A perspective of gene therapy in the glaucomas.

PubMed

Kaufman, P L; Jia, W W; Tan, J; Chen, Z; Gabelt, B T; Booth, V; Tufaro, F; Cynader, M

1999-06-01

Gene therapy in the anterior and posterior segment tissues may have the potential to favorably influence aqueous hydrodynamics and retinal ganglion cell biology, thereby preventing, delaying, or minimizing glaucomatous damage to the optic nerve. We demonstrated the feasibility of using a herpes viral vector (ribonucleotide reductase defective HSV-1, hrR3) to deliver the lacZ reporter gene to living cat and rat eyes. Cats received injections into the anterior chamber and rats into the vitreous cavity. In cats, lacZ expression was detectable at 1 to 2 days in the anterior outer portion of the ciliary muscle and the lining of the intertrabecular spaces of the corneoscleral and uveal meshwork. Rat eyes showed lacZ expression in the retinal pigment epithelium and photoreceptor outer segments 2 days after injection.

Progress in gene targeting and gene therapy for retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farrar, G.J.; Humphries, M.M.; Erven, A.

1994-09-01

Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less

Shine-Dalgarno sequence enhances the efficiency of lacZ repression by artificial anti-lac antisense RNAs in Escherichia coli.

PubMed

Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro

2010-11-01

Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Patterns of expression of position-dependent integrated transgenes in mouse embryo.

PubMed Central

Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

1990-01-01

The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells

PubMed Central

Jackson, Kathyjo A.; Majka, Susan M.; Wang, Hongyu; Pocius, Jennifer; Hartley, Craig J.; Majesky, Mark W.; Entman, Mark L.; Michael, Lloyd H.; Hirschi, Karen K.; Goodell, Margaret A.

2001-01-01

Myocyte loss in the ischemically injured mammalian heart often leads to irreversible deficits in cardiac function. To identify a source of stem cells capable of restoring damaged cardiac tissue, we transplanted highly enriched hematopoietic stem cells, the so-called side population (SP) cells, into lethally irradiated mice subsequently rendered ischemic by coronary artery occlusion for 60 minutes followed by reperfusion. The engrafted SP cells (CD34–/low, c-Kit+, Sca-1+) or their progeny migrated into ischemic cardiac muscle and blood vessels, differentiated to cardiomyocytes and endothelial cells, and contributed to the formation of functional tissue. SP cells were purified from Rosa26 transgenic mice, which express lacZ widely. Donor-derived cardiomyocytes were found primarily in the peri-infarct region at a prevalence of around 0.02% and were identified by expression of lacZ and α-actinin, and lack of expression of CD45. Donor-derived endothelial cells were identified by expression of lacZ and Flt-1, an endothelial marker shown to be absent on SP cells. Endothelial engraftment was found at a prevalence of around 3.3%, primarily in small vessels adjacent to the infarct. Our results demonstrate the cardiomyogenic potential of hematopoietic stem cells and suggest a therapeutic strategy that eventually could benefit patients with myocardial infarction. PMID:11390421

Widespread and highly persistent gene transfer to the CNS by retrovirus vector in utero: implication for gene therapy to Krabbe disease.

PubMed

Shen, Jin-Song; Meng, Xing-Li; Yokoo, Takashi; Sakurai, Ken; Watabe, Kazuhiko; Ohashi, Toya; Eto, Yoshikatsu

2005-05-01

Brain-directed prenatal gene therapy may benefit some lysosomal storage diseases that affect the central nervous system (CNS) before birth. Our previous study showed that intrauterine introduction of recombinant adenoviruses into cerebral ventricles results in efficient gene transfer to the CNS in the mouse. However, transgene expression decreased with time due to the non-integrative property of adenoviral vectors. In this study, in order to obtain permanent gene transduction, we investigated the feasibility of retrovirus-mediated in utero gene transduction. Concentrated retrovirus encoding the LacZ gene was injected into the cerebral ventricles of the embryos of normal and twitcher mice (a murine model of Krabbe disease) at embryonic day 12. The distribution and maintenance of the transgene expression in the recipient brain were analyzed histochemically, biochemically and by the quantitative polymerase chain reaction method pre- and postnatally. Efficient and highly persistent gene transduction to the brain was achieved both in normal and the twitcher mouse. Transduced neurons, astrocytes and oligodendrocytes were distributed throughout the brain. The transduced LacZ gene, its transcript and protein expression in the brain were maintained for 14 months without decrement. In addition, gene transduction to multiple tissues other than the brain was also detected at low levels. This study suggests that brain-directed in utero gene transfer using retrovirus vector may be beneficial to the treatment of lysosomal storage diseases with severe brain damage early in life, such as Krabbe disease. Copyright (c) 2005 John Wiley & Sons, Ltd.

CD133 expression is not restricted to stem cells, and both CD133+ and CD133– metastatic colon cancer cells initiate tumors

PubMed Central

Shmelkov, Sergey V.; Butler, Jason M.; Hooper, Andrea T.; Hormigo, Adilia; Kushner, Jared; Milde, Till; St. Clair, Ryan; Baljevic, Muhamed; White, Ian; Jin, David K.; Chadburn, Amy; Murphy, Andrew J.; Valenzuela, David M.; Gale, Nicholas W.; Thurston, Gavin; Yancopoulos, George D.; D’Angelica, Michael; Kemeny, Nancy; Lyden, David; Rafii, Shahin

2008-01-01

Colon cancer stem cells are believed to originate from a rare population of putative CD133+ intestinal stem cells. Recent publications suggest that a small subset of colon cancer cells expresses CD133, and that only these CD133+ cancer cells are capable of tumor initiation. However, the precise contribution of CD133+ tumor-initiating cells in mediating colon cancer metastasis remains unknown. Therefore, to temporally and spatially track the expression of CD133 in adult mice and during tumorigenesis, we generated a knockin lacZ reporter mouse (CD133lacZ/+), in which the expression of lacZ is driven by the endogenous CD133 promoters. Using this model and immunostaining, we discovered that CD133 expression in colon is not restricted to stem cells; on the contrary, CD133 is ubiquitously expressed on differentiated colonic epithelium in both adult mice and humans. Using Il10–/–CD133lacZ mice, in which chronic inflammation in colon leads to adenocarcinomas, we demonstrated that CD133 is expressed on a full gamut of colonic tumor cells, which express epithelial cell adhesion molecule (EpCAM). Similarly, CD133 is widely expressed by human primary colon cancer epithelial cells, whereas the CD133– population is composed mostly of stromal and inflammatory cells. Conversely, CD133 expression does not identify the entire population of epithelial and tumor-initiating cells in human metastatic colon cancer. Indeed, both CD133+ and CD133– metastatic tumor subpopulations formed colonospheres in in vitro cultures and were capable of long-term tumorigenesis in a NOD/SCID serial xenotransplantation model. Moreover, metastatic CD133– cells form more aggressive tumors and express typical phenotypic markers of cancer-initiating cells, including CD44 (CD44+CD24–), whereas the CD133+ fraction is composed of CD44lowCD24+ cells. Collectively, our data suggest that CD133 expression is not restricted to intestinal stem or cancer-initiating cells, and during the metastatic transition, CD133+ tumor cells might give rise to the more aggressive CD133– subset, which is also capable of tumor initiation in NOD/SCID mice. PMID:18497886

Prostate Cancer Evaluation: Design, Synthesis and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2009-10-01

NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high

Somato-synaptic variation of GABA(A) receptors in cultured murine cerebellar granule cells: investigation of the role of the alpha6 subunit.

PubMed

Mellor, J R; Wisden, W; Randall, A D

2000-07-10

Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden, W., 1997. Ligand-gated ion channel partnerships: GABA(A) receptor alpha(6) subunit inactivation inhibits delta subunit expression. Journal of Neuroscience 17, 1350-1362).

Functional conservation of atonal and Math1 in the CNS and PNS

NASA Technical Reports Server (NTRS)

Ben-Arie, N.; Hassan, B. A.; Bermingham, N. A.; Malicki, D. M.; Armstrong, D.; Matzuk, M.; Bellen, H. J.; Zoghbi, H. Y.

