for ligand recognition in several cases. By selecting high-affinity and -specificity nucleic acid ligands for proteins, promising new therapeutic and diagnostic reagents have been identified. Selection experiments have also been carried out to identify ribozymes that catalyze a variety of chemical transformations, including RNA cleavage, ligation, and synthesis, as well as alkylation and acyl-transfer reactions and N-glycosidic and peptide bond formation. The existence of such RNA enzymes supports the notion that ribozymes could have directed a primitive metabolism before the evolution of protein synthesis. New in vitro protein selection techniques should allow for a direct comparison of the frequency of ligand binding and catalytic structures in pools of random sequence polynucleotides versus polypeptides.
Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N
2009-02-01
Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
Single-cell RNA sequencing reveals developmental heterogeneity among early lymphoid progenitors.
Alberti-Servera, Llucia; von Muenchow, Lilly; Tsapogas, Panagiotis; Capoferri, Giuseppina; Eschbach, Katja; Beisel, Christian; Ceredig, Rhodri; Ivanek, Robert; Rolink, Antonius
2017-12-15
Single-cell RNA sequencing is a powerful technology for assessing heterogeneity within defined cell populations. Here, we describe the heterogeneity of a B220 + CD117 int CD19 - NK1.1 - uncommitted hematopoietic progenitor having combined lymphoid and myeloid potential. Phenotypic and functional assays revealed four subpopulations within the progenitor with distinct lineage developmental potentials. Among them, the Ly6D + SiglecH - CD11c - fraction was lymphoid-restricted exhibiting strong B-cell potential, whereas the Ly6D - SiglecH - CD11c - fraction showed mixed lympho-myeloid potential. Single-cell RNA sequencing of these subsets revealed that the latter population comprised a mixture of cells with distinct lymphoid and myeloid transcriptional signatures and identified a subgroup as the potential precursor of Ly6D + SiglecH - CD11c - Subsequent functional assays confirmed that B220 + CD117 int CD19 - NK1.1 - single cells are, with rare exceptions, not bipotent for lymphoid and myeloid lineages. A B-cell priming gradient was observed within the Ly6D + SiglecH - CD11c - subset and we propose a herein newly identified subgroup as the direct precursor of the first B-cell committed stage. Therefore, the apparent multipotency of B220 + CD117 int CD19 - NK1.1 - progenitors results from underlying heterogeneity at the single-cell level and highlights the validity of single-cell transcriptomics for resolving cellular heterogeneity and developmental relationships among hematopoietic progenitors. © 2017 The Authors.
Yu, Miao; Ji, Lexiang; Neumann, Drexel A.; ...
2015-07-15
Restriction-modification (R-M) systems pose a major barrier to DNA transformation and genetic engineering of bacterial species. Systematic identification of DNA methylation in R-M systems, including N 6-methyladenine (6mA), 5-methylcytosine (5mC) and N 4-methylcytosine (4mC), will enable strategies to make these species genetically tractable. Although single-molecule, real time (SMRT) sequencing technology is capable of detecting 4mC directly for any bacterial species regardless of whether an assembled genome exists or not, it is not as scalable to profiling hundreds to thousands of samples compared with the commonly used next-generation sequencing technologies. Here, we present 4mC-Tet-assisted bisulfite-sequencing (4mC-TAB-seq), a next-generation sequencing method thatmore » rapidly and cost efficiently reveals the genome-wide locations of 4mC for bacterial species with an available assembled reference genome. In 4mC-TAB-seq, both cytosines and 5mCs are read out as thymines, whereas only 4mCs are read out as cytosines, revealing their specific positions throughout the genome. We applied 4mC-TAB-seq to study the methylation of a member of the hyperthermophilc genus, Caldicellulosiruptor, in which 4mC-related restriction is a major barrier to DNA transformation from other species. Lastly, in combination with MethylC-seq, both 4mC- and 5mC-containing motifs are identified which can assist in rapid and efficient genetic engineering of these bacteria in the future.« less
Zhang, Yunxia; Cheng, Chunyan; Li, Ji; Yang, Shuqiong; Wang, Yunzhu; Li, Ziang; Chen, Jinfeng; Lou, Qunfeng
2015-09-25
Differentiation and copy number of repetitive sequences affect directly chromosome structure which contributes to reproductive isolation and speciation. Comparative cytogenetic mapping has been verified an efficient tool to elucidate the differentiation and distribution of repetitive sequences in genome. In present study, the distinct chromosomal structures of five Cucumis species were revealed through genomic in situ hybridization (GISH) technique and comparative cytogenetic mapping of major satellite repeats. Chromosome structures of five Cucumis species were investigated using GISH and comparative mapping of specific satellites. Southern hybridization was employed to study the proliferation of satellites, whose structural characteristics were helpful for analyzing chromosome evolution. Preferential distribution of repetitive DNAs at the subtelomeric regions was found in C. sativus, C hystrix and C. metuliferus, while majority was positioned at the pericentromeric heterochromatin regions in C. melo and C. anguria. Further, comparative GISH (cGISH) through using genomic DNA of other species as probes revealed high homology of repeats between C. sativus and C. hystrix. Specific satellites including 45S rDNA, Type I/II, Type III, Type IV, CentM and telomeric repeat were then comparatively mapped in these species. Type I/II and Type IV produced bright signals at the subtelomeric regions of C. sativus and C. hystrix simultaneously, which might explain the significance of their amplification in the divergence of Cucumis subgenus from the ancient ancestor. Unique positioning of Type III and CentM only at the centromeric domains of C. sativus and C. melo, respectively, combining with unique southern bands, revealed rapid evolutionary patterns of centromeric DNA in Cucumis. Obvious interstitial telomeric repeats were observed in chromosomes 1 and 2 of C. sativus, which might provide evidence of the fusion hypothesis of chromosome evolution from x = 12 to x = 7 in Cucumis species. Besides, the significant correlation was found between gene density along chromosome and GISH band intensity in C. sativus and C. melo. In summary, comparative cytogenetic mapping of major satellites and GISH revealed the distinct differentiation of chromosome structure during species formation. The evolution of repetitive sequences was the main force for the divergence of Cucumis species from common ancestor.
Studier, F. William
1995-04-18
Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.
Studier, F.W.
1995-04-18
Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.
Xu, Tingting; Zhou, Cong-Zhao; Xiao, Jianxi; Liu, Jinsong
2018-02-20
Naturally occurring interruptions in nonfibrillar collagen play key roles in molecular flexibility, collagen degradation, and ligand binding. The structural feature of the interruption sequences and the molecular basis for their functions have not been well studied. Here, we focused on a G5G type natural interruption sequence G-POALO-G from human type XIX collagen, a homotrimer collagen, as this sequence possesses distinct properties compared with those of a pathological similar Gly mutation sequence in collagen mimic peptides. We determined the crystal structures of the host-guest peptide (GPO) 3 -GPOALO-(GPO) 4 to 1.03 Å resolution in two crystal forms. In these structures, the interruption zone brings localized disruptions to the triple helix and introduces a light 6-8° bend with the same directional preference to the whole molecule, which may correspond structurally to the first physiological kink site in type XIX collagen. Furthermore, at the G5G interruption site, the presence of Ala and Leu residues, both with free N-H groups, allows the formation of more direct and water-mediated interchain hydrogen bonds than in the related Gly → Ala structure. These could partly explain the difference in thermal stability between the different interruptions. In addition, our structures provide a detailed view of the dynamic property of such an interrupted zone with respect to hydrogen bonding topology, torsion angles, and helical parameters. Our results, for the first time, also identified the binding of zinc to the end of the triple helix. These findings will shed light on how the interruption sequence influences the conformation of the collagen molecule and provide a structural basis for further functional studies.
Garcia-Hermoso, Dea; Criscuolo, Alexis; Lee, Soo Chan; Legrand, Matthieu; Chaouat, Marc; Denis, Blandine; Lafaurie, Matthieu; Rouveau, Martine; Soler, Charles; Schaal, Jean-Vivien; Mimoun, Maurice; Mebazaa, Alexandre; Heitman, Joseph; Dromer, Françoise; Brisse, Sylvain; Bretagne, Stéphane; Alanio, Alexandre
2018-04-24
Mucorales are ubiquitous environmental molds responsible for mucormycosis in diabetic, immunocompromised, and severely burned patients. Small outbreaks of invasive wound mucormycosis (IWM) have already been reported in burn units without extensive microbiological investigations. We faced an outbreak of IWM in our center and investigated the clinical isolates with whole-genome sequencing (WGS) analysis. We analyzed M. circinelloides isolates from patients in our burn unit (BU1, Hôpital Saint-Louis, Paris, France) together with nonoutbreak isolates from Burn Unit 2 (BU2, Paris area) and from France over a 2-year period (2013 to 2015). A total of 21 isolates, including 14 isolates from six BU1 patients, were analyzed by whole-genome sequencing (WGS). Phylogenetic classification based on de novo assembly and assembly free approaches showed that the clinical isolates clustered in four highly divergent clades. Clade 1 contained at least one of the strains from the six epidemiologically linked BU1 patients. The clinical isolates were specific to each patient. Two patients were infected with more than two strains from different clades, suggesting that an environmental reservoir of clonally unrelated isolates was the source of contamination. Only two patients from BU1 shared one strain, which could correspond to direct transmission or contamination with the same environmental source. In conclusion, WGS of several isolates per patients coupled with precise epidemiological data revealed a complex situation combining potential cross-transmission between patients and multiple contaminations with a heterogeneous pool of strains from a cryptic environmental reservoir. IMPORTANCE Invasive wound mucormycosis (IWM) is a severe infection due to environmental molds belonging to the order Mucorales. Severely burned patients are particularly at risk for IWM. Here, we used whole-genome sequencing (WGS) analysis to resolve an outbreak of IWM due to Mucor circinelloides that occurred in our hospital (BU1). We sequenced 21 clinical isolates, including 14 from BU1 and 7 unrelated isolates, and compared them to the reference genome (1006PhL). This analysis revealed that the outbreak was mainly due to multiple strains that seemed patient specific, suggesting that the patients were more likely infected from a pool of diverse strains from the environment rather than from direct transmission among them. This study revealed the complexity of a Mucorales outbreak in the settings of IWM in burn patients, which has been highlighted based on WGS combined with careful sampling. Copyright © 2018 Garcia-Hermoso et al.
Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.
Kumar, Jyoti; Dixit, Shivendra Kumar; Kumar, Rajiv
2015-09-01
This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA), Rpt2 and 12S ribosomal RNA (rRNA) genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR) based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631). Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S rRNA gene sequence also revealed the identity of 98% with published sequences in the NCBI database. The present study emphasized the PCR as a valuable tool for rapid detection of M. haemolytica in clinical samples from animals. In addition, it offers the opportunity to perform large-scale epidemiological studies regarding the role of M. haemolytica in clinical cases of pneumonia and other disease manifestations in sheep and other ruminants, thereby providing the basis for effective preventive strategies.
Lagares, Antonio; Agaras, Betina; Bettiol, Marisa P; Gatti, Blanca M; Valverde, Claudio
2015-07-01
Species-specific genetic markers are crucial to develop faithful and sensitive molecular methods for the detection and identification of Pseudomonas aeruginosa (Pa). We have previously set up a PCR-RFLP protocol targeting oprF, the gene encoding the genus-specific outer membrane porin F, whose strong conservation and marked sequence diversity allowed detection and differentiation of environmental isolates (Agaras et al., 2012). Here, we evaluated the ability of the PCR-RFLP assay to genotype clinical isolates previously identified as Pa by conventional microbiological methods within a collection of 62 presumptive Pa isolates from different pediatric clinical samples and different sections of the Hospital de Niños "Sor María Ludovica" from La Plata, Argentina. All isolates, but one, gave an oprF amplicon consistent with that from reference Pa strains. The sequence of the smaller-sized amplicon revealed that the isolate was in fact a mendocina Pseudomonas strain. The oprF RFLP pattern generated with TaqI or HaeIII nucleases matched those of reference Pa strains for 59 isolates (96%). The other two Pa isolates (4%) revealed a different RFLP pattern based on HaeIII digestion, although oprF sequencing confirmed that Pa identification was correct. We next tested the effectiveness of the PCR-RFLP to detect pseudomonads on clinical samples of pediatric fibrocystic patients directly without sample cultivation. The expected amplicon and its cognate RFLP profile were obtained for all samples in which Pa was previously detected by cultivation-dependent methods. Altogether, these results provide the basis for the application of the oprF PCR-RFLP protocol to directly detect and identify Pa and other non-Pa pseudomonads in fibrocystic clinical samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Ramalingam, K; Indra, D
2002-04-01
A time course study on the sublethal toxicity of CuSO4 on tissue carbohydrate metabolites level and their phosphatases activity in Achatina fulica revealed differential response. The levels of total carbohydrates and glycogen in the body mass muscle, foot muscle and hemolymph revealed their involvement in the endogenous derivation of energy during stress. The same metabolites in digestive gland revealed its importance to reproduction and development. The lactate accumulated in all the tissues implied the mechanism of CuSO4 toxicosis in the metabolic acidosis. The decrease of pyruvate in foot muscle, body mass muscle and hemolymph inferred the preponderance of glycolysis in energy derivation. In contrast, the pyruvate concentration in digestive gland revealed its differential response in the stress metabolic sequence of changes, as a unique tissue. The lactate/pyruvate ratio and the calcium content in tissues constitute direct evidences for the snails adaptation to toxic stress.
Analysis of mutational changes at the HLA locus in single human sperm.
Huang, M M; Erlich, H A; Goodman, M F; Arnheim, N
1995-01-01
Using a simple and efficient single sperm PCR and direct sequencing method, we screened for HLA-DPB1 gene mutations that may give rise to new alleles at this highly polymorphic locus. More than 800 single sperm were studied from a heterozygous individual whose two alleles carried 16 nucleotide sequence differences clustered in six polymorphic regions. A potential microgene conversion event was detected. Unrepaired heteroduplex DNA similar to that which gives rise to postmeiotic segregation events in yeast was observed in three cases. Control experiments also revealed unusual sperm from DPB1 homozygous individuals. The data may help explain allelic diversity in the MHC and suggest that a possible source of human mosaicism may be incomplete DNA mismatch repair during gametogenesis.
Ferreira, L M; Hazlewood, G P; Barker, P J; Gilbert, H J
1991-01-01
A genomic library of Pseudomonas fluorescens subsp. cellulosa DNA was constructed in pUC18 and Escherichia coli recombinants expressing 4-methylumbelliferyl beta-D-cellobioside-hydrolysing activity (MUCase) were isolated. Enzyme produced by MUCase-positive clones did not hydrolyse either cellobiose or cellotriose but converted cellotetraose into cellobiose and cleaved cellopentaose and cellohexaose, producing a mixture of cellobiose and cellotriose. There was no activity against CM-cellulose, insoluble cellulose or xylan. On this basis, the enzyme is identified as an endo-acting cellodextrinase and is designated cellodextrinase C (CELC). Nucleotide sequencing of the gene (celC) which directs the synthesis of CELC revealed an open reading frame of 2153 bp, encoding a protein of Mr 80,189. The deduced primary sequence of CELC was confirmed by the Mr of purified CELC (77,000) and by the experimentally determined N-terminus of the enzyme which was identical with residues 38-47 of the translated sequence. The N-terminal region of CELC showed strong homology with endoglucanase, xylanases and an arabinofuranosidase of Ps. fluorescens subsp. cellulosa; homologous sequences included highly conserved serine-rich regions. Full-length CELC bound tightly to crystalline cellulose. Truncated forms of celC from which the DNA sequence encoding the conserved domain had been deleted, directed the synthesis of a functional cellodextrinase that did not bind to crystalline cellulose. This is consistent with the N-terminal region of CELC comprising a non-catalytic cellulose-binding domain which is distinct from the catalytic domain. The role of the cellulose-binding region is discussed. Images Fig. 2. Fig. 6. PMID:1953673
kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets
Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.
2013-01-01
Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147
kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets.
Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S; Beer, Michael A
2013-07-01
Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167-80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org.
The implication of DNA bending energy for nucleosome positioning and sliding.
Liu, Guoqing; Xing, Yongqiang; Zhao, Hongyu; Cai, Lu; Wang, Jianying
2018-06-11
Nucleosome not only directly affects cellular processes, such as DNA replication, recombination, and transcription, but also severs as a fundamentally important target of epigenetic modifications. Our previous study indicated that the bending property of DNA is important in nucleosome formation, particularly in predicting the dyad positions of nucleosomes on a DNA segment. Here, we investigated the role of bending energy in nucleosome positioning and sliding in depth to decipher sequence-directed mechanism. The results show that bending energy is a good physical index to predict the free energy in the process of nucleosome reconstitution in vitro. Our data also imply that there are at least 20% of the nucleosomes in budding yeast do not adopt canonical positioning, in which underlying sequences wrapped around histones are structurally symmetric. We also revealed distinct patterns of bending energy profile for distinctly organized chromatin structures, such as well-positioned nucleosomes, fuzzy nucleosomes, and linker regions and discussed nucleosome sliding in terms of bending energy. We proposed that the stability of a nucleosome is positively correlated with the strength of the bending anisotropy of DNA segment, and both accessibility and directionality of nucleosome sliding is likely to be modulated by diverse patterns of DNA bending energy profile.
Biswas et al. describe an “exceptional responder” lung adenocarcinoma patient who survived with metastatic lung adenocarcinoma for 7 years while undergoing single or combination ERBB2-directed therapies. Whole-genome, whole-exome, and high-coverage ion-torrent targeted sequencing were used to demonstrate extreme genomic heterogeneity between the lung and lymph node metastatic
Tal, Asaf; Arbel-Goren, Rinat; Costantino, Nina; Court, Donald L; Stavans, Joel
2014-05-20
The search for specific sequences on long genomes is a key process in many biological contexts. How can specific target sequences be located with high efficiency, within physiologically relevant times? We addressed this question for viral integration, a fundamental mechanism of horizontal gene transfer driving prokaryotic evolution, using the infection of Escherichia coli bacteria with bacteriophage λ and following the establishment of a lysogenic state. Following the targeting process in individual live E. coli cells in real time revealed that λ DNA remains confined near the entry point of a cell following infection. The encounter between the 15-bp-long target sequence on the chromosome and the recombination site on the viral genome is facilitated by the directed motion of bacterial DNA generated during chromosome replication, in conjunction with constrained diffusion of phage DNA. Moving the native bacterial integration site to different locations on the genome and measuring the integration frequency in these strains reveals that the frequencies of the native site and a site symmetric to it relative to the origin are similar, whereas both are significantly higher than when the integration site is moved near the terminus, consistent with the replication-driven mechanism we propose. This novel search mechanism is yet another example of the exquisite coevolution of λ with its host.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe
2014-06-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.
Kanaya, Shoko; Fujisaki, Waka; Nishida, Shin'ya; Furukawa, Shigeto; Yokosawa, Kazuhiko
2015-02-01
Temporal phase discrimination is a useful psychophysical task to evaluate how sensory signals, synchronously detected in parallel, are perceptually bound by human observers. In this task two stimulus sequences synchronously alternate between two states (say, A-B-A-B and X-Y-X-Y) in either of two temporal phases (ie A and B are respectively paired with X and Y, or vice versa). The critical alternation frequency beyond which participants cannot discriminate the temporal phase is measured as an index characterizing the temporal property of the underlying binding process. This task has been used to reveal the mechanisms underlying visual and cross-modal bindings. To directly compare these binding mechanisms with those in another modality, this study used the temporal phase discrimination task to reveal the processes underlying auditory bindings. The two sequences were alternations between two pitches. We manipulated the distance between the two sequences by changing intersequence frequency separation, or presentation ears (diotic vs dichotic). Results showed that the alternation frequency limit ranged from 7 to 30 Hz, becoming higher as the intersequence distance decreased, as is the case with vision. However, unlike vision, auditory phase discrimination limits were higher and more variable across participants. © 2015 SAGE Publications.
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299
Lee, Seung-Bum; Kaittanis, Charalambos; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-01-01
Background Cotton (Gossypium hirsutum) is the most important fiber crop grown in 90 countries. In 2004–2005, US farmers planted 79% of the 5.7-million hectares of nuclear transgenic cotton. Unfortunately, genetically modified cotton has the potential to hybridize with other cultivated and wild relatives, resulting in geographical restrictions to cultivation. However, chloroplast genetic engineering offers the possibility of containment because of maternal inheritance of transgenes. The complete chloroplast genome of cotton provides essential information required for genetic engineering. In addition, the sequence data were used to assess phylogenetic relationships among the major clades of rosids using cotton and 25 other completely sequenced angiosperm chloroplast genomes. Results The complete cotton chloroplast genome is 160,301 bp in length, with 112 unique genes and 19 duplicated genes within the IR, containing a total of 131 genes. There are four ribosomal RNAs, 30 distinct tRNA genes and 17 intron-containing genes. The gene order in cotton is identical to that of tobacco but lacks rpl22 and infA. There are 30 direct and 24 inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Most of the direct repeats are within intergenic spacer regions, introns and a 72 bp-long direct repeat is within the psaA and psaB genes. Comparison of protein coding sequences with expressed sequence tags (ESTs) revealed nucleotide substitutions resulting in amino acid changes in ndhC, rpl23, rpl20, rps3 and clpP. Phylogenetic analysis of a data set including 61 protein-coding genes using both maximum likelihood and maximum parsimony were performed for 28 taxa, including cotton and five other angiosperm chloroplast genomes that were not included in any previous phylogenies. Conclusion Cotton chloroplast genome lacks rpl22 and infA and contains a number of dispersed direct and inverted repeats. RNA editing resulted in amino acid changes with significant impact on their hydropathy. Phylogenetic analysis provides strong support for the position of cotton in the Malvales in the eurosids II clade sister to Arabidopsis in the Brassicales. Furthermore, there is strong support for the placement of the Myrtales sister to the eurosid I clade, although expanded taxon sampling is needed to further test this relationship. PMID:16553962
Epitope mapping of the variable repetitive region with the MB antigen of Ureaplasma urealyticum.
Zheng, X; Lau, K; Frazier, M; Cassell, G H; Watson, H L
1996-01-01
One of the major surface structures of Ureaplasma urealyticum recognized by antibodies of patients during infection is the MB antigen. Previously, we showed by Western blot (immunoblot) analysis that any one of the anti-MB monoclonal antibodies (MAbs) 3B1.5, 5B1.1, and 10C6.6 could block the binding of patient antibodies to MB. Subsequent DNA sequencing revealed that a unique six-amino-acid direct tandem repeat region composed the carboxy two-thirds of this antigen. In the present study, using antibody-reactive peptide scanning of this repeat region, we demonstrated that the amino acids defining the epitopes for MAbs 3B1.5 5B1.1 and 10C6.6 are EQP, GK, and KEQPA, respectively. Peptide scanning analysis of an infected patient's serum antibody response showed that the dominant epitope was defined by the sequence PAGK. Mapping of these continuous epitopes revealed overlap between all MAb and patient polyclonal antibody binding sites, thus explaining the ability of a single MAb to apparently block all polyclonal antibody binding sites. We also show that a single amino acid difference in the sequence of the repeats of serovars 3 and 14 accounts for the lack of reactivity with serovar 14 of two of the serovar 3-specific MAbs. Finally, the data demonstrate the need to obtain the sequences of the mba genes of all serovars before an effective serovar-specific antibody detection method can be developed. PMID:8914774
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheffield, Allyson A.; Johnston, Kathryn V.; Majewski, Steven R.
As large-scale stellar surveys have become available over the past decade, the ability to detect and characterize substructures in the Galaxy has increased dramatically. These surveys have revealed the Triangulum-Andromeda (TriAnd) region to be rich with substructures in the distance range 20-30 kpc, and the relation of these features to each other, if any, remains unclear. An exploration using Two Micron All Sky Survey (2MASS) photometry reveals not only the faint sequence in M giants detected by Rocha-Pinto et al. spanning the range 100° < l < 160° and –50° < b < –15°, but, in addition, a second, brightermore » and more densely populated sequence. These sequences are likely associated with the distinct main sequences (MSs) discovered (and labeled TriAnd1 and TriAnd2) by Martin et al. in an optical survey in the direction of M31, where TriAnd2 is the optical counterpart of the fainter red giant branch (RGB)/asymptotic giant branch sequence of Rocha-Pinto et al. Here, the age, distance, and metallicity ranges for TriAnd1 and TriAnd2 are estimated by simultaneously fitting isochrones to the 2MASS RGB tracks and the optical MS/MS turn-off features. The two populations are clearly distinct in age and distance: the brighter sequence (TriAnd1) is younger (6-10 Gyr) and closer (distance of ∼15-21 kpc), whereas the fainter sequence (TriAnd2) is older (10-12 Gyr) and at an estimated distance of ∼24-32 kpc. A comparison with simulations demonstrates that the differences and similarities between TriAnd1 and TriAnd2 can simultaneously be explained if they represent debris originating from the disruption of the same dwarf galaxy, but torn off during two distinct pericentric passages.« less
Fariña Sarasqueta, Arantza; Moerland, Elna; de Bruyne, Hanneke; de Graaf, Henk; Vrancken, Tamara; van Lijnschoten, Gesina; van den Brule, Adriaan J.C.
2011-01-01
Although direct sequencing is the gold standard for KRAS mutation detection in routine diagnostics, it remains laborious, time consuming, and not very sensitive. Our objective was to evaluate SNaPshot and the KRAS StripAssay as alternatives to sequencing for KRAS mutation detection in daily practice. KRAS exon 2–specific PCR followed by sequencing or by a SNaPshot reaction was performed. For the StripAssay, a mutant-enriched PCR was followed by hybridization to KRAS-specific probes bound to a nitrocellulose strip. To test sensitivities, dilution series of mutated DNA in wild-type DNA were made. Additionally, direct sequencing and SNaPshot were evaluated in 296 colon cancer samples. Detection limits of direct sequencing, SNaPshot, and StripAssay were 20%, 10%, and 1% tumor cells, respectively. Direct sequencing and SNaPshot can detect all 12 mutations in KRAS codons 12 and 13, whereas the StripAssay detects 10 of the most frequent ones. Workload and time to results are comparable for SNaPshot and direct sequencing. SNaPshot is flexible and easy to multiplex. The StripAssay is less time consuming for daily laboratory practice. SNaPshot is more flexible and slightly more sensitive than direct sequencing. The clinical evaluation showed comparable performances between direct sequencing and SNaPshot. The StripAssay is rapid and an extremely sensitive assay that could be considered when few tumor cells are available. However, found mutants should be confirmed to avoid risk of false positives. PMID:21354055
Lucas, James E; Siegel, Justin B
2015-01-01
Enzyme active site residues are often highly conserved, indicating a significant role in function. In this study we quantitate the functional contribution for all conserved molecular interactions occurring within a Michaelis complex for mannitol 2-dehydrogenase derived from Pseudomonas fluorescens (pfMDH). Through systematic mutagenesis of active site residues, we reveal that the molecular interactions in pfMDH mediated by highly conserved residues not directly involved in reaction chemistry can be as important to catalysis as those directly involved in the reaction chemistry. This quantitative analysis of the molecular interactions within the pfMDH active site provides direct insight into the functional role of each molecular interaction, several of which were unexpected based on canonical sequence conservation and structural analyses. PMID:25752240
Lin, Jingxia; Wang, Xiuna; Deng, Xianbo; Feng, Youjun
2016-01-01
The emergence of the mobilized colistin resistance gene, representing a novel mechanism for bacterial drug resistance, challenges the last resort against the severe infections by Gram-negative bacteria with multi-drug resistances. Very recently, we showed the diversity in the mcr-1-carrying plasmid reservoirs from the gut microbiota. Here, we reported that a similar but more complex scenario is present in the healthy swine populations, Southern China, 2016. Amongst the 1026 pieces of Escherichia coli isolates from 3 different pig farms, 302 E. coli isolates were determined to be positive for the mcr-1 gene (30%, 302/1026). Multi-locus sequence typing assigned no less than 11 kinds of sequence types including one novel Sequence Type to these mcr-1-positive strains. PCR analyses combined with the direct DNA sequencing revealed unexpected complexity of the mcr-1-harbouring plasmids whose backbones are at least grouped into 6 types four of which are new. Transcriptional analyses showed that the mcr-1 promoter of different origins exhibits similar activity. It seems likely that complex dissemination of the diversified mcr-1-bearing plasmids occurs amongst the various ST E. coli inhabiting the healthy swine populations, in Southern China. PMID:27741523
Precision of working memory for visual motion sequences and transparent motion surfaces.
Zokaei, Nahid; Gorgoraptis, Nikos; Bahrami, Bahador; Bays, Paul M; Husain, Masud
2011-12-01
Recent studies investigating working memory for location, color, and orientation support a dynamic resource model. We examined whether this might also apply to motion, using random dot kinematograms (RDKs) presented sequentially or simultaneously. Mean precision for motion direction declined as sequence length increased, with precision being lower for earlier RDKs. Two alternative models of working memory were compared specifically to distinguish between the contributions of different sources of error that corrupt memory (W. Zhang & S. J. Luck, 2008 vs. P. M. Bays, R. F. G. Catalao, & M. Husain, 2009). The latter provided a significantly better fit for the data, revealing that decrease in memory precision for earlier items is explained by an increase in interference from other items in a sequence rather than random guessing or a temporal decay of information. Misbinding feature attributes is an important source of error in working memory. Precision of memory for motion direction decreased when two RDKs were presented simultaneously as transparent surfaces, compared to sequential RDKs. However, precision was enhanced when one motion surface was prioritized, demonstrating that selective attention can improve recall precision. These results are consistent with a resource model that can be used as a general conceptual framework for understanding working memory across a range of visual features.
Molecular Evidence for a Natural Primary Triple Hybrid in Plants Revealed from Direct Sequencing
Kaplan, Zdenek; Fehrer, Judith
2007-01-01
Background and Aims Molecular evidence for natural primary hybrids composed of three different plant species is very rarely reported. An investigation was therefore carried out into the origin and a possible scenario for the rise of a sterile plant clone showing a combination of diagnostic morphological features of three separate, well-defined Potamogeton species. Methods The combination of sequences from maternally inherited cytoplasmic (rpl20-rps12) and biparentally inherited nuclear ribosomal DNA (ITS) was used to identify the exact identity of the putative triple hybrid. Key Results Direct sequencing showed ITS variants of three parental taxa, P. gramineus, P. lucens and P. perfoliatus, whereas chloroplast DNA identified P. perfoliatus as the female parent. A scenario for the rise of the triple hybrid through a fertile binary hybrid P. gramineus × P. lucens crossed with P. perfoliatus is described. Conclusions Even though the triple hybrid is sterile, it possesses an efficient strategy for its existence and became locally successful even in the parental environment, perhaps as a result of heterosis. The population investigated is the only one known of this hybrid, P. × torssanderi, worldwide. Isozyme analysis indicated the colony to be genetically uniform. The plants studied represented a single clone that seems to have persisted at this site for a long time. PMID:17478544
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
Delaney, Nigel F.; Marx, Christopher J.
2012-01-01
Understanding evolutionary dynamics within microbial populations requires the ability to accurately follow allele frequencies through time. Here we present a rapid, cost-effective method (FREQ-Seq) that leverages Illumina next-generation sequencing for localized, quantitative allele frequency detection. Analogous to RNA-Seq, FREQ-Seq relies upon counts from the >105 reads generated per locus per time-point to determine allele frequencies. Loci of interest are directly amplified from a mixed population via two rounds of PCR using inexpensive, user-designed oligonucleotides and a bar-coded bridging primer system that can be regenerated in-house. The resulting bar-coded PCR products contain the adapters needed for Illumina sequencing, eliminating further library preparation. We demonstrate the utility of FREQ-Seq by determining the order and dynamics of beneficial alleles that arose as a microbial population, founded with an engineered strain of Methylobacterium, evolved to grow on methanol. Quantifying allele frequencies with minimal bias down to 1% abundance allowed effective analysis of SNPs, small in-dels and insertions of transposable elements. Our data reveal large-scale clonal interference during the early stages of adaptation and illustrate the utility of FREQ-Seq as a cost-effective tool for tracking allele frequencies in populations. PMID:23118913
van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.
2010-01-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608
van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I
2010-11-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.
GC-rich coding sequences reduce transposon-like, small RNA-mediated transgene silencing.
Sidorenko, Lyudmila V; Lee, Tzuu-Fen; Woosley, Aaron; Moskal, William A; Bevan, Scott A; Merlo, P Ann Owens; Walsh, Terence A; Wang, Xiujuan; Weaver, Staci; Glancy, Todd P; Wang, PoHao; Yang, Xiaozeng; Sriram, Shreedharan; Meyers, Blake C
2017-11-01
The molecular basis of transgene susceptibility to silencing is poorly characterized in plants; thus, we evaluated several transgene design parameters as means to reduce heritable transgene silencing. Analyses of Arabidopsis plants with transgenes encoding a microalgal polyunsaturated fatty acid (PUFA) synthase revealed that small RNA (sRNA)-mediated silencing, combined with the use of repetitive regulatory elements, led to aggressive transposon-like silencing of canola-biased PUFA synthase transgenes. Diversifying regulatory sequences and using native microalgal coding sequences (CDSs) with higher GC content improved transgene expression and resulted in a remarkable trans-generational stability via reduced accumulation of sRNAs and DNA methylation. Further experiments in maize with transgenes individually expressing three crystal (Cry) proteins from Bacillus thuringiensis (Bt) tested the impact of CDS recoding using different codon bias tables. Transgenes with higher GC content exhibited increased transcript and protein accumulation. These results demonstrate that the sequence composition of transgene CDSs can directly impact silencing, providing design strategies for increasing transgene expression levels and reducing risks of heritable loss of transgene expression.
Characterization of genetic variability of Venezuelan equine encephalitis viruses
Gardner, Shea N.; McLoughlin, Kevin; Be, Nicholas A.; ...
2016-04-07
Venezuelan equine encephalitis virus (VEEV) is a mosquito-borne alphavirus that has caused large outbreaks of severe illness in both horses and humans. New approaches are needed to rapidly infer the origin of a newly discovered VEEV strain, estimate its equine amplification and resultant epidemic potential, and predict human virulence phenotype. We performed whole genome single nucleotide polymorphism (SNP) analysis of all available VEE antigenic complex genomes, verified that a SNP-based phylogeny accurately captured the features of a phylogenetic tree based on multiple sequence alignment, and developed a high resolution genome-wide SNP microarray. We used the microarray to analyze a broadmore » panel of VEEV isolates, found excellent concordance between array- and sequence-based SNP calls, genotyped unsequenced isolates, and placed them on a phylogeny with sequenced genomes. The microarray successfully genotyped VEEV directly from tissue samples of an infected mouse, bypassing the need for viral isolation, culture and genomic sequencing. Lastly, we identified genomic variants associated with serotypes and host species, revealing a complex relationship between genotype and phenotype.« less
Short interfering RNA confers intracellular antiviral immunity in human cells.
Gitlin, Leonid; Karelsky, Sveta; Andino, Raul
2002-07-25
Gene silencing mediated by double-stranded RNA (dsRNA) is a sequence-specific, highly conserved mechanism in eukaryotes. In plants, it serves as an antiviral defence mechanism. Animal cells also possess this machinery but its specific function is unclear. Here we demonstrate that dsRNA can effectively protect human cells against infection by a rapidly replicating and highly cytolytic RNA virus. Pre-treatment of human and mouse cells with double-stranded, short interfering RNAs (siRNAs) to the poliovirus genome markedly reduces the titre of virus progeny and promotes clearance of the virus from most of the infected cells. The antiviral effect is sequence-specific and is not attributable to either classical antisense mechanisms or to interferon and the interferon response effectors protein kinase R (PKR) and RNaseL. Protection is the result of direct targeting of the viral genome by siRNA, as sequence analysis of escape virus (resistant to siRNAs) reveals one nucleotide substitution in the middle of the targeted sequence. Thus, siRNAs elicit specific intracellular antiviral resistance that may provide a therapeutic strategy against human viruses.
A retrotransposable element from the mosquito Anopheles gambiae .
Besansky, N J
1990-01-01
A family of middle repetitive elements from the African malaria vector Anopheles gambiae is described. Approximately 100 copies of the element, designated T1Ag, are dispersed in the genome. Full-length elements are 4.6 kilobase pairs in length, but truncation of the 5' end is common. Nucleotide sequences of one full-length, two 5'-truncated, and two 5' ends of T1Ag elements were determined and aligned to define a consensus sequence. Sequence analysis revealed two long, overlapping open reading frames followed by a polyadenylation signal, AATAAA, and a tail consisting of tandem repetitions of the motif TGAAA. No direct or inverted long terminal repeats (LTRs) were detected. The first open reading frame, 442 amino acids in length, includes a domain resembling that of nucleic acid-binding proteins. The second open reading frame, 975 amino acids long, resembles the reverse transcriptases of a category of retrotransposable elements without LTRs, variously termed class II retrotransposons, class III elements or non-LTR retrotransposons. Similarity at the sequence and structural levels places T1Ag in this category. Images PMID:1689457
Albertini, A M; Caramori, T; Crabb, W D; Scoffone, F; Galizzi, A
1991-01-01
We cloned and sequenced 8.3 kb of Bacillus subtilis DNA corresponding to the flaA locus involved in flagellar biosynthesis, motility, and chemotaxis. The DNA sequence revealed the presence of 10 complete and 2 incomplete open reading frames. Comparison of the deduced amino acid sequences to data banks showed similarities of nine of the deduced products to a number of proteins of Escherichia coli and Salmonella typhimurium for which a role in flagellar functioning has been directly demonstrated. In particular, the sequence data suggest that the flaA operon codes for the M-ring protein, components of the motor switch, and the distal part of the basal-body rod. The gene order is remarkably similar to that described for region III of the enterobacterial flagellar regulon. One of the open reading frames was translated into a protein with 48% amino acid identity to S. typhimurium FliI and 29% identity to the beta subunit of E. coli ATP synthase. PMID:1828465
Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri
2016-01-01
Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774
Evers, R; Grummt, I
1995-01-01
Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036
Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr
2007-01-01
Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...
2015-09-21
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
Abdelrahman, Tamer; Hughes, Joseph; Main, Janice; McLauchlan, John; Thursz, Mark; Thomson, Emma
2015-01-01
High rates of sexually transmitted infection and reinfection with hepatitis C virus (HCV) have recently been reported in human immunodeficiency virus (HIV)-infected men who have sex with men and reinfection has also been described in monoinfected injecting drug users. The diagnosis of reinfection has traditionally been based on direct Sanger sequencing of samples pre- and posttreatment, but not on more sensitive deep sequencing techniques. We studied viral quasispecies dynamics in patients who failed standard of care therapy in a high-risk HIV-infected cohort of patients with early HCV infection to determine whether treatment failure was associated with reinfection or recrudescence of preexisting infection. Paired sequences (pre- and posttreatment) were analyzed. The HCV E2 hypervariable region-1 was amplified using nested reverse-transcription polymerase chain reaction (RT-PCR) with indexed genotype-specific primers and the same products were sequenced using both Sanger and 454 pyrosequencing approaches. Of 99 HIV-infected patients with acute HCV treated with 24-48 weeks of pegylated interferon alpha and ribavirin, 15 failed to achieve a sustained virological response (six relapsed, six had a null response, and three had a partial response). Using direct sequencing, 10/15 patients (66%) had evidence of a previously undetected strain posttreatment; in many studies, this is interpreted as reinfection. However, pyrosequencing revealed that 15/15 (100%) of patients had evidence of persisting infection; 6/15 (40%) patients had evidence of a previously undetected variant present in the posttreatment sample in addition to a variant that was detected at baseline. This could represent superinfection or a limitation of the sensitivity of pyrosequencing. In this high-risk group, the emergence of new viral strains following treatment failure is most commonly associated with emerging dominance of preexisting minority variants rather than reinfection. Superinfection may occur in this cohort but reinfection is overestimated by Sanger sequencing. © 2014 The Authors. Hepatology published by Wiley on behalf of the American Association for the Study of Liver Diseases.