2000-01-01

To determine the extent to which atonal and its mouse homolog Math1 exhibit functional conservation, we inserted (beta)-galactosidase (lacZ) into the Math1 locus and analyzed its expression, evaluated consequences of loss of Math1 function, and expressed Math1 in atonal mutant flies. lacZ under the control of Math1 regulatory elements duplicated the previously known expression pattern of Math1 in the CNS (i.e., the neural tube, dorsal spinal cord, brainstem, and cerebellar external granule neurons) but also revealed new sites of expression: PNS mechanoreceptors (inner ear hair cells and Merkel cells) and articular chondrocytes. Expressing Math1 induced ectopic chordotonal organs (CHOs) in wild-type flies and partially rescued CHO loss in atonal mutant embryos. These data demonstrate that both the mouse and fly homologs encode lineage identity information and, more interestingly, that some of the cells dependent on this information serve similar mechanoreceptor functions.

Adenylyl cyclase A expression is tip-specific in Dictyostelium slugs and directs StatA nuclear translocation and CudA gene expression.

PubMed

Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P

2001-06-01

cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.

Prostate Cancer Evaluation: Design, Synthesis, and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2006-10-01

colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly...Cancer Facts and Figures, 2004. (www.cancer.org). 2. Jemal A, Thomas A, Murray T, Thun M, 2002 Cancer statistics, 2002, CA Cancer J. Clin., 52, 23-47

Troponin T3 expression in skeletal and smooth muscle is required for growth and postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wtsi) mice.

PubMed

Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M

2013-09-01

The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.

A fast-evolving human NPAS3 enhancer gained reporter expression in the developing forebrain of transgenic mice

PubMed Central

Kamm, Gretel B.; López-Leal, Rodrigo; Lorenzo, Juan R.; Franchini, Lucía F.

2013-01-01

The developmental brain gene NPAS3 stands out as a hot spot in human evolution because it contains the largest number of human-specific, fast-evolving, conserved, non-coding elements. In this paper we studied 2xHAR142, one of these elements that is located in the fifth intron of NPAS3. Using transgenic mice, we show that the mouse and chimp 2xHAR142 orthologues behave as transcriptional enhancers driving expression of the reporter gene lacZ to a similar NPAS3 expression subdomain in the mouse central nervous system. Interestingly, the human 2xHAR142 orthologue drives lacZ expression to an extended expression pattern in the nervous system. Thus, molecular evolution of 2xHAR142 provides the first documented example of human-specific heterotopy in the forebrain promoted by a transcriptional enhancer and suggests that it may have contributed to assemble the unique properties of the human brain. PMID:24218632

Transduction of ferret airway epithelia using a pre-treatment and lentiviral gene vector.

PubMed

Cmielewski, Patricia; Farrow, Nigel; Donnelley, Martin; McIntyre, Chantelle; Penny-Dimri, Jahan; Kuchel, Tim; Parsons, David

2014-11-21

The safety and efficiency of gene therapies for cystic fibrosis (CF) need to be assessed in pre-clinical models. Using the normal ferret, this study sought to determine whether ferret airway epithelia could be transduced with a lysophosphatidylcholine (LPC) pre-treatment followed by a VSV-G pseudotyped HIV-1 based lentiviral (LV) vector, in preparation for future studies in CF ferrets. Six normal ferrets (7 -8 weeks old) were treated with a 150 μL LPC pre-treatment, followed one hour later by a 500 μL LV vector dose containing the LacZ transgene. LacZ gene expression in the conducting airways and lung was assessed by X-gal staining after 7 days. The presence of transduction in the lung, as well as off-target transduction in the liver, spleen and gonads, were assessed by qPCR. The levels of LV vector p24 protein bio-distribution in blood sera were assessed by ELISA at 0, 1, 3, 5 and 7 days. The dosing protocol was well tolerated. LacZ gene expression was observed en face in the trachea of all animals. Histology showed that ciliated and basal cells were transduced in the trachea, with rare LacZ transduced single cells noted in lung. p24 levels was not detectable in the sera of 5 of the 6 animals. The LacZ gene was not detected in the lung tissue and no off-target transduction was detected by qPCR. This study shows that ferret airway epithelia are transducible using our unique two-step pre-treatment and LV vector dosing protocol. We have identified a number of unusual anatomical factors that are likely to influence the level of transduction that can be achieved in ferret airways. The ability to transduce ferret airway epithelium is a promising step towards therapeutic LV-CFTR testing in a CF ferret model.

Somatostatin receptor 2 knockout/lacZ knockin mice show impaired motor coordination and reveal sites of somatostatin action within the striatum.

PubMed

Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C

2003-05-01

The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.

N-acetylcysteine augments adenovirus-mediated gene expression in human endothelial cells by enhancing transgene transcription and virus entry.

PubMed

Jornot, L; Morris, M A; Petersen, H; Moix, I; Rochat, T

2002-01-01

It has previously been shown that oxidants reduce the efficiency of adenoviral transduction in human umbilical vein endothelial cells (HUVECs). In this study, the effect of the antioxidant N-acetylcysteine (NAC) in adenovirus-mediated gene transfer has been investigated. HUVECs were pretreated or not with NAC, and infected with E1E3-deleted adenovirus (Ad) containing the LacZ gene expressed from the RSV-LTR promoter/enhancer in the presence and absence of NAC. Transgene expression was assessed at the protein level (histochemical staining, measurement of beta-Gal activity, and western blot), mRNA level (real-time RT-PCR) and gene level (nuclear run on) 24 h and 48 h after infection. Adenoviral DNA was quantitated by real-time PCR, and cell surface expression of Coxsackie/adenovirus receptors (CAR) was determined by FACS analysis. Pretreatment of cells with NAC prior to Ad infection enhanced beta-Gal activity by two-fold due to an increase in viral DNA, which was related to increased CAR expression. When NAC was present only during the post-infection period, a five-fold increase in beta-Gal activity and LacZ gene transcriptional activity was observed. When NAC was present during both the pretreatment and the post-infection period, beta-Gal activity was further enhanced, by 15-fold. Augmentation of beta-Gal activity was paralleled by an increase in beta-Gal protein and mRNA levels. NAC did not affect the half-life of LacZ mRNA. Pretreatment with NAC prior to Ad infection enhances virus entry, while treatment with NAC post-infection increases transgene transcription. This strategy permits the use of lower adenoviral loads and thus might be helpful for gene therapy of vascular diseases. Copyright 2001 John Wiley & Sons, Ltd.

Heart valve cardiomyocytes of mouse embryos express the serotonin transporter SERT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pavone, Luigi Michele; Department of Biochemistry and Medical Biotechnologies, University of Naples Federico II, Naples; Spina, Anna

2008-12-12

Multiple evidence demonstrate a role for serotonin and its transporter SERT in heart valve development and disease. By utilizing a Cre/loxP system driven by SERT gene expression, we recently demonstrated a regionally restricted distribution of SERT-expressing cells in developing mouse heart. In order to characterize the cell types exhibiting SERT expression within the mouse heart valves at early developmental stages, in this study we performed immunohistochemistry for Islet1 (Isl1) and connexin-43 (Cx-43) on heart sections from SERT{sup Cre/+};ROSA26R embryos previously stained with X-gal. We observed the co-localization of LacZ staining with Isl1 labelling in the outflow tract, the right ventriclemore » and the conal region of E11.5 mouse heart. Cx-43 labelled cells co-localized with LacZ stained cells in the forming atrioventricular valves. These results demonstrate the cardiomyocyte phenotype of SERT-expressing cells in heart valves of the developing mouse heart, thus suggesting an active role of SERT in early heart valve development.« less

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Gene transfer as a strategy to achieve permanent cardioprotection I: rAAV-mediated gene therapy with inducible nitric oxide synthase limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Wu, Wen-Jian; Ou, Qinghui; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Chen, Ning; Dawn, Buddhadeb; Luo, Li; O'Brien, Erin; Bolli, Roberto