De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria
2013-01-01
Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541
Bravo-Patiño, A; Ibarra, J E
2000-01-01
Amino acids Lys34, His36, and Phe37 were substituted by PCR-mediated, site-directed mutagenesis for three Trp's in the AcNPV polyhedrin sequence. Phase contrast microscopy revealed refringent, amorphous polyhedra in the nuclei of infected cells. Electron microscopy confirmed a great variation in form and size of the mutated polyhedra. Although crystallization of the mutated polyhedrin occurred, it was irregular within each polyhedron. Virion occlusion was also severely affected. Virions were partially occluded, or only one virion was occluded per polyhedron. Results suggest that the substitution of these three amino acids affected the morphology of polyhedra, the uniformity of crystallization within each polyhedron, and the virion occlusion.
Abramavicius, Darius; Voronine, Dmitri V.; Mukamel, Shaul
2008-01-01
A simulation study demonstrates how the nonlinear optical response of the Fenna–Matthews–Olson photosynthetic light-harvesting complex may be explored by a sequence of laser pulses specifically designed to probe the correlated dynamics of double excitations. Cross peaks in the 2D correlation plots of the spectra reveal projections of the double-exciton wavefunctions onto a basis of direct products of single excitons. An alternative physical interpretation of these signals in terms of quasiparticle scattering is developed. PMID:18562293
Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.
2016-01-01
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769
Ventura, Marco; Canchaya, Carlos; Meylan, Valèrie; Klaenhammer, Todd R.; Zink, Ralf
2003-01-01
We analyzed the tuf gene, encoding elongation factor Tu, from 33 strains representing 17 Lactobacillus species and 8 Bifidobacterium species. The tuf sequences were aligned and used to infer phylogenesis among species of lactobacilli and bifidobacteria. We demonstrated that the synonymous substitution affecting this gene renders elongation factor Tu a reliable molecular clock for investigating evolutionary distances of lactobacilli and bifidobacteria. In fact, the phylogeny generated by these tuf sequences is consistent with that derived from 16S rRNA analysis. The investigation of a multiple alignment of tuf sequences revealed regions conserved among strains belonging to the same species but distinct from those of other species. PCR primers complementary to these regions allowed species-specific identification of closely related species, such as Lactobacillus casei group members. These tuf gene-based assays developed in this study provide an alternative to present methods for the identification for lactic acid bacterial species. Since a variable number of tuf genes have been described for bacteria, the presence of multiple genes was examined. Southern analysis revealed one tuf gene in the genomes of lactobacilli and bifidobacteria, but the tuf gene was arranged differently in the genomes of these two taxa. Our results revealed that the tuf gene in bifidobacteria is flanked by the same gene constellation as the str operon, as originally reported for Escherichia coli. In contrast, bioinformatic and transcriptional analyses of the DNA region flanking the tuf gene in four Lactobacillus species indicated the same four-gene unit and suggested a novel tuf operon specific for the genus Lactobacillus. PMID:14602655
Ancient DNA sequence revealed by error-correcting codes.
Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo
2015-07-10
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.
Ancient DNA sequence revealed by error-correcting codes
Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo
2015-01-01
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228
Oh, Hye-Seon; Kwon, Hyemi; Park, Suyeon; Kim, Mijin; Jeon, Min Ji; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae; Choi, Jene
2018-01-01
Background The BRAFV600E mutation is the most common genetic alteration identified in papillary thyroid carcinoma (PTC). Because of its costs effectiveness and sensitivity, direct Sanger sequencing has several limitations. The aim of this study was to evaluate the efficiency of immunohistochemistry (IHC) as an alternative method to detect the BRAFV600E mutation in preoperative and postoperative tissue samples. Methods We evaluated 71 patients who underwent thyroid surgery with the result of direct sequencing of the BRAFV600E mutation. IHC staining of the BRAFV600E mutation was performed in 49 preoperative and 23 postoperative thyroid specimens. Results Sixty-two patients (87.3%) had PTC, and of these, BRAFV600E was confirmed by direct sequencing in 57 patients (91.9%). In 23 postoperative tissue samples, the BRAFV600E mutation was detected in 16 samples (70%) by direct sequencing and 18 samples (78%) by IHC. In 24 fine needle aspiration (FNA) samples, BRAFV600E was detected in 18 samples (75%) by direct sequencing and 16 samples (67%) by IHC. In 25 core needle biopsy (CNB) samples, the BRAFV600E mutation was detected in 15 samples (60%) by direct sequencing and 16 samples (64%) by IHC. The sensitivity and specificity of IHC for detecting the BRAFV600E mutation were 77.8% and 66.7% in FNA samples and 99.3% and 80.0% in CNB samples. Conclusion IHC could be an alternative method to direct Sanger sequencing for BRAFV600E mutation detection both in postoperative and preoperative samples. However, application of IHC to detect the BRAFV600E mutation in FNA samples is of limited value compared with direct sequencing. PMID:29388401
DNA sequence-dependent compartmentalization and silencing of chromatin at the nuclear lamina.
Zullo, Joseph M; Demarco, Ignacio A; Piqué-Regi, Roger; Gaffney, Daniel J; Epstein, Charles B; Spooner, Chauncey J; Luperchio, Teresa R; Bernstein, Bradley E; Pritchard, Jonathan K; Reddy, Karen L; Singh, Harinder
2012-06-22
A large fraction of the mammalian genome is organized into inactive chromosomal domains along the nuclear lamina. The mechanism by which these lamina associated domains (LADs) are established remains to be elucidated. Using genomic repositioning assays, we show that LADs, spanning the developmentally regulated IgH and Cyp3a loci contain discrete DNA regions that associate chromatin with the nuclear lamina and repress gene activity in fibroblasts. Lamina interaction is established during mitosis and likely involves the localized recruitment of Lamin B during late anaphase. Fine-scale mapping of LADs reveals numerous lamina-associating sequences (LASs), which are enriched for a GAGA motif. This repeated motif directs lamina association and is bound by the transcriptional repressor cKrox, in a complex with HDAC3 and Lap2β. Knockdown of cKrox or HDAC3 results in dissociation of LASs/LADs from the nuclear lamina. These results reveal a mechanism that couples nuclear compartmentalization of chromatin domains with the control of gene activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Tracking the blue: a MLST approach to characterise the Pseudomonas fluorescens group.
Andreani, N A; Martino, M E; Fasolato, L; Carraro, L; Montemurro, F; Mioni, R; Bordin, P; Cardazzo, B
2014-05-01
The Pseudomonas fluorescens group comprises several closely related species that are involved in food contamination and spoilage. Specifically, the interest in P. fluorescens as a spoiler of dairy products increased after the cases of "blue mozzarella" that occurred in Italy in 2010. A Multilocus Sequence Typing (MLST) scheme was developed and applied to characterise 136 isolates (reference strains and food borne isolates) at strain level, to reveal the genetic relationships among them and to disclose any possible genetic clustering of phenotypic markers involved in food spoilage (protease, lipase, lecithinase activities and pigmented or fluorescent molecule production). The production of dark blue diffusible pigment was evaluated on several bacterial culture media and directly on mozzarella cheese. The MLST scheme provided precise genotyping at the strain level, and the population analyses of the concatenated sequences allowed major taxa to be defined. This approach was revealed to be suitable for tracking the strains according to their origin, such as dairy plants or food matrices. The genetic analysis revealed the presence of a connection between the blue pigment production and a specific phylogenetic cluster. The development of the online database specific to the P. fluorescens group (http://pubmlst.org/pfluorescens) will facilitate the application of the scheme and the sharing of the data. Copyright © 2013 Elsevier Ltd. All rights reserved.
Reprint of 'Tracking the blue: a MLST approach to characterise the Pseudomonas fluorescens group'.
Andreani, N A; Martino, M E; Fasolato, L; Carraro, L; Montemurro, F; Mioni, R; Bordin, P; Cardazzo, B
2015-02-01
The Pseudomonas fluorescens group comprises several closely related species that are involved in food contamination and spoilage. Specifically, the interest in P. fluorescens as a spoiler of dairy products increased after the cases of "blue mozzarella" that occurred in Italy in 2010. A Multilocus Sequence Typing (MLST) scheme was developed and applied to characterise 136 isolates (reference strains and food borne isolates) at strain level, to reveal the genetic relationships among them and to disclose any possible genetic clustering of phenotypic markers involved in food spoilage (protease, lipase, lecithinase activities and pigmented or fluorescent molecule production). The production of dark blue diffusible pigment was evaluated on several bacterial culture media and directly on mozzarella cheese. The MLST scheme provided precise genotyping at the strain level, and the population analyses of the concatenated sequences allowed major taxa to be defined. This approach was revealed to be suitable for tracking the strains according to their origin, such as dairy plants or food matrices. The genetic analysis revealed the presence of a connection between the blue pigment production and a specific phylogenetic cluster. The development of the online database specific to the P. fluorescens group (http://pubmlst.org/pfluorescens) will facilitate the application of the scheme and the sharing of the data. Copyright © 2014. Published by Elsevier Ltd.
Evidence for presumable feline origin of sporadic G6P[9] rotaviruses in humans.
Pietsch, Corinna; Liebert, Uwe G
2018-05-31
Species A rotaviruses are highly diverse and impose a substantial burden to human and animal health. Interspecies transmission between livestock, domestic animals and humans is commonly observed, but spread of animal-like rotaviruses within the human population is limited. During the continued monitoring of rotavirus strains in Germany, an unusual G6P[9] rotavirus strain was detected in feces of a child. The complete rotavirus coding sequences revealed a unique G6-P[9]-I2-R2-C2-M2-A3-N2-T3-E2-H3 genotype constellation. The virus was phylogenetically related to feline G3P[9] strains and other human G6P[9] rotaviruses of presumable zoonotic origin. Analysis of primer binding sites of G6 specific genotyping revealed further evidence of a G6P[9] feline reservoir. Moreover, substantial deficits of conventional semi-nested PCR genotyping approaches in detecting contemporary G6P[9] were revealed. Rotavirus strain GER29-14 most likely resulted from a direct or recent interspecies transmission from a cat to human. Further studies could assess nucleic acid sequences and genotype constellations of feline rotavirus to confirm the likely feline origin of sporadic human G6P[9] strains. Copyright © 2018 Elsevier B.V. All rights reserved.
Cohn, Neil
2013-01-01
Like the sequence of words in written language, comic book page layouts direct images into a deliberate reading sequence. Conventional wisdom would expect that comic panels follow the order of text: left-to-right and down - a "Z-path" - though several layouts can violate this order, such as Gestalt groupings of panels that deny a Z-path of reading. To examine how layouts pressure readers to choose pathways deviating from the Z-path, we presented participants with comic pages empty of content, and asked them to number the panels in the order they would read them. Participants frequently used strategies departing from both the traditional Z-path and Gestalt groupings. These preferences reveal a system of constraints that organizes panels into hierarchic constituents, guiding readers through comic page layouts.
Accommodation of end-state comfort reveals subphonemic planning in speech
Gick, Bryan
2015-01-01
Applying Rosenbaum’s “end-state comfort” hypothesis (Rosenbaum et al., 1992, 1996) to tongue motion provides evidence of long-distance subphonemic planning in speech. Speakers’ tongue postures may anticipate upcoming speech up to three segments, two syllables, and a morpheme or word boundary later. We used m-mode ultrasound imaging to measure the direction of tongue tip/blade movements for known variants of flap/tap allophones of North American English /t/ and /d/. Results show that speakers produce different flap variants early in words or word sequences so as to facilitate the kinematic needs of flap/tap or other /r/ variants that appear later in the word or word sequence. Similar results were also observed across word boundaries, indicating that this is not a lexical effect. PMID:25790787
Yedavalli, Venkat R. K.; Chappey, Colombe; Matala, Erik; Ahmad, Nafees
1998-01-01
The human immunodeficiency virus type 1 (HIV-1) vif gene is conserved among most lentiviruses, suggesting that vif is important for natural infection. To determine whether an intact vif gene is positively selected during mother-to-infant transmission, we analyzed vif sequences from five infected mother-infant pairs following perinatal transmission. The coding potential of the vif open reading frame directly derived from uncultured peripheral blood mononuclear cell DNA was maintained in most of the 78,912 bp sequenced. We found that 123 of the 137 clones analyzed showed an 89.8% frequency of intact vif open reading frames. There was a low degree of heterogeneity of vif genes within mothers, within infants, and between epidemiologically linked mother-infant pairs. The distances between vif sequences were greater in epidemiologically unlinked individuals than in epidemiologically linked mother-infant pairs. Furthermore, the epidemiologically linked mother-infant pair vif sequences displayed similar patterns that were not seen in vif sequences from epidemiologically unlinked individuals. The functional domains, including the two cysteines at positions 114 and 133, a serine phosphorylation site at position 144, and the C-terminal basic amino acids essential for vif protein function, were highly conserved in most of the sequences. Phylogenetic analyses of 137 mother-infant pair vif sequences and 187 other available vif sequences from HIV-1 databases revealed distinct clusters for vif sequences from each mother-infant pair and for other vif sequences. Taken together, these findings suggest that vif plays an important role in HIV-1 infection and replication in mothers and their perinatally infected infants. PMID:9445004
NASA Astrophysics Data System (ADS)
Feng, K. F.; Huang, H. H.
2017-12-01
The Chiayi area is located at the deformation front of active fold-and-thrust belt of Taiwan, where the fault system is composed primarily of a series of north-south-trending east-dipping thrusts and also an east-west-trending strike-slip fault (Meishan Fault, MSF) with right-lateral faulting. On 24th May 2017, a ML 5.1 earthquake occurred at Zhongpu, Chiayi (namely Zhongpu earthquake), however, shows a left-lateral strike-slip faulting distinct from the known structure in the area. The distribution of the reported aftershocks is difficult to distinguish the actual fault plane. To determine the fault plane of this abnormal earthquake and investigate its structural relationships to the regional tectonics, we relocate the earthquake sequence and estimate the rupture directivity of the mainshock by using the 3-D double difference hypocenter relocation method (Lin, 2013) and the 3-D directivity moment tensor inversion method (DMT, Huang et al., 2017, submitted). The DMT results show that the rupture directivity of the Zhongpu earthquake is west- and down-ward along the east-west fault plane, which also agrees with east-west-distributed aftershocks after relocation. As a result, the Zhongpu earthquake reveals an undiscovered east-west-trending structure which is sub-parallel with the MSF but with opposite faulting direction, exhibiting a complex transpressional tectonic regime in the Chiayi area.
Unconscious and out of control: subliminal priming is insensitive to observer expectations.
Cressman, Erin K; Lam, Melanie Y; Franks, Ian M; Enns, James T; Chua, Romeo
2013-09-01
We asked whether the influence of an invisible prime on movement is dependent on conscious movement expectations. Participants reached to a central target, which triggered a directional prime-mask arrow sequence. Participants were instructed that the visible arrows (masks) would most often signal a movement modification in a specific (biased) direction. Kinematic analyses revealed that responses to the visible mask were influenced by participants' intentional bias, as movements were fastest when the more probable mask was displayed. In addition, responses were influenced by the invisible prime without regard to its relationship to the more probable mask. Analysis of the time of initial trajectory modifications revealed that both primes influenced responses in a similar manner after accounting for participants' bias. These results imply that invisible stimuli automatically activate their associated responses and that unconscious priming of the motor system is insensitive to the conscious expectations of the participant making the pointing movements. Copyright © 2013 Elsevier Inc. All rights reserved.
Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A
2018-01-01
Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).
Wang, Yan; Liu, Guo-Hua; Li, Jia-Yuan; Xu, Min-Jun; Ye, Yong-Gang; Zhou, Dong-Hui; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan
2013-02-01
This study examined sequence variation in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 5 (nad5) and cytochrome b (cytb), among Trichuris ovis isolates from different hosts in Guangdong Province, China. A portion of the cox1 (pcox1), nad5 (pnad5) and cytb (pcytb) genes was amplified separately from individual whipworms by PCR, and was subjected to sequencing from both directions. The size of the sequences of pcox1, pnad5 and pcytb was 618, 240 and 464 bp, respectively. Although the intra-specific sequence variations within T. ovis were 0-0.8% for pcox1, 0-0.8% for pnad5 and 0-1.9% for pcytb, the inter-specific sequence differences among members of the genus Trichuris were significantly higher, being 24.3-26.5% for pcox1, 33.7-56.4% for pnad5 and 24.8-26.1% for pcytb, respectively. Phylogenetic analyses using combined sequences of pcox1, pnad5 and pcytb, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), indicated that all of the T. ovis isolates grouped together with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA sequences among T. ovis isolates from different hosts, and have implications for studying molecular epidemiology and population genetics of T. ovis.
Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity.
Müller, Romy; Roberts, Charlotte A; Brown, Terence A
2014-04-22
The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second-nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth-nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis.
Functional and mechanistic diversity of distal transcription enhancers
Bulger, Michael; Groudine, Mark
2013-01-01
Biological differences among metazoans, and between cell types in a given organism, arise in large part due to differences in gene expression patterns. The sequencing of multiple metazoan genomes, coupled with recent advances in genome-wide analysis of histone modifications and transcription factor binding, has revealed that among regulatory DNA sequences, gene-distal enhancers appear to exhibit the greatest diversity and cell-type specificity. Moreover, such elements are emerging as important targets for mutations that can give rise to disease and to genetic variability that underlies evolutionary change. Studies of long-range interactions between distal genomic sequences in the nucleus indicate that enhancers are often important determinants of nuclear organization, contributing to a general model for enhancer function that involves direct enhancer-promoter contact. In a number of systems, however, mechanisms for enhancer function are emerging that do not fit solely within such a model, suggesting that enhancers as a class of DNA regulatory element may be functionally and mechanistically diverse. PMID:21295696
1,003 reference genomes of bacterial and archaeal isolates expand coverage of the tree of life
Mukherjee, Supratim; Seshadri, Rekha; Varghese, Neha J.; ...
2017-06-12
We present 1,003 reference genomes that were sequenced as part of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) initiative, selected to maximize sequence coverage of phylogenetic space. These genomes double the number of existing type strains and expand their overall phylogenetic diversity by 25%. Comparative analyses with previously available finished and draft genomes reveal a 10.5% increase in novel protein families as a function of phylogenetic diversity. The GEBA genomes recruit 25 million previously unassigned metagenomic proteins from 4,650 samples, improving their phylogenetic and functional interpretation. We identify numerous biosynthetic clusters and experimentally validate a divergent phenazine cluster withmore » potential new chemical structure and antimicrobial activity. This Resource is the largest single release of reference genomes to date. Bacterial and archaeal isolate sequence space is still far from saturated, and future endeavors in this direction will continue to be a valuable resource for scientific discovery.« less
Nirasawa, Satoru; Nakahara, Kazuhiko; Takahashi, Saori
2018-02-27
Paenidase is the first microorganism-derived D-aspartyl endopeptidase that specifically recognizes an internal D-Asp residue to cleave [D-Asp]-X peptide bonds. Using peptide sequences obtained from the protein, we performed PCR with degenerate primers to amplify the paenidase I-encoding gene. Nucleotide sequencing revealed that mature paenidase I consists of 322 amino acid residues and that the protein is encoded as a pro-protein with a 197-amino-acid N-terminal extension compared to the mature protein. Paenidase I exhibits amino acid sequence similarity to several penicillin-binding proteins. In addition, paenidase I was classified into peptidase family S12 based on a MEROPS database search. Family S12 contains serine-type D-Ala-D-Ala carboxypeptidases that have three active site residues (Ser, Lys, and Tyr) in the conserved motifs Ser-Xaa-Thr-Lys and Tyr-Xaa-Asn. These motifs were conserved in the primary structure of paenidase I, and the role of these residues was confirmed by site-directed mutagenesis.
Precise detection of chromosomal translocation or inversion breakpoints by whole-genome sequencing.
Suzuki, Toshifumi; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Saitsu, Hirotomo; Takeda, Satoru; Matsumoto, Naomichi
2014-12-01
Structural variations (SVs), including translocations, inversions, deletions and duplications, are potentially associated with Mendelian diseases and contiguous gene syndromes. Determination of SV-related breakpoints at the nucleotide level is important to reveal the genetic causes for diseases. Whole-genome sequencing (WGS) by next-generation sequencers is expected to determine structural abnormalities more directly and efficiently than conventional methods. In this study, 14 SVs (9 balanced translocations, 1 inversion and 4 microdeletions) in 9 patients were analyzed by WGS with a shallow (5 × ) to moderate read coverage (20 × ). Among 28 breakpoints (as each SV has two breakpoints), 19 SV breakpoints had been determined previously at the nucleotide level by any other methods and 9 were uncharacterized. BreakDancer and Integrative Genomics Viewer determined 20 breakpoints (16 translocation, 2 inversion and 2 deletion breakpoints), but did not detect 8 breakpoints (2 translocation and 6 deletion breakpoints). These data indicate the efficacy of WGS for the precise determination of translocation and inversion breakpoints.
1,003 reference genomes of bacterial and archaeal isolates expand coverage of the tree of life
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukherjee, Supratim; Seshadri, Rekha; Varghese, Neha J.
We present 1,003 reference genomes that were sequenced as part of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) initiative, selected to maximize sequence coverage of phylogenetic space. These genomes double the number of existing type strains and expand their overall phylogenetic diversity by 25%. Comparative analyses with previously available finished and draft genomes reveal a 10.5% increase in novel protein families as a function of phylogenetic diversity. The GEBA genomes recruit 25 million previously unassigned metagenomic proteins from 4,650 samples, improving their phylogenetic and functional interpretation. We identify numerous biosynthetic clusters and experimentally validate a divergent phenazine cluster withmore » potential new chemical structure and antimicrobial activity. This Resource is the largest single release of reference genomes to date. Bacterial and archaeal isolate sequence space is still far from saturated, and future endeavors in this direction will continue to be a valuable resource for scientific discovery.« less
Palæomagnetism of Hawaiian lava flows
Doell, Richard R.; Cox, Allan
1961-01-01
PALÆOMAGNETIC investigations of volcanic rocks extruded in various parts of the world during the past several million years have generally revealed a younger sequence of lava flows magnetized nearly parallel to the field of a theoretical geocentric axial dipole, underlain by a sequence of older flows with exactly the opposite direction of remanent magnetization. A 180-degree reversal of the geomagnetic field, occurring near the middle of the Pleistocene epoch, has been inferred by many workers from such results1–3. This is a preliminary report of an investigation of 755 oriented samples collected from 152 lava flows on the island of Hawaii, selected to represent as many stratigraphic horizons as possible. (Sampling details are indicated in Table 1.) This work was undertaken because Hawaii's numerous thick sequences of lava flows, previously mapped as Pliocene to Historic by Stearns and Macdonald4, and afterwards assigned ages ranging from later Tertiary to Recent, by Macdonald and Davis5, appeared to offer an ideal opportunity to examine the most recent reversal of Earth's field.
Multiclonal Invasion in Breast Tumors Identified by Topographic Single Cell Sequencing.
Casasent, Anna K; Schalck, Aislyn; Gao, Ruli; Sei, Emi; Long, Annalyssa; Pangburn, William; Casasent, Tod; Meric-Bernstam, Funda; Edgerton, Mary E; Navin, Nicholas E
2018-01-11
Ductal carcinoma in situ (DCIS) is an early-stage breast cancer that infrequently progresses to invasive ductal carcinoma (IDC). Genomic evolution has been difficult to delineate during invasion due to intratumor heterogeneity and the low number of tumor cells in the ducts. To overcome these challenges, we developed Topographic Single Cell Sequencing (TSCS) to measure genomic copy number profiles of single tumor cells while preserving their spatial context in tissue sections. We applied TSCS to 1,293 single cells from 10 synchronous patients with both DCIS and IDC regions in addition to exome sequencing. Our data reveal a direct genomic lineage between in situ and invasive tumor subpopulations and further show that most mutations and copy number aberrations evolved within the ducts prior to invasion. These results support a multiclonal invasion model, in which one or more clones escape the ducts and migrate into the adjacent tissues to establish the invasive carcinomas. Copyright © 2017 Elsevier Inc. All rights reserved.
The spotted gar genome illuminates vertebrate evolution and facilitates human-to-teleost comparisons
Braasch, Ingo; Gehrke, Andrew R.; Smith, Jeramiah J.; Kawasaki, Kazuhiko; Manousaki, Tereza; Pasquier, Jeremy; Amores, Angel; Desvignes, Thomas; Batzel, Peter; Catchen, Julian; Berlin, Aaron M.; Campbell, Michael S.; Barrell, Daniel; Martin, Kyle J.; Mulley, John F.; Ravi, Vydianathan; Lee, Alison P.; Nakamura, Tetsuya; Chalopin, Domitille; Fan, Shaohua; Wcisel, Dustin; Cañestro, Cristian; Sydes, Jason; Beaudry, Felix E. G.; Sun, Yi; Hertel, Jana; Beam, Michael J.; Fasold, Mario; Ishiyama, Mikio; Johnson, Jeremy; Kehr, Steffi; Lara, Marcia; Letaw, John H.; Litman, Gary W.; Litman, Ronda T.; Mikami, Masato; Ota, Tatsuya; Saha, Nil Ratan; Williams, Louise; Stadler, Peter F.; Wang, Han; Taylor, John S.; Fontenot, Quenton; Ferrara, Allyse; Searle, Stephen M. J.; Aken, Bronwen; Yandell, Mark; Schneider, Igor; Yoder, Jeffrey A.; Volff, Jean-Nicolas; Meyer, Axel; Amemiya, Chris T.; Venkatesh, Byrappa; Holland, Peter W. H.; Guiguen, Yann; Bobe, Julien; Shubin, Neil H.; Di Palma, Federica; Alföldi, Jessica; Lindblad-Toh, Kerstin; Postlethwait, John H.
2016-01-01
To connect human biology to fish biomedical models, we sequenced the genome of spotted gar (Lepisosteus oculatus), whose lineage diverged from teleosts before the teleost genome duplication (TGD). The slowly evolving gar genome conserved in content and size many entire chromosomes from bony vertebrate ancestors. Gar bridges teleosts to tetrapods by illuminating the evolution of immunity, mineralization, and development (e.g., Hox, ParaHox, and miRNA genes). Numerous conserved non-coding elements (CNEs, often cis-regulatory) undetectable in direct human-teleost comparisons become apparent using gar: functional studies uncovered conserved roles of such cryptic CNEs, facilitating annotation of sequences identified in human genome-wide association studies. Transcriptomic analyses revealed that the sum of expression domains and levels from duplicated teleost genes often approximate patterns and levels of gar genes, consistent with subfunctionalization. The gar genome provides a resource for understanding evolution after genome duplication, the origin of vertebrate genomes, and the function of human regulatory sequences. PMID:26950095
Murata, M; Uchida, T; Yang, Y; Lezhava, A; Kinashi, H
2011-04-01
We have comprehensively analyzed the linear chromosomes of Streptomyces griseus mutants constructed and kept in our laboratory. During this study, macrorestriction analysis of AseI and DraI fragments of mutant 402-2 suggested a large chromosomal inversion. The junctions of chromosomal inversion were cloned and sequenced and compared with the corresponding target sequences in the parent strain 2247. Consequently, a transposon-involved mechanism was revealed. Namely, a transposon originally located at the left target site was replicatively transposed to the right target site in an inverted direction, which generated a second copy and at the same time caused a 2.5-Mb chromosomal inversion. The involved transposon named TnSGR was grouped into a new subfamily of the resolvase-encoding Tn3 family transposons based on its gene organization. At the end, terminal diversity of S. griseus chromosomes is discussed by comparing the sequences of strains 2247 and IFO13350.
Physiology and Genetics of Biogenic Methane-Production from Acetate
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sowers, Kevin R
Biomass conversion catalyzed by methanogenic consortia is a widely available, renewable resource for both energy production and waste treatment. The efficiency of this process is directly dependent upon the interaction of three metabolically distinct groups of microorganisms; the fermentative and acetogenic Bacteria and the methanogenic Archaea. One of the rate limiting steps in the degradation of soluble organic matter is the dismutation of acetate, a predominant intermediate in the process, which accounts for 70 % or more of the methane produced by the methanogens. Acetate utilization is controlled by regulation of expression of carbon monoxide dehydrogensase (COdh), which catalyzes themore » dismutation of acetate. However, physiological and molecular factors that control differential substrate utilization have not been identified in these Archaea. Our laboratory has identified sequence elements near the promoter of the gene (cdh) encoding for COdh and we have confirmed that these sequences have a role in the in vivo expression of cdh. The current proposal focuses on identifying the regulatory components that interact with DNA and RNA elements, and identifying the mechanisms used to control cdh expression. We will determine whether expression is controlled at the level of transcription or if it is mediated by coordinate interaction of transcription initiation with other processes such as transcription elongation rate and differential mRNA stability. Utilizing recently sequenced methanosarcinal genomes and a DNA microarray currently under development genes that encode regulatory proteins and transcription factors will be identified and function confirmed by gene disruption and subsequent screening on different substrates. Functional interactions will be determined in vivo by assaying the effects of gene dosage and site-directed mutagenesis of the regulatory gene on the expression of a cdh::lacZ operon fusion. Results of this study will reveal whether this critical catabolic pathway is controlled by mechanisms similar to those employed by the Bacteria and Eukarya, or by a regulatory paradigm that is unique to the Archaea. The mechanism(s) revealed by this investigation will provide insight into the regulatory strategies employed by the aceticlastic methanogenic Archaea to efficiently direct carbon and electron flow in anaerobic consortia during fermentative processes.« less
Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto
2008-04-08
The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.
Harr, Jennifer C; Luperchio, Teresa Romeo; Wong, Xianrong; Cohen, Erez; Wheelan, Sarah J; Reddy, Karen L
2015-01-05
Nuclear organization has been implicated in regulating gene activity. Recently, large developmentally regulated regions of the genome dynamically associated with the nuclear lamina have been identified. However, little is known about how these lamina-associated domains (LADs) are directed to the nuclear lamina. We use our tagged chromosomal insertion site system to identify small sequences from borders of fibroblast-specific variable LADs that are sufficient to target these ectopic sites to the nuclear periphery. We identify YY1 (Ying-Yang1) binding sites as enriched in relocating sequences. Knockdown of YY1 or lamin A/C, but not lamin A, led to a loss of lamina association. In addition, targeted recruitment of YY1 proteins facilitated ectopic LAD formation dependent on histone H3 lysine 27 trimethylation and histone H3 lysine di- and trimethylation. Our results also reveal that endogenous loci appear to be dependent on lamin A/C, YY1, H3K27me3, and H3K9me2/3 for maintenance of lamina-proximal positioning. © 2015 Harr et al.
A draft annotation and overview of the human genome
Wright, Fred A; Lemon, William J; Zhao, Wei D; Sears, Russell; Zhuo, Degen; Wang, Jian-Ping; Yang, Hee-Yung; Baer, Troy; Stredney, Don; Spitzner, Joe; Stutz, Al; Krahe, Ralf; Yuan, Bo
2001-01-01
Background The recent draft assembly of the human genome provides a unified basis for describing genomic structure and function. The draft is sufficiently accurate to provide useful annotation, enabling direct observations of previously inferred biological phenomena. Results We report here a functionally annotated human gene index placed directly on the genome. The index is based on the integration of public transcript, protein, and mapping information, supplemented with computational prediction. We describe numerous global features of the genome and examine the relationship of various genetic maps with the assembly. In addition, initial sequence analysis reveals highly ordered chromosomal landscapes associated with paralogous gene clusters and distinct functional compartments. Finally, these annotation data were synthesized to produce observations of gene density and number that accord well with historical estimates. Such a global approach had previously been described only for chromosomes 21 and 22, which together account for 2.2% of the genome. Conclusions We estimate that the genome contains 65,000-75,000 transcriptional units, with exon sequences comprising 4%. The creation of a comprehensive gene index requires the synthesis of all available computational and experimental evidence. PMID:11516338
Host Cell Virus Entry Mediated by Australian Bat Lyssavirus Envelope G glycoprotein
2013-10-24
39 Figure 7. Comparison of the amino acid sequences of Saccolaimus and Pteropus ABLV G mature protein... sequence analysis revealed that the PCR products were identical. Sequence comparisons of the ABLV N and other lyssavirus N proteins showed that ABLV...Saccolaimus flaviventris) (129). Nucleoprotein sequence comparisons revealed that the Saccolaimus N protein shared 96% amino acid homology with the Pteropus
Chen, X B; Velicer, L F
1991-01-01
Marek's disease is an oncogenic disease of chickens caused by a herpesvirus, Marek's disease virus (MDV). Serial in vitro passage of pathogenic MDV results in amplification of a 132-bp direct repeat in the MDV genome's TRL and IRL repeat regions and loss of tumorigenicity. This led to the hypothesis that upon such expansion, one or more tumor-inducing genes fail to be expressed. In this report a group of cDNAs mapping in the expanded regions were isolated from a pathogenic MDV strain in which the 132-bp direct repeat number was found to range between one and seven. Partial cDNA sequencing and S1 nuclease protection analysis revealed that the corresponding transcripts are either initiated or terminated within or near the expanded regions at multiple sites in both rightward and leftward directions. Furthermore, each 132-bp repeat contains one TATA box and two polyadenylation consensus sequences in each direction. These RNAs contain a partial copy or one or more full copies of the 132-bp direct repeat at either their 5' or 3' end. Northern (RNA) blot analysis showed that the majority of transcripts are 1.8 kb in size, while the minor species range in size from 0.67 to 3.1 kb. Together, these data raise the possibility that the 132-bp direct repeat, and indirectly its copy number, may be involved in the regulation of transcriptional initiation and termination and therefore in the generation of four groups of transcripts from the TRL and IRL, although this remains to be demonstrated. Images PMID:1850022
Fukuzawa, M; Williams, J G
2000-06-01
The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.
NASA Astrophysics Data System (ADS)
Lu, Y. M.; Zeng, J. F.; Huang, J. C.; Kuan, S. Y.; Nieh, T. G.; Wang, W. H.; Pan, M. X.; Liu, C. T.; Yang, Y.
2017-03-01
It has been decade-long and enduring efforts to decipher the structural mechanism of plasticity in metallic glasses; however, it still remains a challenge to directly reveal the structural change, if any, that precedes; and dominant plastics flow in them. Here, by using the dynamic atomic force microscope as an "imaging" as well as a "forcing" tool, we unfold a real-time sequence of structural evolution occurring on the surface of an Au-Si thin film metallic glass. In sharp contrast to the common notion that plasticity comes along with mechanical softening in bulk metallic glasses, our experimental results directly reveal three types of nano-sized surface regions, which undergo plasticity but exhibit different characters of structural evolution following the local plasticity events, including stochastic structural rearrangement, unusual local relaxation and rejuvenation. As such, yielding on the metallic-glass surface manifests as a dynamic equilibrium between local relaxation and rejuvenation as opposed to shear instability in bulk metallic-glasses. Our finding demonstrates that plasticity on the metallic glass surface of Au-Si metallic glass bears much resemblance to that of the colloidal gels, of which nonlinear rheology rather than shear instability governs the constitutive behavior of plasticity.
Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat
2013-07-01
Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.
Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.
2016-01-01
Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004
Not all order memory is equal: Test demands reveal dissociations in memory for sequence information.
Jonker, Tanya R; MacLeod, Colin M
2017-02-01
Remembering the order of a sequence of events is a fundamental feature of episodic memory. Indeed, a number of formal models represent temporal context as part of the memory system, and memory for order has been researched extensively. Yet, the nature of the code(s) underlying sequence memory is still relatively unknown. Across 4 experiments that manipulated encoding task, we found evidence for 3 dissociable facets of order memory. Experiment 1 introduced a test requiring a judgment of which of 2 alternatives had immediately followed a word during encoding. This measure revealed better retention of interitem associations following relational encoding (silent reading) than relatively item-specific encoding (judging referent size), a pattern consistent with that observed in previous research using order reconstruction tests. In sharp contrast, Experiment 2 demonstrated the reverse pattern: Memory for the studied order of 2 sequentially presented items was actually better following item-specific encoding than following relational encoding. Experiment 3 reproduced this dissociation in a single experiment using both tests. Experiment 4 extended these findings by further dissociating the roles of relational encoding and item strength in the 2 tests. Taken together, these results indicate that memory for event sequence is influenced by (a) interitem associations, (b) the emphasized directionality of an association, and (c) an item's strength independent of other items. Memory for order is more complicated than has been portrayed in theories of memory and its nuances should be carefully considered when designing tests and models of temporal and relational memory. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Molecular Genetics Reveal That Silvatic Rhodnius prolixus Do Colonise Rural Houses
Fitzpatrick, Sinead; Feliciangeli, Maria Dora; Sanchez-Martin, Maria J.; Monteiro, Fernando A.; Miles, Michael A.
2008-01-01
Background Rhodnius prolixus is the main vector of Chagas disease in Venezuela. Here, domestic infestations of poor quality rural housing have persisted despite four decades of vector control. This is in contrast to the Southern Cone region of South America, where the main vector, Triatoma infestans, has been eliminated over large areas. The repeated colonisation of houses by silvatic populations of R. prolixus potentially explains the control difficulties. However, controversy surrounds the existence of silvatic R. prolixus: it has been suggested that all silvatic populations are in fact Rhodnius robustus, a related species of minor epidemiological importance. Here we investigate, by direct sequencing (mtcytb, D2) and by microsatellite analysis, 1) the identity of silvatic Rhodnius and 2) whether silvatic populations of Rhodnius are isolated from domestic populations. Methods and Findings Direct sequencing confirmed the presence of R. prolixus in palms and that silvatic bugs can colonise houses, with house and palm specimens sharing seven cytb haplotypes. Additionally, mitochondrial introgression was detected between R. robustus and R. prolixus, indicating a previous hybridisation event. The use of ten polymorphic microsatellite loci revealed a lack of genetic structure between silvatic and domestic ecotopes (non-significant FST values), which is indicative of unrestricted gene flow. Conclusions Our analyses demonstrate that silvatic R. prolixus presents an unquestionable threat to the control of Chagas disease in Venezuela. The design of improved control strategies is essential for successful long term control and could include modified spraying and surveillance practices, together with housing improvements. PMID:18382605
Molecular genetics reveal that silvatic Rhodnius prolixus do colonise rural houses.
Fitzpatrick, Sinead; Feliciangeli, Maria Dora; Sanchez-Martin, Maria J; Monteiro, Fernando A; Miles, Michael A
2008-04-02
Rhodnius prolixus is the main vector of Chagas disease in Venezuela. Here, domestic infestations of poor quality rural housing have persisted despite four decades of vector control. This is in contrast to the Southern Cone region of South America, where the main vector, Triatoma infestans, has been eliminated over large areas. The repeated colonisation of houses by silvatic populations of R. prolixus potentially explains the control difficulties. However, controversy surrounds the existence of silvatic R. prolixus: it has been suggested that all silvatic populations are in fact Rhodnius robustus, a related species of minor epidemiological importance. Here we investigate, by direct sequencing (mtcytb, D2) and by microsatellite analysis, 1) the identity of silvatic Rhodnius and 2) whether silvatic populations of Rhodnius are isolated from domestic populations. Direct sequencing confirmed the presence of R. prolixus in palms and that silvatic bugs can colonise houses, with house and palm specimens sharing seven cytb haplotypes. Additionally, mitochondrial introgression was detected between R. robustus and R. prolixus, indicating a previous hybridisation event. The use of ten polymorphic microsatellite loci revealed a lack of genetic structure between silvatic and domestic ecotopes (non-significant F(ST) values), which is indicative of unrestricted gene flow. Our analyses demonstrate that silvatic R. prolixus presents an unquestionable threat to the control of Chagas disease in Venezuela. The design of improved control strategies is essential for successful long term control and could include modified spraying and surveillance practices, together with housing improvements.
2013-01-01
Background The microsporidian Enterocytozoon hepatopenaei was first described from Thailand in 2009 in farmed, indigenous giant tiger shrimp Penaeus (Penaeus) monodon. The natural reservoir for the parasite is still unknown. More recently, a microsporidian closely resembling it in morphology and tissue preference was found in Thai-farmed, exotic, whiteleg shrimp Penaeus (Litopenaeus) vannamei exhibiting white feces syndrome (WFS). Our objective was to compare the newly found pathogen with E. hepatopenaei and to determine its causal relationship with WFS. Results Generic primers used to amplify a fragment of the small subunit ribosomal RNA (ssu rRNA) gene for cloning and sequencing revealed that the new parasite from WFS ponds had 99% sequence identity to that of E. hepatopenaei, suggesting it was conspecific. Normal histological analysis using tissue sections stained with hematoxylin and eosin (H&E) revealed that relatively few tubule epithelial cells exhibited spores, suggesting that the infections were light. However, the H&E results were deceptive since nested PCR and in situ hybridization analysis based on the cloned ssu rRNA gene fragment revealed very heavy infections in tubule epithelial cells in the central region of the hepatopancreas in the absence of spores. Despite these results, high prevalence of E. hepatopenaei in shrimp from ponds not exhibiting WFS and a pond that had recovered from WFS indicated no direct causal association between these infections and WFS. This was supported by laboratory oral challenge trials that revealed direct horizontal transmission to uninfected shrimp but no signs of WFS. Conclusions The microsporidian newly found in P. vannamei is conspecific with previously described E. hepatopenaei and it is not causally associated with WFS. However, the deceptive severity of infections (much greater than previously reported in P. monodon) would undoubtedly have a negative effect on whiteleg shrimp growth and production efficiency and this could be exacerbated by the possibility of horizontal transmission revealed by laboratory challenge tests. Thus, it is recommended that the PCR and in situ hybridization methods developed herein be used to identify the natural reservoir species so they can be eliminated from the shrimp rearing system. PMID:23856195
Hehle, Verena K.; Paul, Matthew J.; Roberts, Victoria A.; van Dolleweerd, Craig J.; Ma, Julian K.-C.
2016-01-01
This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformed Nicotiana tabacum. Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy’s 13 antibody heavy and light chain mutant combinations were expressed transiently in N. tabacum and demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.—Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217
Ha, Nguyen Thanh; Chau, Hoang Minh; Cung, Le Xuan; Thanh, Ton Kim; Fujiki, Keiko; Murakami, Akira; Hiratsuka, Yoshimune; Hasegawa, Nobuko; Kanai, Atsushi
2003-08-01
To report the clinical and genetic findings of Vietnamese families affected with macular corneal dystrophy (MCD) in 2 generations. Two families, including 7 patients and 3 unaffected members, were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals were used as controls. Genomic DNA was extracted from leukocytes. Analysis of the carbohydrate sulfotransferase (CHST6) gene was performed using polymerase chain reaction and direct sequencing. The typical form of MCD was recognized in family B, in which sequencing of CHST6 gene revealed an nt 1067-1068ins(GGCCGTG) mutation (frameshift after 125V) homozygously in MCD patients and heterozygously in the unaffected members. Family N also showed clinical features of MCD, moderate in the mother but severe in the affected son. Sequencing revealed a single heterozygous Arg211Gln in the mother, compound heterozygous Arg211Gln+ Gln82Stop in the affected son, and heterozygous Arg211Gln mutation in the unaffected members. The identified mutations in these pedigrees were excluded from normal controls. The novel frameshift and compound heterozygous mutations might be responsible for MCD in the families studied. The phenotypic variation between affected parents and offspring was unclear. In family N, severe MCD phenotype seen in the affected son may be due the fact that he had an early stop codon mutation (Gln82Stop).
O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert
2014-01-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323
Bäumer, Sebastian; Lentes, Sabine; Gottschalk, Gerhard; Deppenmeier, Uwe
2002-03-01
Analysis of genome sequence data from the methanogenic archaeon Methanosarcina mazei Gö1 revealed the existence of two open reading frames encoding proton-translocating pyrophosphatases (PPases). These open reading frames are linked by a 750-bp intergenic region containing TC-rich stretches and are transcribed in opposite directions. The corresponding polypeptides are referred to as Mvp1 and Mvp2 and consist of 671 and 676 amino acids, respectively. Both enzymes represent extremely hydrophobic, integral membrane proteins with 15 predicted transmembrane segments and an overall amino acid sequence similarity of 50.1%. Multiple sequence alignments revealed that Mvp1 is closely related to eukaryotic PPases, whereas Mvp2 shows highest homologies to bacterial PPases. Northern blot experiments with RNA from methanol-grown cells harvested in the mid-log growth phase indicated that only Mvp2 was produced under these conditions. Analysis of washed membranes showed that Mvp2 had a specific activity of 0.34 U mg (protein)(-1). Proton translocation experiments with inverted membrane vesicles prepared from methanol-grown cells showed that hydrolysis of 1 mol of pyrophosphate was coupled to the translocation of about 1 mol of protons across the cytoplasmic membrane. Appropriate conditions for mvp1 expression could not be determined yet. The pyrophosphatases of M. mazei Gö1 represent the first examples of this enzyme class in methanogenic archaea and may be part of their energy-conserving system.
Kapusinszky, Beatrix; Szomor, Katalin N; Farkas, Agnes; Takács, Mária; Berencsi, György
2010-04-01
Human enteroviruses are associated with various clinical syndromes from minor febrile illness to severe, potentially fatal conditions like aseptic meningitis, paralysis, myocarditis, and neonatal enteroviral sepsis. Between June 2000 and August 2008 echovirus (E) type 2, 4, 6, 7, 9, 11, 13, 25, 30, coxsackievirus (CV) -A16, -A19, -B5, and enterovirus 71 (EV71) were reported in Hungary. In this study, 29 previously enterovirus positive samples from 28 patients diagnosed with hand, foot and mouth disease, meningitis and encephalitis, were molecularly typed. The genetic relationships of identified serotypes CV-A16, EV71, and E30 were assessed by direct sequencing of genomic region encoding the capsid protein VP1. The sequences were compared to each other and sequences from other geographical regions possessed in Genbank. The phylogenetic analysis of CV-A16 revealed that the viruses were mostly of Far-Eastern or Asia-Pacific origin. Typing of EV71 showed that one virus from 2000 belonged to genotype C1 and five viruses observed in 2004 and 2005 were identified as genotype C4. The 11 echovirus 30 strains showed homology with those of neighbor European countries. The molecular examination of E30 revealed that three separate lineages circulated in 2000, 2001, and 2004-2006 in Hungary.
Meadows, J R S; Kijas, J W
2009-02-01
The male-specific region of the ovine Y chromosome (MSY) remains poorly characterized, yet sequence variants from this region have the potential to reveal the wild progenitor of domestic sheep or examples of domestic and wild paternal introgression. The 5' promoter region of the sex-determining gene SRY was re-sequenced using a subset of wild sheep including bighorn (Ovis canadensis), thinhorn (Ovis dalli spp.), urial (Ovis vignei), argali (Ovis ammon), mouflon (Ovis musimon) and domestic sheep (Ovis aries). Seven novel SNPs (oY2-oY8) were revealed; these were polymorphic between but not within species. Re-sequencing and fragment analysis was applied to the MSY microsatellite SRYM18. It contains a complex compound repeat structure and sequencing of three novel size fragments revealed that a pentanucleotide element remained fixed, whilst a dinucleotide element displayed variability within species. Comparison of the sequence between species revealed that urial and argali sheep grouped more closely to the mouflon and domestic breeds than the pachyceriforms (bighorn and thinhorn). SNP and microsatellite data were combined to define six previously undetected haplotypes. Analysis revealed the mouflon as the only species to share a haplotype with domestic sheep, consistent with its status as a feral domesticate that has undergone male-mediated exchange with domestic animals. A comparison of the remaining wild species and domestic sheep revealed that O. aries is free from signatures of wild sheep introgression.
Haskett, Timothy L; Terpolilli, Jason J; Ramachandran, Vinoy K; Verdonk, Callum J; Poole, Phillip S; O'Hara, Graham W; Ramsay, Joshua P
2018-03-01
Tripartite integrative and conjugative elements (ICE3) are a novel form of ICE that exist as three separate DNA regions integrated within the genomes of Mesorhizobium spp. Prior to conjugative transfer the three ICE3 regions of M. ciceri WSM1271 ICEMcSym1271 combine and excise to form a single circular element. This assembly requires three coordinated recombination events involving three site-specific recombinases IntS, IntG and IntM. Here, we demonstrate that three excisionases-or recombination directionality factors-RdfS, RdfG and RdfM are required for ICE3 excision. Transcriptome sequencing revealed that expression of ICE3 transfer and conjugation genes was induced by quorum sensing. Quorum sensing activated expression of rdfS, and in turn RdfS stimulated transcription of both rdfG and rdfM. Therefore, RdfS acts as a "master controller" of ICE3 assembly and excision. The dependence of all three excisive reactions on RdfS ensures that ICE3 excision occurs via a stepwise sequence of recombination events that avoids splitting the chromosome into a non-viable configuration. These discoveries expose a surprisingly simple control system guiding molecular assembly of these novel and complex mobile genetic elements and highlight the diverse and critical functions of excisionase proteins in control of horizontal gene transfer.
Yarimizu, Tohru; Nakamura, Mikiko; Hoshida, Hisashi; Akada, Rinji
2015-02-14
Targeting of cellular proteins to the extracellular environment is directed by a secretory signal sequence located at the N-terminus of a secretory protein. These signal sequences usually contain an N-terminal basic amino acid followed by a stretch containing hydrophobic residues, although no consensus signal sequence has been identified. In this study, simple modeling of signal sequences was attempted using Gaussia princeps secretory luciferase (GLuc) in the yeast Kluyveromyces marxianus, which allowed comprehensive recombinant gene construction to substitute synthetic signal sequences. Mutational analysis of the GLuc signal sequence revealed that the GLuc hydrophobic peptide length was lower limit for effective secretion and that the N-terminal basic residue was indispensable. Deletion of the 16th Glu caused enhanced levels of secreted protein, suggesting that this hydrophilic residue defined the boundary of a hydrophobic peptide stretch. Consequently, we redesigned this domain as a repeat of a single hydrophobic amino acid between the N-terminal Lys and C-terminal Glu. Stretches consisting of Phe, Leu, Ile, or Met were effective for secretion but the number of residues affected secretory activity. A stretch containing sixteen consecutive methionine residues (M16) showed the highest activity; the M16 sequence was therefore utilized for the secretory production of human leukemia inhibitory factor protein in yeast, resulting in enhanced secreted protein yield. We present a new concept for the provision of secretory signal sequence ability in the yeast K. marxianus, determined by the number of residues of a single hydrophobic residue located between N-terminal basic and C-terminal acidic amino acid boundaries.
A generic assay for whole-genome amplification and deep sequencing of enterovirus A71
Tan, Le Van; Tuyen, Nguyen Thi Kim; Thanh, Tran Tan; Ngan, Tran Thuy; Van, Hoang Minh Tu; Sabanathan, Saraswathy; Van, Tran Thi My; Thanh, Le Thi My; Nguyet, Lam Anh; Geoghegan, Jemma L.; Ong, Kien Chai; Perera, David; Hang, Vu Thi Ty; Ny, Nguyen Thi Han; Anh, Nguyen To; Ha, Do Quang; Qui, Phan Tu; Viet, Do Chau; Tuan, Ha Manh; Wong, Kum Thong; Holmes, Edward C.; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H. Rogier
2015-01-01
Enterovirus A71 (EV-A71) has emerged as the most important cause of large outbreaks of severe and sometimes fatal hand, foot and mouth disease (HFMD) across the Asia-Pacific region. EV-A71 outbreaks have been associated with (sub)genogroup switches, sometimes accompanied by recombination events. Understanding EV-A71 population dynamics is therefore essential for understanding this emerging infection, and may provide pivotal information for vaccine development. Despite the public health burden of EV-A71, relatively few EV-A71 complete-genome sequences are available for analysis and from limited geographical localities. The availability of an efficient procedure for whole-genome sequencing would stimulate effort to generate more viral sequence data. Herein, we report for the first time the development of a next-generation sequencing based protocol for whole-genome sequencing of EV-A71 directly from clinical specimens. We were able to sequence viruses of subgenogroup C4 and B5, while RNA from culture materials of diverse EV-A71 subgenogroups belonging to both genogroup B and C was successfully amplified. The nature of intra-host genetic diversity was explored in 22 clinical samples, revealing 107 positions carrying minor variants (ranging from 0 to 15 variants per sample). Our analysis of EV-A71 strains sampled in 2013 showed that they all belonged to subgenogroup B5, representing the first report of this subgenogroup in Vietnam. In conclusion, we have successfully developed a high-throughput next-generation sequencing-based assay for whole-genome sequencing of EV-A71 from clinical samples. PMID:25704598
Elouej, Sahar; Beleza-Meireles, Ana; Caswell, Richard; Colclough, Kevin; Ellard, Sian; Desvignes, Jean Pierre; Béroud, Christophe; Lévy, Nicolas; Mohammed, Shehla; De Sandre-Giovannoli, Annachiara
2017-06-01
Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome (MDPL) is an autosomal dominant systemic disorder characterized by prominent loss of subcutaneous fat, a characteristic facial appearance and metabolic abnormalities. This syndrome is caused by heterozygous de novo mutations in the POLD1 gene. To date, 19 patients with MDPL have been reported in the literature and among them 14 patients have been characterized at the molecular level. Twelve unrelated patients carried a recurrent in-frame deletion of a single codon (p.Ser605del) and two other patients carried a novel heterozygous mutation in exon 13 (p.Arg507Cys). Additionally and interestingly, germline mutations of the same gene have been involved in familial polyposis and colorectal cancer (CRC) predisposition. We describe a male and a female patient with MDPL respectively affected with mild and severe phenotypes. Both of them showed mandibular hypoplasia, a beaked nose with bird-like facies, prominent eyes, a small mouth, growth retardation, muscle and skin atrophy, but the female patient showed such a severe and early phenotype that a first working diagnosis of Hutchinson-Gilford Progeria was made. The exploration was performed by direct sequencing of POLD1 gene exon 15 in the male patient with a classical MDPL phenotype and by whole exome sequencing in the female patient and her unaffected parents. Exome sequencing identified in the latter patient a de novo heterozygous undescribed mutation in the POLD1 gene (NM_002691.3: c.3209T>A), predicted to cause the missense change p.Ile1070Asn in the ZnF2 (Zinc Finger 2) domain of the protein. This mutation was not reported in the 1000 Genome Project, dbSNP and Exome sequencing databases. Furthermore, the Isoleucine1070 residue of POLD1 is highly conserved among various species, suggesting that this substitution may cause a major impairment of POLD1 activity. For the second patient, affected with a typical MDPL phenotype, direct sequencing of POLD1 exon 15 revealed the recurrent in-frame deletion (c.1812_1814del, p.S605del). Our work highlights that mutations in different POLD1 domains can lead to phenotypic variability, ranging from dominantly inherited cancer predisposition syndromes, to mild MDPL phenotypes without lifespan reduction, to very severe MDPL syndromes with major premature aging features. These results also suggest that POLD1 gene testing should be considered in patients presenting with severe progeroid features. Copyright © 2017 Elsevier Inc. All rights reserved.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-08-31
Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements.
Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin
2013-10-10
Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae. Molecular dating analyses suggest that Ranunculaceae and Berberidaceae diverged between 90 and 84 mya, which is congruent with the fossil records and with recent estimates of the divergence time of these two taxa. © 2013.
Streptococcus mutans clonal variation revealed by multilocus sequence typing.
Nakano, Kazuhiko; Lapirattanakul, Jinthana; Nomura, Ryota; Nemoto, Hirotoshi; Alaluusua, Satu; Grönroos, Lisa; Vaara, Martti; Hamada, Shigeyuki; Ooshima, Takashi; Nakagawa, Ichiro
2007-08-01
Streptococcus mutans is the major pathogen of dental caries, a biofilm-dependent infectious disease, and occasionally causes infective endocarditis. S. mutans strains have been classified into four serotypes (c, e, f, and k). However, little is known about the S. mutans population, including the clonal relationships among strains of S. mutans, in relation to the particular clones that cause systemic diseases. To address this issue, we have developed a multilocus sequence typing (MLST) scheme for S. mutans. Eight housekeeping gene fragments were sequenced from each of 102 S. mutans isolates collected from the four serotypes in Japan and Finland. Between 14 and 23 alleles per locus were identified, allowing us theoretically to distinguish more than 1.2 x 10(10) sequence types. We identified 92 sequence types in these 102 isolates, indicating that S. mutans contains a diverse population. Whereas serotype c strains were widely distributed in the dendrogram, serotype e, f, and k strains were differentiated into clonal complexes. Therefore, we conclude that the ancestral strain of S. mutans was serotype c. No geographic specificity was identified. However, the distribution of the collagen-binding protein gene (cnm) and direct evidence of mother-to-child transmission were clearly evident. In conclusion, the superior discriminatory capacity of this MLST scheme for S. mutans may have important practical implications.
Paugh, Steven W.; Coss, David R.; Bao, Ju; ...
2016-02-04
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
NASA Astrophysics Data System (ADS)
Streets, Aaron M.; Cao, Chen; Zhang, Xiannian; Huang, Yanyi
2016-03-01
Phenotype classification of single cells reveals biological variation that is masked in ensemble measurement. This heterogeneity is found in gene and protein expression as well as in cell morphology. Many techniques are available to probe phenotypic heterogeneity at the single cell level, for example quantitative imaging and single-cell RNA sequencing, but it is difficult to perform multiple assays on the same single cell. In order to directly track correlation between morphology and gene expression at the single cell level, we developed a microfluidic platform for quantitative coherent Raman imaging and immediate RNA sequencing (RNA-Seq) of single cells. With this device we actively sort and trap cells for analysis with stimulated Raman scattering microscopy (SRS). The cells are then processed in parallel pipelines for lysis, and preparation of cDNA for high-throughput transcriptome sequencing. SRS microscopy offers three-dimensional imaging with chemical specificity for quantitative analysis of protein and lipid distribution in single cells. Meanwhile, the microfluidic platform facilitates single-cell manipulation, minimizes contamination, and furthermore, provides improved RNA-Seq detection sensitivity and measurement precision, which is necessary for differentiating biological variability from technical noise. By combining coherent Raman microscopy with RNA sequencing, we can better understand the relationship between cellular morphology and gene expression at the single-cell level.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paugh, Steven W.; Coss, David R.; Bao, Ju
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
Barrera, Maritza; Garrido-Haro, Ana; Vaca, María S.; Granda, Danilo; Acosta-Batallas, Alfredo
2017-01-01
In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV), clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador. PMID:29379796
Leung, Preston; Eltahla, Auda A; Lloyd, Andrew R; Bull, Rowena A; Luciani, Fabio
2017-07-15
With the advent of affordable deep sequencing technologies, detection of low frequency variants within genetically diverse viral populations can now be achieved with unprecedented depth and efficiency. The high-resolution data provided by next generation sequencing technologies is currently recognised as the gold standard in estimation of viral diversity. In the analysis of rapidly mutating viruses, longitudinal deep sequencing datasets from viral genomes during individual infection episodes, as well as at the epidemiological level during outbreaks, now allow for more sophisticated analyses such as statistical estimates of the impact of complex mutation patterns on the evolution of the viral populations both within and between hosts. These analyses are revealing more accurate descriptions of the evolutionary dynamics that underpin the rapid adaptation of these viruses to the host response, and to drug therapies. This review assesses recent developments in methods and provide informative research examples using deep sequencing data generated from rapidly mutating viruses infecting humans, particularly hepatitis C virus (HCV), human immunodeficiency virus (HIV), Ebola virus and influenza virus, to understand the evolution of viral genomes and to explore the relationship between viral mutations and the host adaptive immune response. Finally, we discuss limitations in current technologies, and future directions that take advantage of publically available large deep sequencing datasets. Copyright © 2016 Elsevier B.V. All rights reserved.
Castro-Prieto, Aines; Wachter, Bettina; Melzheimer, Joerg; Thalwitzer, Susanne; Sommer, Simone
2011-01-01
The genes of the major histocompatibility complex (MHC) are a key component of the mammalian immune system and have become important molecular markers for fitness-related genetic variation in wildlife populations. Currently, no information about the MHC sequence variation and constitution in African leopards exists. In this study, we isolated and characterized genetic variation at the adaptively most important region of MHC class I and MHC class II-DRB genes in 25 free-ranging African leopards from Namibia and investigated the mechanisms that generate and maintain MHC polymorphism in the species. Using single-stranded conformation polymorphism analysis and direct sequencing, we detected 6 MHC class I and 6 MHC class II-DRB sequences, which likely correspond to at least 3 MHC class I and 3 MHC class II-DRB loci. Amino acid sequence variation in both MHC classes was higher or similar in comparison to other reported felids. We found signatures of positive selection shaping the diversity of MHC class I and MHC class II-DRB loci during the evolutionary history of the species. A comparison of MHC class I and MHC class II-DRB sequences of the leopard to those of other felids revealed a trans-species mode of evolution. In addition, the evolutionary relationships of MHC class II-DRB sequences between African and Asian leopard subspecies are discussed.
USDA-ARS?s Scientific Manuscript database
The P. ultimum DAOM BR144 (=CBS 805.95 = ATCC200006) genome (42.8 Mb) encodes 15,290 genes, and has extensive sequence similarity and synteny with related Phytophthora spp., including the potato late blight pathogen Phytophthora infestans. Whole transcriptome sequencing revealed expression of 86 % o...
Correia, J J; Chacko, B M; Lam, S S; Lin, K
2001-02-06
SMAD proteins are known to oligomerize and hetero-associate during their activation and translocation to the nucleus for transcriptional control. Analytical ultracentrifuge studies on Smad3 and Smad4 protein constructs are presented to clarify the model of homo- and hetero-oligomerization and the role of phosphorylation in the activation process. These constructs all exhibit a tendency to form disulfide cross-linked aggregates, primarily dimers, and a strong reducing agent, TCEP, was found to be required to determine the best estimates for reversible association models and equilibrium constants. A Smad4 construct, S4AF, consisting of the middle linker (L) domain and the C-terminal (C) domain, is shown to be a monomer, while a Smad3 construct, S3LC, consisting of the LC domains, is shown to form a trimer with an affinity K(3) = (1.2-3.1) x 10(9) M(-2). A Smad3 construct that mimics phosphorylation at the C-terminal target sequence, S3LC(3E), has 17--35-fold enhanced ability to form trimer over that of the wild-type construct, S3LC. S4AF associates with either S3LC or S3LC(3E) to form a hetero-trimer. In each case, the hetero-trimer is favored over the formation of the homo-trimer. Despite high sequence homology between Smad3 and Smad4, a chimeric Smad4 construct with an engineered Smad3 C-terminal pseudo-phosphorylation sequence, S4AF(3E), shows no tendency to form trimer. This suggests a Smad4-specific sequence insert inhibits homo-trimer formation, or other domains or sequences in S3LC are required in addition to the target sequence to mediate the formation of trimer. These results represent a direct molecular measure of the importance of hetero-trimerization and phosphorylation in the TGF-beta-activated Smad protein signal transduction process.
Fukumori, F; Saint, C P
1997-01-01
A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291
The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.
Zubiaga, A M; Belasco, J G; Greenberg, M E
1995-01-01
Labile mRNAs that encode cytokine and immediate-early gene products often contain AU-rich sequences within their 3' untranslated region (UTR). These AU-rich sequences appear to be key determinants of the short half-lives of these mRNAs, although the sequence features of these elements and the mechanism by which they target mRNAs for rapid decay have not been fully defined. We have examined the features of AU-rich elements (AREs) that are crucial for their function as determinants of mRNA instability in mammalian cells by testing the ability of various mutant c-fos AREs and synthetic AREs to direct rapid mRNA deadenylation and decay when inserted within the 3' UTR of the normally stable beta-globin mRNA. Evidence is presented that the pentamer AUUUA, which previously was suggested to be the minimal determinant of instability present in mammalian AREs, cannot direct rapid mRNA deadenylation and decay. Instead, the nonomer UUAUUUAUU is the elemental AU-rich sequence motif that destabilizes mRNA. Removal of one uridine residue from either end of the nonamer (UUAUUUAU or UAUUUAUU) results in a decrease of potency of the element, while removal of a uridine residue from both ends of the nonamer (UAUUUAU) eliminates detectable destabilizing activity. The inclusion of an additional uridine residue at both ends of the nonamer (UUUAUUUAUUU) does not further increase the efficacy of the element. Taken together, these findings suggest that the nonamer UUAUUUAUU is the minimal AU-rich motif that effectively destabilizes mRNA. Additional ARE potency is achieved by combining multiple copies of this nonamer in a single mRNA 3' UTR. Furthermore, analysis of poly(A) shortening rates for ARE-containing mRNAs reveals that the UUAUUUAUU sequence also accelerates mRNA deadenylation and suggests that the UUAUUUAUU motif targets mRNA for rapid deadenylation as an early step in the mRNA decay process. PMID:7891716
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baraibar, Martin A.; Muhoberac, Barry B.; Garringer, Holly J.
Mutations in the coding sequence of the ferritin light chain (FTL) gene cause a neurodegenerative disease known as neuroferritinopathy or hereditary ferritinopathy, which is characterized by the presence of intracellular inclusion bodies containing the mutant FTL polypeptide and by abnormal accumulation of iron in the brain. Here, we describe the x-ray crystallographic structure and report functional studies of ferritin homopolymers formed from the mutant FTL polypeptide p.Phe167SerfsX26, which has a C terminus that is altered in amino acid sequence and length. The structure was determined and refined to 2.85 {angstrom} resolution and was very similar to the wild type betweenmore » residues Ile-5 and Arg-154. However, instead of the E-helices normally present in wild type ferritin, the C-terminal sequences of all 24 mutant subunits showed substantial amounts of disorder, leading to multiple C-terminal polypeptide conformations and a large disruption of the normally tiny 4-fold axis pores. Functional studies underscored the importance of the mutant C-terminal sequence in iron-induced precipitation and revealed iron mishandling by soluble mutant FTL homopolymers in that only wild type incorporated iron when in direct competition in solution with mutant ferritin. Even without competition, the amount of iron incorporation over the first few minutes differed severalfold. Our data suggest that disruption at the 4-fold pores may lead to direct iron mishandling through attenuated iron incorporation by the soluble form of mutant ferritin and that the disordered C-terminal polypeptides may play a major role in iron-induced precipitation and formation of ferritin inclusion bodies in hereditary ferritinopathy.« less
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
Menkis, A; Lynikienė, J; Marčiulynas, A; Gedminas, A; Povilaitienė, A
2017-08-01
We studied the occurrence, morphology and phenology of Dendroctonus micans in Lithuania and the fungi associated with the beetle at different developmental stages. The occurrence of D. micans was assessed in 19 seed orchards (at least 40 years old) of Picea abies (L. Karst.) situated in different parts of the country. Bark beetle phenology was studied in two sites: a seed orchard of P. abies and a plantation of Picea pungens (Engelm.). D. micans morphology was assessed under the dissection microscope using individuals at different developmental stages that were sampled during phenology observations. Communities of fungi associated with D. micans were studied using both fungal culturing methods and direct high-throughput sequencing from D. micans. Results showed that the incidence D. micans was relatively rare and D. micans was mainly detected in central and eastern Lithuania. The life cycle included the following stages: adult, egg, I-V developmental stage larvae and pupa. However, development of D. micans was quicker and its nests larger under the bark of P. pungens than of P. abies, indicating the effect of the host species. Fungal culturing and direct high-throughput sequencing revealed that D. micans associated fungi communities were species rich and dominated by yeasts from a class Saccharomycetes. In total, 319 fungal taxa were sequenced, among which Peterozyma toletana (37.5% of all fungal sequences), Yamadazyma scolyti (30.0%) and Kuraishia capsulate (17.7%) were the most common. Plant pathogens and blue stain fungi were also detected suggesting their potentially negative effects to both tree health and timber quality.
Listen up! Processing of intensity change differs for vocal and nonvocal sounds.
Schirmer, Annett; Simpson, Elizabeth; Escoffier, Nicolas
2007-10-24
Changes in the intensity of both vocal and nonvocal sounds can be emotionally relevant. However, as only vocal sounds directly reflect communicative intent, intensity change of vocal but not nonvocal sounds is socially relevant. Here we investigated whether a change in sound intensity is processed differently depending on its social relevance. To this end, participants listened passively to a sequence of vocal or nonvocal sounds that contained rare deviants which differed from standards in sound intensity. Concurrently recorded event-related potentials (ERPs) revealed a mismatch negativity (MMN) and P300 effect for intensity change. Direction of intensity change was of little importance for vocal stimulus sequences, which recruited enhanced sensory and attentional resources for both loud and soft deviants. In contrast, intensity change in nonvocal sequences recruited more sensory and attentional resources for loud as compared to soft deviants. This was reflected in markedly larger MMN/P300 amplitudes and shorter P300 latencies for the loud as compared to soft nonvocal deviants. Furthermore, while the processing pattern observed for nonvocal sounds was largely comparable between men and women, sex differences for vocal sounds suggest that women were more sensitive to their social relevance. These findings extend previous evidence of sex differences in vocal processing and add to reports of voice specific processing mechanisms by demonstrating that simple acoustic change recruits more processing resources if it is socially relevant.
Molecular detection of Toxoplasma gondii in snakes.
Nasiri, Vahid; Teymurzadeh, Shohreh; Karimi, Gholamreza; Nasiri, Mehdi
2016-10-01
Toxoplasma gondii, an obligate intracellular protozoan parasite, is responsible for one of the most common zoonotic parasitic diseases in almost all warm-blooded vertebrates worldwide, and it is estimated that about one-third of the world human population is chronically infected with this parasite. Little is known about the circulation of T. gondii in snakes and this study for the first time aimed to evaluate the infection rates of snakes by this parasite by PCR methods. The brain of 68 Snakes, that were collected between May 2012 and September 2015 and died after the hold in captivity, under which they were kept for taking poisons, were examined for the presence of this parasite. DNA was extracted and Nested-PCR method was carried out with two of pairs of primers to detect the 344 bp fragment of T. gondii GRA6 gene. Five positive nested-PCR products were directly sequenced in the forward and reverse directions by Sequetech Company (Mountain View, CA). T. gondii GRA6 gene were detected from 55 (80.88%) of 68 snakes brains. Sequencing of the GRA6 gene revealed 98-100% of similarity with T. gondii sequences deposited in GenBank. To our knowledge, this is the first study of molecular detection of T. gondii in snakes and our findings show a higher frequency of this organism among them. Copyright © 2016 Elsevier Inc. All rights reserved.
Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb
2017-08-01
Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.
Gonzalez, Patrice; Labarère, Jacques
1998-01-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259
Gonzalez, P; Labarère, J
1998-11-01
A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.
Korber, B T; Kunstman, K J; Patterson, B K; Furtado, M; McEvilly, M M; Levy, R; Wolinsky, S M
1994-01-01
Human immunodeficiency virus type 1 (HIV-1) sequences were generated from blood and from brain tissue obtained by stereotactic biopsy from six patients undergoing a diagnostic neurosurgical procedure. Proviral DNA was directly amplified by nested PCR, and 8 to 36 clones from each sample were sequenced. Phylogenetic analysis of intrapatient envelope V3-V5 region HIV-1 DNA sequence sets revealed that brain viral sequences were clustered relative to the blood viral sequences, suggestive of tissue-specific compartmentalization of the virus in four of the six cases. In the other two cases, the blood and brain virus sequences were intermingled in the phylogenetic analyses, suggesting trafficking of virus between the two tissues. Slide-based PCR-driven in situ hybridization of two of the patients' brain biopsy samples confirmed our interpretation of the intrapatient phylogenetic analyses. Interpatient V3 region brain-derived sequence distances were significantly less than blood-derived sequence distances. Relative to the tip of the loop, the set of brain-derived viral sequences had a tendency towards negative or neutral charge compared with the set of blood-derived viral sequences. Entropy calculations were used as a measure of the variability at each position in alignments of blood and brain viral sequences. A relatively conserved set of positions were found, with a significantly lower entropy in the brain-than in the blood-derived viral sequences. These sites constitute a brain "signature pattern," or a noncontiguous set of amino acids in the V3 region conserved in viral sequences derived from brain tissue. This brain-derived signature pattern was also well preserved among isolates previously characterized in vitro as macrophage tropic. Macrophage-monocyte tropism may be the biological constraint that results in the conservation of the viral brain signature pattern. Images PMID:7933130
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P
2001-09-01
To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.
Liang, Winnie S.; Fonseca, Rafael; Bryce, Alan H.; McCullough, Ann E.; Barrett, Michael T.; Hunt, Katherine; Patel, Maitray D.; Young, Scott W.; Collins, Joseph M.; Silva, Alvin C.; Condjella, Rachel M.; Block, Matthew; McWilliams, Robert R.; Lazaridis, Konstantinos N.; Klee, Eric W.; Bible, Keith C.; Harris, Pamela; Oliver, Gavin R.; Bhavsar, Jaysheel D.; Nair, Asha A.; Middha, Sumit; Asmann, Yan; Kocher, Jean-Pierre; Schahl, Kimberly; Kipp, Benjamin R.; Barr Fritcher, Emily G.; Baker, Angela; Aldrich, Jessica; Kurdoglu, Ahmet; Izatt, Tyler; Christoforides, Alexis; Cherni, Irene; Nasser, Sara; Reiman, Rebecca; Phillips, Lori; McDonald, Jackie; Adkins, Jonathan; Mastrian, Stephen D.; Placek, Pamela; Watanabe, Aprill T.; LoBello, Janine; Han, Haiyong; Von Hoff, Daniel; Craig, David W.; Stewart, A. Keith; Carpten, John D.
2014-01-01
Advanced cholangiocarcinoma continues to harbor a difficult prognosis and therapeutic options have been limited. During the course of a clinical trial of whole genomic sequencing seeking druggable targets, we examined six patients with advanced cholangiocarcinoma. Integrated genome-wide and whole transcriptome sequence analyses were performed on tumors from six patients with advanced, sporadic intrahepatic cholangiocarcinoma (SIC) to identify potential therapeutically actionable events. Among the somatic events captured in our analysis, we uncovered two novel therapeutically relevant genomic contexts that when acted upon, resulted in preliminary evidence of anti-tumor activity. Genome-wide structural analysis of sequence data revealed recurrent translocation events involving the FGFR2 locus in three of six assessed patients. These observations and supporting evidence triggered the use of FGFR inhibitors in these patients. In one example, preliminary anti-tumor activity of pazopanib (in vitro FGFR2 IC50≈350 nM) was noted in a patient with an FGFR2-TACC3 fusion. After progression on pazopanib, the same patient also had stable disease on ponatinib, a pan-FGFR inhibitor (in vitro, FGFR2 IC50≈8 nM). In an independent non-FGFR2 translocation patient, exome and transcriptome analysis revealed an allele specific somatic nonsense mutation (E384X) in ERRFI1, a direct negative regulator of EGFR activation. Rapid and robust disease regression was noted in this ERRFI1 inactivated tumor when treated with erlotinib, an EGFR kinase inhibitor. FGFR2 fusions and ERRFI mutations may represent novel targets in sporadic intrahepatic cholangiocarcinoma and trials should be characterized in larger cohorts of patients with these aberrations. PMID:24550739
Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy
2016-09-12
CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.
Young, Lydia M.; Tu, Ling-Hsien; Raleigh, Daniel P.; Ashcroft, Alison E.
2017-01-01
Although amyloid assembly in vitro is commonly investigated using single protein sequences, fibril formation in vivo can be more heterogeneous, involving co-assembly of proteins of different length, sequence and/or post-translational modifications. Emerging evidence suggests that co-polymerization can alter the rate and/or mechanism of aggregation and can contribute to pathogenicity. Electrospray ionization-ion mobility spectrometry-mass spectrometry (ESI-IMS-MS) is uniquely suited to the study of these heterogeneous ensembles. Here, ESI-IMS-MS combined with analysis of fibrillation rates using thioflavin T (ThT) fluorescence, is used to track the course of aggregation of variants of islet-amyloid polypeptide (IAPP) in isolation and in pairwise mixtures. We identify a sub-population of extended monomers as the key precursors of amyloid assembly, and reveal that the fastest aggregating sequence in peptide mixtures determines the lag time of fibrillation, despite being unable to cross-seed polymerization. The results demonstrate that co-polymerization of IAPP sequences radically alters the rate of amyloid assembly by altering the conformational properties of the mixed oligomers that form. PMID:28970890
High diversity of picornaviruses in rats from different continents revealed by deep sequencing.
Hansen, Thomas Arn; Mollerup, Sarah; Nguyen, Nam-Phuong; White, Nicole E; Coghlan, Megan; Alquezar-Planas, David E; Joshi, Tejal; Jensen, Randi Holm; Fridholm, Helena; Kjartansdóttir, Kristín Rós; Mourier, Tobias; Warnow, Tandy; Belsham, Graham J; Bunce, Michael; Willerslev, Eske; Nielsen, Lars Peter; Vinner, Lasse; Hansen, Anders Johannes
2016-08-17
Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norvegicus (R. norvegicus) is a known reservoir for important zoonotic pathogens. Transmission may be direct via contact with the animal, for example, through exposure to its faecal matter, or indirectly mediated by arthropod vectors. Here we investigated the viral content in rat faecal matter (n=29) collected from two continents by analyzing 2.2 billion next-generation sequencing reads derived from both DNA and RNA. Among other virus families, we found sequences from members of the Picornaviridae to be abundant in the microbiome of all the samples. Here we describe the diversity of the picornavirus-like contigs including near-full-length genomes closely related to the Boone cardiovirus and Theiler's encephalomyelitis virus. From this study, we conclude that picornaviruses within R. norvegicus are more diverse than previously recognized. The virome of R. norvegicus should be investigated further to assess the full potential for zoonotic virus transmission.
Schel, Anne Marijke; Tranquilli, Sandra; Zuberbühler, Klaus
2009-05-01
Vervet monkey alarm calling has long been the paradigmatic example of how primates use vocalizations in response to predators. In vervets, there is a close and direct relationship between the production of distinct alarm vocalizations and the presence of distinct predator types. Recent fieldwork has however revealed the use of several additional alarm calling systems in primates. Here, the authors describe playback studies on the alarm call system of two colobine species, the King colobus (Colobus polykomos) of Taï Forest, Ivory Coast, and the Guereza colobus (C. guereza) of Budongo Forest, Uganda. Both species produce two basic alarm call types, snorts and acoustically variable roaring phrases, when confronted with leopards or crowned eagles. Neither call type is given exclusively to one predator, but the authors found strong regularities in call sequencing. Leopards typically elicited sequences consisting of a snort followed by few phrases, while eagles typically elicited sequences with no snorts and many phrases. The authors discuss how these call sequences have the potential to encode information at different levels, such as predator type, response-urgency, or the caller's imminent behavior. (PsycINFO Database Record (c) 2009 APA, all rights reserved).
Genetic characterisation of Taenia multiceps cysts from ruminants in Greece.