2011-11-01

The ultimate goal of prophylactic gene therapy is to confer permanent protection against ischemia. Although gene therapy with inducible nitric oxide synthase (iNOS) is known to protect against myocardial infarction at 3 days and up to 2 months, the long-term effects on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the iNOS gene (rAAV/iNOS), which enables long-lasting transgene expression. The ability of rAAV/iNOS to direct the expression of functional iNOS protein was confirmed in COS-7 cells before in vivo gene transfer. Mice received injections in the anterior LV wall of rAAV/LacZ or rAAV/iNOS; 1 year later, they underwent a 30-min coronary occlusion (O) and 4 h of reperfusion (R). iNOS gene transfer resulted in elevated iNOS protein expression (+3-fold vs. the LacZ group, n = 6; P < 0.05) and iNOS activity (+4.4-fold vs. the LacZ group, n = 6; P < 0.05) 1 year later. Infarct size (% of risk region) was dramatically reduced at 1 year after iNOS gene transfer (13.5 ± 2.2%, n = 12, vs. 41.7 ± 2.9%, n = 10, in the LacZ group; P < 0.05). The infarct-sparing effect of iNOS gene therapy at 1 year was as powerful as that observed 24 h after ischemic preconditioning (six 4-min O/4-min R cycles) (19.3 ± 2.3%, n = 11; P < 0.05). Importantly, compared with the LacZ group (n = 11), iNOS gene transfer (n = 10) had no effect on LV dimensions or function for up to 1 year (at 1 year: FS 34.5 ± 2.0 vs. 34.6 ± 2.6%, EF 57.0 ± 2.0 vs. 59.7 ± 2.9%, LVEDD 4.3 ± 0.1 vs. 4.2 ± 0.2 mm, LVESD 2.8 ± 0.1 vs. 2.9 ± 0.2 mm) (echocardiography). These data demonstrate, for the first time, that rAAV-mediated iNOS gene transfer affords long-term, probably permanent (1 year), cardioprotection without adverse functional consequences, providing a strong rationale for further preclinical testing of prophylactic gene therapy.

[Role of the sweet taste receptor in glucose metabolism: no sweets for diabetes?].

PubMed

Nomura, Masatoshi; Kawahara, Yuta

2015-01-01

Type 2 diabetes is closely associated with our daily diets and has become a global health problem with increasing number of patients. Maintaining energy homeostasis is essentially required for the treatment of diabetes. Energy metabolism starts with taking in a meal. Nutrients including amino acids, fatty acids and glucose in the digest have been shown to act on the neuroendocrine cells in the gastrointestinal (GI) tract, and thereby play important roles in energy homeostasis. Therefore, the GI tract is now recognized as a sensor system for nutrient signals. Taste receptor type 1 member 2 (T1R2) is known to function as a co-receptor with T1R3 to detect sweet chemicals in the taste buds. It has been proposed that the T1R2/T1R3 receptor complex acts as sweet sensor in the intestine, and plays a pivotal role in sensing sugars and maintaining glucose homeostasis through incretin secretion. To clarify the physiological roles of T1R2 in glucose homeostasis, T1r2-lacZ knock-in/knock-out mice were generated. We found lacZ gene expression in the GI tract where T1r3 expression has been reported. Interestingly, the T1r2-lacZ knock-in mice showed impaired glucose tolerance on oral glucose challenge but not on intraperitoneal injection. However, the fasting glucose level in T1r2-lacZ knock-in mice was comparable to that in wild type mice. These results suggest an important role of the sweet taste receptor system in the intestine when stimulated by glucose. Therefore, the roles of T1R2 will be presented and the mechanism for metabolic homeostasis will be discussed.

Expression of Rous sarcoma virus-derived retroviral vectors in the avian blastoderm: Potential as stable genetic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, S.T.; Stoker, A.W.; Bissell, M.J.

1991-12-01

Retroviruses are valuable tools in studies of embryonic development, both as gene expression vectors and as cell lineage markers. In this study early chicken blastoderm cells are shown to be permissive for infection by Rous sarcoma virus and derivative replication-defective by Rous sarcoma virus and derivative replication-defective vectors, and, in contrast to previously published data, these cells will readily express viral genes. In cultured blastoderm cells, Rous sarcoma virus stably integrates and is transcribed efficiently, producing infectious virus particles. Using replication-defective vectors encoding the bacterial lacZ gene, the authors further show that blastoderms can be infected in culture and inmore » ovo. In ovo, lacZ expression is seen within 24 hours of virus inoculation, and by 96 hours stably expressing clones of cells are observed in diverse tissues throughout the embryo, including epidermis, somites, and heart, as well as in extraembryonic membranes. Given the rapid onset of vector expression and the broad range of permissive cell types, it should be feasible to use Rous sarcoma virus-derived retroviruses as early lineage markers and expression vectors beginning at the blastoderm stage of avian embryogenesis.« less

Genetic Requirements for the Single-Strand Annealing Pathway of Double-Strand Break Repair in Saccharomyces Cerevisiae

PubMed Central

Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.

1996-01-01

HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880

Regulation of the glv Operon in Bacillus subtilis: YfiA (GlvR) Is a Positive Regulator of the Operon That Is Repressed through CcpA and cre

PubMed Central

Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi

2001-01-01

Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite repression requiring both CcpA and cre. PMID:11489864

A major defect in mast cell effector functions in CRACM1-/- mice

PubMed Central

Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre

2008-01-01

CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270

Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion

PubMed Central

Yang, Hua; Gan, Jean; Xie, Xiaoling; Deng, Min; Feng, Liang; Chen, Xiaowei; Gao, Zhiqiang; Gan, Lin

2010-01-01

Summary Gfi1encodes a zinc-finger transcription factor essential for the development and maintenance of haematopoiesis and the inner ear. In mouse inner ear, Gfi1 expression is confined to hair cells during development and in adulthood. To construct a genetic tool for inner ear hair cell-specific gene deletion, we generated a Gfi1-Cre mouse line by knocking-in Cre coding sequences into the Gfi1 locus and inactivating the endogenous Gfi1. The specificity and efficiency of Gfi1-Cre recombinase-mediated recombination in the developing inner ear was revealed through the expression of the conditional R26R-lacZ reporter gene. The onset of lacZ expression in the Gfi1Cre/+ inner ear was first detected at E13.5 in the vestibule and at E15.5 in the cochlea, coinciding with the generation of hair cells. Throughout inner ear development, lacZ expression was detected only in hair cells. Thus, Gfi1-Cre knock-in mouse line provides a useful tool for gene manipulations specifically in inner ear hair cells. PMID:20533399

Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2

PubMed Central

Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.

2000-01-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626

Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.

PubMed

Kume, T; Deng, K; Hogan, B L

2000-02-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

In vitro study for laser gene transfer in BHK-21 fibroblast cell line

NASA Astrophysics Data System (ADS)

Abdel Aziz, M.; Salem, D. S.; Salama, M. S.; Badr, Y.

2009-02-01

Modifications to our previously introduced system for laser microbeam cell surgery were carried out in the present work to match animal cells. These modifications included: 1- Using other laser system that used before, Excimer laser with 193 and 308 nm wavelengths. The used laser here, is He-Cd with low power and 441.5 nm wavelength in the visible region. 2- Instead of using pulsed laser, we used here CW He-Cd chopped by electrical chopper, which is synchronized with the mechanical motion of the mobile stage with step 40 microns, according to cell dimensions to avoid puncturing the same cell twice. The advantages of the modified here laser setup for gene transfer is: it is less damaging to the sensitive animal cell which has thin cell membrane. The present work aimed to: 1- Design a modified laser microbeam cell surgery, applicable to animal cells, such as fibroblast cells 2- To examine the efficiency of such system. 3- To assure gene transfer and its expression in the used cells. 4- To evaluate the ultra damages produced from using the laser beam as a modality for gene transfer. On the other wards, to introduce: safe, efficient and less damaging modality for gene transfer in animal cells. To achieve these goals, we applied the introduced here home-made laser setup with its synchronized parameters to introduce pBK-CMV phagemid, containing LacZ and neomycin resistance (neor )genes into BHK-21 fibroblast cell line. The results of the present work showed that: 1- Our modified laser microbeam cell surgery setup proved to be useful and efficient tool for gene transfer into fibroblast cells. 2- The presence and expression of LacZ gene was achieved using histochemical LacZ assay. 3- Selection of G418 antibiotic sensitivity assay confirmed the presence and expression towards stability of neor gene with time. 4- Presence of LacZ and neor genes in the genomic DNA of transfected fibroblast cells was indicated using PCR analysis. 5- Transmission electron microscopy indicated that, no ultradamages or changes for cell; membrane, organilles or any component of transfected fibroblast cell as a result of using laser microbeam compared with control cell.