Al-Riyami, Shumoos; Ioannidou, Evi; Koehler, Anson V; Hussain, Muhammad H; Al-Rawahi, Abdulmajeed H; Giadinis, Nektarios D; Lafi, Shawkat Q; Papadopoulos, Elias; Jabbar, Abdul
2016-03-01
This study was designed to genetically characterise the larval stage (coenurus) of Taenia multiceps from ruminants in Greece, utilising DNA regions within the cytochrome c oxidase subunit 1 (partial cox1) and NADH dehydrogenase 1 (pnad1) mitochondrial (mt) genes, respectively. A molecular-phylogenetic approach was used to analyse the pcox1 and pnad1 amplicons derived from genomic DNA samples from individual cysts (n=105) from cattle (n=3), goats (n=5) and sheep (n=97). Results revealed five and six distinct electrophoretic profiles for pcox1 and pnad1, respectively, using single-strand conformation polymorphism. Direct sequencing of selected amplicons representing each of these profiles defined five haplotypes each for pcox1 and pnad1, among all 105 isolates. Phylogenetic analysis of individual sequence data for each locus, including a range of well-defined reference sequences, inferred that all isolates of T. multiceps cysts from ruminants in Greece clustered with previously published sequences from different continents. The present study provides a foundation for future large-scale studies on the epidemiology of T. multiceps in ruminants as well as dogs in Greece. Copyright © 2015 Elsevier B.V. All rights reserved.
Predicting DNA binding proteins using support vector machine with hybrid fractal features.
Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo
2014-02-21
DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.
Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter
2017-01-01
The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230
Navigating Comics: An Empirical and Theoretical Approach to Strategies of Reading Comic Page Layouts
Cohn, Neil
2013-01-01
Like the sequence of words in written language, comic book page layouts direct images into a deliberate reading sequence. Conventional wisdom would expect that comic panels follow the order of text: left-to-right and down – a “Z-path” – though several layouts can violate this order, such as Gestalt groupings of panels that deny a Z-path of reading. To examine how layouts pressure readers to choose pathways deviating from the Z-path, we presented participants with comic pages empty of content, and asked them to number the panels in the order they would read them. Participants frequently used strategies departing from both the traditional Z-path and Gestalt groupings. These preferences reveal a system of constraints that organizes panels into hierarchic constituents, guiding readers through comic page layouts. PMID:23616776
Deng, Jiajia; Toh, Chee-Seng
2013-06-17
A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.
Integrated segmentation and recognition of connected Ottoman script
NASA Astrophysics Data System (ADS)
Yalniz, Ismet Zeki; Altingovde, Ismail Sengor; Güdükbay, Uğur; Ulusoy, Özgür
2009-11-01
We propose a novel context-sensitive segmentation and recognition method for connected letters in Ottoman script. This method first extracts a set of segments from a connected script and determines the candidate letters to which extracted segments are most similar. Next, a function is defined for scoring each different syntactically correct sequence of these candidate letters. To find the candidate letter sequence that maximizes the score function, a directed acyclic graph is constructed. The letters are finally recognized by computing the longest path in this graph. Experiments using a collection of printed Ottoman documents reveal that the proposed method provides >90% precision and recall figures in terms of character recognition. In a further set of experiments, we also demonstrate that the framework can be used as a building block for an information retrieval system for digital Ottoman archives.
Valença-Barbosa, Carolina; Fernandes, Fabiano Araújo; Santos, Helena Lucia Carneiro; Sarquis, Otília; Harry, Myriam; Almeida, Carlos Eduardo; Lima, Marli Maria
2015-01-01
We used the gut contents of triatomines collected from rural areas of Ceará State, northeastern Brazil, to identify their putative hosts via vertebrate cytb gene sequencing. Successful direct sequencing was obtained for 48% of insects, comprising 50 Triatoma brasiliensis, 7 Triatoma pseudomaculata, and 1 Rhodnius nasutus. Basic local alignment search tool (BLAST) procedure revealed that domestic animals, such as chickens (Gallus gallus) and goats (Capra hircus), are the main food source, including in sylvatic environment. Native hosts were also detected in peridomestic environment such as reptiles (Tropidurus sp. and Iguana iguana) and the Galea spixii (Rodentia: Caviidae). The role of goats and Galea spixii in Chagas disease epidemiology calls for further studies, because these mammals likely link the sylvatic and domestic Trypanosoma cruzi cycles. PMID:26350453
Autosomal-dominant non-autoimmune hyperthyroidism presenting with neuromuscular symptoms.
Elgadi, Aziz; Arvidsson, C-G; Janson, Annika; Marcus, Claude; Costagliola, Sabine; Norgren, Svante
2005-08-01
Neuromuscular presentations are common in thyroid disease, although the mechanism is unclear. In the present study, we investigated the pathogenesis in a boy with autosomal-dominant hyperthyroidism presenting with neuromuscular symptoms. The TSHr gene was investigated by direct sequencing. Functional properties of the mutant TSHr were investigated during transient expression in COS-7 cells. Family members were investigated by clinical and biochemical examinations. Sequence analysis revealed a previously reported heterozygous missense mutation Glycine 431 for Serine in the first transmembrane segment, leading to an increased specific constitutive activity. Three additional affected family members carried the same mutation. There was no indication of autoimmune disorder. All symptoms disappeared upon treatment with thacapzol and L-thyroxine and subsequent subtotal thyroidectomy. The data imply that neuromuscular symptoms can be caused by excessive thyroid hormone levels rather than by autoimmunity.
Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.
Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B
1990-01-01
Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563
Priest, Henry D; Fox, Samuel E; Rowley, Erik R; Murray, Jessica R; Michael, Todd P; Mockler, Todd C
2014-01-01
Brachypodium distachyon is a close relative of many important cereal crops. Abiotic stress tolerance has a significant impact on productivity of agriculturally important food and feedstock crops. Analysis of the transcriptome of Brachypodium after chilling, high-salinity, drought, and heat stresses revealed diverse differential expression of many transcripts. Weighted Gene Co-Expression Network Analysis revealed 22 distinct gene modules with specific profiles of expression under each stress. Promoter analysis implicated short DNA sequences directly upstream of module members in the regulation of 21 of 22 modules. Functional analysis of module members revealed enrichment in functional terms for 10 of 22 network modules. Analysis of condition-specific correlations between differentially expressed gene pairs revealed extensive plasticity in the expression relationships of gene pairs. Photosynthesis, cell cycle, and cell wall expression modules were down-regulated by all abiotic stresses. Modules which were up-regulated by each abiotic stress fell into diverse and unique gene ontology GO categories. This study provides genomics resources and improves our understanding of abiotic stress responses of Brachypodium.
NASA Astrophysics Data System (ADS)
Lewis, A. R.; Levy, R. H.; Naish, T.; Gorman, A. R.; Golledge, N.; Dickinson, W. W.; Kraus, C.; Florindo, F.; Ashworth, A. C.; Pyne, A.; Kingan, T.
2015-12-01
The Early to mid-Miocene is a compelling interval to study Antarctic ice sheet (AIS) sensitivity. Circulation patterns in the southern hemisphere were broadly similar to present and reconstructed atmospheric CO2 concentrations were analogous to those projected for the next several decades. Geologic records from locations proximal to the AIS are required to examine ice sheet response to climate variability during this time. Coastal and offshore drill core records recovered by ANDRILL and IODP provide information regarding ice sheet variability along and beyond the coastal margin but they cannot constrain the extent of inland retreat. Additional environmental data from the continental interior is required to constrain the magnitude of ice sheet variability and inform numerical ice sheet models. The only well-dated terrestrial deposits that register early to mid-Miocene interior ice extent and climate are in the Friis Hills, 80 km inland. The deposits record multiple glacial-interglacial cycles and fossiliferous non-glacial beds show that interglacial climate was warm enough for a diverse biota. Drifts are preserved in a shallow valley with the oldest beds exposed along the edges where they terminate at sharp erosional margins. These margins reveal drifts in short stratigraphic sections but none is more than 13 m thick. A 34 m-thick composite stratigraphic sequence has been produced from exposed drift sequences but correlating beds in scattered exposures is problematic. Moreover, much of the sequence is buried and inaccessible in the basin center. New seismic data collected during 2014 reveal a sequence of sediments at least 50 m thick. This stratigraphic package likely preserves a detailed and more complete sedimentary sequence for the Friis Hills that can be used to refine and augment the outcrop-based composite stratigraphy. We aim to drill through this sequence using a helicopter-transportable diamond coring system. These new cores will allow us to obtain continuous measurements on unweathered material through the terrestrial sequence. Beds of tephra are exposed in outcrop and we expect to encounter these key age markers in the cored sequence. These new high quality, well-dated terrestrial data will be directly compared to marine cores to provide environmental data across a broad onshore-offshore transect.
NASA Astrophysics Data System (ADS)
Kraus, S.; Miller, H.
2003-12-01
Between 2000 and 2002 areas of up to 100,000 m2 have been mapped at several locations of the South Shetland Islands, mainly on King George and Livingston Islands. A structural analysis of the dykes and the host rocks was undertaken, and about 250 dykes were sampled for geochemical studies. On Livingston Island six different strike directions were identified, yielding a reliable relative time sequence as deduced from field-relationships. Geochemically, these dykes can be separated into five different groups, correlating with the different strike directions, one of those groups comprising two directions. Analysis of the structural data shows, that at least on Livingston Island only minor changes of the tensional situation occurred. Geochemical data reveal that all dykes of the South Shetland Islands belong to a calc-alkaline, arc-related suite, ranging from primitive basalts to highly differentiated rhyolites. Interpretation of Sr isotopic data of the dykes proves difficult, as there are indications for sea-water induced Sr-alteration. Nd isotopic analysis yield better results, revealing a three-stage development from the oldest dykes (ɛ Nd -0.2 to 0.6) on Livingston Island towards a second, younger group (ɛ Nd 2.8 to 4.2, also Livingston), terminating with a third one (ɛ Nd 5.2 to 7.6), which includes the youngest dykes on Livingston and all dykes on King George and also Penguin Island. Either two mantle sources were involved, or the amount of crustal contamination changed considerately with time. It may have been high during initial arc volcanism, because of a still unstretched crust, then decreasing continually with progressing volcanism. In any case, the pattern reflects a chronological sequence corresponding with other authors' hypothesis of a migrating arc volcanism from SW to NE, i.e. from Livingston (older dykes) towards King George Island (younger dykes). Pb isotopic data, plottet together with MORB- and sediment-samples dredged from the Drake Passage, indicate a three-component mixture of the arc magma. Mixing of MORB- and sediment-sources alone cannot explain the observed pattern. An additional source, maybe the crust underlying the South Shetland block, was involved.
Casali, Nicola; Broda, Agnieszka; Harris, Simon R.; Brown, Timothy; Drobniewski, Francis
2016-01-01
Background A large isoniazid-resistant tuberculosis outbreak centred on London, United Kingdom, has been ongoing since 1995. The aim of this study was to investigate the power and value of whole genome sequencing (WGS) to resolve the transmission network compared to current molecular strain typing approaches, including analysis of intra-host diversity within a specimen, across body sites, and over time, with identification of genetic factors underlying the epidemiological success of this cluster. Methods and Findings We sequenced 344 outbreak isolates from individual patients collected over 14 y (2 February 1998–22 June 2012). This demonstrated that 96 (27.9%) were indistinguishable, and only one differed from this major clone by more than five single nucleotide polymorphisms (SNPs). The maximum number of SNPs between any pair of isolates was nine SNPs, and the modal distance between isolates was two SNPs. WGS was able to reveal the direction of transmission of tuberculosis in 16 cases within the outbreak (4.7%), including within a multidrug-resistant cluster that carried a rare rpoB mutation associated with rifampicin resistance. Eleven longitudinal pairs of patient pulmonary isolates collected up to 48 mo apart differed from each other by between zero and four SNPs. Extrapulmonary dissemination resulted in acquisition of a SNP in two of five cases. WGS analysis of 27 individual colonies cultured from a single patient specimen revealed ten loci differed amongst them, with a maximum distance between any pair of six SNPs. A limitation of this study, as in previous studies, is that indels and SNPs in repetitive regions were not assessed due to the difficulty in reliably determining this variation. Conclusions Our study suggests that (1) certain paradigms need to be revised, such as the 12 SNP distance as the gold standard upper threshold to identify plausible transmissions; (2) WGS technology is helpful to rule out the possibility of direct transmission when isolates are separated by a substantial number of SNPs; (3) the concept of a transmission chain or network may not be useful in institutional or household settings; (4) the practice of isolating single colonies prior to sequencing is likely to lead to an overestimation of the number of SNPs between cases resulting from direct transmission; and (5) despite appreciable genomic diversity within a host, transmission of tuberculosis rarely results in minority variants becoming dominant. Thus, whilst WGS provided some increased resolution over variable number tandem repeat (VNTR)-based clustering, it was insufficient for inferring transmission in the majority of cases. PMID:27701423
Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu
2009-01-01
Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593
Demberg, Lilian M; Winkler, Jana; Wilde, Caroline; Simon, Kay-Uwe; Schön, Julia; Rothemund, Sven; Schöneberg, Torsten; Prömel, Simone; Liebscher, Ines
2017-03-17
Members of the adhesion G protein-coupled receptor (aGPCR) family carry an agonistic sequence within their large ectodomains. Peptides derived from this region, called the Stachel sequence, can activate the respective receptor. As the conserved core region of the Stachel sequence is highly similar between aGPCRs, the agonist specificity of Stachel sequence-derived peptides was tested between family members using cell culture-based second messenger assays. Stachel peptides derived from aGPCRs of subfamily VI (GPR110/ADGRF1, GPR116/ADGRF5) and subfamily VIII (GPR64/ADGRG2, GPR126/ADGRG6) are able to activate more than one member of the respective subfamily supporting their evolutionary relationship and defining them as pharmacological receptor subtypes. Extended functional analyses of the Stachel sequences and derived peptides revealed agonist promiscuity, not only within, but also between aGPCR subfamilies. For example, the Stachel -derived peptide of GPR110 (subfamily VI) can activate GPR64 and GPR126 (both subfamily VIII). Our results indicate that key residues in the Stachel sequence are very similar between aGPCRs allowing for agonist promiscuity of several Stachel -derived peptides. Therefore, aGPCRs appear to be pharmacologically more closely related than previously thought. Our findings have direct implications for many aGPCR studies, as potential functional overlap has to be considered for in vitro and in vivo studies. However, it also offers the possibility of a broader use of more potent peptides when the original Stachel sequence is less effective. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Protein sequences from mastodon and Tyrannosaurus rex revealed by mass spectrometry.
Asara, John M; Schweitzer, Mary H; Freimark, Lisa M; Phillips, Matthew; Cantley, Lewis C
2007-04-13
Fossilized bones from extinct taxa harbor the potential for obtaining protein or DNA sequences that could reveal evolutionary links to extant species. We used mass spectrometry to obtain protein sequences from bones of a 160,000- to 600,000-year-old extinct mastodon (Mammut americanum) and a 68-million-year-old dinosaur (Tyrannosaurus rex). The presence of T. rex sequences indicates that their peptide bonds were remarkably stable. Mass spectrometry can thus be used to determine unique sequences from ancient organisms from peptide fragmentation patterns, a valuable tool to study the evolution and adaptation of ancient taxa from which genomic sequences are unlikely to be obtained.
Cliques of Neurons Bound into Cavities Provide a Missing Link between Structure and Function.
Reimann, Michael W; Nolte, Max; Scolamiero, Martina; Turner, Katharine; Perin, Rodrigo; Chindemi, Giuseppe; Dłotko, Paweł; Levi, Ran; Hess, Kathryn; Markram, Henry
2017-01-01
The lack of a formal link between neural network structure and its emergent function has hampered our understanding of how the brain processes information. We have now come closer to describing such a link by taking the direction of synaptic transmission into account, constructing graphs of a network that reflect the direction of information flow, and analyzing these directed graphs using algebraic topology. Applying this approach to a local network of neurons in the neocortex revealed a remarkably intricate and previously unseen topology of synaptic connectivity. The synaptic network contains an abundance of cliques of neurons bound into cavities that guide the emergence of correlated activity. In response to stimuli, correlated activity binds synaptically connected neurons into functional cliques and cavities that evolve in a stereotypical sequence toward peak complexity. We propose that the brain processes stimuli by forming increasingly complex functional cliques and cavities.
Scherer, Florian; Kurtz, David M; Newman, Aaron M; Stehr, Henning; Craig, Alexander F M; Esfahani, Mohammad Shahrokh; Lovejoy, Alexander F; Chabon, Jacob J; Klass, Daniel M; Liu, Chih Long; Zhou, Li; Glover, Cynthia; Visser, Brendan C; Poultsides, George A; Advani, Ranjana H; Maeda, Lauren S; Gupta, Neel K; Levy, Ronald; Ohgami, Robert S; Kunder, Christian A; Diehn, Maximilian; Alizadeh, Ash A
2016-11-09
Patients with diffuse large B cell lymphoma (DLBCL) exhibit marked diversity in tumor behavior and outcomes, yet the identification of poor-risk groups remains challenging. In addition, the biology underlying these differences is incompletely understood. We hypothesized that characterization of mutational heterogeneity and genomic evolution using circulating tumor DNA (ctDNA) profiling could reveal molecular determinants of adverse outcomes. To address this hypothesis, we applied cancer personalized profiling by deep sequencing (CAPP-Seq) analysis to tumor biopsies and cell-free DNA samples from 92 lymphoma patients and 24 healthy subjects. At diagnosis, the amount of ctDNA was found to strongly correlate with clinical indices and was independently predictive of patient outcomes. We demonstrate that ctDNA genotyping can classify transcriptionally defined tumor subtypes, including DLBCL cell of origin, directly from plasma. By simultaneously tracking multiple somatic mutations in ctDNA, our approach outperformed immunoglobulin sequencing and radiographic imaging for the detection of minimal residual disease and facilitated noninvasive identification of emergent resistance mutations to targeted therapies. In addition, we identified distinct patterns of clonal evolution distinguishing indolent follicular lymphomas from those that transformed into DLBCL, allowing for potential noninvasive prediction of histological transformation. Collectively, our results demonstrate that ctDNA analysis reveals biological factors that underlie lymphoma clinical outcomes and could facilitate individualized therapy. Copyright © 2016, American Association for the Advancement of Science.
Schwefel, David; Boucherit, Virginie C; Christodoulou, Evangelos; Walker, Philip A; Stoye, Jonathan P; Bishop, Kate N; Taylor, Ian A
2015-04-08
The SAMHD1 triphosphohydrolase inhibits HIV-1 infection of myeloid and resting T cells by depleting dNTPs. To overcome SAMHD1, HIV-2 and some SIVs encode either of two lineages of the accessory protein Vpx that bind the SAMHD1 N or C terminus and redirect the host cullin-4 ubiquitin ligase to target SAMHD1 for proteasomal degradation. We present the ternary complex of Vpx from SIV that infects mandrills (SIVmnd-2) with the cullin-4 substrate receptor, DCAF1, and N-terminal and SAM domains from mandrill SAMHD1. The structure reveals details of Vpx lineage-specific targeting of SAMHD1 N-terminal "degron" sequences. Comparison with Vpx from SIV that infects sooty mangabeys (SIVsmm) complexed with SAMHD1-DCAF1 identifies molecular determinants directing Vpx lineages to N- or C-terminal SAMHD1 sequences. Inspection of the Vpx-DCAF1 interface also reveals conservation of Vpx with the evolutionally related HIV-1/SIV accessory protein Vpr. These data suggest a unified model for how Vpx and Vpr exploit DCAF1 to promote viral replication. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
High-Throughput Sequencing Reveals Principles of Adeno-Associated Virus Serotype 2 Integration
Janovitz, Tyler; Klein, Isaac A.; Oliveira, Thiago; Mukherjee, Piali; Nussenzweig, Michel C.; Sadelain, Michel
2013-01-01
Viral integrations are important in human biology, yet genome-wide integration profiles have not been determined for many viruses. Adeno-associated virus (AAV) infects most of the human population and is a prevalent gene therapy vector. AAV integrates into the human genome with preference for a single locus, termed AAVS1. However, the genome-wide integration of AAV has not been defined, and the principles underlying this recombination remain unclear. Using a novel high-throughput approach, integrant capture sequencing, nearly 12 million AAV junctions were recovered from a human cell line, providing five orders of magnitude more data than were previously available. Forty-five percent of integrations occurred near AAVS1, and several thousand novel integration hotspots were identified computationally. Most of these occurred in genes, with dozens of hotspots targeting known oncogenes. Viral replication protein binding sites (RBS) and transcriptional activity were major factors favoring integration. In a first for eukaryotic viruses, the data reveal a unique asymmetric integration profile with distinctive directional orientation of viral genomes. These studies provide a new understanding of AAV integration biology through the use of unbiased high-throughput data acquisition and bioinformatics. PMID:23720718
Damiani, Céline; Balthazard-Accou, Ketty; Clervil, Elmyre; Diallo, Aïssata; Da Costa, Cécilia; Emmanuel, Evens; Totet, Anne; Agnamey, Patrice
2013-01-01
The protozoan parasite Cryptosporidium sp. has emerged as one of the most important water contaminants, causing waterborne outbreaks of diarrhoeal diseases worldwide. In Haiti, cryptosporidiosis is a frequent cause of diarrhoea in children under the age of five years, HIV-infected individuals, and people living in low socioeconomic conditions, mainly due to the consumption of water or food polluted by Cryptosporidium oocysts. The aim of this study was to detect and identify Cryptosporidium oocysts present in 12 water samples collected in Port-au-Prince and 4 water samples collected in Cap Haïtien. Initial detection consisted of immunomagnetic separation – immunofluorescence assay (IMS-IFA), which was confirmed by nested PCR, targeting the most polymorphic region of the 18S rRNA gene in 15/16 samples. Genotyping was performed by PCR-restriction fragment length polymorphism (RFLP) analysis and DNA sequencing. Under our working conditions, neither nested PCR-RFLP nor direct DNA sequencing revealed the expected species diversity, as only Cryptosporidium parvum was identified in the water samples studied. This study highlights the difficulty of detecting mixed populations of Cryptosporidium species in environmental samples. PMID:24252814
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Kazuo; Yasunami, Michio; Matsuda, Yoichi
1996-09-01
Embryonic TEA domain-containing factor (ETF) belongs to the family of proteins structurally related to transcriptional enhancer factor-1 (TEF-1) and is implicated in neural development. Isolation and characterization of the cosmid clones encoding the mouse ETF gene (Etdf) revealed that Etdf spans approximately 17.9 kb and consists of 12 exons. The exon-intron structure of Etdf closely resembles that of the Drosophila scalloped gene, indicating that these genes may have evolved from a common ancestor. Then multiple transcription initiation sites revealed by S1 protection and primer extension analyses are consistent with the absence of the canonical TATA and CAAT boxes in themore » 5{prime}-flanking region, which contains many potential regulatory sequences, such as the E-box, N-box, Sp1 element, GATA-1 element, TAATGARAT element, and B2 short interspersed element (SINE) as well as several direct and inverted repeat sequences. The Etdf locus was assigned to the proximal region of mouse chromosome 7 using fluorescence in situ hybridization and linkage mapping analyses. These results provide the molecular basis for studying the regulation, in vivo function, and evolution of Etdf. 29 refs., 5 figs., 1 tab.« less
Suzuki, K; Yasunami, M; Matsuda, Y; Maeda, T; Kobayashi, H; Terasaki, H; Ohkubo, H
1996-09-01
Embryonic TEA domain-containing factor (ETF) belongs to the family of proteins structurally related to transcriptional enhancer factor-1 (TEF-1) and is implicated in neural development. Isolation and characterization of the cosmid clones encoding the mouse ETF gene (Etdf) revealed that Etdf spans approximately 17.9 kb and consists of 12 exons. The exon-intron structure of Etdf closely resembles that of the Drosophila scalloped gene, indicating that these genes may have evolved from a common ancestor. The multiple transcription initiation sites revealed by S1 protection and primer extension analyses are consistent with the absence of the canonical TATA and CAAT boxes in the 5'-flanking region, which contains many potential regulatory sequences, such as the E-box, N-box, Sp1 element, GATA-1 element, TAATGARAT element, and B2 short interspersed element (SINE) as well as several direct and inverted repeat sequences. The Etdf locus was assigned to the proximal region of mouse chromosome 7 using fluorescence in situ hybridization and linkage mapping analyses. These results provide the molecular basis for studying the regulation, in vivo function, and evolution of Etdf.
Duan, Naibin; Bai, Yang; Sun, Honghe; Wang, Nan; Ma, Yumin; Li, Mingjun; Wang, Xin; Jiao, Chen; Legall, Noah; Mao, Linyong; Wan, Sibao; Wang, Kun; He, Tianming; Feng, Shouqian; Zhang, Zongying; Mao, Zhiquan; Shen, Xiang; Chen, Xiaoliu; Jiang, Yuanmao; Wu, Shujing; Yin, Chengmiao; Ge, Shunfeng; Yang, Long; Jiang, Shenghui; Xu, Haifeng; Liu, Jingxuan; Wang, Deyun; Qu, Changzhi; Wang, Yicheng; Zuo, Weifang; Xiang, Li; Liu, Chang; Zhang, Daoyuan; Gao, Yuan; Xu, Yimin; Xu, Kenong; Chao, Thomas; Fazio, Gennaro; Shu, Huairui; Zhong, Gan-Yuan; Cheng, Lailiang; Fei, Zhangjun; Chen, Xuesen
2017-08-15
Human selection has reshaped crop genomes. Here we report an apple genome variation map generated through genome sequencing of 117 diverse accessions. A comprehensive model of apple speciation and domestication along the Silk Road is proposed based on evidence from diverse genomic analyses. Cultivated apples likely originate from Malus sieversii in Kazakhstan, followed by intensive introgressions from M. sylvestris. M. sieversii in Xinjiang of China turns out to be an "ancient" isolated ecotype not directly contributing to apple domestication. We have identified selective sweeps underlying quantitative trait loci/genes of important fruit quality traits including fruit texture and flavor, and provide evidences supporting a model of apple fruit size evolution comprising two major events with one occurring prior to domestication and the other during domestication. This study outlines the genetic basis of apple domestication and evolution, and provides valuable information for facilitating marker-assisted breeding and apple improvement.Apple is one of the most important fruit crops. Here, the authors perform deep genome resequencing of 117 diverse accessions and reveal comprehensive models of apple origin, speciation, domestication, and fruit size evolution as well as candidate genes associated with important agronomic traits.
Berim, Anna; Hyatt, David C.; Gang, David R.
2012-01-01
Polymethoxylated flavonoids occur in a number of plant families, including the Lamiaceae. To date, the metabolic pathways giving rise to the diversity of these compounds have not been studied. Analysis of our expressed sequence tag database for four sweet basil (Ocimum basilicum) lines afforded identification of candidate flavonoid O-methyltransferase genes. Recombinant proteins displayed distinct substrate preferences and product specificities that can account for all detected 7-/6-/4′-methylated, 8-unsubstituted flavones. Their biochemical specialization revealed only certain metabolic routes to be highly favorable and therefore likely in vivo. Flavonoid O-methyltransferases catalyzing 4′- and 6-O-methylations shared high identity (approximately 90%), indicating that subtle sequence changes led to functional differentiation. Structure homology modeling suggested the involvement of several amino acid residues in defining the proteins’ stringent regioselectivities. The roles of these individual residues were confirmed by site-directed mutagenesis, revealing two discrete mechanisms as a basis for the switch between 6- and 4′-O-methylation of two different substrates. These findings delineate major pathways in a large segment of the flavone metabolic network and provide a foundation for its further elucidation. PMID:22923679
Walterson, Alyssa M.; Smith, Derek D. N.; Stavrinides, John
2014-01-01
Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857
Deep Sequencing Reveals a Divergent Ugandan cassava brown streak virus Isolate from Malawi
Winter, Stephan; Mukasa, Settumba; Tairo, Fred; Sseruwagi, Peter; Ndunguru, Joseph; Duffy, Siobain
2017-01-01
ABSTRACT Illumina sequencing of RNA from a cassava cutting from northern Malawi produced a genome of Ugandan cassava brown streak virus (UCBSV-MW-NB7_2013). Sequence comparisons revealed stronger similarity to an isolate from nearby Tanzania (93.4% pairwise nucleotide identity) than to those previously reported from Malawi (86.9 to 87.0%). PMID:28818908
An Anatomy of a Seismic Sequence in a Deep Gold Mine
NASA Astrophysics Data System (ADS)
Gibowicz, S. J.
1997-12-01
An unusual swarm-like seismic sequence occurred in April 1993 at the Western Deep Levels gold mine, South Africa. Altogether 199 events with moment magnitude from -0.5 to 3.1 were recorded and located by the mine seismic network. The sequence lasted 12 days and was composed in fact of four main shock-aftershocks sequences, closely following each other in space and time. The events were confined to a volume of rock extending to 670 m in the N-S, 630 m in the E-W, and 390 m in the vertical directions. The first sequence lasted 179 hours and the second only 13 hours, being interrupted by the third sequence which lasted 31 hours, being in turn interrupted by the fourth sequence. The parameter p, describing the rate of occurrence of aftershocks, ranged from 0.7 to 1. The first sequence is characterized by the lowest value of the fractal correlation dimension D = 1.75 and the second by the highest value of D = 2.4, whereas the third and fourth sequences are characterized by the middle value of D = 1.9.¶The corner frequencies of P and S waves are in close proximity and range from 14 to 220 Hz. A display of source parameters as a function of time shows that the four main shocks are most distinctly marked by their source radius. For 46 events a moment tensor inversion was performed. In most cases the double-couple component is dominant, ranging from 60 to 90 percent of the solution. The double-couple solutions correspond to the same number of normal and reverse faults and oblique-slip focal mechanisms. An analysis of space distribution of P, T and B axes reveals that the distribution of B axes is the most regular.
Jaeckisch, Nina; Yang, Ines; Wohlrab, Sylke; Glöckner, Gernot; Kroymann, Juergen; Vogel, Heiko; Cembella, Allan; John, Uwe
2011-01-01
Many dinoflagellate species are notorious for the toxins they produce and ecological and human health consequences associated with harmful algal blooms (HABs). Dinoflagellates are particularly refractory to genomic analysis due to the enormous genome size, lack of knowledge about their DNA composition and structure, and peculiarities of gene regulation, such as spliced leader (SL) trans-splicing and mRNA transposition mechanisms. Alexandrium ostenfeldii is known to produce macrocyclic imine toxins, described as spirolides. We characterized the genome of A. ostenfeldii using a combination of transcriptomic data and random genomic clones for comparison with other dinoflagellates, particularly Alexandrium species. Examination of SL sequences revealed similar features as in other dinoflagellates, including Alexandrium species. SL sequences in decay indicate frequent retro-transposition of mRNA species. This probably contributes to overall genome complexity by generating additional gene copies. Sequencing of several thousand fosmid and bacterial artificial chromosome (BAC) ends yielded a wealth of simple repeats and tandemly repeated longer sequence stretches which we estimated to comprise more than half of the whole genome. Surprisingly, the repeats comprise a very limited set of 79–97 bp sequences; in part the genome is thus a relatively uniform sequence space interrupted by coding sequences. Our genomic sequence survey (GSS) represents the largest genomic data set of a dinoflagellate to date. Alexandrium ostenfeldii is a typical dinoflagellate with respect to its transcriptome and mRNA transposition but demonstrates Alexandrium-like stop codon usage. The large portion of repetitive sequences and the organization within the genome is in agreement with several other studies on dinoflagellates using different approaches. It remains to be determined whether this unusual composition is directly correlated to the exceptionally genome organization of dinoflagellates with a low amount of histones and histone-like proteins. PMID:22164224
Detection and decay rates of prey and prey symbionts in the gut of a predator through metagenomics.
Paula, Débora P; Linard, Benjamin; Andow, David A; Sujii, Edison R; Pires, Carmen S S; Vogler, Alfried P
2015-07-01
DNA methods are useful to identify ingested prey items from the gut of predators, but reliable detection is hampered by low amounts of degraded DNA. PCR-based methods can retrieve minute amounts of starting material but suffer from amplification biases and cross-reactions with the predator and related species genomes. Here, we use PCR-free direct shotgun sequencing of total DNA isolated from the gut of the harlequin ladybird Harmonia axyridis at five time points after feeding on a single pea aphid Acyrthosiphon pisum. Sequence reads were matched to three reference databases: Insecta mitogenomes of 587 species, including H. axyridis sequenced here; A. pisum nuclear genome scaffolds; and scaffolds and complete genomes of 13 potential bacterial symbionts. Immediately after feeding, multicopy mtDNA of A. pisum was detected in tens of reads, while hundreds of matches to nuclear scaffolds were detected. Aphid nuclear DNA and mtDNA decayed at similar rates (0.281 and 0.11 h(-1) respectively), and the detectability periods were 32.7 and 23.1 h. Metagenomic sequencing also revealed thousands of reads of the obligate Buchnera aphidicola and facultative Regiella insecticola aphid symbionts, which showed exponential decay rates significantly faster than aphid DNA (0.694 and 0.80 h(-1) , respectively). However, the facultative aphid symbionts Hamiltonella defensa, Arsenophonus spp. and Serratia symbiotica showed an unexpected temporary increase in population size by 1-2 orders of magnitude in the predator guts before declining. Metagenomics is a powerful tool that can reveal complex relationships and the dynamics of interactions among predators, prey and their symbionts. © 2014 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bac, M.G.; Schulein, B.J.
1990-05-01
Variability in the biomarker compositions of petroleums is typically employed in the recognition and distinction of contributions from different source rocks. We demonstrate that the fluctuations in the biomarker distributions of different intervals within a single source rock sequence appear to account for specific compositional differences in a suite of oils from the San Joaquin basin California. Rock-Eval pyrolysis studies of a 100-m-thick immature, laminated, marine shale sequence within the Upper Cretaceous lo lower Paleocene portion of the Moreno Formation reveals TOC (total organic carbon) contents consistently around 2% and moderate hydrogen indices (i.e., 175-300 mg HC/g org. C) characteristicsmore » suggestive of a uniform depositional sequence with source rock potential. Analyses of the extractable aliphatic hydrocarbons of cored samples taken at approximately 10-m intervals from the sequence reveal significant variability in biomarker distributions. Such differences are exemplified by the triterpenoids (as seen in m/z 191 chromatograms from GC-MS and GC-MS/MS analyses) where the dominant component fluctuates from a 17{alpha}(h),21{beta}(H)-30-norhopane to 28,30-l8{alpha}(H)-bisnorhopane to 20S and 20R danunar-13(17)-enes. Some components are dominant in one interval, but are not detected in others, suggesting discrete stratigraphic variations in the biomarker characteristics of the Moreno. Similar discrepancies in biomarker distributions are evident in the aliphatic hydrocarbons of the suite of oils. The three petroleums reservoired in the San Carlos sandstone member of the Lodo Formation which directly overlies the Moreno, reflect biomarker contributions from a Moreno source, including compound distributions, and the occurrence of both alkanes (e.g., 28.30-bisnorhopane) and alkenes (e.g.. danunarenes and diasterenes).« less
van den Broek, M; Bolat, I; Nijkamp, J F; Ramos, E; Luttik, M A H; Koopman, F; Geertman, J M; de Ridder, D; Pronk, J T; Daran, J-M
2015-09-01
Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. Copyright © 2015, van den Broek et al.
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
Thurber, Mary I; Ghai, Ria R; Hyeroba, David; Weny, Geoffrey; Tumukunde, Alex; Chapman, Colin A; Wiseman, Roger W; Dinis, Jorge; Steeil, James; Greiner, Ellis C; Friedrich, Thomas C; O'Connor, David H; Goldberg, Tony L
2013-07-01
Hemoparasites of the apicomplexan family Plasmodiidae include the etiological agents of malaria, as well as a suite of non-human primate parasites from which the human malaria agents evolved. Despite the significance of these parasites for global health, little information is available about their ecology in multi-host communities. Primates were investigated in Kibale National Park, Uganda, where ecological relationships among host species are well characterized. Blood samples were examined for parasites of the genera Plasmodium and Hepatocystis using microscopy and PCR targeting the parasite mitochondrial cytochrome b gene, followed by Sanger sequencing. To assess co-infection, "deep sequencing" of a variable region within cytochrome b was performed. Out of nine black-and-white colobus (Colobus guereza), one blue guenon (Cercopithecus mitis), five grey-cheeked mangabeys (Lophocebus albigena), 23 olive baboons (Papio anubis), 52 red colobus (Procolobus rufomitratus) and 12 red-tailed guenons (Cercopithecus ascanius), 79 infections (77.5%) were found, all of which were Hepatocystis spp. Sanger sequencing revealed 25 different parasite haplotypes that sorted phylogenetically into six species-specific but morphologically similar lineages. "Deep sequencing" revealed mixed-lineage co-infections in baboons and red colobus (41.7% and 64.7% of individuals, respectively) but not in other host species. One lineage infecting red colobus also infected baboons, but always as the minor variant, suggesting directional cross-species transmission. Hepatocystis parasites in this primate community are a diverse assemblage of cryptic lineages, some of which co-infect hosts and at least one of which can cross primate species barriers. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
van den Broek, M.; Bolat, I.; Nijkamp, J. F.; Ramos, E.; Luttik, M. A. H.; Koopman, F.; Geertman, J. M.; de Ridder, D.; Pronk, J. T.
2015-01-01
Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. PMID:26150454
Wright, David; Mallon, Tom; McCormick, Carl; Orton, Richard J.; McDowell, Stanley; Trewby, Hannah; Skuce, Robin A.; Kao, Rowland R.
2012-01-01
Whole genome sequencing (WGS) technology holds great promise as a tool for the forensic epidemiology of bacterial pathogens. It is likely to be particularly useful for studying the transmission dynamics of an observed epidemic involving a largely unsampled ‘reservoir’ host, as for bovine tuberculosis (bTB) in British and Irish cattle and badgers. BTB is caused by Mycobacterium bovis, a member of the M. tuberculosis complex that also includes the aetiological agent for human TB. In this study, we identified a spatio-temporally linked group of 26 cattle and 4 badgers infected with the same Variable Number Tandem Repeat (VNTR) type of M. bovis. Single-nucleotide polymorphisms (SNPs) between sequences identified differences that were consistent with bacterial lineages being persistent on or near farms for several years, despite multiple clear whole herd tests in the interim. Comparing WGS data to mathematical models showed good correlations between genetic divergence and spatial distance, but poor correspondence to the network of cattle movements or within-herd contacts. Badger isolates showed between zero and four SNP differences from the nearest cattle isolate, providing evidence for recent transmissions between the two hosts. This is the first direct genetic evidence of M. bovis persistence on farms over multiple outbreaks with a continued, ongoing interaction with local badgers. However, despite unprecedented resolution, directionality of transmission cannot be inferred at this stage. Despite the often notoriously long timescales between time of infection and time of sampling for TB, our results suggest that WGS data alone can provide insights into TB epidemiology even where detailed contact data are not available, and that more extensive sampling and analysis will allow for quantification of the extent and direction of transmission between cattle and badgers. PMID:23209404
To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples
Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.
2011-01-01
The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625
Sequence Composition and Gene Content of the Short Arm of Rye (Secale cereale) Chromosome 1
Fluch, Silvia; Kopecky, Dieter; Burg, Kornel; Šimková, Hana; Taudien, Stefan; Petzold, Andreas; Kubaláková, Marie; Platzer, Matthias; Berenyi, Maria; Krainer, Siegfried; Doležel, Jaroslav; Lelley, Tamas
2012-01-01
Background The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale) with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. Methodology/Principal Findings Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3%) being the most abundant. More than four thousand simple sequence repeat (SSR) sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. Conclusions The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye. PMID:22328922
Evaluating the accuracy of SHAPE-directed RNA secondary structure predictions
Sükösd, Zsuzsanna; Swenson, M. Shel; Kjems, Jørgen; Heitsch, Christine E.
2013-01-01
Recent advances in RNA structure determination include using data from high-throughput probing experiments to improve thermodynamic prediction accuracy. We evaluate the extent and nature of improvements in data-directed predictions for a diverse set of 16S/18S ribosomal sequences using a stochastic model of experimental SHAPE data. The average accuracy for 1000 data-directed predictions always improves over the original minimum free energy (MFE) structure. However, the amount of improvement varies with the sequence, exhibiting a correlation with MFE accuracy. Further analysis of this correlation shows that accurate MFE base pairs are typically preserved in a data-directed prediction, whereas inaccurate ones are not. Thus, the positive predictive value of common base pairs is consistently higher than the directed prediction accuracy. Finally, we confirm sequence dependencies in the directability of thermodynamic predictions and investigate the potential for greater accuracy improvements in the worst performing test sequence. PMID:23325843
Clyde, Karen; Glaunsinger, Britt A.