Endogenous IL-33 is highly expressed in mouse epithelial barrier tissues, lymphoid organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33-LacZ gene trap reporter strain.

PubMed

Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe

2012-04-01

IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.

Naringenin Regulates Expression of Genes Involved in Cell Wall Synthesis in Herbaspirillum seropedicae▿

PubMed Central

Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.

2011-01-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805

Naringenin regulates expression of genes involved in cell wall synthesis in Herbaspirillum seropedicae.

PubMed

Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A

2011-03-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.

Single-step method for β-galactosidase assays in Escherichia coli using a 96-well microplate reader.

PubMed

Schaefer, Jorrit; Jovanovic, Goran; Kotta-Loizou, Ioly; Buck, Martin

2016-06-15

Historically, the lacZ gene is one of the most universally used reporters of gene expression in molecular biology. Its activity can be quantified using an artificial substrate, o-nitrophenyl-ß-d-galactopyranoside (ONPG). However, the traditional method for measuring LacZ activity (first described by J. H. Miller in 1972) can be challenging for a large number of samples, is prone to variability, and involves hazardous compounds for lysis (e.g., chloroform, toluene). Here we describe a single-step assay using a 96-well microplate reader with a proven alternative cell permeabilization method. This modified protocol reduces handling time by 90%. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Organization of the Indian hedgehog--parathyroid hormone-related protein system in the postnatal growth plate.

PubMed

Chau, Michael; Forcinito, Patricia; Andrade, Anenisia C; Hegde, Anita; Ahn, Sohyun; Lui, Julian C; Baron, Jeffrey; Nilsson, Ola

2011-08-01

In embryonic growth cartilage, Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) participate in a negative feedback loop that regulates chondrocyte differentiation. Postnatally, this region undergoes major structural and functional changes. To explore the organization of the Ihh–PTHrP system in postnatal growth plate, we microdissected growth plates of 7-day-old rats into their constituent zones and assessed expression of genes participating in the h–PTHrP feedback loop. Ihh, Patched 1, Smoothened, Gli1, Gli2, Gli3, and Pthr1 were expressed in regions analogous to the expression domains in embryonic growth cartilage. However, PTHrP was expressed in resting zone cartilage, a site that differs from the embryonic source, the periarticular cells. We then used mice in which lacZ has replaced coding sequences of Gli1 and thus serves as a marker for active hedgehog signaling. At 1, 4, 8, and 12 weeks of age, lacZ expression was detected in a pattern analogous to that of embryonic cartilage. The findings support the hypothesis that the embryonic Ihh–PTHrP feedback loop is maintained in the postnatal growth plate except that the source of PTHrP has shifted to a more proximal location in the resting zone.

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

Role of Spermidine in Overwintering of Cyanobacteria

PubMed Central

Zhu, Xiangzhi; Li, Qiong; Yin, Chuntao; Fang, Xiantao

2015-01-01

ABSTRACT Polyamines are found in all groups of cyanobacteria, but their role in environmental adaptation has been barely investigated. In Synechocystis sp. strain PCC 6803, inactivation of spermidine synthesis genes significantly reduced the survivability under chill (5°C)-light stress, and the survivability could be restored by addition of spermidine. To analyze the effects of spermidine on gene expression at 5°C, lacZ was expressed from the promoter of carboxy(nor)spermidine decarboxylase gene (CASDC) in Synechocystis. Synechocystis 6803::PCASDC-lacZ pretreated at 15°C showed a high level of LacZ activity for a long period of time at 5°C; without the pretreatment or with protein synthesis inhibited at 5°C, the enzyme activity gradually decreased. In a spermidine-minus mutant harboring PCASDC-lacZ, lacZ showed an expression pattern as if protein synthesis were inhibited at 5°C, even though the stability of its mRNA increased. Four other genes, including rpoA that encodes the α subunit of RNA polymerase, showed similar expression patterns. The chill-light stress led to a rapid increase of protein carbonylation in Synechocystis. The protein carbonylation then quickly returned to the background level in the wild type but continued to slowly increase in the spermidine-minus mutant. Our results indicate that spermidine promotes gene expression and replacement of damaged proteins in cyanobacteria under the chill-light stress in winter. IMPORTANCE Outbreak of cyanobacterial blooms in freshwater lakes is a worldwide environmental problem. In the annual cycle of bloom-forming cyanobacteria, overwintering is the least understood stage. Survival of Synechocystis sp. strain PCC 6803 under long-term chill (5°C)-light stress has been established as a model for molecular studies on overwintering of cyanobacteria. Here, we show that spermidine, the most common polyamine in cyanobacteria, promotes the survivability of Synechocystis under long-term chill-light stress and that the physiological function is based on its effects on gene expression and recovery from protein damage. This is the first report on the role of polyamines in survival of overwintering cyanobacteria. We also analyzed spermidine synthesis pathways in cyanobacteria on the basis of bioinformatic and experimental data. PMID:25917915

Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation

PubMed Central

Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J.; Cao, Huojun; Amendt, Brad A.

2017-01-01

The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1−/− mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. PMID:28746823

Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation.

PubMed

Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J; Cao, Huojun; Amendt, Brad A

2017-09-01

The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1 -/- mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Ephrin-B2 Reverse Signaling Is Required for Topography but Not Pattern Formation of Lateral Superior Olivary Inputs to the Inferior Colliculus

PubMed Central

Wallace, Matthew M.; Kavianpour, Sarah M.; Gabriele, Mark L.

2014-01-01

Graded and modular expressions of Eph-ephrins are known to provide positional information for the formation of topographic maps and patterning in the developing nervous system. Previously we have shown that ephrin-B2 is expressed in a continuous gradient across the tonotopic axis of the central nucleus of the inferior colliculus (CNIC), whereas patterns are discontinuous and modular in the lateral cortex of the IC (LCIC). The present study explores the involvement of ephrin-B2 signaling in the development of projections to the CNIC and LCIC arising from the lateral superior olivary nuclei (LSO) prior to hearing onset. Anterograde and retrograde fluorescent tracing methods in neonatal fixed tissue preparations were used to compare topographic mapping and the establishment of LSO layers/modules in wild-type and ephrin-B2lacZ/+ mice (severely compromised reverse signaling). At birth, pioneer LSO axons occupy the ipsilateral IC in both groups but are delayed contralaterally in ephrin-B2lacZ/+ mutants. By the onset of hearing, both wild-type and mutant projections form discernible layers bilaterally in the CNIC and modular arrangements within the ipsilateral LCIC. In contrast, ephrin-B2lacZ/+ mice lack a reliable topography in LSO-IC projections, suggesting that fully functional ephrin-B2 reverse signaling is required for normal projection mapping. Taken together, these ephrin-B2 findings paired with known coexpression of EphA4 suggest the importance of these signaling proteins in establishing functional auditory circuits prior to experience. PMID:23042409

Ephrin-B2 reverse signaling is required for topography but not pattern formation of lateral superior olivary inputs to the inferior colliculus.

PubMed

Wallace, Matthew M; Kavianpour, Sarah M; Gabriele, Mark L

2013-05-01

Graded and modular expressions of Eph-ephrins are known to provide positional information for the formation of topographic maps and patterning in the developing nervous system. Previously we have shown that ephrin-B2 is expressed in a continuous gradient across the tonotopic axis of the central nucleus of the inferior colliculus (CNIC), whereas patterns are discontinuous and modular in the lateral cortex of the IC (LCIC). The present study explores the involvement of ephrin-B2 signaling in the development of projections to the CNIC and LCIC arising from the lateral superior olivary nuclei (LSO) prior to hearing onset. Anterograde and retrograde fluorescent tracing methods in neonatal fixed tissue preparations were used to compare topographic mapping and the establishment of LSO layers/modules in wild-type and ephrin-B2(lacZ/+) mice (severely compromised reverse signaling). At birth, pioneer LSO axons occupy the ipsilateral IC in both groups but are delayed contralaterally in ephrin-B2(lacZ/+) mutants. By the onset of hearing, both wild-type and mutant projections form discernible layers bilaterally in the CNIC and modular arrangements within the ipsilateral LCIC. In contrast, ephrin-B2(lacZ/+) mice lack a reliable topography in LSO-IC projections, suggesting that fully functional ephrin-B2 reverse signaling is required for normal projection mapping. Taken together, these ephrin-B2 findings paired with known coexpression of EphA4 suggest the importance of these signaling proteins in establishing functional auditory circuits prior to experience. Copyright © 2012 Wiley Periodicals, Inc.