2011-01-01
One characteristic of lytic infection with gammaherpesviruses, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV) and murine herpesvirus 68 (MHV68), is the dramatic suppression of cellular gene expression in a process known as host shutoff. The alkaline exonuclease proteins (KSHV SOX, MHV-68 muSOX and EBV BGLF5) have been shown to induce shutoff by destabilizing cellular mRNAs. Here we extend previous analyses of cellular mRNA abundance during lytic infection to characterize the effects of SOX and muSOX, in the absence of other viral genes, utilizing deep sequencing technology (RNA-seq). Consistent with previous observations during lytic infection, the majority of transcripts are downregulated in cells expressing either SOX or muSOX, with muSOX acting as a more potent shutoff factor than SOX. Moreover, most cellular messages fall into the same expression class in both SOX- and muSOX-expressing cells, indicating that both factors target similar pools of mRNAs. More abundant mRNAs are more efficiently downregulated, suggesting a concentration effect in transcript targeting. However, even among highly expressed genes there are mRNAs that escape host shutoff. Further characterization of select escapees reveals multiple mechanisms by which cellular genes can evade downregulation. While some mRNAs are directly refractory to SOX, the steady state levels of others remain unchanged, presumably as a consequence of downstream effects on mRNA biogenesis. Collectively, these studies lay the framework for dissecting the mechanisms underlying the susceptibility of mRNA to destruction during lytic gammaherpesvirus infection. PMID:21573023
Abaci, Ayhan; Wood, Kent; Demir, Korcan; Büyükgebiz, Atilla; Böber, Ece; Kopp, Peter
2010-01-01
To study the case of a 2 10/12-year-old boy who had growth failure and delayed bone maturation. We reviewed the history, which revealed that he had had polyuria, polydipsia, lack of weight gain, and frequent vomiting since the age of 5 months. On physical examination, his height was 86 cm (-1.93 standard deviation [SD]), his weight 10.5 kg (-2.67 SD), and he had motor and mental retardation. His maternal great-grandfather also had polyuria and polydipsia (but not diabetes mellitus), suggesting X-linked nephrogenic diabetes insipidus as the underlying cause. The patient underwent a water deprivation-desmopressin test. The coding region of the AVPR2 gene was amplified by polymerase chain reaction and submitted to direct sequence analysis. The water deprivation test confirmed the diagnosis of diabetes insipidus, and administration of desmopressin did not diminish his water secretion. Direct sequencing of the AVPR2 gene revealed a novel deletion of adenine at position 222 (222delA) in exon 2. This mutation is predicted to lead to a frameshift beginning at amino acid 75 and a premature stop codon at position 115 (FS75>115X). His height and weight, as well as his motor skills, improved after initiation of therapy with hydrochlorothiazide and amiloride. Growth delay can be associated with diabetes insipidus. The X-linked nephrogenic diabetes insipidus in this boy is caused by a novel mutation in the AVPR2 gene that is predicted to truncate the receptor protein.
Soumya, Neelagiri; Kumar, I Sravan; Shivaprasad, S; Gorakh, Landage Nitin; Dinesh, Neeradi; Swamy, Kayala Kambagiri; Singh, Sushma
2015-04-01
An adenosine monophosphate forming acetyl CoA synthetase (AceCS) which is the key enzyme involved in the conversion of acetate to acetyl CoA has been identified from Leishmania donovani for the first time. Sequence analysis of L. donovani AceCS (LdAceCS) revealed the presence of a 'PX4GK' motif which is highly conserved throughout organisms with higher sequence identity (96%) to lower sequence identity (38%). A ∼ 77 kDa heterologous protein with C-terminal 6X His-tag was expressed in Escherichia coli. Expression of LdAceCS in promastigotes was confirmed by western blot and RT-PCR analysis. Immunolocalization studies revealed that it is a cytosolic protein. We also report the kinetic characterization of recombinant LdAceCS with acetate, adenosine 5'-triphosphate, coenzyme A and propionate as substrates. Site directed mutagenesis of residues in conserved PX4GK motif of LdAceCS was performed to gain insight into its potential role in substrate binding, catalysis and its role in maintaining structural integrity of the protein. P646A, G651A and K652R exhibited more than 90% loss in activity signifying its indispensible role in the enzyme activity. Substitution of other residues in this motif resulted in altered substrate specificity and catalysis. However, none of them had any role in modulation of the secondary structure of the protein except G651A mutant. Copyright © 2015 Elsevier B.V. All rights reserved.
Bacterial diversity characterization in petroleum samples from Brazilian reservoirs
de Oliveira, Valéria Maia; Sette, Lara Durães; Simioni, Karen Christina Marques; dos Santos Neto, Eugênio Vaz
2008-01-01
This study aimed at evaluating potential differences among the bacterial communities from formation water and oil samples originated from biodegraded and non-biodegraded Brazilian petroleum reservoirs by using a PCR-DGGE based approach. Environmental DNA was isolated and used in PCR reactions with bacterial primers, followed by separation of 16S rDNA fragments in the DGGE. PCR products were also cloned and sequenced, aiming at the taxonomic affiliation of the community members. The fingerprints obtained allowed the direct comparison among the bacterial communities from oil samples presenting distinct degrees of biodegradation, as well as between the communities of formation water and oil sample from the non-biodegraded reservoir. Very similar DGGE band profiles were observed for all samples, and the diversity of the predominant bacterial phylotypes was shown to be low. Cloning and sequencing results revealed major differences between formation water and oil samples from the non-biodegraded reservoir. Bacillus sp. and Halanaerobium sp. were shown to be the predominant components of the bacterial community from the formation water sample, whereas the oil sample also included Alicyclobacillus acidoterrestris, Rhodococcus sp., Streptomyces sp. and Acidithiobacillus ferrooxidans. The PCR-DGGE technique, combined with cloning and sequencing of PCR products, revealed the presence of taxonomic groups not found previously in these samples when using cultivation-based methods and 16S rRNA gene library assembly, confirming the need of a polyphasic study in order to improve the knowledge of the extent of microbial diversity in such extreme environments. PMID:24031244
The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.
Vonk, Freek J; Casewell, Nicholas R; Henkel, Christiaan V; Heimberg, Alysha M; Jansen, Hans J; McCleary, Ryan J R; Kerkkamp, Harald M E; Vos, Rutger A; Guerreiro, Isabel; Calvete, Juan J; Wüster, Wolfgang; Woods, Anthony E; Logan, Jessica M; Harrison, Robert A; Castoe, Todd A; de Koning, A P Jason; Pollock, David D; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S; Ribeiro, José M C; Arntzen, Jan W; van den Thillart, Guido E E J M; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P; Spaink, Herman P; Duboule, Denis; McGlinn, Edwina; Kini, R Manjunatha; Richardson, Michael K
2013-12-17
Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection.
Photometric and Structural Properties of NGC 6544: A Combined VVV-Hubble Space Telescope Study
NASA Astrophysics Data System (ADS)
Cohen, Roger E.; Mauro, Francesco; Geisler, Doug; Moni Bidin, Christian; Dotter, Aaron; Bonatto, Charles
2014-07-01
We combine archival Hubble Space Telescope imaging with wide-field near-infrared photometry to study the neglected metal-poor Galactic globular cluster NGC 6544. A high spatial resolution map of differential reddening over the inner portion of the cluster is constructed, revealing variations of up to half of the total reddening, and the resulting corrected color-magnitude diagrams reveal a sparse blue horizontal branch and centrally concentrated blue straggler population, verified via relative proper motions. Using the corrected photometry to investigate the cluster distance, reddening, and age via direct comparison to well-calibrated photometry of clusters with similar metallicities, we estimate (m - M)0 = 11.96, E(B - V) = 0.79, and an age coeval with M13 to within the relevant uncertainties. Although our data are insufficient to place tight constraints on the reddening law toward NGC 6544, we find no strong evidence that it is non-standard at optical or near-infrared wavelengths. We also provide near-infrared fiducial sequences extending nearly 2 mag below the cluster main sequence turnoff, generated from a statistically decontaminated sample of cluster stars. Lastly, we redetermine the cluster center and construct a radial number density profile which is well fit by an atypically flat power law with a slope of about 1.7. We discuss this result, together with a flattened main sequence luminosity function and inverted mass function, in the context of mass segregation and tidal stripping via interactions with Milky Way potential.
Novel variants in PAX6 gene caused congenital aniridia in two Chinese families.
Zhang, R; Linpeng, S; Wei, X; Li, H; Huang, Y; Guo, J; Wu, Q; Liang, D; Wu, L
2017-06-01
PurposeTo reveal the underlying genetic defect in two four-generation Chinese families with aniridia and explore the pathologic mechanism.MethodsFull ophthalmic examinations were performed in two families with aniridia. The PAX6 gene was directly sequenced in patients of two families, and the detected variants were screened in unaffected family members and two hundred unrelated healthy controls. Real-time quantitative PCR was used to explore pathologic mechanisms of the two variants.ResultsAniridia, cataract, and oscillatory nystagmus were observed in patients of the two families. In addition, we observed corneal opacity and microphthalmus in family 1, and strabismus, left ectopia lentis, microphthalmus, and microcornea in family 2. Sanger sequencing detected a novel 1-bp duplication (c.50dupA) in family 1 and a novel 2-bp splice site deletion (c.765+1_765+2delGT) in family 2. Sequencing of cDNA indicated skipping of exon 9 caused by the splice site deletion, being predicted to cause a premature stop codon, as well as the duplication. The PAX6 mRNA significantly lower in patients with aniridia than in unaffected family members in both families, suggesting that the duplication and splice site deletion caused nonsense-mediated mRNA decay.ConclusionsOur study identified two novel PAX6 variants in two families with aniridia and revealed the pathogenicity of the variants; this would expand the variant spectrum of PAX6 and help us better understand the molecular basis of aniridia, thus facilitating genetic counseling.
Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf
2015-10-01
Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
NASA Astrophysics Data System (ADS)
Jiang, Houjun; Feng, Guangcai; Wang, Teng; Bürgmann, Roland
2017-02-01
Sentinel-1's continuous observation program over all major plate boundary regions makes it well suited for earthquake studies. However, decorrelation due to large displacement gradients and limited azimuth resolution of the Terrain Observation by Progressive Scan (TOPS) data challenge acquiring measurements in the near field of many earthquake ruptures and prevent measurements of displacements in the along-track direction. Here we propose to fully exploit the coherent and incoherent information of TOPS data by using standard interferometric synthetic aperture radar (InSAR), split-bandwidth interferometry in range and azimuth, swath/burst-overlap interferometry, and amplitude cross correlation to map displacements in both the line-of-sight and the along-track directions. Application to the 2016 Kumamoto earthquake sequence reveals the coseismic displacements from the far field to the near field. By adding near-field constraints, the derived slip model reveals more shallow slip than obtained when only using far-field data from InSAR, highlighting the importance of exploiting all coherent and incoherent information in TOPS data.
Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.
Toffan, Anna; Jonassen, Christine Monceyron; De Battisti, Cristian; Schiavon, Eliana; Kofstad, Tone; Capua, Ilaria; Cattoli, Giovanni
2009-10-20
Astroviruses have been described in several animals species frequently associated with diarrhoea, especially in young animals. In dogs, astrovirus-like particles have been observed sporadically and very little is known about their epidemiology and characteristics. In this paper, we describe the detection of astrovirus-like particles in symptomatic puppies. Furthermore, for the first time in this species, the presumptive identification made by electron microscopy was confirmed by genetic analysis of the viral RNA conducted directly on the clinical specimens. Genetic sequences of ORF2 (2443 nt), encoding for the capsid protein, and partial sequence of ORF1b (346 nt), encoding for the viral polymerase, identified the viruses as member of the family Astroviridae. The phylogenetic analysis clearly clustered canine astroviruses in the genus Mamastrovirus. Relative closest similarities were revealed with a cluster comprising human, porcine and feline astroviruses, based on the ORF2 sequences available. Based on the species definition for astroviruses and on the data obtained in this study, we suggest a new species of astrovirus - canine astrovirus, CaAstV - to be included in the genus Mamastrovirus.
Zhou, Jianye; Jiang, Nan; Wang, Zhenzhen; Li, Longqing; Zhang, Jumei; Ma, Rui; Nie, Hongbing
2016-01-01
ABSTRACT This study aimed to identify the differences in the oral microbial communities in saliva from patients with and without caries by performing sequencing with the Illumina MiSeq platform, as well as to further assess their relationships with environmental factors (salivary pH and iron concentration). Forty-three volunteers were selected, including 21 subjects with and 22 without caries, from one village in Gansu, China. Based on 966,255 trimmed sequences and clustering at the 97% similarity level, 1,303 species-level operational taxonomic units were generated. The sequencing data for the two groups revealed that (i) particular distribution patterns (synergistic effects or competition) existed in the subjects with and without caries at both the genus and species levels and (ii) both the salivary pH and iron concentration had significant influences on the microbial community structure. IMPORTANCE The significant influences of the oral environment observed in this study increase the current understanding of the salivary microbiome in caries. These results will be useful for expanding research directions and for improving disease diagnosis, prognosis, and therapy. PMID:27940544
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Zhang, Zhijun; Zhang, Pengjun; Li, Weidi; Zhang, Jinming; Huang, Fang; Yang, Jian; Bei, Yawei; Lu, Yaobin
2013-05-01
The western flower thrips (WFT), Frankliniella occidentalis, a world-wide invasive insect, causes agricultural damage by directly feeding and by indirectly vectoring Tospoviruses, such as Tomato spotted wilt virus (TSWV). We characterized the transcriptome of WFT and analyzed global gene expression of WFT response to TSWV infection using Illumina sequencing platform. We compiled 59,932 unigenes, and identified 36,339 unigenes by similarity analysis against public databases, most of which were annotated using gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. Within these annotated transcripts, we collected 278 sequences related to insecticide resistance. GO and KEGG analysis of different expression genes between TSWV-infected and non-infected WFT population revealed that TSWV can regulate cellular process and immune response, which might lead to low virus titers in thrips cells and no detrimental effects on F. occidentalis. This data-set not only enriches genomic resource for WFT, but also benefits research into its molecular genetics and functional genomics. Copyright © 2013 Elsevier Inc. All rights reserved.
Sequence variants in four genes underlying Bardet-Biedl syndrome in consanguineous families
Ullah, Asmat; Umair, Muhammad; Yousaf, Maryam; Khan, Sher Alam; Nazim-ud-din, Muhammad; Shah, Khadim; Ahmad, Farooq; Azeem, Zahid; Ali, Ghazanfar; Alhaddad, Bader; Rafique, Afzal; Jan, Abid; Haack, Tobias B.; Strom, Tim M.; Meitinger, Thomas; Ghous, Tahseen
2017-01-01
Purpose To investigate the molecular basis of Bardet-Biedl syndrome (BBS) in five consanguineous families of Pakistani origin. Methods Linkage in two families (A and B) was established to BBS7 on chromosome 4q27, in family C to BBS8 on chromosome 14q32.1, and in family D to BBS10 on chromosome 12q21.2. Family E was investigated directly with exome sequence analysis. Results Sanger sequencing revealed two novel mutations and three previously reported mutations in the BBS genes. These mutations include two deletions (c.580_582delGCA, c.1592_1597delTTCCAG) in the BBS7 gene, a missense mutation (p.Gln449His) in the BBS8 gene, a frameshift mutation (c.271_272insT) in the BBS10 gene, and a nonsense mutation (p.Ser40*) in the MKKS (BBS6) gene. Conclusions Two novel mutations and three previously reported variants, identified in the present study, further extend the body of evidence implicating BBS6, BBS7, BBS8, and BBS10 in causing BBS. PMID:28761321
Zhou, Jianye; Jiang, Nan; Wang, Zhenzhen; Li, Longqing; Zhang, Jumei; Ma, Rui; Nie, Hongbing; Li, Zhiqiang
2017-02-15
This study aimed to identify the differences in the oral microbial communities in saliva from patients with and without caries by performing sequencing with the Illumina MiSeq platform, as well as to further assess their relationships with environmental factors (salivary pH and iron concentration). Forty-three volunteers were selected, including 21 subjects with and 22 without caries, from one village in Gansu, China. Based on 966,255 trimmed sequences and clustering at the 97% similarity level, 1,303 species-level operational taxonomic units were generated. The sequencing data for the two groups revealed that (i) particular distribution patterns (synergistic effects or competition) existed in the subjects with and without caries at both the genus and species levels and (ii) both the salivary pH and iron concentration had significant influences on the microbial community structure. The significant influences of the oral environment observed in this study increase the current understanding of the salivary microbiome in caries. These results will be useful for expanding research directions and for improving disease diagnosis, prognosis, and therapy. Copyright © 2017 Zhou et al.
Panwar, Priyankar; Verma, A K; Dubey, Ashutosh
2018-05-01
Barnyard ( Echinochloa frumentacea ) and finger ( Eleusine coracana ) millet growing at northwestern Himalaya were explored for the α-amylase inhibitor (α-AI). The mature seeds of barnyard millet variety PRJ1 had maximum α-AI activity which increases in different developmental stage. α-AI was purified up to 22.25-fold from barnyard millet variety PRJ1. Semi-quantitative PCR of different developmental stages of barnyard millet seeds showed increased levels of the transcript from 7 to 28 days. Sequence analysis revealed that it contained 315 bp nucleotide which encodes 104 amino acid sequence with molecular weight 10.72 kDa. The predicted 3D structure of α-AI was 86.73% similar to a bifunctional inhibitor of ragi. In silico analysis of 71 α-AI protein sequences were carried out for biochemical features, homology search, multiple sequence alignment, phylogenetic tree construction, motif, and superfamily distribution of protein sequences. Analysis of multiple sequence alignment revealed the existence of conserved regions NPLP[S/G]CRWYVV[S/Q][Q/R]TCG[V/I] throughout sequences. Superfam analysis revealed that α-AI protein sequences were distributed among seven different superfamilies.
Hamond, C; Pestana, C P; Medeiros, M A; Lilenbaum, W
2016-01-01
The aim of this study was to identify Leptospira in urine samples of cattle by direct sequencing of the secY gene. The validity of this approach was assessed using ten Leptospira strains obtained from cattle in Brazil and 77 DNA samples previously extracted from cattle urine, that were positive by PCR for the genus-specific lipL32 gene of Leptospira. Direct sequencing identified 24 (31·1%) interpretable secY sequences and these were identical to those obtained from direct DNA sequencing of the urine samples from which they were recovered. Phylogenetic analyses identified four species: L. interrogans, L. borgpetersenii, L. noguchii, and L. santarosai with the most prevalent genotypes being associated with L. borgpetersenii. While direct sequencing cannot, as yet, replace culturing of leptospires, it is a valid additional tool for epidemiological studies. An unexpected finding from this study was the genetic diversity of Leptospira infecting Brazilian cattle.
Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C. Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B.; Nauck, Markus; Kaminski, Wolfgang E.
2017-01-01
The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its “a” determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the “a” determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of “a” determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated. PMID:28472040
Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E
2017-01-01
The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.
2010-01-01
Background BamHI-A rightward frame-1 (BARF1) is a carcinoma-specific Epstein-Barr virus (EBV) encoded oncogene. Here we describe the BARF1 sequence diversity in nasopharyngeal carcinoma (NPC), other EBV-related diseases and Indonesian healthy EBV carriers in relation to EBV genotype, viral load and serology markers. Nasopharyngeal brushings from 56 NPC cases, blood or tissue from 15 other EBV-related disorders, spontaneous B cell lines (LCL) from 5 Indonesian healthy individuals and several prototype EBV isolates were analysed by PCR-direct sequencing. Results Most NPC isolates revealed specific BARF1 nucleotide changes compared to prototype B95-8 virus. At the protein level these mutations resulted in 3 main substitutions (V29A, W72G, H130R), which are not considered to cause gross tertiary structure alterations in the hexameric BARF1 protein. At least one amino acid conversion was detected in 80.3% of NPC samples compared to 33.3% of non-NPC samples (p < 0.001) and 40.0% of healthy LCLs (p = 0.074). NPC isolates also showed more frequent codon mutation than non-NPC samples. EBV strain typing revealed most isolates as EBV type 1. The viral load of either NPC or non-NPC samples was high, but only in non- NPC group it related to a particular BARF1 variant. Serology on NPC sera using IgA/EBNA-1 ELISA, IgA/VCA-p18 ELISA and immunoblot score showed no relation with BARF1 sequence diversity (p = 0.802, 0.382 and 0.058, respectively). NPC patients had variable antibody reactivity against purified hexameric NPC-derived BARF1 irrespective of the endogenous BARF1 sequence. Conclusion The sequence variation of BARF1 observed in Indonesian NPC patients and controls may reflect a natural selection of EBV strains unlikely to be predisposing to carcinogenesis. The conserved nature of BARF1 may reflect an important role in EBV (epithelial) persistence. PMID:20849661
Hutajulu, Susanna H; Hoebe, Eveline K; Verkuijlen, Sandra Awm; Fachiroh, Jajah; Hariwijanto, Bambang; Haryana, Sofia M; Stevens, Servi Jc; Greijer, Astrid E; Middeldorp, Jaap M
2010-09-19
BamHI-A rightward frame-1 (BARF1) is a carcinoma-specific Epstein-Barr virus (EBV) encoded oncogene. Here we describe the BARF1 sequence diversity in nasopharyngeal carcinoma (NPC), other EBV-related diseases and Indonesian healthy EBV carriers in relation to EBV genotype, viral load and serology markers. Nasopharyngeal brushings from 56 NPC cases, blood or tissue from 15 other EBV-related disorders, spontaneous B cell lines (LCL) from 5 Indonesian healthy individuals and several prototype EBV isolates were analysed by PCR-direct sequencing. Most NPC isolates revealed specific BARF1 nucleotide changes compared to prototype B95-8 virus. At the protein level these mutations resulted in 3 main substitutions (V29A, W72G, H130R), which are not considered to cause gross tertiary structure alterations in the hexameric BARF1 protein. At least one amino acid conversion was detected in 80.3% of NPC samples compared to 33.3% of non-NPC samples (p < 0.001) and 40.0% of healthy LCLs (p = 0.074). NPC isolates also showed more frequent codon mutation than non-NPC samples. EBV strain typing revealed most isolates as EBV type 1. The viral load of either NPC or non-NPC samples was high, but only in non- NPC group it related to a particular BARF1 variant. Serology on NPC sera using IgA/EBNA-1 ELISA, IgA/VCA-p18 ELISA and immunoblot score showed no relation with BARF1 sequence diversity (p = 0.802, 0.382 and 0.058, respectively). NPC patients had variable antibody reactivity against purified hexameric NPC-derived BARF1 irrespective of the endogenous BARF1 sequence. The sequence variation of BARF1 observed in Indonesian NPC patients and controls may reflect a natural selection of EBV strains unlikely to be predisposing to carcinogenesis. The conserved nature of BARF1 may reflect an important role in EBV (epithelial) persistence.
A novel ATTR L32V mutation causes familial amyloid polyneuropathy in a Bolivian family.
Martínez-Ulloa, Pedro L; Vallejo, Manuela; Corral, Iñigo; García-Barragán, Nuria; Alcazar, Alberto; Martínez-Alonso, Emma; Martínez-Poles, Javier; Pian, Hector; Jiménez-Escrig, Adriano
2017-09-01
We report a new transthyretin (ATTR) gene c.272C>G mutation and variant protein, p.Leu32Val, in a kindred of Bolivian origin with a rapid progressive peripheral neuropathy and cardiomyopathy. Three individuals from a kindred with peripheral nerve and cardiac amyloidosis were examined. Analysis of the TTR gene was performed by Sanger direct sequencing. Neuropathologic examination was obtained on the index patient with mass spectrometry study of the ATTR deposition. Direct DNA sequence analysis of exons 2, 3, and 4 of the TTR gene demonstrated a c.272 C>G mutation in exon 2 (p.L32V). Sural nerve biopsy revealed massive amyloid deposition in the perineurium, endoneurium and vasa nervorum. Mass spectrometric analyses of ATTR immunoprecipitated from nerve biopsy showed the presence of both wild-type and variant proteins. The observed mass results for the wild-type and variant proteins were consistent with the predicted values calculated from the genetic analysis data. The ATTR L32V is associated with a severe course. This has implications for treatment of affected individuals and counseling of family members. © 2017 Peripheral Nerve Society.
Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto
2008-01-01
The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377
He, Xiaoyuan; Wang, Liqin; Wang, Shuishu
2016-04-15
The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.
Spatial distribution of marine airborne bacterial communities
Seifried, Jasmin S; Wichels, Antje; Gerdts, Gunnar
2015-01-01
The spatial distribution of bacterial populations in marine bioaerosol samples was investigated during a cruise from the North Sea to the Baltic Sea via Skagerrak and Kattegat. The analysis of the sampled bacterial communities with a pyrosequencing approach revealed that the most abundant phyla were represented by the Proteobacteria (49.3%), Bacteroidetes (22.9%), Actinobacteria (16.3%), and Firmicutes (8.3%). Cyanobacteria were assigned to 1.5% of all bacterial reads. A core of 37 bacterial OTUs made up more than 75% of all bacterial sequences. The most abundant OTU was Sphingomonas sp. which comprised 17% of all bacterial sequences. The most abundant bacterial genera were attributed to distinctly different areas of origin, suggesting highly heterogeneous sources for bioaerosols of marine and coastal environments. Furthermore, the bacterial community was clearly affected by two environmental parameters – temperature as a function of wind direction and the sampling location itself. However, a comparison of the wind directions during the sampling and calculated backward trajectories underlined the need for more detailed information on environmental parameters for bioaerosol investigations. The current findings support the assumption of a bacterial core community in the atmosphere. They may be emitted from strong aerosolizing sources, probably being mixed and dispersed over long distances. PMID:25800495
Kanhayuwa, Lakkhana; Coutts, Robert H. A.
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
The contribution of alu elements to mutagenic DNA double-strand break repair.
Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L
2015-03-01
Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.
Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jisen; Sharma, Anupma; Yu, Qingyi
Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less
Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum
Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...
2016-06-10
Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less
Bacterial identification and subtyping using DNA microarray and DNA sequencing.
Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D
2012-01-01
The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.
2013-01-01
Background Next-generation-sequencing (NGS) technologies combined with a classic DNA barcoding approach have enabled fast and credible measurement for biodiversity of mixed environmental samples. However, the PCR amplification involved in nearly all existing NGS protocols inevitably introduces taxonomic biases. In the present study, we developed new Illumina pipelines without PCR amplifications to analyze terrestrial arthropod communities. Results Mitochondrial enrichment directly followed by Illumina shotgun sequencing, at an ultra-high sequence volume, enabled the recovery of Cytochrome c Oxidase subunit 1 (COI) barcode sequences, which allowed for the estimation of species composition at high fidelity for a terrestrial insect community. With 15.5 Gbp Illumina data, approximately 97% and 92% were detected out of the 37 input Operational Taxonomic Units (OTUs), whether the reference barcode library was used or not, respectively, while only 1 novel OTU was found for the latter. Additionally, relatively strong correlation between the sequencing volume and the total biomass was observed for species from the bulk sample, suggesting a potential solution to reveal relative abundance. Conclusions The ability of the new Illumina PCR-free pipeline for DNA metabarcoding to detect small arthropod specimens and its tendency to avoid most, if not all, false positives suggests its great potential in biodiversity-related surveillance, such as in biomonitoring programs. However, further improvement for mitochondrial enrichment is likely needed for the application of the new pipeline in analyzing arthropod communities at higher diversity. PMID:23587339
Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †
Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary
2008-01-01
Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877
Hafner, John C; Upham, Nathan S
2011-06-01
AIM: The rodent genus Microdipodops (kangaroo mice) includes two sand-obligate endemics of the Great Basin Desert: M. megacephalus and M. pallidus. The dark kangaroo mouse, M. megacephalus, is distributed throughout the Great Basin and our principal aims were to formulate phylogenetic hypotheses for this taxon and make phylogeographical comparisons with its congener. LOCATION: The Great Basin Desert of western North America. METHODS: DNA sequence data from three mitochondrial genes were examined from 186 individuals of M. megacephalus, representing 47 general localities. Phylogenetic inference was used to analyse the sequence data. Directional analysis of phylogeographical patterns was used to examine haplotype sharing patterns and recover routes of gene exchange. Haplotype-area curves were constructed to evaluate the relationship between genetic variation and distributional island size for M. megacephalus and M. pallidus. RESULTS: Microdipodops megacephalus is a rare desert rodent (trapping success was 2.67%). Temporal comparison of trapping data shows that kangaroo mice are becoming less abundant in the study area. The distribution has changed slightly since the 1930s but many northern populations now appear to be small, fragmented, or locally extinct. Four principal phylogroups (the Idaho isolate and the western, central and eastern clades) are evident; mean sequence divergence between phylogroups for cytochrome b is c. 8%. Data from haplotype sharing show two trends: a north-south trend and a web-shaped trend. Analyses of haplotype-area curves reveal significant positive relationships. MAIN CONCLUSIONS: The four phylogroups of M. megacephalus appear to represent morphologically cryptic species; in comparison, a companion study revealed two cryptic lineages in M. pallidus. Estimated divergence times of the principal clades of M. megacephalus (c. 2-4 Ma) indicate that these kangaroo mice were Pleistocene invaders into the Great Basin coincident with the formation of sandy habitats. The north-south and web patterns from directional analyses reveal past routes of gene flow and provide evidence for source-sink population regulation. The web pattern was not seen in the companion study of M. pallidus. Significant haplotype-area curves indicate that the distributional islands are now in approximate genetic equilibrium. The patterns described here are potentially useful to conservation biologists and wildlife managers and may serve as a model for other sand-obligate organisms of the Great Basin.
Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z
1994-01-01
The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.
Polycomb repressive complex 1 modifies transcription of active genes
Pherson, Michelle; Misulovin, Ziva; Gause, Maria; Mihindukulasuriya, Kathie; Swain, Amanda; Dorsett, Dale
2017-01-01
This study examines the role of Polycomb repressive complex 1 (PRC1) at active genes. The PRC1 and PRC2 complexes are crucial for epigenetic silencing during development of an organism. They are recruited to Polycomb response elements (PREs) and establish silenced domains over several kilobases. Recent studies show that PRC1 is also directly recruited to active genes by the cohesin complex. Cohesin participates broadly in control of gene transcription, but it is unknown whether cohesin-recruited PRC1 also plays a role in transcriptional control of active genes. We address this question using genome-wide RNA sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq). The results show that PRC1 influences transcription of active genes, and a significant fraction of its effects are likely direct. The roles of different PRC1 subunits can also vary depending on the gene. Depletion of PRC1 subunits by RNA interference alters phosphorylation of RNA polymerase II (Pol II) and occupancy by the Spt5 pausing-elongation factor at most active genes. These effects on Pol II phosphorylation and Spt5 are likely linked to changes in elongation and RNA processing detected by nascent RNA-seq, although the mechanisms remain unresolved. The experiments also reveal that PRC1 facilitates association of Spt5 with enhancers and PREs. Reduced Spt5 levels at these regulatory sequences upon PRC1 depletion coincide with changes in Pol II occupancy and phosphorylation. Our findings indicate that, in addition to its repressive roles in epigenetic gene silencing, PRC1 broadly influences transcription of active genes and may suppress transcription of nonpromoter regulatory sequences. PMID:28782042
Lescat, Mathilde; Hoede, Claire; Clermont, Olivier; Garry, Louis; Darlu, Pierre; Tuffery, Pierre; Denamur, Erick; Picard, Bertrand
2009-12-29
Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. We identified the gene encoding esterase B as the acetyl-esterase gene (aes) using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR) strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Toral-López, Jaime; González-Huerta, Luz M; Martín-Del Campo, Mónica; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio A
2018-05-01
The proband in this study was a 4-year-old Mexican girl with Blau syndrome. She and her affected family members had skin rash and arthritis but no uveitis. Exome sequencing and DNA direct sequencing from blood samples revealed a novel nucleotide-binding oligomerization domain-containing protein 2 gene mutation in the affected family members. This study is the first report of a Mexican family with Blau syndrome showing good infliximab treatment response. The novel mutation in the nucleotide-binding oligomerization domain-containing protein 2 gene (c.1808A>G) enriches the mutation spectrum in Blau syndrome. This family represents one of the few cases of autosomal Blau syndrome with no uveitis; because of phenotype variability, it is important to recognize Blau syndrome's clinical spectrum and recommend genetic consultation. © 2018 Wiley Periodicals, Inc.
Structure and expression of the attacin genes in Hyalophora cecropia.
Sun, S C; Lindström, I; Lee, J Y; Faye, I
1991-02-26
To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.
An application of statistics to comparative metagenomics
Rodriguez-Brito, Beltran; Rohwer, Forest; Edwards, Robert A
2006-01-01
Background Metagenomics, sequence analyses of genomic DNA isolated directly from the environments, can be used to identify organisms and model community dynamics of a particular ecosystem. Metagenomics also has the potential to identify significantly different metabolic potential in different environments. Results Here we use a statistical method to compare curated subsystems, to predict the physiology, metabolism, and ecology from metagenomes. This approach can be used to identify those subsystems that are significantly different between metagenome sequences. Subsystems that were overrepresented in the Sargasso Sea and Acid Mine Drainage metagenome when compared to non-redundant databases were identified. Conclusion The methodology described herein applies statistics to the comparisons of metabolic potential in metagenomes. This analysis reveals those subsystems that are more, or less, represented in the different environments that are compared. These differences in metabolic potential lead to several testable hypotheses about physiology and metabolism of microbes from these ecosystems. PMID:16549025
An application of statistics to comparative metagenomics.
Rodriguez-Brito, Beltran; Rohwer, Forest; Edwards, Robert A
2006-03-20
Metagenomics, sequence analyses of genomic DNA isolated directly from the environments, can be used to identify organisms and model community dynamics of a particular ecosystem. Metagenomics also has the potential to identify significantly different metabolic potential in different environments. Here we use a statistical method to compare curated subsystems, to predict the physiology, metabolism, and ecology from metagenomes. This approach can be used to identify those subsystems that are significantly different between metagenome sequences. Subsystems that were overrepresented in the Sargasso Sea and Acid Mine Drainage metagenome when compared to non-redundant databases were identified. The methodology described herein applies statistics to the comparisons of metabolic potential in metagenomes. This analysis reveals those subsystems that are more, or less, represented in the different environments that are compared. These differences in metabolic potential lead to several testable hypotheses about physiology and metabolism of microbes from these ecosystems.
Genome analysis of the platypus reveals unique signatures of evolution.
Warren, Wesley C; Hillier, LaDeana W; Marshall Graves, Jennifer A; Birney, Ewan; Ponting, Chris P; Grützner, Frank; Belov, Katherine; Miller, Webb; Clarke, Laura; Chinwalla, Asif T; Yang, Shiaw-Pyng; Heger, Andreas; Locke, Devin P; Miethke, Pat; Waters, Paul D; Veyrunes, Frédéric; Fulton, Lucinda; Fulton, Bob; Graves, Tina; Wallis, John; Puente, Xose S; López-Otín, Carlos; Ordóñez, Gonzalo R; Eichler, Evan E; Chen, Lin; Cheng, Ze; Deakin, Janine E; Alsop, Amber; Thompson, Katherine; Kirby, Patrick; Papenfuss, Anthony T; Wakefield, Matthew J; Olender, Tsviya; Lancet, Doron; Huttley, Gavin A; Smit, Arian F A; Pask, Andrew; Temple-Smith, Peter; Batzer, Mark A; Walker, Jerilyn A; Konkel, Miriam K; Harris, Robert S; Whittington, Camilla M; Wong, Emily S W; Gemmell, Neil J; Buschiazzo, Emmanuel; Vargas Jentzsch, Iris M; Merkel, Angelika; Schmitz, Juergen; Zemann, Anja; Churakov, Gennady; Kriegs, Jan Ole; Brosius, Juergen; Murchison, Elizabeth P; Sachidanandam, Ravi; Smith, Carly; Hannon, Gregory J; Tsend-Ayush, Enkhjargal; McMillan, Daniel; Attenborough, Rosalind; Rens, Willem; Ferguson-Smith, Malcolm; Lefèvre, Christophe M; Sharp, Julie A; Nicholas, Kevin R; Ray, David A; Kube, Michael; Reinhardt, Richard; Pringle, Thomas H; Taylor, James; Jones, Russell C; Nixon, Brett; Dacheux, Jean-Louis; Niwa, Hitoshi; Sekita, Yoko; Huang, Xiaoqiu; Stark, Alexander; Kheradpour, Pouya; Kellis, Manolis; Flicek, Paul; Chen, Yuan; Webber, Caleb; Hardison, Ross; Nelson, Joanne; Hallsworth-Pepin, Kym; Delehaunty, Kim; Markovic, Chris; Minx, Pat; Feng, Yucheng; Kremitzki, Colin; Mitreva, Makedonka; Glasscock, Jarret; Wylie, Todd; Wohldmann, Patricia; Thiru, Prathapan; Nhan, Michael N; Pohl, Craig S; Smith, Scott M; Hou, Shunfeng; Nefedov, Mikhail; de Jong, Pieter J; Renfree, Marilyn B; Mardis, Elaine R; Wilson, Richard K
2008-05-08
We present a draft genome sequence of the platypus, Ornithorhynchus anatinus. This monotreme exhibits a fascinating combination of reptilian and mammalian characters. For example, platypuses have a coat of fur adapted to an aquatic lifestyle; platypus females lactate, yet lay eggs; and males are equipped with venom similar to that of reptiles. Analysis of the first monotreme genome aligned these features with genetic innovations. We find that reptile and platypus venom proteins have been co-opted independently from the same gene families; milk protein genes are conserved despite platypuses laying eggs; and immune gene family expansions are directly related to platypus biology. Expansions of protein, non-protein-coding RNA and microRNA families, as well as repeat elements, are identified. Sequencing of this genome now provides a valuable resource for deep mammalian comparative analyses, as well as for monotreme biology and conservation.
Genome analysis of the platypus reveals unique signatures of evolution
Warren, Wesley C.; Hillier, LaDeana W.; Marshall Graves, Jennifer A.; Birney, Ewan; Ponting, Chris P.; Grützner, Frank; Belov, Katherine; Miller, Webb; Clarke, Laura; Chinwalla, Asif T.; Yang, Shiaw-Pyng; Heger, Andreas; Locke, Devin P.; Miethke, Pat; Waters, Paul D.; Veyrunes, Frédéric; Fulton, Lucinda; Fulton, Bob; Graves, Tina; Wallis, John; Puente, Xose S.; López-Otín, Carlos; Ordóñez, Gonzalo R.; Eichler, Evan E.; Chen, Lin; Cheng, Ze; Deakin, Janine E.; Alsop, Amber; Thompson, Katherine; Kirby, Patrick; Papenfuss, Anthony T.; Wakefield, Matthew J.; Olender, Tsviya; Lancet, Doron; Huttley, Gavin A.; Smit, Arian F. A.; Pask, Andrew; Temple-Smith, Peter; Batzer, Mark A.; Walker, Jerilyn A.; Konkel, Miriam K.; Harris, Robert S.; Whittington, Camilla M.; Wong, Emily S. W.; Gemmell, Neil J.; Buschiazzo, Emmanuel; Vargas Jentzsch, Iris M.; Merkel, Angelika; Schmitz, Juergen; Zemann, Anja; Churakov, Gennady; Kriegs, Jan Ole; Brosius, Juergen; Murchison, Elizabeth P.; Sachidanandam, Ravi; Smith, Carly; Hannon, Gregory J.; Tsend-Ayush, Enkhjargal; McMillan, Daniel; Attenborough, Rosalind; Rens, Willem; Ferguson-Smith, Malcolm; Lefèvre, Christophe M.; Sharp, Julie A.; Nicholas, Kevin R.; Ray, David A.; Kube, Michael; Reinhardt, Richard; Pringle, Thomas H.; Taylor, James; Jones, Russell C.; Nixon, Brett; Dacheux, Jean-Louis; Niwa, Hitoshi; Sekita, Yoko; Huang, Xiaoqiu; Stark, Alexander; Kheradpour, Pouya; Kellis, Manolis; Flicek, Paul; Chen, Yuan; Webber, Caleb; Hardison, Ross; Nelson, Joanne; Hallsworth-Pepin, Kym; Delehaunty, Kim; Markovic, Chris; Minx, Pat; Feng, Yucheng; Kremitzki, Colin; Mitreva, Makedonka; Glasscock, Jarret; Wylie, Todd; Wohldmann, Patricia; Thiru, Prathapan; Nhan, Michael N.; Pohl, Craig S.; Smith, Scott M.; Hou, Shunfeng; Renfree, Marilyn B.; Mardis, Elaine R.; Wilson, Richard K.