Targeted Deletion of the Antisilencer/Enhancer (ASE) Element from Intron 1 of the Myelin Proteolipid Protein Gene (Plp1) in Mouse Reveals that the Element Is Dispensable for Plp1 Expression in Brain during Development and Remyelination

PubMed Central

Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.

2012-01-01

Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328

A gene expression resource generated by genome-wide lacZ profiling in the mouse

PubMed Central

Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.

2015-01-01

ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943

HO-1 gene overexpression enhances the beneficial effects of superparamagnetic iron oxide labeled bone marrow stromal cells transplantation in swine hearts underwent ischemia/reperfusion: an MRI study.

PubMed

Jiang, Yibo; Chen, Lijuan; Tang, Yaoliang; Ma, Genshan; Shen, Chengxing; Qi, Chunmei; Zhu, Qi; Yao, Yuyu; Liu, Naifeng

2010-05-01

To determine the effect of intracoronary transfer of superparamagnetic iron oxide (SPIO) labeled heme oxygenase-1 (HO-1) overexpressed bone marrow stromal cells (BMSCs) in a porcine myocardial ischemia/reperfusion model. Cell apoptosis was assayed and supernatant cytokine concentrations were measured in BMSCs that underwent hypoxia/reoxygen in vitro. Female mini-swines that underwent 1 h LAD occlusion followed by 1 h reperfusion were randomly allocated to receive intracoronary saline (control), 1 x 10(7) SPIO-labeled BMSCs transfected with pcDNA3.1-Lacz plasmid (Lacz-BMSCs), pcDNA3.1-human HO-1 (HO-1-BMSCs), pcDNA3.1-hHO-1 pretreated with a HO inhibitor, tin protoporphyrin (SnPP, n = 10 each). MRI and postmortem histological analysis were made at 1 week or 3 months thereafter. Post hypoxia/reoxygen in vitro, apoptosis was significantly reduced, supernatant VEGF significantly increased while TNF-alpha and IL-6 significantly reduced in HO-1-BMSCs group compared with Lacz-BMSCs group (all p < 0.05). Myocardial expression of VEGF was significantly higher in HO-1-BMSCs than in Lacz-BMSCs group at 1 week post transplantation (all p < 0.05). Signal voids induced by the SPIO were detected in the peri-infarction region in all BMSC groups at 1 week but not at 3 months post transplantation and the extent of the hypointense signal was the highest in HO-1-BMSCs group, and histological analysis showed that signal voids represented cardiac macrophages that engulfed the SPIO-labeled BMSCs. Pretreatment with SnPP significantly attenuated the beneficial effects of HO-1-BMSCs. Transplantation of HO-1-overexpressed BMSCs significantly enhanced the beneficial effects of BMSCs on improving cardiac function in this model.

Mesenchymal-to-Epithelial Transition Contributes to Endometrial Regeneration Following Natural and Artificial Decidualization

PubMed Central

Patterson, Amanda L.; Zhang, Ling; Arango, Nelson A.; Teixeira, Jose

2013-01-01

Despite being a histologically dynamic organ, mechanisms coordinating uterine regeneration during the menstrual/estrous cycle and following parturition are poorly understood. In the current study, we hypothesized that endometrial epithelial tissue regeneration is accomplished, in part, by mesenchymal-to-epithelial transition (MET). To test this hypothesis, fate mapping studies were completed using a double transgenic (Tg) reporter strain, Amhr2-Cre; Rosa26-Stopfl/fl-EYFP (i.e., flox-stop EYFP reporter). EYFP expression was observed in Müllerian duct mesenchyme-derived stroma and myometrium, but not epithelia in young and peripubertal double Tg female mice. However, mosaic EYFP expression was observed in epithelia of double Tg mice after parturition. To ensure the observed epithelial EYFP expression was not due to leaky Amhr2 promoter activity, resulting in aberrant Cre expression, transgenic mice expressing LacZ under the control of the Amhr2 promoter (Amhr2-LacZ) were used to monitor β-galactosidase (β-Gal) activity within the uterus. β-Gal activity was not detected in luminal or glandular epithelia regardless of age, reproductive status, or degree of damage incurred within the uterus. Lastly, a unique population of transitional cells was identified that expressed the epithelial cell marker, pan-cytokeratin, and the stromal cell marker, vimentin. These cells localized predominantly to the regeneration zone in the mesometrial region of the endometrium. These findings suggest a previously unappreciated role for MET in endometrial regeneration and have important implications for proliferative diseases of the endometrium such as endometriosis. PMID:23216285

Sex- and age-dependent effects of Gpr30 genetic deletion on the metabolic and cardiovascular profiles of diet-induced obese mice.

PubMed

Meoli, Luca; Isensee, Jörg; Zazzu, Valeria; Nabzdyk, Christoph S; Soewarto, Dian; Witt, Henning; Foryst-Ludwig, Anna; Kintscher, Ulrich; Noppinger, Patricia Ruiz

2014-05-01

The G protein-coupled receptor 30 (GPR30) has been claimed as an estrogen receptor. However, the literature reports controversial findings and the physiological function of GPR30 is not fully understood yet. Consistent with studies assigning a role of GPR30 in the cardiovascular and metabolic systems, GPR30 expression has been reported in small arterial vessels, pancreas and chief gastric cells of the stomach. Therefore, we hypothesized a role of GPR30 in the onset and progression of cardiovascular and metabolic diseases. In order to test our hypothesis, we investigated the effects of a high-fat diet on the metabolic and cardiovascular profiles of Gpr30-deficient mice (GPR30-lacZ mice). We found that GPR30-lacZ female, rather than male, mice had significant lower levels of HDL along with an increase in fat liver accumulation as compared to control mice. However, two indicators of cardiac performance assessed by echocardiography, ejection fraction and fractional shortening were both decreased in an age-dependent manner only in Gpr30-lacZ male mice. Collectively our results point to a potential role of Gpr30 in preserving lipid metabolism and cardiac function in a sex- and age-dependent fashion. Copyright © 2014 Elsevier B.V. All rights reserved.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Regulatory analysis of the mouse Hoxb3 gene: multiple elements work in concert to direct temporal and spatial patterns of expression.

PubMed

Kwan, C T; Tsang, S L; Krumlauf, R; Sham, M H

2001-04-01

The expression pattern of the mouse Hoxb3 gene is exceptionally complex and dynamic compared with that of other members of the Hoxb cluster. There are multiple types of transcripts for Hoxb3 gene, and the anterior boundaries of its expression vary at different stages of development. Two enhancers flanking Hoxb3 on the 3' and 5' sides regulate Hoxb2 and Hoxb4, respectively, and these control regions define the two ends of a 28-kb interval in and around the Hoxb3 locus. To assay the regulatory potential of DNA fragments in this interval we have used transgenic analysis with a lacZ reporter gene to locate cis-elements for directing the dynamic patterns of Hoxb3 expression. Our detailed analysis has identified four new and widely spaced cis-acting regulatory regions that can together account for major aspects of the Hoxb3 expression pattern. Elements Ib, IIIa, and IVb control gene expression in neural and mesodermal tissues; element Va controls mesoderm-specific gene expression. The most anterior neural expression domain of Hoxb3 is controlled by an r5 enhancer (element IVa); element IIIa directs reporter expression in the anterior spinal cord and hindbrain up to r6, and the region A enhancer (in element I) mediates posterior neural expression. Hence, the regulation of segmental expression of Hoxb3 in the hindbrain is different from that of Hoxa3, as two separate enhancer elements contribute to expression in r5 and r6. The mesoderm-specific element (Va) directs reporter expression to prevertebra C1 at 12.5 dpc, which is the anterior limit of paraxial mesoderm expression for Hoxb3. When tested in combinations, these cis-elements appear to work as modules in an additive manner to recapitulate the major endogenous expression patterns of Hoxb3 during embryogenesis. Together our study shows that multiple control elements direct reporter gene expression in diverse tissue-, temporal-, and spatially restricted subset of the endogenous Hoxb3 expression domains and work in concert to control the neural and mesodermal patterns of expression. Copyright 2001 Academic Press.

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.

PubMed

Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi

2009-02-01

Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

VanT, a Homologue of Vibrio harveyi LuxR, Regulates Serine, Metalloprotease, Pigment, and Biofilm Production in Vibrio anguillarum

PubMed Central

Croxatto, Antony; Chalker, Victoria J.; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L.

2002-01-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum ΔvanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the ΔvanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an l-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum ΔvanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production. PMID:11872713

VanT, a homologue of Vibrio harveyi LuxR, regulates serine, metalloprotease, pigment, and biofilm production in Vibrio anguillarum.

PubMed

Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L

2002-03-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.

Isolated Anxa5{sup +}/Sca-1{sup +} perivascular cells from mouse meningeal vasculature retain their perivascular phenotype in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brachvogel, Bent; Pausch, Friederike; Farlie, Peter

2007-07-15

Pericytes are closely associated with endothelial cells, contribute to vascular stability and represent a potential source of mesenchymal progenitor cells. Using the specifically expressed annexin A5-LacZ fusion gene (Anxa5-LacZ), it became possible to isolate perivascular cells (PVC) from mouse tissues. These cells proliferate and can be cultured without undergoing senescence for multiple passages. PVC display phenotypic characteristics of pericytes, as they express pericyte-specific markers (NG2-proteoglycan, desmin, {alpha}SMA, PDGFR-{beta}). They also express stem cell marker Sca-1, whereas endothelial (PECAM), hematopoietic (CD45) or myeloid (F4/80, CD11b) lineage markers are not detectable. These characteristics are in common with the pericyte-like cell line 10T1/2.more » PVC also display a phagocytoic activity higher than 10T1/2 cells. During coculture with endothelial cells both cell types stimulate angiogenic processes indicated by an increased expression of PECAM in endothelial cells and specific deposition of basement membrane proteins. PVC show a significantly increased induction of endothelial specific PECAM expression compared to 10T1/2 cells. Accordingly, in vivo grafts of PVC aggregates onto chorioallantoic membranes of quail embryos recruit endothelial cells, get highly vascularized and deposit basement membrane components. These data demonstrate that isolated Anxa5-LacZ{sup +} PVC from mouse meninges retain their capacity for differentiation to pericyte-like cells and contribute to angiogenic processes.« less

Targeted deletion of the antisilencer/enhancer (ASE) element from intron 1 of the myelin proteolipid protein gene (Plp1) in mouse reveals that the element is dispensable for Plp1 expression in brain during development and remyelination.

PubMed

Pereira, Glauber B; Meng, Fanxue; Kockara, Neriman T; Yang, Baoli; Wight, Patricia A

2013-02-01

Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. Although removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is non-functional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. © 2012 International Society for Neurochemistry.

Targeted gene expression without a tissue-specific promoter: creating mosaic embryos using laser-induced single-cell heat shock

NASA Technical Reports Server (NTRS)

Halfon, M. S.; Kose, H.; Chiba, A.; Keshishian, H.

1997-01-01

We have developed a method to target gene expression in the Drosophila embryo to a specific cell without having a promoter that directs expression in that particular cell. Using a digitally enhanced imaging system to identify single cells within the living embryo, we apply a heat shock to each cell individually by using a laser microbeam. A 1- to 2-min laser treatment is sufficient to induce a heat-shock response but is not lethal to the heat-shocked cells. Induction of heat shock was measured in a variety of cell types, including neurons and somatic muscles, by the expression of beta-galactosidase from an hsp26-lacZ reporter construct or by expression of a UAS target gene after induction of hsGAL4. We discuss the applicability of this technique to ectopic gene expression studies, lineage tracing, gene inactivation studies, and studies of cells in vitro. Laser heat shock is a versatile technique that can be adapted for use in a variety of research organisms and is useful for any studies in which it is desirable to express a given gene in only a distinct cell or clone of cells, either transiently or constitutively, at a time point of choice.

Expression of a non-inactivating K+ channel driven by a rat heat shock promoter increased the resting potential in Aplysia silent neurons.

PubMed

Han, J H; Yim, S W; Lim, C S; Park, C W; Kaang, B K

1999-05-01

We assessed the role of a non-inactivating K+ channel (aKv5.1) in the resting potential by overexpressing this channel by heat shock in the neurons. A reporter gene lacZ linked to a promoter region spanning from the -285 to the +88 base of the rat HSP70ib gene was induced 62.5-fold when this DNA construct was microinjected into the neurons of the marine mollusk Aplysia and treated with heat shock at 30 degrees C for 3 h. Using this efficient induction system, we induced the expression of aKv5.1 by heat shock in cultured, electrically silent neurons of Aplysia and examined its effect on the resting potential. The channel expression increased the resting potential by approximately 10 mV. This increase was specific to heat shock induction and abolished by treatment with TEA, a specific K+ channel blocker. These results provide the direct evidence that a low voltage-activated, non-inactivating K+ channel can contribute to the resting potential.

Genetic Tool Development for a New Host for Biotechnology, the Thermotolerant Bacterium Bacillus coagulans▿ †

PubMed Central

Kovács, Ákos T.; van Hartskamp, Mariska; Kuipers, Oscar P.; van Kranenburg, Richard

2010-01-01

Bacillus coagulans has good potential as an industrial production organism for platform chemicals from renewable resources but has limited genetic tools available. Here, we present a targeted gene disruption system using the Cre-lox system, development of a LacZ reporter assay for monitoring gene transcription, and heterologous d-lactate dehydrogenase expression. PMID:20400555

MET Signaling Mediates Intestinal Crypt-Villus Development, Regeneration, and Adenoma Formation and Is Promoted by Stem Cell CD44 Isoforms.

PubMed

Joosten, Sander P J; Zeilstra, Jurrit; van Andel, Harmen; Mijnals, R Clinton; Zaunbrecher, Joost; Duivenvoorden, Annet A M; van de Wetering, Marc; Clevers, Hans; Spaargaren, Marcel; Pals, Steven T

2017-10-01

Resistance of metastatic human colorectal cancer cells to drugs that block epidermal growth factor (EGF) receptor signaling could be caused by aberrant activity of other receptor tyrosine kinases, activating overlapping signaling pathways. One of these receptor tyrosine kinases could be MET, the receptor for hepatocyte growth factor (HGF). We investigated how MET signaling, and its interaction with CD44 (a putative MET coreceptor regulated by Wnt signaling and highly expressed by intestinal stem cells [ISCs] and adenomas) affects intestinal homeostasis, regeneration, and adenoma formation in mini-gut organoids and mice. We established organoid cultures from ISCs stimulated with HGF or EGF and assessed intestinal differentiation by immunohistochemistry. Mice with total epithelial disruption of MET (Ah Cre /Met fl/fl /LacZ) or ISC-specific disruption of MET (Lgr5 Creert2 /Met fl/fl /LacZ) and control mice (Ah Cre /Met +/+ /LacZ, Lgr5 Creert2 /Met +/+ /LacZ) were exposed to 10 Gy total body irradiation; intestinal tissues were collected, and homeostasis and regeneration were assessed by immunohistochemistry. We investigated adenoma organoid expansion stimulated by HGF or EGF using adenomas derived from Lgr5 Creert2 /Met fl/fl /Apc fl/fl and Lgr5 Creert2 /Met +/+ /Apc fl/fl mice. The same mice were evaluated for adenoma prevalence and size. We also quantified adenomas in Ah Cre /Met fl/fl /Apc fl/+ mice compared with Ah Cre /Met +/+ /Apc fl/+ control mice. We studied expansion of organoids generated from crypts and adenomas, stimulated by HGF or EGF, that were derived from mice expressing different CD44 splice variants (Cd44 +/+ , Cd44 -/- , Cd44 s/s , or Cd44 v4-10/v4-10 mice). Crypts incubated with EGF or HGF expanded into self-organizing mini-guts with similar levels of efficacy and contained all differentiated cell lineages. MET-deficient mice did not have defects in intestinal homeostasis. Total body irradiation reduced numbers of proliferating crypts in Ah Cre /Met fl/fl /LacZ mice. Lgr5 Creert2 /Met fl/fl /LacZ mice had impaired regeneration of MET-deficient ISCs. Adenoma organoids stimulated with EGF or HGF expanded to almost twice the size of nonstimulated organoids. MET-deficient adenoma organoids did not respond to HGF stimulation, but did respond to EGF. ISC-specific disruption of Met (Lgr5 Creert2 /Met fl/fl /Apc fl/fl mice) caused a twofold increase in apoptosis in microadenomas, resulting in an approximately 50% reduction of microadenoma numbers and significantly reduced average adenoma size. Total epithelial disruption of Met (Ah Cre /Met fl/fl /Apc fl/+ mice) resulted in an approximate 50% reduction in (micro)adenoma numbers. Intestinal crypts from Cd44 -/- mice did not expand to the same extent as crypts from Cd44 +/+ mice on stimulation with HGF, but had the same response to EGF. The negative effect on HGF-mediated growth was overcome by expression of CD44v4-10, but not by CD44s. Similarly, HGF-mediated expansion of adenoma organoids required CD44v4-10. In studies of intestinal organoid cultures and mice with inducible deletion of MET, we found HGF receptor signaling to regulate intestinal homeostasis and regeneration, as well as adenoma formation. These activities of MET are promoted by the stem cell CD44 isoform CD44v4-10. Our findings provide rationale for targeting signaling via MET and CD44 during anti-EGF receptor therapy of patients with colorectal cancer or in patients resistant to EGF receptor inhibitors. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase, Protease, HarpinEcc, and a Global RNA Regulator in Erwinia carotovora subsp. carotovora†