2009-01-01
We present a draft genome sequence of the platypus, Ornithorhynchus anatinus. This monotreme exhibits a fascinating combination of reptilian and mammalian characters. For example, platypuses have a coat of fur adapted to an aquatic lifestyle; platypus females lactate, yet lay eggs; and males are equipped with venom similar to that of reptiles. Analysis of the first monotreme genome aligned these features with genetic innovations. We find that reptile and platypus venom proteins have been co-opted independently from the same gene families; milk protein genes are conserved despite platypuses laying eggs; and immune gene family expansions are directly related to platypus biology. Expansions of protein, non-protein-coding RNA and microRNA families, as well as repeat elements, are identified. Sequencing of this genome now provides a valuable resource for deep mammalian comparative analyses, as well as for monotreme biology and conservation. PMID:18464734
Somatic mitochondrial mutation in gastric cancer.
Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.
1995-01-01
Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355
A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein
Sepulveda, Edgardo; Vogelmann, Jutta
2011-01-01
Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692
Distinct frontal regions for processing sentence syntax and story grammar.
Sirigu, A; Cohen, L; Zalla, T; Pradat-Diehl, P; Van Eeckhout, P; Grafman, J; Agid, Y
1998-12-01
Time is a fundamental dimension of cognition. It is expressed in the sequential ordering of individual elements in a wide variety of activities such as language, motor control or in the broader domain of long range goal-directed actions. Several studies have shown the importance of the frontal lobes in sequencing information. The question addressed in this study is whether this brain region hosts a single supramodal sequence processor, or whether separate mechanisms are required for different kinds of temporally organised knowledge structures such as syntax and action knowledge. Here we show that so-called agrammatic patients, with lesions in Broca's area, ordered word groups correctly to form a logical sequence of actions but they were severely impaired when similar word groups had to be ordered as a syntactically well-formed sentence. The opposite performance was observed in patients with dorsolateral prefrontal lesions, that is, while their syntactic processing was intact at the sentence level, they demonstrated a pronounced deficit in producing temporally coherent sequences of actions. Anatomical reconstruction of lesions from brain scans revealed that the sentence and action grammar deficits involved distinct, non-overlapping sites within the frontal lobes. Finally, in a third group of patients whose lesions encompassed both Broca's area and the prefrontal cortex, the two types of deficits were found. We conclude that sequence processing is specific to knowledge domains and involves different networks within the frontal lobes.
Lefèvre, Emilie; Bardot, Corinne; Noël, Christophe; Carrias, Jean-François; Viscogliosi, Eric; Amblard, Christian; Sime-Ngando, Télesphore
2007-01-01
This study presents an original 18S rRNA PCR survey of the freshwater picoeukaryote community, and was designed to detect unidentified heterotrophic picoflagellates (size range 0.6-5 microm) which are prevalent throughout the year within the heterotrophic flagellate assemblage in Lake Pavin. Four clone libraries were constructed from samples collected in two contrasting zones in the lake. Computerized statistic tools have suggested that sequence retrieval was representative of the in situ picoplankton diversity. The two sampling zones exhibited similar diversity patterns but shared only about 5% of the operational taxonomic units (OTUs). Phylogenetic analysis clustered our sequences into three taxonomic groups: Alveolates (30% of OTUs), Fungi (23%) and Cercozoa (19%). Fungi thus substantially contributed to the detected diversity, as was additionally supported by direct microscopic observations of fungal zoospores and sporangia. A large fraction of the sequences belonged to parasites, including Alveolate sequences affiliated to the genus Perkinsus known as zooparasites, and chytrids that include host-specific parasitic fungi of various freshwater phytoplankton species, primarily diatoms. Phylogenetic analysis revealed five novel clades that probably include typical freshwater environmental sequences. Overall, from the unsuspected fungal diversity unveiled, we think that fungal zooflagellates have been misidentified as phagotrophic nanoflagellates in previous studies. This is in agreement with a recent experimental demonstration that zoospore-producing fungi and parasitic activity may play an important role in aquatic food webs.
The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4
Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.
2013-01-01
The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524
Sequence-based screening for self-sufficient P450 monooxygenase from a metagenome library.
Kim, B S; Kim, S Y; Park, J; Park, W; Hwang, K Y; Yoon, Y J; Oh, W K; Kim, B Y; Ahn, J S
2007-05-01
Cytochrome P450 monooxygenases (CYPs) are useful catalysts for oxidation reactions. Self-sufficient CYPs harbour a reductive domain covalently connected to a P450 domain and are known for their robust catalytic activity with great potential as biocatalysts. In an effort to expand genetic sources of self-sufficient CYPs, we devised a sequence-based screening system to identify them in a soil metagenome. We constructed a soil metagenome library and performed sequence-based screening for self-sufficient CYP genes. A new CYP gene, syk181, was identified from the metagenome library. Phylogenetic analysis revealed that SYK181 formed a distinct phylogenic line with 46% amino-acid-sequence identity to CYP102A1 which has been extensively studied as a fatty acid hydroxylase. The heterologously expressed SYK181 showed significant hydroxylase activity towards naphthalene and phenanthrene as well as towards fatty acids. Sequence-based screening of metagenome libraries is expected to be a useful approach for searching self-sufficient CYP genes. The translated product of syk181 shows self-sufficient hydroxylase activity towards fatty acids and aromatic compounds. SYK181 is the first self-sufficient CYP obtained directly from a metagenome library. The genetic and biochemical information on SYK181 are expected to be helpful for engineering self-sufficient CYPs with broader catalytic activities towards various substrates, which would be useful for bioconversion of natural products and biodegradation of organic chemicals.
Fanali, Gabriella; Ascenzi, Paolo; Bernardi, Giorgio; Fasano, Mauro
2012-01-01
Serum albumin (SA) is a circulating protein providing a depot and carrier for many endogenous and exogenous compounds. At least seven major binding sites have been identified by structural and functional investigations mainly in human SA. SA is conserved in vertebrates, with at least 49 entries in protein sequence databases. The multiple sequence analysis of this set of entries leads to the definition of a cladistic tree for the molecular evolution of SA orthologs in vertebrates, thus showing the clustering of the considered species, with lamprey SAs (Lethenteron japonicum and Petromyzon marinus) in a separate outgroup. Sequence analysis aimed at searching conserved domains revealed that most SA sequences are made up by three repeated domains (about 600 residues), as extensively characterized for human SA. On the contrary, lamprey SAs are giant proteins (about 1400 residues) comprising seven repeated domains. The phylogenetic analysis of the SA family reveals a stringent correlation with the taxonomic classification of the species available in sequence databases. A focused inspection of the sequences of ligand binding sites in SA revealed that in all sites most residues involved in ligand binding are conserved, although the versatility towards different ligands could be peculiar of higher organisms. Moreover, the analysis of molecular links between the different sites suggests that allosteric modulation mechanisms could be restricted to higher vertebrates.
Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.
1988-08-01
The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less
Changes in spinal reflex excitability associated with motor sequence learning.
Lungu, Ovidiu; Frigon, Alain; Piché, Mathieu; Rainville, Pierre; Rossignol, Serge; Doyon, Julien
2010-05-01
There is ample evidence that motor sequence learning is mediated by changes in brain activity. Yet the question of whether this form of learning elicits changes detectable at the spinal cord level has not been addressed. To date, studies in humans have revealed that spinal reflex activity may be altered during the acquisition of various motor skills, but a link between motor sequence learning and changes in spinal excitability has not been demonstrated. To address this issue, we studied the modulation of H-reflex amplitude evoked in the flexor carpi radialis muscle of 14 healthy individuals between blocks of movements that involved the implicit acquisition of a sequence versus other movements that did not require learning. Each participant performed the task in three conditions: "sequence"-externally triggered, repeating and sequential movements, "random"-similar movements, but performed in an arbitrary order, and "simple"- involving alternating movements in a left-right or up-down direction only. When controlling for background muscular activity, H-reflex amplitude was significantly more reduced in the sequence (43.8 +/- 1.47%. mean +/- SE) compared with the random (38.2 +/- 1.60%) and simple (31.5 +/- 1.82%) conditions, while the M-response was not different across conditions. Furthermore, H-reflex changes were observed from the beginning of the learning process up to when subjects reached asymptotic performance on the motor task. Changes also persisted for >60 s after motor activity ceased. Such findings suggest that the excitability in some spinal reflex circuits is altered during the implicit learning process of a new motor sequence.
Voz, Marianne L.; Coppieters, Wouter; Manfroid, Isabelle; Baudhuin, Ariane; Von Berg, Virginie; Charlier, Carole; Meyer, Dirk; Driever, Wolfgang; Martial, Joseph A.; Peers, Bernard
2012-01-01
Forward genetics using zebrafish is a powerful tool for studying vertebrate development through large-scale mutagenesis. Nonetheless, the identification of the molecular lesion is still laborious and involves time-consuming genetic mapping. Here, we show that high-throughput sequencing of the whole zebrafish genome can directly locate the interval carrying the causative mutation and at the same time pinpoint the molecular lesion. The feasibility of this approach was validated by sequencing the m1045 mutant line that displays a severe hypoplasia of the exocrine pancreas. We generated 13 Gb of sequence, equivalent to an eightfold genomic coverage, from a pool of 50 mutant embryos obtained from a map-cross between the AB mutant carrier and the WIK polymorphic strain. The chromosomal region carrying the causal mutation was localized based on its unique property to display high levels of homozygosity among sequence reads as it derives exclusively from the initial AB mutated allele. We developed an algorithm identifying such a region by calculating a homozygosity score along all chromosomes. This highlighted an 8-Mb window on chromosome 5 with a score close to 1 in the m1045 mutants. The sequence analysis of all genes within this interval revealed a nonsense mutation in the snapc4 gene. Knockdown experiments confirmed the assertion that snapc4 is the gene whose mutation leads to exocrine pancreas hypoplasia. In conclusion, this study constitutes a proof-of-concept that whole-genome sequencing is a fast and effective alternative to the classical positional cloning strategies in zebrafish. PMID:22496837
Pyrin gene and mutants thereof, which cause familial Mediterranean fever
Kastner, Daniel L [Bethesda, MD; Aksentijevichh, Ivona [Bethesda, MD; Centola, Michael [Tacoma Park, MD; Deng, Zuoming [Gaithersburg, MD; Sood, Ramen [Rockville, MD; Collins, Francis S [Rockville, MD; Blake, Trevor [Laytonsville, MD; Liu, P Paul [Ellicott City, MD; Fischel-Ghodsian, Nathan [Los Angeles, CA; Gumucio, Deborah L [Ann Arbor, MI; Richards, Robert I [North Adelaide, AU; Ricke, Darrell O [San Diego, CA; Doggett, Norman A [Santa Cruz, NM; Pras, Mordechai [Tel-Hashomer, IL
2003-09-30
The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.
Wang, Yang; Zhang, Rongmin; Li, Jiyun; Wu, Zuowei; Yin, Wenjuan; Schwarz, Stefan; Tyrrell, Jonathan M; Zheng, Yongjun; Wang, Shaolin; Shen, Zhangqi; Liu, Zhihai; Liu, Jianye; Lei, Lei; Li, Mei; Zhang, Qidi; Wu, Congming; Zhang, Qijing; Wu, Yongning; Walsh, Timothy R; Shen, Jianzhong
2017-02-06
By 2030, the global population will be 8.5 billion, placing pressure on international poultry production, of which China is a key producer 1 . From April 2017, China will implement the withdrawal of colistin as a growth promoter, removing over 8,000 tonnes per year from the Chinese farming sector 2 . To understand the impact of banning colistin and the epidemiology of multi-drug-resistant (MDR) Escherichia coli (using bla NDM and mcr-1 as marker genes), we sampled poultry, dogs, sewage, wild birds and flies. Here, we show that mcr-1, but not bla NDM , is prevalent in hatcheries, but bla NDM quickly contaminates flocks through dogs, flies and wild birds. We also screened samples directly for resistance genes to understand the true breadth and depth of the environmental and animal resistome. Direct sample testing for bla NDM and mcr-1 in hatcheries, commercial farms, a slaughterhouse and supermarkets revealed considerably higher levels of positive samples than the bla NDM - and mcr-1-positive E. coli, indicating a substantial segment of unseen resistome-a phenomenon we have termed the 'phantom resistome'. Whole-genome sequencing identified common bla NDM -positive E. coli shared among farms, flies, dogs and farmers, providing direct evidence of carbapenem-resistant E. coli transmission and environmental contamination.
The 12th June 2017 Mw = 6.3 Lesvos earthquake from detailed seismological observations
NASA Astrophysics Data System (ADS)
Papadimitriou, P.; Kassaras, I.; Kaviris, G.; Tselentis, G.-A.; Voulgaris, N.; Lekkas, E.; Chouliaras, G.; Evangelidis, C.; Pavlou, K.; Kapetanidis, V.; Karakonstantis, A.; Kazantzidou-Firtinidou, D.; Fountoulakis, I.; Millas, C.; Spingos, I.; Aspiotis, T.; Moumoulidou, A.; Skourtsos, E.; Antoniou, V.; Andreadakis, E.; Mavroulis, S.; Kleanthi, M.
2018-04-01
A major earthquake (Mwö=ö6.3) occurred on the 12th of June 2017 (12:28 GMT) offshore, south of the SE coast of Lesvos Island, at a depth of 13ökm, in an area characterized by normal faulting with an important strike-slip component in certain cases. Over 900 events of the sequence between 12 and 30 June 2017 were manually analyzed and located, employing an optimized local velocity model. Double-difference relocation revealed seven spatially separated groups of events, forming two linear branches, roughly aligned N130°E, compatible with the strike of known mapped faults along the southern coast of Lesvos Island. Spatiotemporal analysis indicated gradual migration of seismicity towards NW and SE from the margins of the main rupture, while a strong secondary sequence at a separate fault patch SE of the mainshock, oriented NW-SE, was triggered by the largest aftershock (Mwö=ö5.2) that occurred on 17 June. The focal mechanisms of the mainshock (φö=ö122°, δö=ö40° and λö=ö-83°) and of the major aftershocks were determined using regional moment tensor inversion. In most cases normal faulting was revealed with the fault plane oriented in a NW-SE direction, dipping SW, with the exception of the largest aftershock that was characterized by strike-slip faulting. Stress inversion revealed a complex stress field south of Lesvos, related both to normal, in an approximate E-W direction, and strike-slip faulting. All aftershocks outside the main rupture, where gradual seismicity migration was observed, are located within the positive lobes of static stress transfer determined by applying the Coulomb criterion for the mainshock. Stress loading on optimal faults under a strike-slip regime explains the occurrence of the largest aftershock and the seismicity that was triggered at the eastern patch of the rupture zone.
Adeola, O A; Olugasa, B O; Emikpe, B O
2017-12-01
In the post-pandemic period, influenza A(H1N1)pdm09 virus has been detected in swine populations in different parts of the world. This study was conducted to determine the presence and spatial patterns of this human pandemic virus among Nigerian pigs and identify associated risk factors. Using a two-stage stratified random sampling method, nasal swab specimens were obtained from pigs in Ibadan, Nigeria during the 2013-2014 and 2014-2015 influenza seasons, and the virus was detected by reverse transcriptase-polymerase chain reaction (RT-PCR). Purified RT-PCR products were sequenced in both directions, and sequences were aligned using MUSCLE. Phylogenetic analysis was conducted in MEGA6. Purely spatial scan statistics and a spatial lag regression model were used to identify spatial clusters and associated risk factors. The virus was detected in both seasons, with an overall prevalence of 8·7%. Phylogenetic analyses revealed that the M genes were similar to those of pandemic strains which circulated in humans prior to and during the study. Cluster analysis revealed a significant primary spatial cluster (RR = 4·71, LLR = 5·66, P = 0·0046), while 'hours spent with pigs (R 2 = 0·90, P = 0·0018)' and 'hours spent with pigs from different farms (R 2 = 0·91, P = 0·0001)' were identified as significant risk factors (P < 0·05). These findings reveal that there is considerable risk of transmission of the pandemic virus, either directly from pig handlers or through fomites, to swine herds in Ibadan, Nigeria. Active circulation of the virus among Nigerian pigs could enhance its reassortment with endemic swine influenza viruses. Campaigns for adoption of biosecurity measures in West African piggeries and abattoirs should be introduced and sustained in order to prevent the emergence of a new influenza epicentre in the sub-region.
Analysis of a microbial community oxidizing inorganic sulfide and mercaptans.
Duncan, K E; Sublette, K L; Rider, P A; Stepp, A; Beitle, R R; Conner, J A; Kolhatkar, R
2001-01-01
Successful treatment of refinery spent-sulfidic caustic (which results from the addition of sodium hydroxide solutions to petroleum refinery waste streams) was achieved in a bioreactor containing an enrichment culture immobilized in organic polymer beads with embedded powdered activated carbon (Bio-Sep). The aerobic enrichment culture had previously been selected using a gas mixture of hydrogen sulfide and methyl mercaptan (MeSH) as the sole carbon and energy sources. The starting cultures for the enrichment consisted of several different Thiobacilli spp. (T. thioparus, T. denitrificans, T. thiooxidans, and T. neopolitanus), as well as activated sludge from a refinery aerobic wastewater treatment system and sludge from an industrial anaerobic digester. Microscopic examination (light and SEM) of the beads and of microbial growth on the walls of the bioreactor revealed a great diversity of microorganisms. Further characterization was undertaken starting with culturable aerobic heterotrophic microorganisms (sequencing of PCR-amplified DNA coding for 16S rRNA, Gram staining) and by PCR amplification of DNA coding for 16S rRNA extracted directly from the cell mass, followed by the separation of the PCR products by DGGE (denaturing gradient gel electrophoresis). Eight prominent bands from the DGGE gel were sequenced and found to be closest to sequences of uncultured Cytophagales (3 bands), Gram-positive cocci (Micrococcineae), alpha proteobacteria (3 bands), and an unidentified beta proteobacterium. Culturable microbes included several genera of fungi as well as various Gram-positive and Gram-negative heterotrophic bacteria not seen in techniques using direct DNA extraction.
NASA Astrophysics Data System (ADS)
Rovelli, A.; Calderoni, G.
2012-12-01
A simple method based on the EGF deconvolution in the frequency domain is applied to detect the occurrence of unilateral ruptures in recent damaging earthquakes in Italy. The spectral ratio between event pairs with different magnitudes at individual stations shows large azimuthal variations above corner frequency when the target event is affected by source directivity and the EGF is not or vice versa. The analysis is applied to seismograms and accelerograms recorded during the seismic sequence following the 20 May 2012, Mw 5.6 main shock in Emilia, northern Italy, the 6 April 2009, Mw 6.1 earthquake of L'Aquila, central Italy, and the 26 September 1997, Mw 5.7 and 6.0 shocks in Umbria-Marche, central Italy. Events of each seismic sequence are selected as having consistent focal mechanisms, and the station selection obeys to the constraint of a similar source-to-receiver path for the event pairs. The analyzed data set of L'Aquila consists of 962 broad-band seismograms relative to 69 normal-faulting earthquakes (3.3 ≤ MW ≤ 6.1, according to Herrmann et al., 2011), stations are selected in the distance range 100 to 250 km to minimize differences in propagation paths. The seismogram analysis reveals that a strong along-strike (toward SE) source directivity characterized all of the three Mw > 5.0 shocks. Source directivity was also persistent up to the smallest magnitudes: 65% of earthquakes under study showed evidence of directivity toward SE whereas only one (Mw 3.7) event showed directivity in the opposite direction. Also the Mw 5.6 main shock of the 20 May 2012 in Emilia result in large azimuthal spectral variations indicating unilateral rupture propagation toward SE. According to the reconstructed geometry of the trust-fault plane, the inferred directivity direction suggests top-down rupture propagation. The analysis over the Emilia aftershock sequence is in progress. The third seismic sequence, dated 1997-1998, occurred in the northern Apennines and, similarly to L'Aquila faults, was characterized by normal-faulting earthquakes with strike substantially parallel to the Apennine trend. Although the amount of data is not as abundant as for the most recent earthquakes, the available data were already object of previous studies indicating unilateral rupture propagation in several of the strongest (5.5 < Mw < 6.0) shocks. We show that the effect of directivity is particularly significant in intermontane basins where long-period (T > 1 sec) ground motions are amplified by soft sediments and the combination of local amplification with source directivity causes exceedance of spectral ordinates at those periods up to more than 2 standard deviations from the expected values of commonly used GMPEs for soft sites. These results arise a concern in terms of seismic hazard because source directivity is found to be recurrent feature in the Apennines. Moreover, the predominant fault strike and intermontane basins are both aligned along the Apennine chain offering a condition potentially favorable to extra-amplifications at periods relevant to seismic risk.
Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C
2007-09-01
The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.
Benevenuto, Juliana; Peters, Leila P.; Carvalho, Giselle; Palhares, Alessandra; Quecine, Maria C.; Nunes, Filipe R. S.; Kmit, Maria C. P.; Wai, Alvan; Hausner, Georg; Aitken, Karen S.; Berkman, Paul J.; Fraser, James A.; Moolhuijzen, Paula M.; Coutinho, Luiz L.; Creste, Silvana; Vieira, Maria L. C.; Kitajima, João P.; Monteiro-Vitorello, Claudia B.
2015-01-01
Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence) revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions. PMID:26065709
Thomas, Austen C; Jarman, Simon N; Haman, Katherine H; Trites, Andrew W; Deagle, Bruce E
2014-08-01
Ecologists are increasingly interested in quantifying consumer diets based on food DNA in dietary samples and high-throughput sequencing of marker genes. It is tempting to assume that food DNA sequence proportions recovered from diet samples are representative of consumer's diet proportions, despite the fact that captive feeding studies do not support that assumption. Here, we examine the idea of sequencing control materials of known composition along with dietary samples in order to correct for technical biases introduced during amplicon sequencing and biological biases such as variable gene copy number. Using the Ion Torrent PGM(©) , we sequenced prey DNA amplified from scats of captive harbour seals (Phoca vitulina) fed a constant diet including three fish species in known proportions. Alongside, we sequenced a prey tissue mix matching the seals' diet to generate tissue correction factors (TCFs). TCFs improved the diet estimates (based on sequence proportions) for all species and reduced the average estimate error from 28 ± 15% (uncorrected) to 14 ± 9% (TCF-corrected). The experimental design also allowed us to infer the magnitude of prey-specific digestion biases and calculate digestion correction factors (DCFs). The DCFs were compared with possible proxies for differential digestion (e.g. fish protein%, fish lipid%) revealing a strong relationship between the DCFs and percent lipid of the fish prey, suggesting prey-specific corrections based on lipid content would produce accurate diet estimates in this study system. These findings demonstrate the value of parallel sequencing of food tissue mixtures in diet studies and offer new directions for future research in quantitative DNA diet analysis. © 2013 John Wiley & Sons Ltd.
Urvoas, Agathe; Guellouz, Asma; Valerio-Lepiniec, Marie; Graille, Marc; Durand, Dominique; Desravines, Danielle C; van Tilbeurgh, Herman; Desmadril, Michel; Minard, Philippe
2010-11-26
Repeat proteins have a modular organization and a regular architecture that make them attractive models for design and directed evolution experiments. HEAT repeat proteins, although very common, have not been used as a scaffold for artificial proteins, probably because they are made of long and irregular repeats. Here, we present and validate a consensus sequence for artificial HEAT repeat proteins. The sequence was defined from the structure-based sequence analysis of a thermostable HEAT-like repeat protein. Appropriate sequences were identified for the N- and C-caps. A library of genes coding for artificial proteins based on this sequence design, named αRep, was assembled using new and versatile methodology based on circular amplification. Proteins picked randomly from this library are expressed as soluble proteins. The biophysical properties of proteins with different numbers of repeats and different combinations of side chains in hypervariable positions were characterized. Circular dichroism and differential scanning calorimetry experiments showed that all these proteins are folded cooperatively and are very stable (T(m) >70 °C). Stability of these proteins increases with the number of repeats. Detailed gel filtration and small-angle X-ray scattering studies showed that the purified proteins form either monomers or dimers. The X-ray structure of a stable dimeric variant structure was solved. The protein is folded with a highly regular topology and the repeat structure is organized, as expected, as pairs of alpha helices. In this protein variant, the dimerization interface results directly from the variable surface enriched in aromatic residues located in the randomized positions of the repeats. The dimer was crystallized both in an apo and in a PEG-bound form, revealing a very well defined binding crevice and some structure flexibility at the interface. This fortuitous binding site could later prove to be a useful binding site for other low molecular mass partners. Copyright © 2010 Elsevier Ltd. All rights reserved.
Rybarczyk-Mydłowska, Katarzyna; Maboreke, Hazel Ruvimbo; van Megen, Hanny; van den Elsen, Sven; Mooyman, Paul; Smant, Geert; Bakker, Jaap; Helder, Johannes
2012-11-21
Plant parasitic nematodes are unusual Metazoans as they are equipped with genes that allow for symbiont-independent degradation of plant cell walls. Among the cell wall-degrading enzymes, glycoside hydrolase family 5 (GHF5) cellulases are relatively well characterized, especially for high impact parasites such as root-knot and cyst nematodes. Interestingly, ancestors of extant nematodes most likely acquired these GHF5 cellulases from a prokaryote donor by one or multiple lateral gene transfer events. To obtain insight into the origin of GHF5 cellulases among evolutionary advanced members of the order Tylenchida, cellulase biodiversity data from less distal family members were collected and analyzed. Single nematodes were used to obtain (partial) genomic sequences of cellulases from representatives of the genera Meloidogyne, Pratylenchus, Hirschmanniella and Globodera. Combined Bayesian analysis of ≈ 100 cellulase sequences revealed three types of catalytic domains (A, B, and C). Represented by 84 sequences, type B is numerically dominant, and the overall topology of the catalytic domain type shows remarkable resemblance with trees based on neutral (= pathogenicity-unrelated) small subunit ribosomal DNA sequences. Bayesian analysis further suggested a sister relationship between the lesion nematode Pratylenchus thornei and all type B cellulases from root-knot nematodes. Yet, the relationship between the three catalytic domain types remained unclear. Superposition of intron data onto the cellulase tree suggests that types B and C are related, and together distinct from type A that is characterized by two unique introns. All Tylenchida members investigated here harbored one or multiple GHF5 cellulases. Three types of catalytic domains are distinguished, and the presence of at least two types is relatively common among plant parasitic Tylenchida. Analysis of coding sequences of cellulases suggests that root-knot and cyst nematodes did not acquire this gene directly by lateral genes transfer. More likely, these genes were passed on by ancestors of a family nowadays known as the Pratylenchidae.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-01-01
Background Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements. PMID:16945140
Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M
2016-10-02
Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic diagnosis rate of the patients with unexplained ID or DD. Combined use of these technologies can serve as a useful examinational method in assisting differential diagnosis of children with unexplained ID or DD.
Mikalová, Lenka; Strouhal, Michal; Oppelt, Jan; Grange, Philippe Alain; Janier, Michel; Benhaddou, Nadjet; Dupin, Nicolas; Šmajs, David
2017-01-01
Background Treponema pallidum subsp. endemicum (TEN) is the causative agent of endemic syphilis (bejel). An unusual human TEN 11q/j isolate was obtained from a syphilis-like primary genital lesion from a patient that returned to France from Pakistan. Methodology/Principal findings The TEN 11q/j isolate was characterized using nested PCR followed by Sanger sequencing and/or direct Illumina sequencing. Altogether, 44 chromosomal regions were analyzed. Overall, the 11q/j isolate clustered with TEN strains Bosnia A and Iraq B as expected from previous TEN classification of the 11q/j isolate. However, the 11q/j sequence in a 505 bp-long region at the TP0488 locus was similar to Treponema pallidum subsp. pallidum (TPA) strains, but not to TEN Bosnia A and Iraq B sequences, suggesting a recombination event at this locus. Similarly, the 11q/j sequence in a 613 bp-long region at the TP0548 locus was similar to Treponema pallidum subsp. pertenue (TPE) strains, but not to TEN sequences. Conclusions/Significance A detailed analysis of two recombinant loci found in the 11q/j clinical isolate revealed that the recombination event occurred just once, in the TP0488, with the donor sequence originating from a TPA strain. Since TEN Bosnia A and Iraq B were found to contain TPA-like sequences at the TP0548 locus, the recombination at TP0548 took place in a treponeme that was an ancestor to both TEN Bosnia A and Iraq B. The sequence of 11q/j isolate in TP0548 represents an ancestral TEN sequence that is similar to yaws-causing treponemes. In addition to the importance of the 11q/j isolate for reconstruction of the TEN phylogeny, this case emphasizes the possible role of TEN strains in development of syphilis-like lesions. PMID:28263990
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benasutti, M.; Ejadi, S.; Whitlow, M.D.
The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less
Maternally inherited Leigh syndrome: an unusual cause of infantile apnea.
Shuk-kuen Chau, Christy; Kwok, Ka-li; Ng, Daniel K; Lam, Ching-Wan; Tong, Sui-Fan; Chan, Yan-Wo; Siu, Wai-Kwan; Yuen, Yuet-Ping
2010-06-01
Leigh Syndrome is an uncommon cause of infantile apnea. We report a 5-month-old girl with sudden respiratory arrest followed by episodic hyper- and hypo-ventilation, encephalopathy, and persistent lactic acidosis. Computed tomography of the brain revealed symmetric low densities over the basal ganglia, internal capsule, thalami, and midbrain. Cardiac echocardiogram was suggestive of hypertrophic cardiomyopathy. Diagnosis of Leigh syndrome due to T8993G mutation was confirmed with polymerase chain reaction and direct DNA sequencing of mitochondrial genome. To our knowledge, this is the first report of proven maternally inherited Leigh syndrome in Hong Kong.
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
Chaikind, Brian; Bessen, Jeffrey L.; Thompson, David B.; Hu, Johnny H.; Liu, David R.
2016-01-01
We describe the development of ‘recCas9’, an RNA-programmed small serine recombinase that functions in mammalian cells. We fused a catalytically inactive dCas9 to the catalytic domain of Gin recombinase using an optimized fusion architecture. The resulting recCas9 system recombines DNA sites containing a minimal recombinase core site flanked by guide RNA-specified sequences. We show that these recombinases can operate on DNA sites in mammalian cells identical to genomic loci naturally found in the human genome in a manner that is dependent on the guide RNA sequences. DNA sequencing reveals that recCas9 catalyzes guide RNA-dependent recombination in human cells with an efficiency as high as 32% on plasmid substrates. Finally, we demonstrate that recCas9 expressed in human cells can catalyze in situ deletion between two genomic sites. Because recCas9 directly catalyzes recombination, it generates virtually no detectable indels or other stochastic DNA modification products. This work represents a step toward programmable, scarless genome editing in unmodified cells that is independent of endogenous cellular machinery or cell state. Current and future generations of recCas9 may facilitate targeted agricultural breeding, or the study and treatment of human genetic diseases. PMID:27515511
El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl
2017-03-01
Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.
Prediction during statistical learning, and implications for the implicit/explicit divide
Dale, Rick; Duran, Nicholas D.; Morehead, J. Ryan
2012-01-01
Accounts of statistical learning, both implicit and explicit, often invoke predictive processes as central to learning, yet practically all experiments employ non-predictive measures during training. We argue that the common theoretical assumption of anticipation and prediction needs clearer, more direct evidence for it during learning. We offer a novel experimental context to explore prediction, and report results from a simple sequential learning task designed to promote predictive behaviors in participants as they responded to a short sequence of simple stimulus events. Predictive tendencies in participants were measured using their computer mouse, the trajectories of which served as a means of tapping into predictive behavior while participants were exposed to very short and simple sequences of events. A total of 143 participants were randomly assigned to stimulus sequences along a continuum of regularity. Analysis of computer-mouse trajectories revealed that (a) participants almost always anticipate events in some manner, (b) participants exhibit two stable patterns of behavior, either reacting to vs. predicting future events, (c) the extent to which participants predict relates to performance on a recall test, and (d) explicit reports of perceiving patterns in the brief sequence correlates with extent of prediction. We end with a discussion of implicit and explicit statistical learning and of the role prediction may play in both kinds of learning. PMID:22723817
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less
Statistical discovery of site inter-dependencies in sub-molecular hierarchical protein structuring
2012-01-01
Background Much progress has been made in understanding the 3D structure of proteins using methods such as NMR and X-ray crystallography. The resulting 3D structures are extremely informative, but do not always reveal which sites and residues within the structure are of special importance. Recently, there are indications that multiple-residue, sub-domain structural relationships within the larger 3D consensus structure of a protein can be inferred from the analysis of the multiple sequence alignment data of a protein family. These intra-dependent clusters of associated sites are used to indicate hierarchical inter-residue relationships within the 3D structure. To reveal the patterns of associations among individual amino acids or sub-domain components within the structure, we apply a k-modes attribute (aligned site) clustering algorithm to the ubiquitin and transthyretin families in order to discover associations among groups of sites within the multiple sequence alignment. We then observe what these associations imply within the 3D structure of these two protein families. Results The k-modes site clustering algorithm we developed maximizes the intra-group interdependencies based on a normalized mutual information measure. The clusters formed correspond to sub-structural components or binding and interface locations. Applying this data-directed method to the ubiquitin and transthyretin protein family multiple sequence alignments as a test bed, we located numerous interesting associations of interdependent sites. These clusters were then arranged into cluster tree diagrams which revealed four structural sub-domains within the single domain structure of ubiquitin and a single large sub-domain within transthyretin associated with the interface among transthyretin monomers. In addition, several clusters of mutually interdependent sites were discovered for each protein family, each of which appear to play an important role in the molecular structure and/or function. Conclusions Our results demonstrate that the method we present here using a k-modes site clustering algorithm based on interdependency evaluation among sites obtained from a sequence alignment of homologous proteins can provide significant insights into the complex, hierarchical inter-residue structural relationships within the 3D structure of a protein family. PMID:22793672
Statistical discovery of site inter-dependencies in sub-molecular hierarchical protein structuring.
Durston, Kirk K; Chiu, David Ky; Wong, Andrew Kc; Li, Gary Cl
2012-07-13
Much progress has been made in understanding the 3D structure of proteins using methods such as NMR and X-ray crystallography. The resulting 3D structures are extremely informative, but do not always reveal which sites and residues within the structure are of special importance. Recently, there are indications that multiple-residue, sub-domain structural relationships within the larger 3D consensus structure of a protein can be inferred from the analysis of the multiple sequence alignment data of a protein family. These intra-dependent clusters of associated sites are used to indicate hierarchical inter-residue relationships within the 3D structure. To reveal the patterns of associations among individual amino acids or sub-domain components within the structure, we apply a k-modes attribute (aligned site) clustering algorithm to the ubiquitin and transthyretin families in order to discover associations among groups of sites within the multiple sequence alignment. We then observe what these associations imply within the 3D structure of these two protein families. The k-modes site clustering algorithm we developed maximizes the intra-group interdependencies based on a normalized mutual information measure. The clusters formed correspond to sub-structural components or binding and interface locations. Applying this data-directed method to the ubiquitin and transthyretin protein family multiple sequence alignments as a test bed, we located numerous interesting associations of interdependent sites. These clusters were then arranged into cluster tree diagrams which revealed four structural sub-domains within the single domain structure of ubiquitin and a single large sub-domain within transthyretin associated with the interface among transthyretin monomers. In addition, several clusters of mutually interdependent sites were discovered for each protein family, each of which appear to play an important role in the molecular structure and/or function. Our results demonstrate that the method we present here using a k-modes site clustering algorithm based on interdependency evaluation among sites obtained from a sequence alignment of homologous proteins can provide significant insights into the complex, hierarchical inter-residue structural relationships within the 3D structure of a protein family.
The Essential Genome of Escherichia coli K-12.
Goodall, Emily C A; Robinson, Ashley; Johnston, Iain G; Jabbari, Sara; Turner, Keith A; Cunningham, Adam F; Lund, Peter A; Cole, Jeffrey A; Henderson, Ian R
2018-02-20
Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. IMPORTANCE Incentives to define lists of genes that are essential for bacterial survival include the identification of potential targets for antibacterial drug development, genes required for rapid growth for exploitation in biotechnology, and discovery of new biochemical pathways. To identify essential genes in Escherichia coli , we constructed a transposon mutant library of unprecedented density. Initial automated analysis of the resulting data revealed many discrepancies compared to the literature. We now report more extensive statistical analysis supported by both literature searches and detailed inspection of high-density TraDIS sequencing data for each putative essential gene for the E. coli model laboratory organism. This paper is important because it provides a better understanding of the essential genes of E. coli , reveals the limitations of relying on automated analysis alone, and provides a new standard for the analysis of TraDIS data. Copyright © 2018 Goodall et al.
Jakupciak, John P; Wells, Jeffrey M; Karalus, Richard J; Pawlowski, David R; Lin, Jeffrey S; Feldman, Andrew B
2013-01-01
Large-scale genomics projects are identifying biomarkers to detect human disease. B. pseudomallei and B. mallei are two closely related select agents that cause melioidosis and glanders. Accurate characterization of metagenomic samples is dependent on accurate measurements of genetic variation between isolates with resolution down to strain level. Often single biomarker sensitivity is augmented by use of multiple or panels of biomarkers. In parallel with single biomarker validation, advances in DNA sequencing enable analysis of entire genomes in a single run: population-sequencing. Potentially, direct sequencing could be used to analyze an entire genome to serve as the biomarker for genome identification. However, genome variation and population diversity complicate use of direct sequencing, as well as differences caused by sample preparation protocols including sequencing artifacts and mistakes. As part of a Department of Homeland Security program in bacterial forensics, we examined how to implement whole genome sequencing (WGS) analysis as a judicially defensible forensic method for attributing microbial sample relatedness; and also to determine the strengths and limitations of whole genome sequence analysis in a forensics context. Herein, we demonstrate use of sequencing to provide genetic characterization of populations: direct sequencing of populations.
Jakupciak, John P.; Wells, Jeffrey M.; Karalus, Richard J.; Pawlowski, David R.; Lin, Jeffrey S.; Feldman, Andrew B.
2013-01-01
Large-scale genomics projects are identifying biomarkers to detect human disease. B. pseudomallei and B. mallei are two closely related select agents that cause melioidosis and glanders. Accurate characterization of metagenomic samples is dependent on accurate measurements of genetic variation between isolates with resolution down to strain level. Often single biomarker sensitivity is augmented by use of multiple or panels of biomarkers. In parallel with single biomarker validation, advances in DNA sequencing enable analysis of entire genomes in a single run: population-sequencing. Potentially, direct sequencing could be used to analyze an entire genome to serve as the biomarker for genome identification. However, genome variation and population diversity complicate use of direct sequencing, as well as differences caused by sample preparation protocols including sequencing artifacts and mistakes. As part of a Department of Homeland Security program in bacterial forensics, we examined how to implement whole genome sequencing (WGS) analysis as a judicially defensible forensic method for attributing microbial sample relatedness; and also to determine the strengths and limitations of whole genome sequence analysis in a forensics context. Herein, we demonstrate use of sequencing to provide genetic characterization of populations: direct sequencing of populations. PMID:24455204
Severe congenital toxoplasmosis: a case report and strain characterization.