PubMed Central

Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.

1999-01-01

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ transcriptional fusions. We conclude that KdgREcc affects extracellular enzyme production by two ways: (i) directly, by inhibiting the transcription of exoenzyme genes; and (ii) indirectly, by preventing the production of a global RNA regulator. Our findings support the idea that KdgREcc affects transcription by promoter occlusion, i.e., preventing the initiation of transcription, and by a roadblock mechanism, i.e., by affecting the elongation of transcription. PMID:10198003

Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.

PubMed Central

Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S

1990-01-01

The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807

Site-specific recombination in the cyanobacterium Anabaena sp. strain PCC 7120 catalyzed by the integrase of coliphage HK022.

PubMed

Melnikov, Olga; Zaritsky, Arieh; Zarka, Aliza; Boussiba, Sammy; Malchin, Natalia; Yagil, Ezra; Kolot, Mikhail

2009-07-01

The integrase (Int) of the lambda-like coliphage HK022 catalyzes the site-specific integration and excision of the phage DNA into and from the chromosome of its host, Escherichia coli. Int recognizes two different pairs of recombining sites attP x attB and attL x attR for integration and excision, respectively. This system was adapted to the cyanobacterium Anabaena sp. strain PCC 7120 as a potential tool for site-specific gene manipulations in the cyanobacterium. Two plasmids were consecutively cointroduced by conjugation into Anabaena cells, one plasmid that expresses HK022 Int recombinase and the other plasmid that carries the excision substrate P(glnA)-attL-T1/T2-attR-lacZ, where T1/T2 are the strong transcription terminators of rrnB, to prevent expression of the lacZ reporter under the constitutive promoter P(glnA). The Int-catalyzed site-specific recombination reaction was monitored by the expression of lacZ emanating as a result of T1/T2 excision. Int catalyzed the site-specific excision reaction in Anabaena cells when its substrate was located either on the plasmid or on the chromosome with no need to supply an accessory protein, such as integration host factor and excisionase (Xis), which are indispensable for this reaction in its host, E. coli.

Taste bud cells of adult mice are responsive to Wnt/β-catenin signaling: implications for the renewal of mature taste cells

PubMed Central

Gaillard, Dany; Barlow, Linda A.

2012-01-01

Wnt/β-catenin signaling initiates taste papilla development in mouse embryos, however, its involvement in taste cell turnover in adult mice has not been explored. Here we used the BATGAL reporter mouse model, which carries an engineered allele in which the LacZ gene is expressed in the presence of activated β-catenin, to determine the responsiveness of adult taste bud cells to canonical Wnt signaling. Double immunostaining with markers of differentiated taste cells revealed that a subset of type I, II and III taste cells express β-galactosidase. Using in situ hybridization, we showed that β-catenin activates the transcription of the LacZ gene mainly in intragemmal basal cells that are immature taste cells, identified by their expression of Sonic Hedgehog (Shh). Finally, we showed that β-catenin activity is significantly reduced in taste buds of 25 week-old mice compared to 10 week-old animals. Our data suggest that Wnt/β-catenin signaling may influence taste cell turnover by regulating cell differentiation. Reduced canonical Wnt signaling in older mice could explain in part the loss of taste sensitivity with aging, implicating a possible deficiency in the rate of taste cell renewal. More investigations are now necessary to understand if and how Wnt signaling regulates adult taste cell turnover. PMID:21328519

Taste bud cells of adult mice are responsive to Wnt/β-catenin signaling: implications for the renewal of mature taste cells.

PubMed

Gaillard, Dany; Barlow, Linda A

2011-04-01

Wnt/β-catenin signaling initiates taste papilla development in mouse embryos, however, its involvement in taste cell turnover in adult mice has not been explored. Here we used the BATGAL reporter mouse model, which carries an engineered allele in which the LacZ gene is expressed in the presence of activated β-catenin, to determine the responsiveness of adult taste bud cells to canonical Wnt signaling. Double immunostaining with markers of differentiated taste cells revealed that a subset of Type I, II, and III taste cells express β-galactosidase. Using in situ hybridization, we showed that β-catenin activates the transcription of the LacZ gene mainly in intragemmal basal cells that are immature taste cells, identified by their expression of Sonic Hedgehog (Shh). Finally, we showed that β-catenin activity is significantly reduced in taste buds of 25-week-old mice compared with 10-week-old animals. Our data suggest that Wnt/β-catenin signaling may influence taste cell turnover by regulating cell differentiation. Reduced canonical Wnt signaling in older mice could explain in part the loss of taste sensitivity with aging, implicating a possible deficiency in the rate of taste cell renewal. More investigations are now necessary to understand if and how Wnt signaling regulates adult taste cell turnover. Copyright © 2011 Wiley-Liss, Inc.

Hazardous effects of effluent from the chrome plating industry: 70 kDa heat shock protein expression as a marker of cellular damage in transgenic Drosophila melanogaster (hsp70-lacZ).

PubMed Central

Mukhopadhyay, Indranil; Saxena, Daya Krishna; Chowdhuri, Debapratim Kar

2003-01-01

Hazardous effects of an effluent from the chrome plating industry were examined by exposing transgenic Drosophila melanogaster (hsp70-lacZ) to various concentrations (0.05, 0.1, 1.0, 10.0, and 100.0 micro L/mL) of the effluent through diet. The emergence pattern of adult flies was affected, along with impaired reproductive performance at the higher dietary concentrations of the effluent. Interestingly, the effect of the effluent was more pronounced in male than in female flies. The effect of the effluent on development of adult flies was concurrent with the expression pattern of the heat shock protein 70 gene (hsp70), both in larval tissues and in the reproductive organs of adult flies. We observed a dose- and time-dependent expression of hsp70 in third instar larvae exposed for different time intervals. Absence of hsp70 expression in larvae exposed to 0.1 micro L/mL of the effluent indicated that this is the highest nontoxic concentration for Drosophila. The stress gene assay in the reproductive organs of adult flies revealed hsp70 expression in the testis of male flies only. However, trypan blue dye exclusion tests in these tissues indicate tissue damage in the male accessory gland of adult flies, which was further confirmed by ultrastructural observations. In the present study we demonstrate the utility of transgenic Drosophila as an alternative animal model for evaluating hazardous effects of the effluent from the chrome plating industry and further reveal the cytoprotective role of hsp70 and its expression as an early marker in environmental risk assessment. PMID:14644668

Expression of Noggin and Gremlin1 and its implications in fine-tuning BMP activities in mouse cartilage tissues.