Sarkari, Bahador; Abdolahi Khabisi, Samaneh
2015-01-01
We report a fatal congenital toxoplasmosis case in an Iranian woman in the south of Iran. A pregnant mother had been admitted at the 15th week of her pregnancy on account of a febrile illness, symptoms of common cold, and enlargement of submandibular lymph nodes. Serological testing of the mother's serum revealed positive IgG and IgM anti-Toxoplasma antibodies. Amniotic fluid was taken and evaluated by polymerase chain reaction (PCR) assay with a direct amplification of the Toxoplasma URPT gene which was found to be positive. Sequencing and analysis of PCR product revealed that the isolate has the most similarity with type I of Toxoplasma gondii. Fetal scan showed anomaly in fetus including mild hydrocephaly. Termination of the pregnancy was suggested by the physician and pregnancy was terminated 178 days after conception.
NASA Astrophysics Data System (ADS)
Gaylord, D. R.
1983-09-01
The Ferris Dune Fields were examined. Sand dunes are especially valuable in paleoclimate reconstructions because they: (1) bury and preserve datable materials and artifacts; (2) respond to even subtle changes in wind velocity and direction as reflected both in external morphology and internal structures; and (3) remain unconsolidated, making them amenable to easy textural and compositional examination. The valley of Clear Creek in the Ferris Dunes reveals a relatively continuous Holocene section of interbedded dune and interdunal pond deposits. Radiocarbon dates from the interdunal pond strata at Clear Creek, theoretical sand dune migration rates, compositional analysis of periglacial sand wedges, and relative dating of actively migrating parabolic dunes reveals a general sequence of geologic-climatic events that affected the Ferris-Lost Soldier area. The most recent major reactivaton of dunes occurred approximately 290 years ago.
Scholz, Christian F P; Jensen, Anders
2017-01-01
The protocol describes a computational method to develop a Single Locus Sequence Typing (SLST) scheme for typing bacterial species. The resulting scheme can be used to type bacterial isolates as well as bacterial species directly from complex communities using next-generation sequencing technologies.
Lucero, Mary E.; Unc, Adrian; Cooke, Peter; Dowd, Scot; Sun, Shulei
2011-01-01
Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequencing (TEFAP) analysis amplified sequences from callus homologous to diverse fungal and bacterial taxa. Culturing isolated some seed borne endophyte taxa which could be readily propagated apart from the host. Microbial cells were observed within biofilm-like residues associated with plant cell surfaces and intercellular spaces. Various universal primers amplified both plant and microbial sequences, with different primers revealing different patterns of fungal diversity. Bacterial and fungal TEFAP followed by alignment with sequences from curated databases revealed 7 bacterial and 17 ascomycete taxa in A. canescens, and 5 bacterial taxa in A. torreyi. Additional diversity was observed among isolates and clone libraries. Micropropagated Atriplex retains a complex, intimately associated microbiome which includes diverse strains well poised to interact in manners that influence host physiology. Microbiome analysis was facilitated by high throughput sequencing methods, but primer biases continue to limit recovery of diverse sequences from even moderately complex communities. PMID:21437280
NASA Astrophysics Data System (ADS)
Dick, G. J.; Andersson, A.; Banfield, J. F.
2007-12-01
Our understanding of environmental microbiology has been greatly enhanced by community genome sequencing of DNA recovered directly the environment. Community genomics provides insights into the diversity, community structure, metabolic function, and evolution of natural populations of uncultivated microbes, thereby revealing dynamics of how microorganisms interact with each other and their environment. Recent studies have demonstrated the potential for reconstructing near-complete genomes from natural environments while highlighting the challenges of analyzing community genomic sequence, especially from diverse environments. A major challenge of shotgun community genome sequencing is identification of DNA fragments from minor community members for which only low coverage of genomic sequence is present. We analyzed community genome sequence retrieved from biofilms in an acid mine drainage (AMD) system in the Richmond Mine at Iron Mountain, CA, with an emphasis on identification and assembly of DNA fragments from low-abundance community members. The Richmond mine hosts an extensive, relatively low diversity subterranean chemolithoautotrophic community that is sustained entirely by oxidative dissolution of pyrite. The activity of these microorganisms greatly accelerates the generation of AMD. Previous and ongoing work in our laboratory has focused on reconstrucing genomes of dominant community members, including several bacteria and archaea. We binned contigs from several samples (including one new sample and two that had been previously analyzed) by tetranucleotide frequency with clustering by Self-Organizing Maps (SOM). The binning, evaluated by comparison with information from the manually curated assembly of the dominant organisms, was found to be very effective: fragments were correctly assigned with 95% accuracy. Improperly assigned fragments often contained sequences that are either evolutionarily constrained (e.g. 16S rRNA genes) or mobile elements that are not expected to reflect the tetranucleotide frequency signature of the host genome. Four unknown tetranucleotide frequency clusters with significant sequence (6 Mb total) were noted and analyzed further. Based on phylogenetic markers and BLAST results, these clusters represent low abundance bacteria including Acintobacteria, Firmicutes, and Proteobacteria. Functional analysis of these clusters revealved that the low- abundance bacteria harbor genes that could potentially encode important ecosystem functions such as sulfur utilization (e.g. polysulfide reductase) and polymer degradation (e.g. chitinase and glycoside hydrolase). We conclude that ESOM clustering of tetranucleotide frequency patterns is an effective method for rapidly binning shotgun community genomic sequences and a valuable tool for analyzing minor community members, which despite their low abundance may play crucial ecological roles.
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.
Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne
2011-06-01
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Sequencing Adventure Activities: A New Perspective.
ERIC Educational Resources Information Center
Bisson, Christian
Sequencing in adventure education involves putting activities in an order appropriate to the needs of the group. Contrary to the common assumption that each adventure sequence is unique, a review of literature concerning five sequencing models reveals a certain universality. These models present sequences that move through four phases: group…
Single molecule sequencing of the M13 virus genome without amplification
Zhao, Luyang; Deng, Liwei; Li, Gailing; Jin, Huan; Cai, Jinsen; Shang, Huan; Li, Yan; Wu, Haomin; Xu, Weibin; Zeng, Lidong; Zhang, Renli; Zhao, Huan; Wu, Ping; Zhou, Zhiliang; Zheng, Jiao; Ezanno, Pierre; Yang, Andrew X.; Yan, Qin; Deem, Michael W.; He, Jiankui
2017-01-01
Next generation sequencing (NGS) has revolutionized life sciences research. However, GC bias and costly, time-intensive library preparation make NGS an ill fit for increasing sequencing demands in the clinic. A new class of third-generation sequencing platforms has arrived to meet this need, capable of directly measuring DNA and RNA sequences at the single-molecule level without amplification. Here, we use the new GenoCare single-molecule sequencing platform from Direct Genomics to sequence the genome of the M13 virus. Our platform detects single-molecule fluorescence by total internal reflection microscopy, with sequencing-by-synthesis chemistry. We sequenced the genome of M13 to a depth of 316x, with 100% coverage. We determined a consensus sequence accuracy of 100%. In contrast to GC bias inherent to NGS results, we demonstrated that our single-molecule sequencing method yields minimal GC bias. PMID:29253901
Single molecule sequencing of the M13 virus genome without amplification.
Zhao, Luyang; Deng, Liwei; Li, Gailing; Jin, Huan; Cai, Jinsen; Shang, Huan; Li, Yan; Wu, Haomin; Xu, Weibin; Zeng, Lidong; Zhang, Renli; Zhao, Huan; Wu, Ping; Zhou, Zhiliang; Zheng, Jiao; Ezanno, Pierre; Yang, Andrew X; Yan, Qin; Deem, Michael W; He, Jiankui
2017-01-01
Next generation sequencing (NGS) has revolutionized life sciences research. However, GC bias and costly, time-intensive library preparation make NGS an ill fit for increasing sequencing demands in the clinic. A new class of third-generation sequencing platforms has arrived to meet this need, capable of directly measuring DNA and RNA sequences at the single-molecule level without amplification. Here, we use the new GenoCare single-molecule sequencing platform from Direct Genomics to sequence the genome of the M13 virus. Our platform detects single-molecule fluorescence by total internal reflection microscopy, with sequencing-by-synthesis chemistry. We sequenced the genome of M13 to a depth of 316x, with 100% coverage. We determined a consensus sequence accuracy of 100%. In contrast to GC bias inherent to NGS results, we demonstrated that our single-molecule sequencing method yields minimal GC bias.
Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A
2014-01-01
The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
An integrated semiconductor device enabling non-optical genome sequencing.
Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James
2011-07-20
The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.
Quantification of fetal heart rate regularity using symbolic dynamics
NASA Astrophysics Data System (ADS)
van Leeuwen, P.; Cysarz, D.; Lange, S.; Geue, D.; Groenemeyer, D.
2007-03-01
Fetal heart rate complexity was examined on the basis of RR interval time series obtained in the second and third trimester of pregnancy. In each fetal RR interval time series, short term beat-to-beat heart rate changes were coded in 8bit binary sequences. Redundancies of the 28 different binary patterns were reduced by two different procedures. The complexity of these sequences was quantified using the approximate entropy (ApEn), resulting in discrete ApEn values which were used for classifying the sequences into 17 pattern sets. Also, the sequences were grouped into 20 pattern classes with respect to identity after rotation or inversion of the binary value. There was a specific, nonuniform distribution of the sequences in the pattern sets and this differed from the distribution found in surrogate data. In the course of gestation, the number of sequences increased in seven pattern sets, decreased in four and remained unchanged in six. Sequences that occurred less often over time, both regular and irregular, were characterized by patterns reflecting frequent beat-to-beat reversals in heart rate. They were also predominant in the surrogate data, suggesting that these patterns are associated with stochastic heart beat trains. Sequences that occurred more frequently over time were relatively rare in the surrogate data. Some of these sequences had a high degree of regularity and corresponded to prolonged heart rate accelerations or decelerations which may be associated with directed fetal activity or movement or baroreflex activity. Application of the pattern classes revealed that those sequences with a high degree of irregularity correspond to heart rate patterns resulting from complex physiological activity such as fetal breathing movements. The results suggest that the development of the autonomic nervous system and the emergence of fetal behavioral states lead to increases in not only irregular but also regular heart rate patterns. Using symbolic dynamics to examine the cardiovascular system may thus lead to new insight with respect to fetal development.
Seegelke, Christian; Hughes, Charmayne M L
2015-12-01
It has been proposed that the preparation of goal-direct actions involves internal movement simulation, or motor imagery. Evidence suggests that motor imagery is critically involved in the prediction of action consequences and contributes heavily to movement planning processes. The present study examined whether the sensitivity towards end-state comfort and the possibility/impossibility to perform an action sequence are considered during motor imagery. Participants performed a mental rotation task in which two images were simultaneously presented. The image on the left depicted the start posture of a right hand when grasping a bar, while the right image depicted the hand posture at the end of the action sequence. The right image displayed the bar in a vertical orientation with the hand in a comfortable (thumb-up) or in an uncomfortable (thumb-down) posture, while the bar in the left image was rotated in picture plane in steps of 45°. Crucially, the two images formed either a physically possible or physically impossible to perform action sequence. Results revealed strikingly different response time patterns for the two action sequence conditions. In general, response times increased almost monotonically with increasing angular disparity for the possible to perform action sequences. However, slight deviations from this monotonicity were apparent when the sequences contained an uncomfortable as opposed to a comfortable final posture. In contrast, for the impossible sequences, response times did not follow a typical mental rotation function, but instead were uniformly very slow. These findings suggest that both biomechanical constraints (i.e., end-state comfort) and the awareness of the possibility/impossibility to perform an action sequence are considered during motor imagery. We conclude that motor representations contain information about the spatiotemporal movement organization and the possibility of performing an action, which are crucially involved in anticipation and planning of action sequences. Copyright © 2015 Elsevier Inc. All rights reserved.
Nelson, Edward M; Li, Hui; Timp, Gregory
2014-06-24
We report direct, concurrent measurements of the forces and currents associated with the translocation of a single-stranded DNA molecule tethered to the tip of an atomic force microscope (AFM) cantilever through synthetic pores with topagraphies comparable to the DNA. These measurements were performed to gauge the signal available for sequencing and the electric force required to impel a single molecule through synthetic nanopores ranging from 1.0 to 3.5 nm in diameter in silicon nitride membranes 6-10 nm thick. The measurements revealed that a molecule can slide relatively frictionlessly through a pore, but regular fluctuations are observed intermittently in the force (and the current) every 0.35-0.72 nm, which are attributed to individual nucleotides translating through the nanopore in a turnstile-like motion.
Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa
2018-01-01
Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225
Noise-gating to Clean Astrophysical Image Data
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeForest, C. E.
I present a family of algorithms to reduce noise in astrophysical images and image sequences, preserving more information from the original data than is retained by conventional techniques. The family uses locally adaptive filters (“noise gates”) in the Fourier domain to separate coherent image structure from background noise based on the statistics of local neighborhoods in the image. Processing of solar data limited by simple shot noise or by additive noise reveals image structure not easily visible in the originals, preserves photometry of observable features, and reduces shot noise by a factor of 10 or more with little to nomore » apparent loss of resolution. This reveals faint features that were either not directly discernible or not sufficiently strongly detected for quantitative analysis. The method works best on image sequences containing related subjects, for example movies of solar evolution, but is also applicable to single images provided that there are enough pixels. The adaptive filter uses the statistical properties of noise and of local neighborhoods in the data to discriminate between coherent features and incoherent noise without reference to the specific shape or evolution of those features. The technique can potentially be modified in a straightforward way to exploit additional a priori knowledge about the functional form of the noise.« less
Novák, Karel; Pikousová, Jitka; Czerneková, Vladimíra; Mátlová, Věra
2017-07-03
The allelic variants of immunity genes in historical breeds likely reflect local infection pressure and therefore represent a reservoir for breeding. Screening to determine the diversity of the Toll-like receptor gene TLR4 was conducted in two conserved cattle breeds: Czech Red and Czech Red Pied. High-throughput sequencing of pooled PCR amplicons using the PacBio platform revealed polymorphisms, which were subsequently confirmed via genotyping techniques. Eight SNPs found in coding and adjacent regions were grouped into 18 haplotypes, representing a significant portion of the known diversity in the global breed panel and presumably exceeding diversity in production populations. Notably, the ancient Czech Red breed appeared to possess greater haplotype diversity than the Czech Red Pied breed, a Simmental variant, although the haplotype frequencies might have been distorted by significant crossbreeding and bottlenecks in the history of Czech Red cattle. The differences in haplotype frequencies validated the phenotypic distinctness of the local breeds. Due to the availability of Czech Red Pied production herds, the effect of intensive breeding on TLR diversity can be evaluated in this model. The advantages of the Pacific Biosciences technology for the resequencing of long PCR fragments with subsequent direct phasing were independently validated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schofield, Michael M.; Jain, Sunit; Porat, Daphne
Ecteinascidin 743 (ET-743, Yondelis) is a clinically approved chemotherapeutic natural product isolated from the Caribbean mangrove tunicate Ecteinascidia turbinata. Researchers have long suspected that a microorganism may be the true producer of the anti-cancer drug, but its genome has remained elusive due to our inability to culture the bacterium in the laboratory using standard techniques. Here, we sequenced and assembled the complete genome of the ET-743 producer, Candidatus Endoecteinascidia frumentensis, directly from metagenomic DNA isolated from the tunicate. Analysis of the ~631 kb microbial genome revealed strong evidence of an endosymbiotic lifestyle and extreme genome reduction. Phylogenetic analysis suggested thatmore » the producer of the anti-cancer drug is taxonomically distinct from other sequenced microorganisms and could represent a new family of Gammaproteobacteria. The complete genome has also greatly expanded our understanding of ET-743 production and revealed new biosynthetic genes dispersed across more than 173 kb of the small genome. The gene cluster’s architecture and its preservation demonstrate that the drug is likely essential to the interactions of the microorganism with its mangrove tunicate host. In conclusion, taken together, these studies elucidate the lifestyle of a unique, and pharmaceutically-important microorganism and highlight the wide diversity of bacteria capable of making potent natural products.« less
Noise-gating to Clean Astrophysical Image Data
NASA Astrophysics Data System (ADS)
DeForest, C. E.
2017-04-01
I present a family of algorithms to reduce noise in astrophysical images and image sequences, preserving more information from the original data than is retained by conventional techniques. The family uses locally adaptive filters (“noise gates”) in the Fourier domain to separate coherent image structure from background noise based on the statistics of local neighborhoods in the image. Processing of solar data limited by simple shot noise or by additive noise reveals image structure not easily visible in the originals, preserves photometry of observable features, and reduces shot noise by a factor of 10 or more with little to no apparent loss of resolution. This reveals faint features that were either not directly discernible or not sufficiently strongly detected for quantitative analysis. The method works best on image sequences containing related subjects, for example movies of solar evolution, but is also applicable to single images provided that there are enough pixels. The adaptive filter uses the statistical properties of noise and of local neighborhoods in the data to discriminate between coherent features and incoherent noise without reference to the specific shape or evolution of those features. The technique can potentially be modified in a straightforward way to exploit additional a priori knowledge about the functional form of the noise.
Schofield, Michael M.; Jain, Sunit; Porat, Daphne; ...
2015-07-21
Ecteinascidin 743 (ET-743, Yondelis) is a clinically approved chemotherapeutic natural product isolated from the Caribbean mangrove tunicate Ecteinascidia turbinata. Researchers have long suspected that a microorganism may be the true producer of the anti-cancer drug, but its genome has remained elusive due to our inability to culture the bacterium in the laboratory using standard techniques. Here, we sequenced and assembled the complete genome of the ET-743 producer, Candidatus Endoecteinascidia frumentensis, directly from metagenomic DNA isolated from the tunicate. Analysis of the ~631 kb microbial genome revealed strong evidence of an endosymbiotic lifestyle and extreme genome reduction. Phylogenetic analysis suggested thatmore » the producer of the anti-cancer drug is taxonomically distinct from other sequenced microorganisms and could represent a new family of Gammaproteobacteria. The complete genome has also greatly expanded our understanding of ET-743 production and revealed new biosynthetic genes dispersed across more than 173 kb of the small genome. The gene cluster’s architecture and its preservation demonstrate that the drug is likely essential to the interactions of the microorganism with its mangrove tunicate host. In conclusion, taken together, these studies elucidate the lifestyle of a unique, and pharmaceutically-important microorganism and highlight the wide diversity of bacteria capable of making potent natural products.« less
Rai, A; Tripathi, S; Kushwaha, R; Singh, P; Srivastava, P; Sanyal, S; Bandyopadhyay, S
2014-01-30
The peroxisome proliferator-activated receptor gamma (PPARγ), a group of ligand-activated transcriptional factors, is expressed in glial fibrillary acidic protein (GFAP)-immunoreactive astrocytes. Here, we investigated the role of PPARγ in regulating GFAP using a mixture of As, Cd and Pb (metal mixture, MM) that induces apoptosis and aberrant morphology in rat brain astrocytes. We observed a phospho PPARγ (serine 112 (S112)) (p-PPARγ (S112))-mediated downregulation of GFAP in the MM-exposed astrocytes. We validated this using pure PPARγ agonist, troglitazone (TZ). As reported with MM, TZ induced astrocyte damage owing to reduced GFAP. In silico analysis in the non-coding region of GFAP gene revealed two PPARγ response elements (PPREs); inverted repeat 10 and direct repeat 1 sequences. Gel shift and chromatin immunoprecipitation assays demonstrated enhancement in binding of p-PPARγ (S112) to the sequences, and luciferase reporter assay revealed strong repression of GFAP via PPREs, in response to both MM and TZ. This indicated that suppression in GFAP indeed occurs through direct regulation of these elements by p-PPARγ (S112). Signaling studies proved that MM, as well as TZ, activated the cyclin-dependent kinase 5 (CDK5) and enhanced its interaction with PPARγ resulting into increased p-PPARγ (S112). The p-CDK5 levels were dependent on proximal activation of extracellular signal-regulated protein kinase 1/2 and downstream Jun N-terminal kinase. Taken together, these results are the first to delineate downregulation of GFAP through genomic and non-genomic signaling of PPARγ. It also brings forth a resemblance of TZ with MM in terms of astrocyte disarray in developing brain.
Milia, Maria Grazia; Cerutti, Francesco; Gregori, Gabriella; Burdino, Elisa; Allice, Tiziano; Ruggiero, Tina; Proia, Maria; De Rosa, Giulia; Enrico, Eugenia; Lipani, Filippo; Di Perri, Giovanni; Ghisetti, Valeria
2013-11-01
Enteroviruses (EVs) are common human viral pathogens, causing a variety of diseases, including aseptic meningitis. Recently, EV aseptic meningitis outbreaks have been reported across Europe, but, in Italy, knowledge of recent EV molecular epidemiology is very limited. We report an outbreak of EV aseptic meningitis in 10 adults in North-Western Italy, from October to November 2012. Patients were parents or close relatives of children <5 years old attending the same class of a nursery school, suffering from a mild febrile upper respiratory disease. Phylogenetic relationship with other European circulating strains was analyzed updating E30 circulation in Italy in recent years. EVs were detected from cerebrospinal fluid (CSF) specimens with a real-time reverse transcription polymerase chain reaction and virus isolation was achieved from rectal and pharyngeal swabs. For cluster definition and phylogenetic studies, viral VP1 region was directly amplified and sequenced from CSF. EVs were identified in CSF from all patients and from rectal and pharyngeal swabs in 7 of them. Direct sequencing of CSF revealed the presence of the same Echovirus 30 (E30) in all patients and phylogenetic analysis identified it as a diverging clade within E30 genotype VII, the most recent strain circulating in UK, Finland and Denmark since 2006. Molecular techniques allowed the rapid identification and typing of E30 from CSF. Phylogenetic analysis revealed that the cluster might be due to a new E30 variant within the genotype VII currently circulating in Europe, thus updating the epidemiology of EV circulation in Italy. Copyright © 2013 Elsevier B.V. All rights reserved.
Häger, K P; Wind, C
1997-06-15
Subunit monomers and oligomers of crystalloid-type legumins are major components of SDS-soluble fractions from Metasequoia glyptostroboides (Dawn redwood, Taxodiaceae) seed proteins. The subunits are made up of disulfide linked alpha-polypeptides and beta-polypeptides with molecular masses of 33 kDa and 23-25 kDa, respectively. Unusually for legumins, those from Metasequoia are glycosylated and the carbohydrate moieties are residing in the C-terminal region of the respective beta-polypeptides. A Metasequoia endosperm cDNA library has been constructed and legumin-encoding transcripts representing two divergent gene subfamilies have been characterized. Intersubfamily comparisons reveal 75% identity at the amino acid level and the values range from 53-35% when the legumin precursors deduced were compared with those from angiosperms. The predicted sequences together with data from amino acid sequencing prove that post-translational processing of Metasequoia prolegumins is directed to two different processing sites, each of them specific for one of the legumin subfamilies. The sites involved differ in their relative position and in the junction to be cleaved: Metasequoia legumin precursors MgLeg18 and MgLeg26 contain the conventional post-translational Asn-Gly processing site, which is generally regarded as highly conserved. In contrast, the MgLeg4 precursor is lacking this site and post-translational cleavage is directed to an unusual Asn-Thr processing site located in its hypervariable region, causing N-terminal extension of the beta-polypeptide relative to those hitherto known. Evidence is given that the unusual variant of processing also occurs in other conifers. Phylogenetic analysis reveals the precursors concerned as representatives of a distinct legumin subfamily, originating from duplication of an ancestral gene prior to or at the beginning of Taxodiaceae diversification.
LGI1 microdeletion in autosomal dominant lateral temporal epilepsy
Fanciulli, M.; Santulli, L.; Errichiello, L.; Barozzi, C.; Tomasi, L.; Rigon, L.; Cubeddu, T.; de Falco, A.; Rampazzo, A.; Michelucci, R.; Uzzau, S.; Striano, S.; de Falco, F.A.; Striano, P.
2012-01-01
Objectives: To characterize clinically and genetically a family with autosomal dominant lateral temporal epilepsy (ADLTE) negative to LGI1 exon sequencing test. Methods: All participants were personally interviewed and underwent neurologic examination. Most affected subjects underwent EEG and neuroradiologic examinations (CT/MRI). Available family members were genotyped with the HumanOmni1-Quad v1.0 single nucleotide polymorphism (SNP) array beadchip and copy number variations (CNVs) were analyzed in each subject. LGI1 gene dosage was performed by real-time quantitative PCR (qPCR). Results: The family had 8 affected members (2 deceased) over 3 generations. All of them showed GTC seizures, with focal onset in 6 and unknown onset in 2. Four patients had focal seizures with auditory features. EEG showed only minor sharp abnormalities in 3 patients and MRI was unremarkable in all the patients examined. Three family members presented major depression and anxiety symptoms. Routine LGI1 exon sequencing revealed no point mutation. High-density SNP array CNV analysis identified a genomic microdeletion about 81 kb in size encompassing the first 4 exons of LGI1 in all available affected members and in 2 nonaffected carriers, which was confirmed by qPCR analysis. Conclusions: This is the first microdeletion affecting LGI1 identified in ADLTE. Families with ADLTE in which no point mutations are revealed by direct exon sequencing should be screened for possible genomic deletion mutations by CNV analysis or other appropriate methods. Overall, CNV analysis of multiplex families may be useful for identifying microdeletions in novel disease genes. PMID:22496201
Rodrigues, Bruno Leite; Carvalho-Costa, Luís Fernando; Pinto, Israel de Souza; Rebêlo, José Manuel Macário
2018-03-17
Sand fly (Diptera: Psychodidae) taxonomy is complex and time-consuming, which hampers epidemiological efforts directed toward controlling leishmaniasis in endemic regions such as northeastern Brazil. Here, we used a fragment of the mitochondrial cytochrome c oxidase I (COI) gene to identify sand fly species in Maranhão State (northeastern Brazil) and to assess cryptic diversity occurring at different spatial scales. For this, we obtained 148 COI sequences of 15 sand fly species (10 genera) from Maranhão (fine spatial scale), and joined them to COI sequences from other Brazilian localities (distant about 2,000 km from Maranhão, broad spatial scale) available in GenBank. We revealed cases of cryptic diversity in sand flies both at fine (Lutzomyia longipalpis (Lutz and Neiva) and Evandromyia termitophila (Martins, Falcão and Silva)) and broad spatial scales (Migonemyia migonei (França), Pressatia choti (Floch and Abonnenc), Psychodopygus davisi (Root), Sciopemyia sordellii (Shannon and Del Ponte), and Bichromomyia flaviscutellata (Mangabeira)). We argue that in the case of Bi. flaviscutellata, the cryptic diversity is associated with a putative new species. Cases in which DNA taxonomy was not as effective as morphological identification possibly involved recent speciation and/or introgressive hybridization, highlighting the need for integrative approaches to identify some sand fly species. Finally, we provide the first barcode sequences for four species (Brumptomyia avellari (Costa Lima), Evandromyia infraspinosa (Mangabeira), Evandromyia evandroi (Costa Lima and Antunes), and Psychodopygus complexus (Mangabeira)), which will be useful for further molecular identification of neotropical species.
Rennick, Linda J; Duprex, W Paul; Rima, Bert K
2007-10-01
Transcription from morbillivirus genomes commences at a single promoter in the 3' non-coding terminus, with the six genes being transcribed sequentially. The 3' and 5' untranslated regions (UTRs) of the genes (mRNA sense), together with the intergenic trinucleotide spacer, comprise the non-coding sequences (NCS) of the virus and contain the conserved gene end and gene start signals, respectively. Bicistronic minigenomes containing transcription units (TUs) encoding autofluorescent reporter proteins separated by measles virus (MV) NCS were used to give a direct estimation of gene expression in single, living cells by assessing the relative amounts of each fluorescent protein in each cell. Initially, five minigenomes containing each of the MV NCS were generated. Assays were developed to determine the amount of each fluorescent protein in cells at both cell population and single-cell levels. This revealed significant variations in gene expression between cells expressing the same NCS-containing minigenome. The minigenome containing the M/F NCS produced significantly lower amounts of fluorescent protein from the second TU (TU2), compared with the other minigenomes. A minigenome with a truncated F 5' UTR had increased expression from TU2. This UTR is 524 nt longer than the other MV 5' UTRs. Insertions into the 5' UTR of the enhanced green fluorescent protein gene in the minigenome containing the N/P NCS showed that specific sequences, rather than just the additional length of F 5' UTR, govern this decreased expression from TU2.
The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system
Vonk, Freek J.; Casewell, Nicholas R.; Henkel, Christiaan V.; Heimberg, Alysha M.; Jansen, Hans J.; McCleary, Ryan J. R.; Kerkkamp, Harald M. E.; Vos, Rutger A.; Guerreiro, Isabel; Calvete, Juan J.; Wüster, Wolfgang; Woods, Anthony E.; Logan, Jessica M.; Harrison, Robert A.; Castoe, Todd A.; de Koning, A. P. Jason; Pollock, David D.; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B.; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S.; Ribeiro, José M. C.; Arntzen, Jan W.; van den Thillart, Guido E. E. J. M.; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P.; Spaink, Herman P.; Duboule, Denis; McGlinn, Edwina; Kini, R. Manjunatha; Richardson, Michael K.
2013-01-01
Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection. PMID:24297900
Quantitative microbiome profiling links gut community variation to microbial load.
Vandeputte, Doris; Kathagen, Gunter; D'hoe, Kevin; Vieira-Silva, Sara; Valles-Colomer, Mireia; Sabino, João; Wang, Jun; Tito, Raul Y; De Commer, Lindsey; Darzi, Youssef; Vermeire, Séverine; Falony, Gwen; Raes, Jeroen
2017-11-23
Current sequencing-based analyses of faecal microbiota quantify microbial taxa and metabolic pathways as fractions of the sample sequence library generated by each analysis. Although these relative approaches permit detection of disease-associated microbiome variation, they are limited in their ability to reveal the interplay between microbiota and host health. Comparative analyses of relative microbiome data cannot provide information about the extent or directionality of changes in taxa abundance or metabolic potential. If microbial load varies substantially between samples, relative profiling will hamper attempts to link microbiome features to quantitative data such as physiological parameters or metabolite concentrations. Saliently, relative approaches ignore the possibility that altered overall microbiota abundance itself could be a key identifier of a disease-associated ecosystem configuration. To enable genuine characterization of host-microbiota interactions, microbiome research must exchange ratios for counts. Here we build a workflow for the quantitative microbiome profiling of faecal material, through parallelization of amplicon sequencing and flow cytometric enumeration of microbial cells. We observe up to tenfold differences in the microbial loads of healthy individuals and relate this variation to enterotype differentiation. We show how microbial abundances underpin both microbiota variation between individuals and covariation with host phenotype. Quantitative profiling bypasses compositionality effects in the reconstruction of gut microbiota interaction networks and reveals that the taxonomic trade-off between Bacteroides and Prevotella is an artefact of relative microbiome analyses. Finally, we identify microbial load as a key driver of observed microbiota alterations in a cohort of patients with Crohn's disease, here associated with a low-cell-count Bacteroides enterotype (as defined through relative profiling).
Photometric and structural properties of NGC 6544: A combined VVV-Hubble space telescope study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cohen, Roger E.; Mauro, Francesco; Geisler, Doug
We combine archival Hubble Space Telescope imaging with wide-field near-infrared photometry to study the neglected metal-poor Galactic globular cluster NGC 6544. A high spatial resolution map of differential reddening over the inner portion of the cluster is constructed, revealing variations of up to half of the total reddening, and the resulting corrected color-magnitude diagrams reveal a sparse blue horizontal branch and centrally concentrated blue straggler population, verified via relative proper motions. Using the corrected photometry to investigate the cluster distance, reddening, and age via direct comparison to well-calibrated photometry of clusters with similar metallicities, we estimate (m – M){sub 0}more » = 11.96, E(B – V) = 0.79, and an age coeval with M13 to within the relevant uncertainties. Although our data are insufficient to place tight constraints on the reddening law toward NGC 6544, we find no strong evidence that it is non-standard at optical or near-infrared wavelengths. We also provide near-infrared fiducial sequences extending nearly 2 mag below the cluster main sequence turnoff, generated from a statistically decontaminated sample of cluster stars. Lastly, we redetermine the cluster center and construct a radial number density profile which is well fit by an atypically flat power law with a slope of about 1.7. We discuss this result, together with a flattened main sequence luminosity function and inverted mass function, in the context of mass segregation and tidal stripping via interactions with Milky Way potential.« less
Bäumer, Sebastian; Lentes, Sabine; Gottschalk, Gerhard; Deppenmeier, Uwe
2002-01-01
Analysis of genome sequence data from the methanogenic archaeon Methanosarcina mazei Gö1 revealed the existence of two open reading frames encoding proton-translocating pyrophosphatases (PPases). These open reading frames are linked by a 750-bp intergenic region containing TC-rich stretches and are transcribed in opposite directions. The corresponding polypeptides are referred to as Mvp1 and Mvp2 and consist of 671 and 676 amino acids, respectively. Both enzymes represent extremely hydrophobic, integral membrane proteins with 15 predicted transmembrane segments and an overall amino acid sequence similarity of 50.1%. Multiple sequence alignments revealed that Mvp1 is closely related to eukaryotic PPases, whereas Mvp2 shows highest homologies to bacterial PPases. Northern blot experiments with RNA from methanol-grown cells harvested in the mid-log growth phase indicated that only Mvp2 was produced under these conditions. Analysis of washed membranes showed that Mvp2 had a specific activity of 0.34 U mg (protein)–1. Proton translocation experiments with inverted membrane vesicles prepared from methanol-grown cells showed that hydrolysis of 1 mol of pyrophosphate was coupled to the translocation of about 1 mol of protons across the cytoplasmic membrane. Appropriate conditions for mvp1 expression could not be determined yet. The pyrophosphatases of M. mazei Gö1 represent the first examples of this enzyme class in methanogenic archaea and may be part of their energy-conserving system. Abbreviations: DCCD, N,N′-dicyclohexylcarbodiimide; PPase, inorganic pyrophosphatase; PPi, inorganic pyrophosphate; Δp, proton motive force. PMID:15803653
The TGA codons are present in the open reading frame of selenoprotein P cDNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hill, K.E.; Lloyd, R.S.; Read, R.
1991-03-11
The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less
Jabbar, Abdul; Papini, Roberto; Ferrini, Nadia; Gasser, Robin B
2012-10-01
A 9 year-old male, neutered cat with a history of a sudden onset of lethargy, anorexia and respiratory distress was presented in a veterinary practice in Lucca, Italy. A clinical examination revealed that the cat was severely dehydrated, and had pale mucous membranes and tachypnoea. No pain or discomfort was detected at the time of physical examination. The cat was administered fluids, antibiotics and supportive therapy, but died overnight. The owner of the cat requested for a post mortem examination to be conducted. At necropsy, acephalic structures, consistent with proliferative tapeworm (cestode) larvae, were detected in the thoracic cavity on pleural surfaces. As these larvae could not be identified to genus or species by microscopy, a PCR-based sequencing-phylogenetic approach was used. Part of the cytochrome c oxidase subunit 1 gene was PCR-amplified from genomic DNAs from five individual larvae and sequenced; all five sequences obtained were identical. This consensus sequence was aligned (over 355 nucleotide positions) with homologous sequences representing a range of cestodes (including Echinococcus granulosus, Echinococcus multilocularis, Hymenolepis microstoma, Mesocestoides spp. and Taenia saginata) from previously published studies and then subjected to phylogenetic analysis. The sequence representing the larval cestode from the affected cat grouped, with strong statistical support, with those representing Mesocestoides corti and Mesocestoides lineatus. Therefore, a definitive diagnosis of pleural proliferative larval mesocestoidiasis could be made. This study illustrates the value of using molecular tools to directly assist clinical and pathological investigations of cestodiases of animals. Copyright © 2012 Elsevier B.V. All rights reserved.
Evaluation of the genetic diversity of Plum pox virus in a single plum tree.
Predajňa, Lukáš; Šubr, Zdeno; Candresse, Thierry; Glasa, Miroslav
2012-07-01
Genetic diversity of Plum pox virus (PPV) and its distribution within a single perennial woody host (plum, Prunus domestica) has been evaluated. A plum tree was triply infected by chip-budding with PPV-M, PPV-D and PPV-Rec isolates in 2003 and left to develop untreated under open field conditions. In September 2010 leaf and fruit samples were collected from different parts of the tree canopy. A 745-bp NIb-CP fragment of PPV genome, containing the hypervariable region encoding the CP N-terminal end was amplified by RT-PCR from each sample and directly sequenced to determine the dominant sequence. In parallel, the PCR products were cloned and a total of 105 individual clones were sequenced. Sequence analysis revealed that after 7 years of infection, only PPV-M was still detectable in the tree and that the two other isolates (PPV-Rec and PPV-D) had been displaced. Despite the fact that the analysis targeted a relatively short portion of the genome, a substantial amount of intra-isolate variability was observed for PPV-M. A total of 51 different haplotypes could be identified from the 105 individual sequences, two of which were largely dominant. However, no clear-cut structuration of the viral population by the tree architecture could be highlighted although the results obtained suggest the possibility of intra-leaf/fruit differentiation of the viral population. Comparison of the consensus sequence with the original source isolate showed no difference, suggesting within-plant stability of this original isolate under open field conditions. Copyright © 2012 Elsevier B.V. All rights reserved.
Direct and Indirect Influence of Altruistic Behavior in a Social Network.
Liu, Pei-Pei; Safin, Vasiliy; Yang, Barry; Luhmann, Christian C
2015-01-01
Prior research has suggested that recipients of generosity behave more generously themselves (a direct social influence). In contrast, there is conflicting evidence about the existence of indirect influence (i.e., whether interacting with a recipient of generosity causes one to behave more generously), casting doubt on the possibility that altruistic behavior can cascade through social networks. The current study investigated how far selfish and generous behavior can be transmitted through social networks and the cognitive mechanisms that underlie such transmission. Participants played a sequence of public goods games comprising a chain network. This network is advantageous because it permits only a single, unambiguous path of influence. Furthermore, we experimentally manipulated the behavior of the first link in the chain to be either generous or selfish. Results revealed the presence of direct social influence, but no evidence for indirect influence. Results also showed that selfish behavior exerted a substantially greater influence than generous behavior. Finally, expectations about future partners' behavior strongly mediated the observed social influence, suggesting an adaptive basis for such influence.
Rocher, Solen; Jean, Martine; Castonguay, Yves; Belzile, François
2015-01-01
Genotyping-by-sequencing (GBS) is a relatively low-cost high throughput genotyping technology based on next generation sequencing and is applicable to orphan species with no reference genome. A combination of genome complexity reduction and multiplexing with DNA barcoding provides a simple and affordable way to resolve allelic variation between plant samples or populations. GBS was performed on ApeKI libraries using DNA from 48 genotypes each of two heterogeneous populations of tetraploid alfalfa (Medicago sativa spp. sativa): the synthetic cultivar Apica (ATF0) and a derived population (ATF5) obtained after five cycles of recurrent selection for superior tolerance to freezing (TF). Nearly 400 million reads were obtained from two lanes of an Illumina HiSeq 2000 sequencer and analyzed with the Universal Network-Enabled Analysis Kit (UNEAK) pipeline designed for species with no reference genome. Following the application of whole dataset-level filters, 11,694 single nucleotide polymorphism (SNP) loci were obtained. About 60% had a significant match on the Medicago truncatula syntenic genome. The accuracy of allelic ratios and genotype calls based on GBS data was directly assessed using 454 sequencing on a subset of SNP loci scored in eight plant samples. Sequencing depth in this study was not sufficient for accurate tetraploid allelic dosage, but reliable genotype calls based on diploid allelic dosage were obtained when using additional quality filtering. Principal Component Analysis of SNP loci in plant samples revealed that a small proportion (<5%) of the genetic variability assessed by GBS is able to differentiate ATF0 and ATF5. Our results confirm that analysis of GBS data using UNEAK is a reliable approach for genome-wide discovery of SNP loci in outcrossed polyploids. PMID:26115486
Louis, Ed
2011-01-01
In the early days of the yeast genome sequencing project, gene annotation was in its infancy and suffered the problem of many false positive annotations as well as missed genes. The lack of other sequences for comparison also prevented the annotation of conserved, functional sequences that were not coding. We are now in an era of comparative genomics where many closely related as well as more distantly related genomes are available for direct sequence and synteny comparisons allowing for more probable predictions of genes and other functional sequences due to conservation. We also have a plethora of functional genomics data which helps inform gene annotation for previously uncharacterised open reading frames (ORFs)/genes. For Saccharomyces cerevisiae this has resulted in a continuous updating of the gene and functional sequence annotations in the reference genome helping it retain its position as the best characterized eukaryotic organism's genome. A single reference genome for a species does not accurately describe the species and this is quite clear in the case of S. cerevisiae where the reference strain is not ideal for brewing or baking due to missing genes. Recent surveys of numerous isolates, from a variety of sources, using a variety of technologies have revealed a great deal of variation amongst isolates with genome sequence surveys providing information on novel genes, undetectable by other means. We now have a better understanding of the extant variation in S. cerevisiae as a species as well as some idea of how much we are missing from this understanding. As with gene annotation, comparative genomics enhances the discovery and description of genome variation and is providing us with the tools for understanding genome evolution, adaptation and selection, and underlying genetics of complex traits.
Kantak, Shailesh S; Mummidisetty, Chaithanya K; Stinear, James W
2012-09-01
Implicit and explicit memory systems for motor skills compete with each other during and after motor practice. Primary motor cortex (M1) is known to be engaged during implicit motor learning, while dorsal premotor cortex (PMd) is critical for explicit learning. To elucidate the neural substrates underlying the interaction between implicit and explicit memory systems, adults underwent a randomized crossover experiment of anodal transcranial direct current stimulation (AtDCS) applied over M1, PMd or sham stimulation during implicit motor sequence (serial reaction time task, SRTT) practice. We hypothesized that M1-AtDCS during practice will enhance online performance and offline learning of the implicit motor sequence. In contrast, we also hypothesized that PMd-AtDCS will attenuate performance and retention of the implicit motor sequence. Implicit sequence performance was assessed at baseline, at the end of acquisition (EoA), and 24 h after practice (retention test, RET). M1-AtDCS during practice significantly improved practice performance and supported offline stabilization compared with Sham tDCS. Performance change from EoA to RET revealed that PMd-AtDCS during practice attenuated offline stabilization compared with M1-AtDCS and sham stimulation. The results support the role of M1 in implementing online performance gains and offline stabilization for implicit motor sequence learning. In contrast, enhancing the activity within explicit motor memory network nodes such as the PMd during practice may be detrimental to offline stabilization of the learned implicit motor sequence. These results support the notion of competition between implicit and explicit motor memory systems and identify underlying neural substrates that are engaged in this competition. © 2012 The Authors. European Journal of Neuroscience © 2012 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.
V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B
2016-12-01
Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.
Piri, Fahimeh; Zarei Mahmoudabadi, Ali; Ronagh, Ali; Ahmadi, Bahram; Makimura, Koichi; Rezaei-Matehkolaei, Ali
2018-06-26
Conventional direct microscopy with potassium hydroxide (KOH) and culture were found to lack the ability to establish a fast and specific diagnosis of dermatophytosis. A pan-dermatophyte nested-PCR assay was developed using a novel primer pair targeting the translation elongation factor 1-α (Tef-1α) sequences for direct detection and identification of most veterinary relevant dermatophytes in animal samples suspected to dermatophytosis. A total of 140 animal skin and hair samples were subjected to direct microscopy, culture, and ITS-RFLP/ITS-sequencing of culture isolates for the detection and identification of dermatophytosis agents. Nested-PCR sequencing was performed on all the extracted DNAs using a commercial kit after dissolving the specimens by mechanical beating. Nested-PCR was positive in 90% of samples, followed by direct microscopy (85.7%) and culture (75%). The degree of agreement between nested-PCR and direct microscopy (94.4%) was higher than with culture (83.3%). In 105 culture positive cases, the measures of agreement for the identification of dermatophytosis agents were as follows: 100% between nested-PCR sequencing and ITS-RFLP/ITS-sequencing and 63.8% between nested-PCR sequencing and culture. The developed nested-PCR was faster as well as more sensitive and specific than conventional methods for detection and identification of dermatophytes in clinical samples, which was particularly suitable for epidemiological studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Evaluation of microbial community in hydrothermal field by direct DNA sequencing
NASA Astrophysics Data System (ADS)
Kawarabayasi, Y.; Maruyama, A.
2002-12-01
Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.
A candidate gene for X-linked Ocular Albinism (OA1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bassi, M.T.; Schiaffino, V.; Rugarli, E.
1994-09-01
Ocular Albinism of the Nettleship-Fall type 1 (OA1) is the most common form of ocular albinism. It is transmitted as an X-linked recessive trait with affected males showing severe reduction of visual acuity, nystagmus, strabismus, photophobia. Ophthalmologic examination reveals foveal hypoplasia, hypopigmentation of the retina and iris translucency. Microscopic examination of melanocytes suggests that the underlying defect in OA1 is an abnormality in melanosome formation. Recently we assembled a 350 kb cosmid contig spanning the entire critical region on Xp22.3, which measures approximately 110 kb. A minimum set of cosmids was used to identify transcribed sequences using both cDNA selectionmore » and exon amplification. Two putative exons recovered by exon amplification strategy were found to be highly conserved throughout evolution and, therefore, they were used as probes for the screening of fetal and adult retina cDNA libraries. This led to the isolation of clones spanning a full-length cDNA which measures 7.6 kb. Sequence analysis revealed that the predicted protein product shows homology with syntrophines and a Xenopus laevis apical protein. The gene covers approximately 170 kb of DNA and spans the entire critical region for OA1, being deleted in two patients with contiguous gene deletion including OA1 and in one patient with isolated OA1. Therefore, this new gene represents a very strong candidate for involvement in OA1 (an alternative, but unlikely possibility to be considered is that the true OA1 gene lies within an intron of the former). Northern analysis revealed very high level of expression in retina and melanoma. Unlike most Xp22.3 genes, this gene is conserved in the mouse. We are currently performing SSCP analysis and direct sequencing of exons on DNAs from approximately 60 unrelated patients with OA1 for mutation detection.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burakova, Ludmila P.; Natashin, Pavel V.; Markova, Svetlana V.
The full-length cDNA genes encoding five new isoforms of Ca2 +-regulated photoprotein mitrocomin from a small tissue sample of the outer bell margin containing photocytes of only one specimen of the luminous jellyfish Mitrocoma cellularia were cloned, sequenced, and characterized after their expression in Escherichia coli and subsequent purification. The analysis of cDNA nucleotide sequences encoding mitrocomin isoforms allowed suggestion that two isoforms might be the products of two allelic genes differing in one amino acid residue (64R/Q) whereas other isotypes appear as a result of transcriptional mutations. In addition, the crystal structure of mitrocomin was determined at 1.30 Åmore » resolution which expectedly revealed a high similarity with the structures of other hydromedusan photoproteins. Although mitrocomin isoforms reveal a high degree of identity of amino acid sequences, they vary in specific bioluminescence activities. At that, all isotypes displayed the identical bioluminescence spectra (473–474 nm with no shoulder at 400 nm). Fluorescence spectra of Ca2 +-discharged mitrocomins were almost identical to their light emission spectra similar to the case of Ca2 +-discharged aequorin, but different from Ca2 +-discharged obelins and clytin which fluorescence is red-shifted by 25–30 nm from bioluminescence spectra. The main distinction of mitrocomin from other hydromedusan photoproteins is an additional Tyr at the C-terminus. Using site-directed mutagenesis, we showed that this Tyr is not important for bioluminescence because its deletion even increases specific activity and efficiency of apo-mitrocomin conversion into active photoprotein, in contrast to C-terminal Pro of other photoproteins. Since genes in a population generally exist as different isoforms, it makes us anticipate the cloning of even more isoforms of mitrocomin and other hydromedusan photoproteins with different bioluminescence properties.« less
Yu, Fang; Cai, Wenping; Jiang, Beizhan; Xu, Laijun; Liu, Shangfeng; Zhao, Shouliang
2018-01-01
Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhattacharya, Monolekha; Das, Amit Kumar, E-mail: amitk@hijli.iitkgp.ernet.in
Highlights: Black-Right-Pointing-Pointer The regulatory sequences recognized by TcrX have been identified. Black-Right-Pointing-Pointer The regulatory region comprises of inverted repeats segregated by 30 bp region. Black-Right-Pointing-Pointer The mode of binding of TcrX with regulatory sequence is unique. Black-Right-Pointing-Pointer In silico TcrX-DNA docked model binds one of the inverted repeats. Black-Right-Pointing-Pointer Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has notmore » been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by {approx}30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.« less
Mela, Francesca; Fritsche, Kathrin; Boersma, Hidde; van Elsas, Jan D; Bartels, Daniela; Meyer, Folker; de Boer, Wietse; van Veen, Johannes A; Leveau, Johan H J
2008-10-01
Plasmid pTer331 from the bacterium Collimonas fungivorans Ter331 is a new member of the pIPO2/pSB102 family of environmental plasmids. The 40 457-bp sequence of pTer331 codes for 44 putative ORFs, most of which represent genes involved in replication, partitioning and transfer of the plasmid. We confirmed that pTer331 is stably maintained in its native host. Deletion analysis identified a mini-replicon capable of replicating autonomously in Escherichia coli and Pseudomonas putida. Furthermore, plasmid pTer331 was able to mobilize and retromobilize IncQ plasmid pSM1890 at typical rates of 10(-4) and 10(-8), respectively. Analysis of the 91% DNA sequence identity between pTer331 and pIPO2 revealed functional conservation of coding sequences, the deletion of DNA fragments flanked by short direct repeats (DR), and sequence preservation of long DRs. In addition, we experimentally established that pTer331 has no obvious contribution in several of the phenotypes that are characteristic of its host C. fungivorans Ter331, including the ability to efficiently colonize plant roots. Based on our findings, we hypothesize that cryptic plasmids such as pTer331 and pIPO2 might not confer an individual advantage to bacteria, but, due to their broad-host-range and ability to retromobilize, benefit bacterial populations by accelerating the intracommunal dissemination of the mobile gene pool.
Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W
2011-05-01
Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Coat protein sequences of 33 Potyvirus isolates from legume and Passiflora spp. were sequenced to determine the identity of infecting viruses. Phylogenetic analysis of the sequences revealed the presence of seven distinct virus species....
Meza-Joya, Fabio Leonardo; Ramos-Pallares, Eliana Patricia; Ramírez-Pinilla, Martha Patricia
2013-07-01
Over the last century, the morphogenesis of the vertebral column has been considered as a highly conserved process among anurans. This statement is based on the study of few metamorphic taxa, ignoring the role of developmental mechanisms underlying the evolution of specialized life-histories. Direct development in anurans has been regarded as evolutionarily derived and involves developmental recapitulation and repatterning at different levels in all amphibian taxa studied so far. Herein, we analyze the vertebral column morphogenesis of the direct-developing frog Eleutherodactylus johnstonei, describing the sequence of chondrification and ossification, based on cleared and double-stained specimens from early stage embryos to adults. In general, our results show that the morphogenesis of the vertebral column in E. johnstonei recapitulates the ancestral tadpole-like pattern of development. However, the analysis of the sequence of events using heterochrony plots shows important heterocronies relative to metamorphic species, such as a delay in the chondrification of the vertebral centra and in osteogenesis. These ontogenetic peculiarities may represent derived traits in direct-developing frogs and are possibly correlated with its unusual life history. In addition, several features of the vertebral column of E. johnstonei are highly variable from its typical morphology. We report some malformations and small deviations, which do not seem to affect the survival of individuals. These anomalies have also been found in other frogs, and include many vertebral defects, such as vertebral fusion, and vertebral preclusion and/or induction. Copyright © 2013 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Araki, E.; Saffer, D. M.; Kopf, A.; To, A.; Ide, S.; Nakano, M.; Kimura, T.; Machida, Y.
2016-12-01
Seismic behavior of the thrust zone in trench side of the seismically coupled plate interface in the Nankai Trough is poorly understood because shore based seismic and geodetic observation does not have enough sensitivity to detect slow activity in the area. In these years, we constructed dense seafloor observation network in combination with pore-fluid pressure, strain, and seismic sensing in IODP deep boreholes (C0002G and C0010A) and 20+ seafloor broadband seismometers cabled to the observation network called DONET for long-term continuous observation in the To-Nankai area of the Nankai Trough, south of Japan. Analysis of the seismic records from DONET seafloor seismometer and pore-fluid pressure records from the boreholes in the period from Jan. 2011 to Apr. 2016 revealed the activities of the slow slip events (SSE), low frequency tremor (LFT), and very low frequency earthquakes (VLFE) in the observation network, detecting seven sequence of pore-fluid pressure transients in these boreholes representing SSEs and many LFT and VLFEs from seismic records. Some of the SSE sequence accompanies active LFT swarms in the regions offshore of the locked seismogenic zone. Some of the pressure transient initiate precedent to the LFT swarms, as well as some does not accompany obvious LFT activity, as if the SSE occurs "silently", suggesting LFT does not express SSE but LFT seems activated by the SSE. This is also supported by change of SSE pressure transient rate in accordance with LFT activity, observed in sequences in Mar. 2011, Oct. 2015, and April 2016. In the Oct. 2015 sequence, observed pressure transient in two boreholes indicates the slip propagates updip in the shallow subduction zone. In many sequences including this sequence, we ientify that the LFT swarm tends to migrate updip direction. The pressure transient in Apr. 2016 also followed this tendency, initiating from co-seismic compression by Apr. 1 earthquake occurred downdip side of the boreholes, followed by further compression due to the after slip, and slow release of the pressure suggesting SSE along with very active LFT and VLFE activities migrating offshore direction in the following two weeks period. The SSE seemed further activated by teleseismic events Kumamoto earthquake in Apr. 17.
Nonpareil 3: Fast Estimation of Metagenomic Coverage and Sequence Diversity.
Rodriguez-R, Luis M; Gunturu, Santosh; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T
2018-01-01
Estimations of microbial community diversity based on metagenomic data sets are affected, often to an unknown degree, by biases derived from insufficient coverage and reference database-dependent estimations of diversity. For instance, the completeness of reference databases cannot be generally estimated since it depends on the extant diversity sampled to date, which, with the exception of a few habitats such as the human gut, remains severely undersampled. Further, estimation of the degree of coverage of a microbial community by a metagenomic data set is prohibitively time-consuming for large data sets, and coverage values may not be directly comparable between data sets obtained with different sequencing technologies. Here, we extend Nonpareil, a database-independent tool for the estimation of coverage in metagenomic data sets, to a high-performance computing implementation that scales up to hundreds of cores and includes, in addition, a k -mer-based estimation as sensitive as the original alignment-based version but about three hundred times as fast. Further, we propose a metric of sequence diversity ( N d ) derived directly from Nonpareil curves that correlates well with alpha diversity assessed by traditional metrics. We use this metric in different experiments demonstrating the correlation with the Shannon index estimated on 16S rRNA gene profiles and show that N d additionally reveals seasonal patterns in marine samples that are not captured by the Shannon index and more precise rankings of the magnitude of diversity of microbial communities in different habitats. Therefore, the new version of Nonpareil, called Nonpareil 3, advances the toolbox for metagenomic analyses of microbiomes. IMPORTANCE Estimation of the coverage provided by a metagenomic data set, i.e., what fraction of the microbial community was sampled by DNA sequencing, represents an essential first step of every culture-independent genomic study that aims to robustly assess the sequence diversity present in a sample. However, estimation of coverage remains elusive because of several technical limitations associated with high computational requirements and limiting statistical approaches to quantify diversity. Here we described Nonpareil 3, a new bioinformatics algorithm that circumvents several of these limitations and thus can facilitate culture-independent studies in clinical or environmental settings, independent of the sequencing platform employed. In addition, we present a new metric of sequence diversity based on rarefied coverage and demonstrate its use in communities from diverse ecosystems.
Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman
2016-11-02
Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence
2013-06-01
Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.
Trinh, T. Q.; Sinden, R. R.
1993-01-01
We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478
Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M
2004-01-01
Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051
Kim, Hoon; Zheng, Siyuan; Amini, Seyed S.; Virk, Selene M.; Mikkelsen, Tom; Brat, Daniel J.; Grimsby, Jonna; Sougnez, Carrie; Muller, Florian; Hu, Jian; Sloan, Andrew E.; Cohen, Mark L.; Van Meir, Erwin G.; Scarpace, Lisa; Laird, Peter W.; Weinstein, John N.; Lander, Eric S.; Gabriel, Stacey; Getz, Gad; Meyerson, Matthew; Chin, Lynda; Barnholtz-Sloan, Jill S.
2015-01-01
Glioblastoma (GBM) is a prototypical heterogeneous brain tumor refractory to conventional therapy. A small residual population of cells escapes surgery and chemoradiation, resulting in a typically fatal tumor recurrence ∼7 mo after diagnosis. Understanding the molecular architecture of this residual population is critical for the development of successful therapies. We used whole-genome sequencing and whole-exome sequencing of multiple sectors from primary and paired recurrent GBM tumors to reconstruct the genomic profile of residual, therapy resistant tumor initiating cells. We found that genetic alteration of the p53 pathway is a primary molecular event predictive of a high number of subclonal mutations in glioblastoma. The genomic road leading to recurrence is highly idiosyncratic but can be broadly classified into linear recurrences that share extensive genetic similarity with the primary tumor and can be directly traced to one of its specific sectors, and divergent recurrences that share few genetic alterations with the primary tumor and originate from cells that branched off early during tumorigenesis. Our study provides mechanistic insights into how genetic alterations in primary tumors impact the ensuing evolution of tumor cells and the emergence of subclonal heterogeneity. PMID:25650244
Ma, Xueyan; Panjikar, Santosh; Koepke, Juergen; Loris, Elke; Stöckigt, Joachim
2006-01-01
The enzyme strictosidine synthase (STR1) from the Indian medicinal plant Rauvolfia serpentina is of primary importance for the biosynthetic pathway of the indole alkaloid ajmaline. Moreover, STR1 initiates all biosynthetic pathways leading to the entire monoterpenoid indole alkaloid family representing an enormous structural variety of ∼2000 compounds in higher plants. The crystal structures of STR1 in complex with its natural substrates tryptamine and secologanin provide structural understanding of the observed substrate preference and identify residues lining the active site surface that contact the substrates. STR1 catalyzes a Pictet-Spengler–type reaction and represents a novel six-bladed β-propeller fold in plant proteins. Structure-based sequence alignment revealed a common repetitive sequence motif (three hydrophobic residues are followed by a small residue and a hydrophilic residue), indicating a possible evolutionary relationship between STR1 and several sequence-unrelated six-bladed β-propeller structures. Structural analysis and site-directed mutagenesis experiments demonstrate the essential role of Glu-309 in catalysis. The data will aid in deciphering the details of the reaction mechanism of STR1 as well as other members of this enzyme family. PMID:16531499
Ma, Xueyan; Panjikar, Santosh; Koepke, Juergen; Loris, Elke; Stöckigt, Joachim
2006-04-01
The enzyme strictosidine synthase (STR1) from the Indian medicinal plant Rauvolfia serpentina is of primary importance for the biosynthetic pathway of the indole alkaloid ajmaline. Moreover, STR1 initiates all biosynthetic pathways leading to the entire monoterpenoid indole alkaloid family representing an enormous structural variety of approximately 2000 compounds in higher plants. The crystal structures of STR1 in complex with its natural substrates tryptamine and secologanin provide structural understanding of the observed substrate preference and identify residues lining the active site surface that contact the substrates. STR1 catalyzes a Pictet-Spengler-type reaction and represents a novel six-bladed beta-propeller fold in plant proteins. Structure-based sequence alignment revealed a common repetitive sequence motif (three hydrophobic residues are followed by a small residue and a hydrophilic residue), indicating a possible evolutionary relationship between STR1 and several sequence-unrelated six-bladed beta-propeller structures. Structural analysis and site-directed mutagenesis experiments demonstrate the essential role of Glu-309 in catalysis. The data will aid in deciphering the details of the reaction mechanism of STR1 as well as other members of this enzyme family.
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
The Essential Genome of Escherichia coli K-12
2018-01-01
ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657
Ferriol, I; Silva Junior, D M; Nigg, J C; Zamora-Macorra, E J; Falk, B W
2016-11-01
Torradoviruses, family Secoviridae, are emergent bipartite RNA plant viruses. RNA1 is ca. 7kb and has one open reading frame (ORF) encoding for the protease, helicase and RNA-dependent RNA polymerase (RdRp). RNA2 is ca. 5kb and has two ORFs. RNA2-ORF1 encodes for a putative protein with unknown function(s). RNA2-ORF2 encodes for a putative movement protein and three capsid proteins. Little is known about the replication and polyprotein processing strategies of torradoviruses. Here, the cleavage sites in the RNA2-ORF2-encoded polyproteins of two torradoviruses, Tomato marchitez virus isolate M (ToMarV-M) and tomato chocolate spot virus, were determined by N-terminal sequencing, revealing that the amino acid (aa) at the -1 position of the cleavage sites is a glutamine. Multiple aa sequence comparison confirmed that this glutamine is conserved among other torradoviruses. Finally, site-directed mutagenesis of conserved aas in the ToMarV-M RdRp and protease prevented substantial accumulation of viral coat proteins or RNAs. Copyright © 2016 Elsevier Inc. All rights reserved.
Microbial diversity in ikaite tufa columns: an alkaline, cold ecological niche in Greenland.
Stougaard, Peter; Jørgensen, Flemming; Johnsen, Mads G; Hansen, Ole C
2002-08-01
Ikaite tufa columns from the Ikka Fjord in south-western Greenland constitute a natural, stable environment at low temperature and with a pH ranging from neutral at the exterior to very alkaline (pH 10.4) at the interior of the column. Phylogenetic analysis of culturable organisms revealed ten different isolates representing three of the major bacterial divisions. Nine of the isolates showed 94-99% similarity to known sequences, whereas one isolate displayed a low degree of similarity (less than 90%) to a Cyclobacterium species. Seven of the isolates were shown to be cold active alkaliphiles, whereas three isolates showed optimal growth at neutral pH. Phylogenetic analysis of DNA isolated directly from the ikaite material demonstrated the presence of a microbial flora more diverse than the culturable isolates. Whereas approximately half of the phylotypes showed 90-99% similarity to known meso- or thermophilic alkaliphiles, the rest of the sequences displayed less than 90% similarity when compared to known 16S rRNA gene sequences in databases. Thus, in the present paper, we demonstrate that ikaite columns that host a specialized macroscopic flora and fauna also contain a unique, cold active, alkaliphilic microflora.
Genome sequencing and secondary metabolism of the postharvest pathogen Penicillium griseofulvum.
Banani, Houda; Marcet-Houben, Marina; Ballester, Ana-Rosa; Abbruscato, Pamela; González-Candelas, Luis; Gabaldón, Toni; Spadaro, Davide
2016-01-05
Penicillium griseofulvum is associated in stored apples with blue mould, the most important postharvest disease of pome fruit. This pathogen can simultaneously produce both detrimental and beneficial secondary metabolites (SM). In order to gain insight into SM synthesis in P. griseofulvum in vitro and during disease development on apple, we sequenced the genome of P. griseofulvum strain PG3 and analysed important SM clusters. PG3 genome sequence (29.3 Mb) shows that P. griseofulvum branched off after the divergence of P. oxalicum but before the divergence of P. chrysogenum. Genome-wide analysis of P. griseofulvum revealed putative gene clusters for patulin, griseofulvin and roquefortine C biosynthesis. Furthermore, we quantified the SM production in vitro and on apples during the course of infection. The expression kinetics of key genes of SM produced in infected apple were examined. We found additional SM clusters, including those potentially responsible for the synthesis of penicillin, yanuthone D, cyclopiazonic acid and we predicted a cluster putatively responsible for the synthesis of chanoclavine I. These findings provide relevant information to understand the molecular basis of SM biosynthesis in P. griseofulvum, to allow further research directed to the overexpression or blocking the synthesis of specific SM.
Protospacer Adjacent Motif (PAM)-Distal Sequences Engage CRISPR Cas9 DNA Target Cleavage
Ethier, Sylvain; Schmeing, T. Martin; Dostie, Josée; Pelletier, Jerry
2014-01-01
The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5′NGG3′ protospacer adjacent motifs (PAM). Yet among 43 ChIP-seq sites harboring seed regions analyzed for mutational status, we find editing only at the intended on-target locus and one off-target site. In vitro analysis of target site recognition revealed that interactions between the 5′ end of the guide and PAM-distal target sequences are necessary to efficiently engage Cas9 nucleolytic activity, providing an explanation for why off-target editing is significantly lower than expected from ChIP-seq data. PMID:25275497
Frantz, Laurent A F; Madsen, Ole; Megens, Hendrik-Jan; Groenen, Martien A M; Lohse, Konrad
2014-01-01
In many temperate regions, ice ages promoted range contractions into refugia resulting in divergence (and potentially speciation), while warmer periods led to range expansions and hybridization. However, the impact these climatic oscillations had in many parts of the tropics remains elusive. Here, we investigate this issue using genome sequences of three pig (Sus) species, two of which are found on islands of the Sunda-shelf shallow seas in Island South-East Asia (ISEA). A previous study revealed signatures of interspecific admixture between these Sus species (Genome biology,14, 2013, R107). However, the timing, directionality and extent of this admixture remain unknown. Here, we use a likelihood-based model comparison to more finely resolve this admixture history and test whether it was mediated by humans or occurred naturally. Our analyses suggest that interspecific admixture between Sunda-shelf species was most likely asymmetric and occurred long before the arrival of humans in the region. More precisely, we show that these species diverged during the late Pliocene but around 23% of their genomes have been affected by admixture during the later Pleistocene climatic transition. In addition, we show that our method provides a significant improvement over D-statistics which are uninformative about the direction of admixture. PMID:25294645
Nagashima-type palmoplantar keratosis in a Chinese Han population
Zhang, Jia; Zhang, Guolong; Ni, Cheng; Cheng, Ruhong; Liang, Jianying; Li, Ming; Yao, Zhirong
2016-01-01
Nagashima-type palmoplantar keratosis (NPPK) is an autosomal recessive form of palmoplantar keratoderma (PPK), which is caused by mutations in the SERPINB7 gene. NPPK has only been reported in Japanese and Chinese populations. The present study was conducted on 12 unrelated Chinese patients who were clinically predicted to suffer from NPPK. Mutation screening was performed by direct sequencing of the entire coding regions of SERPINB7, SLURP1, AQP5, CSTA, KRT1 and KRT9 genes. Direct sequencing of SERPINB7 revealed five homozygous founder mutations (c.796C>T) and four compound heterozygous mutations in nine patients, including one novel mutation (c.122_127delTGGTCC). Nine out of the 12 patients were diagnosed with NPPK due to SERPINB7 pathogenic mutations, and the results expanded the known mutation spectrum of NPPK. Taking the other seven reported Chinese patients, who had been definitively diagnosed with NPPK by genetic testing, into account, the present study further demonstrated that NPPK is a common entity in Mainland China, and c.796C>T is the most prevalent mutation and exerts a founder effect. Furthermore, the NPPK cases described in the current study presented a consistently mild phenotype, as compared with the degrees of phenotypic variability associated with other types of relatively severe PPK, including Mal de Meleda and Olmsted syndrome. PMID:27666198
Novel Tay-Sachs disease mutations from China.
Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F
1992-01-01
We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.
Son, S J; Park, M R; Ryu, S D; Maburutse, B E; Oh, N S; Park, J; Oh, S; Kim, Y
2016-11-01
This study aimed to develop an in vivo screening platform using Caenorhabditis elegans to identify a novel bacteriocin for controlling the mastitis-causing pathogen Staphylococcus aureus strain RF122 in dairy cows. Using Bacillus spp. isolated from traditional Korean foods, we developed a direct in vivo screening platform that uses 96-well plates and fluorescence image analysis. We identified a novel bacteriocin produced by Bacillus licheniformis strain 146 (lichenicin 146) with a high in vivo antimicrobial activity using our liquid C. elegans-Staph. aureus assay. We also determined the characteristics of lichenicin 146 using liquid chromatography-mass spectrometry and confirmed that it shared homologous sequences with bacteriocin family proteins. In addition, RNA-sequencing analysis revealed genes encoding cell surface or membrane proteins (SAB0993c, SAB0150, SAB0994c, and SAB2375c) that are involved in the bactericidal activity of lichenicin 146 against Staph. aureus strain RF122 infection as well as those encoding transcriptional regulators (SAB0844c and SAB0133). Thus, our direct in vivo screening platform facilitates simple, convenient, cost-effective, and reliable screening of potential antimicrobial compounds with applications in the dairy field. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Flexible ex vivo phantoms for validation of diffusion tensor tractography on a clinical scanner.
Watanabe, Makoto; Aoki, Shigeki; Masutani, Yoshitaka; Abe, Osamu; Hayashi, Naoto; Masumoto, Tomohiko; Mori, Harushi; Kabasawa, Hiroyuki; Ohtomo, Kuni
2006-11-01
The aim of this study was to develop ex vivo diffusion tensor (DT) flexible phantoms. Materials were bundles of textile threads of cotton, monofilament nylon, rayon, and polyester bunched with spiral wrapping bands and immersed in water. DT images were acquired on a 1.5-Tesla clinical magnetic resonance scanner using echo planar imaging sequences with 15 motion probing gradient directions. DT tractography with seeding and a line-tracking method was carried out by software originally developed on a PC-based workstation. We observed relatively high fractional anisotropy on the polyester phantom and were able to reconstruct tractography. Straight tracts along the bundle were displayed when it was arranged linearly. It was easy to bend arcuately or bifurcate at one end; and tracts followed the course of the bundle, whether it was curved or branched and had good agreement with direct visual observation. Tractography with the other fibers was unsuccessful. The polyester phantom revealed a diffusion anisotropic structure according to its shape and would be utilizable repeatedly under the same conditions, differently from living central neuronal system. It would be useful to validate DT sequences and to optimize an algorithm or parameters of DT tractography software. Additionally, the flexibility of the phantom would enable us to model human axonal projections.
An Aromatic Sensor with Aversion to Damaged Strands Confers Versatility to DNA Repair
Maillard, Olivier; Solyom, Szilvia; Naegeli, Hanspeter
2007-01-01
It was not known how xeroderma pigmentosum group C (XPC) protein, the primary initiator of global nucleotide excision repair, achieves its outstanding substrate versatility. Here, we analyzed the molecular pathology of a unique Trp690Ser substitution, which is the only reported missense mutation in xeroderma patients mapping to the evolutionary conserved region of XPC protein. The function of this critical residue and neighboring conserved aromatics was tested by site-directed mutagenesis followed by screening for excision activity and DNA binding. This comparison demonstrated that Trp690 and Phe733 drive the preferential recruitment of XPC protein to repair substrates by mediating an exquisite affinity for single-stranded sites. Such a dual deployment of aromatic side chains is the distinctive feature of functional oligonucleotide/oligosaccharide-binding folds and, indeed, sequence homologies with replication protein A and breast cancer susceptibility 2 protein indicate that XPC displays a monomeric variant of this recurrent interaction motif. An aversion to associate with damaged oligonucleotides implies that XPC protein avoids direct contacts with base adducts. These results reveal for the first time, to our knowledge, an entirely inverted mechanism of substrate recognition that relies on the detection of single-stranded configurations in the undamaged complementary sequence of the double helix. PMID:17355181
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea
Didi, Jennifer; Ergani, Ayla; Lima, Sandra
2016-01-01
ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.
Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry
2017-02-01
Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.
Alterations of the Transcriptome of Sulfolobus acidocaldarius by Exoribonuclease aCPSF2
Märtens, Birgit; Amman, Fabian; Manoharadas, Salim; Zeichen, Lukas; Orell, Alvaro; Albers, Sonja-Verena; Hofacker, Ivo; Bläsi, Udo
2013-01-01
Recent studies identified a 5´ to 3´ exoribonuclease termed Sso-RNase J in the crenarchaeon Sulfolobus solfataricus (Sso), which has been reclassified to the aCPSF2 (archaeal cleavage and polyadenylation specificity factor 2) group of β-CASP proteins. In this study, the Sso-aCPSF2 orthologue of Sulfolobus acidocaldarius (Saci-aCPSF2) was functionally characterized. Like Sso-aCPSF2, Saci-aCPSF2 degrades RNA with 5´ to 3´ directionality in vitro. To address the biological significance of Saci-aCPSF2, a deletion mutant was constructed, and the influence of Saci-aCPSF2 on the transcriptome profile was assessed employing high throughput RNA sequencing. This analysis revealed 560 genes with differential transcript abundance, suggesting a considerable role of this enzyme in RNA metabolism. In addition, bioinformatic analyses revealed several transcripts that are preferentially degraded at the 5´ end. This was exemplarily verified for two transcripts by Northern-blot analyses, showing for the first time that aCPSF2 proteins play a role in 5' to 3' directional mRNA decay in the crenarchaeal clade of Archaea. PMID:24116119
Allmér, Johan; Vasiliauskas, Rimvis; Ihrmark, Katarina; Stenlid, Jan; Dahlberg, Anders
2006-01-01
Wood-inhabiting fungi play a key role in forest ecosystems and constitute an essential part of forest biodiversity. We therefore examined the composition and abundance of wood-inhabiting fungi by three methods: sporocarp counts, mycelial culturing and direct amplification of internal transcribed spacer terminal restriction fragment length polymorphism from wood combined with sequencing of reference rDNA. Seven-year-old slash piles left after a thinning were analyzed in a 50-year-old Norway spruce plantation. Fifty-eight fungal species were detected from the piled branches and treetops. More species were revealed by sporocarp counts and cultured mycelia than by direct amplification from wood. In principle, sporocarp monitoring may reveal all fruiting taxa, but it poorly reflects their relative abundance in the wood. In contrast, terminal restriction fragment length polymorphism will record the most frequent fungal taxa in the wood, but it may overlook uncommon taxa. Culturing mycelia from wood gives a bias towards species favoured by the cultural medium. The results demonstrate the advantage and the limitations of these methods to be considered in analyses of fungal communities in wood.
Accetto, Tomaž; Avguštin, Gorazd
2011-01-01
The Shine-Dalgarno (SD) sequence is a key element directing the translation to initiate at the authentic start codons and also enabling translation initiation to proceed in 5′ untranslated mRNA regions (5′-UTRs) containing moderately strong secondary structures. Bioinformatic analysis of almost forty genomes from the major bacterial phylum Bacteroidetes revealed, however, a general absence of SD sequence, drop in GC content and consequently reduced tendency to form secondary structures in 5′-UTRs. The experiments using the Prevotella bryantii TC1-1 expression system were in agreement with these findings: neither addition nor omission of SD sequence in the unstructured 5′-UTR affected the level of the reporter protein, non-specific nuclease NucB. Further, NucB level in P. bryantii TC1-1, contrary to hMGFP level in Escherichia coli, was five times lower when SD sequence formed part of the secondary structure with a folding energy -5,2 kcal/mol. Also, the extended SD sequences did not affect protein levels as in E. coli. It seems therefore that a functional SD interaction does not take place during the translation initiation in P. bryanttii TC1-1 and possibly other members of phylum Bacteroidetes although the anti SD sequence is present in 16S rRNA genes of their genomes. We thus propose that in the absence of the SD sequence interaction, the selection of genuine start codons in Bacteroidetes is accomplished by binding of ribosomal protein S1 to unstructured 5′-UTR as opposed to coding region which is inaccessible due to mRNA secondary structure. Additionally, we found that sequence logos of region preceding the start codons may be used as taxonomical markers. Depending on whether complete sequence logo or only part of it, such as information content and base proportion at specific positions, is used, bacterial genera or families and in some cases even bacterial phyla can be distinguished. PMID:21857964
Cysteine-containing peptide tag for site-specific conjugation of proteins
Backer, Marina V.; Backer, Joseph M.
2008-04-08
The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.
Cysteine-containing peptide tag for site-specific conjugation of proteins
Backer, Marina V.; Backer, Joseph M.
2010-10-05
The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.
Digital gene expression for non-model organisms
Hong, Lewis Z.; Li, Jun; Schmidt-Küntzel, Anne; Warren, Wesley C.; Barsh, Gregory S.
2011-01-01
Next-generation sequencing technologies offer new approaches for global measurements of gene expression but are mostly limited to organisms for which a high-quality assembled reference genome sequence is available. We present a method for gene expression profiling called EDGE, or EcoP15I-tagged Digital Gene Expression, based on ultra-high-throughput sequencing of 27-bp cDNA fragments that uniquely tag the corresponding gene, thereby allowing direct quantification of transcript abundance. We show that EDGE is capable of assaying for expression in >99% of genes in the genome and achieves saturation after 6–8 million reads. EDGE exhibits very little technical noise, reveals a large (106) dynamic range of gene expression, and is particularly suited for quantification of transcript abundance in non-model organisms where a high-quality annotated genome is not available. In a direct comparison with RNA-seq, both methods provide similar assessments of relative transcript abundance, but EDGE does better at detecting gene expression differences for poorly expressed genes and does not exhibit transcript length bias. Applying EDGE to laboratory mice, we show that a loss-of-function mutation in the melanocortin 1 receptor (Mc1r), recognized as a Mendelian determinant of yellow hair color in many different mammals, also causes reduced expression of genes involved in the interferon response. To illustrate the application of EDGE to a non-model organism, we examine skin biopsy samples from a cheetah (Acinonyx jubatus) and identify genes likely to control differences in the color of spotted versus non-spotted regions. PMID:21844123
Groves, Ryan A.; Hagel, Jillian M.; Zhang, Ye; Kilpatrick, Korey; Levy, Asaf; Marsolais, Frédéric; Lewinsohn, Efraim; Sensen, Christoph W.; Facchini, Peter J.
2015-01-01
Amphetamine analogues are produced by plants in the genus Ephedra and by khat (Catha edulis), and include the widely used decongestants and appetite suppressants (1S,2S)-pseudoephedrine and (1R,2S)-ephedrine. The production of these metabolites, which derive from L-phenylalanine, involves a multi-step pathway partially mapped out at the biochemical level using knowledge of benzoic acid metabolism established in other plants, and direct evidence using khat and Ephedra species as model systems. Despite the commercial importance of amphetamine-type alkaloids, only a single step in their biosynthesis has been elucidated at the molecular level. We have employed Illumina next-generation sequencing technology, paired with Trinity and Velvet-Oases assembly platforms, to establish data-mining frameworks for Ephedra sinica and khat plants. Sequence libraries representing a combined 200,000 unigenes were subjected to an annotation pipeline involving direct searches against public databases. Annotations included the assignment of Gene Ontology (GO) terms used to allocate unigenes to functional categories. As part of our functional genomics program aimed at novel gene discovery, the databases were mined for enzyme candidates putatively involved in alkaloid biosynthesis. Queries used for mining included enzymes with established roles in benzoic acid metabolism, as well as enzymes catalyzing reactions similar to those predicted for amphetamine alkaloid metabolism. Gene candidates were evaluated based on phylogenetic relationships, FPKM-based expression data, and mechanistic considerations. Establishment of expansive sequence resources is a critical step toward pathway characterization, a goal with both academic and industrial implications. PMID:25806807