PubMed

Yu, Xiaodan; Kawakami, Hiroko; Tahara, Naoyuki; Olmer, Merissa; Hayashi, Shinichi; Akiyama, Ryutaro; Bagchi, Anindya; Lotz, Martin; Kawakami, Yasuhiko

2017-08-01

Increasing evidence supports the idea that bone morphogenetic proteins (BMPs) regulate cartilage maintenance in the adult skeleton. The aim of this study is to obtain insight into the regulation of BMP activities in the adult skeletal system. We analyzed expression of Noggin and Gremlin1, BMP antagonists that are known to regulate embryonic skeletal development, in the adult skeletal system by Noggin-LacZ and Gremlin1-LacZ knockin reporter mouse lines. Both reporters are expressed in the adult skeleton in a largely overlapping manner with some distinct patterns. Both are detected in the articular cartilage, pubic symphysis, facet joint in the vertebrae, and intervertebral disk, suggesting that they regulate BMP activities in these tissues. In a surgically induced knee osteoarthritis model in mice, expression of Noggin mRNA was lost from the articular cartilage, which correlated with loss of BMP2/4 and pSMAD1/5/8, an indicator of active BMP signaling. Both reporters are also expressed in the sterna and rib cartilage, suggesting an extensive role of BMP antagonism in adult cartilage tissue. Moreover, Noggin-LacZ was detected in sutures in the skull and broadly in the nasal cartilage, while Gremlin1-LacZ exhibits a weaker and more restricted expression domain in the nasal cartilage. These results suggest broad regulation of BMP activities by Noggin and Gremlin1 in cartilage tissues in the adult skeleton, and that BMP signaling and its antagonism by NOGGIN play a role in osteoarthritis development. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1671-1682, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Msx genes define a population of mural cell precursors required for head blood vessel maturation.

PubMed

Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Lallemand, Yvan; Cumano, Ana; Robert, Benoît

2011-07-01

Vessels are primarily formed from an inner endothelial layer that is secondarily covered by mural cells, namely vascular smooth muscle cells (VSMCs) in arteries and veins and pericytes in capillaries and veinules. We previously showed that, in the mouse embryo, Msx1(lacZ) and Msx2(lacZ) are expressed in mural cells and in a few endothelial cells. To unravel the role of Msx genes in vascular development, we have inactivated the two Msx genes specifically in mural cells by combining the Msx1(lacZ), Msx2(lox) and Sm22α-Cre alleles. Optical projection tomography demonstrated abnormal branching of the cephalic vessels in E11.5 mutant embryos. The carotid and vertebral arteries showed an increase in caliber that was related to reduced vascular smooth muscle coverage. Taking advantage of a newly constructed Msx1(CreERT2) allele, we demonstrated by lineage tracing that the primary defect lies in a population of VSMC precursors. The abnormal phenotype that ensues is a consequence of impaired BMP signaling in the VSMC precursors that leads to downregulation of the metalloprotease 2 (Mmp2) and Mmp9 genes, which are essential for cell migration and integration into the mural layer. Improper coverage by VSMCs secondarily leads to incomplete maturation of the endothelial layer. Our results demonstrate that both Msx1 and Msx2 are required for the recruitment of a population of neural crest-derived VSMCs.

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Differential Expression of Virulence Genes and Motility in Ralstonia (Pseudomonas) solanacearum during Exponential Growth.

PubMed

Clough, S J; Flavier, A B; Schell, M A; Denny, T P

1997-03-01

A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.

The occlusion-derived virus envelope protein ODV-E56 is required for optimal oral infectivity but is not essential for virus binding and fusion

USDA-ARS?s Scientific Manuscript database

The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

PubMed Central

2012-01-01

Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator.

PubMed

Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos

2012-10-05

Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

PubMed Central

1994-01-01

The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

Construction of a β-galactosidase-gene-based fusion is convenient for screening candidate genes involved in regulation of pyrrolnitrin biosynthesis in Pseudomonas chlororaphis G05.

PubMed

Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe

2018-05-28

In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.

Gsg1, Trnp1, and Tmem215 Mark Subpopulations of Bipolar Interneurons in the Mouse Retina

PubMed Central

Park, Ko Uoon; Randazzo, Grace; Jones, Kenneth L.; Brzezinski, Joseph A.

2017-01-01

Purpose How retinal bipolar cell interneurons are specified and assigned to specialized subtypes is only partially understood. In part, this is due to a lack of early pan- and subtype-specific bipolar cell markers. To discover these factors, we identified genes that were upregulated in Blimp1 (Prdm1) mutant retinas, which exhibit precocious bipolar cell development. Methods Postnatal day (P)2 retinas from Blimp1 conditional knock-out (CKO) mice and controls were processed for RNA sequencing. Genes that increased at least 45% and were statistically different between conditions were considered candidate bipolar-specific factors. Candidates were further evaluated by RT-PCR, in situ hybridization, and immunohistochemistry. Knock-in Tmem215-LacZ mice were used to better trace retinal expression. Results A comparison between Blimp1 CKO and control RNA-seq datasets revealed approximately 40 significantly upregulated genes. We characterized the expression of three genes that have no known function in the retina, Gsg1 (germ cell associated gene), Trnp1 (TMF-regulated nuclear protein), and Tmem215 (a predicted transmembrane protein). Germ cell associated gene appeared restricted to a small subset of cone bipolars while Trnp1 was seen in all ON type bipolar cells. Using Tmem215-LacZ heterozygous knock-in mice, we observed that β-galactosidase expression started early in bipolar cell development. In adults, Tmem215 was expressed by a subset of ON and OFF cone bipolar cells. Conclusions We have identified Gsg1, Tmem215, and Trnp1 as novel bipolar subtype-specific genes. The spatial and temporal pattern of their expression is consistent with a role in controlling bipolar subtype fate choice, differentiation, or physiology. PMID:28199486

Transcriptional Activation of Pyoluteorin Operon Mediated by the LysR-Type Regulator PltR Bound at a 22 bp lys Box in Pseudomonas aeruginosa M18

PubMed Central

Wang, Guohao; Xu, Yuquan

2012-01-01

Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817

Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.

PubMed Central

Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D

1993-01-01

Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Abh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression▿

PubMed Central

Strauch, Mark A.; Bobay, Benjamin G.; Cavanagh, John; Yao, Fude; Wilson, Angelo; Le Breton, Yoann

2007-01-01

The Bacillus subtilis abh gene encodes a protein whose N-terminal domain has 74% identity to the DNA-binding domain of the global regulatory protein AbrB. Strains with a mutation in abh showed alterations in the production of antimicrobial compounds directed against some other Bacillus species and gram-positive microbes. Relative to its wild-type parental strain, the abh mutant was found deficient, enhanced, or unaffected for the production of antimicrobial activity. Using lacZ fusions, we examined the effects of abh upon the expression of 10 promoters known to be regulated by AbrB, including five that transcribe well-characterized antimicrobial functions (SdpC, SkfA, TasA, sublancin, and subtilosin). For an otherwise wild-type background, the results show that Abh plays a negative regulatory role in the expression of four of the promoters, a positive role for the expression of three, and no apparent regulatory role in the expression of the other three promoters. Binding of AbrB and Abh to the promoter regions was examined using DNase I footprinting, and the results revealed significant differences. The transcription of abh is not autoregulated, but it is subject to a degree of AbrB-afforded negative regulation. The results indicate that Abh is part of the complex interconnected regulatory system that controls gene expression during the transition from active growth to stationary phase. PMID:17720793

TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants.

PubMed Central

Leskiw, B K; Lawlor, E J; Fernandez-Abalos, J M; Chater, K F

1991-01-01

In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hyg and aad) containing TTA codons show a medium-dependent reduction in phenotypic expression (hygromycin resistance and spectinomycin resistance, respectively) in bldA mutants. For hyg, evidence is presented that the UUA codon is probably being translated by a tRNA with an imperfectly matched anticodon, giving very low levels of gene product but relatively high resistance to hygromycin. It is proposed that TTA codons may be generally absent from genes expressed during vegetative growth and from the structural genes for differentiation and antibiotic production but present in some regulatory and resistance genes associated with the latter processes. The codon may therefore play a role in developmental regulation. Images PMID:1826053

Identification of a spatially specific enhancer element in the chicken Msx-2 gene that regulates its expression in the apical ectodermal ridge of the developing limb buds of transgenic mice.

PubMed

Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B

1995-07-01

Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.

Tracing notochord-derived cells using a Noto-cre mouse: implications for intervertebral disc development.

PubMed

McCann, Matthew R; Tamplin, Owen J; Rossant, Janet; Séguin, Cheryle A

2012-01-01

Back pain related to intervertebral disc degeneration is the most common musculoskeletal problem, with a lifetime prevalence of 82%. The lack of effective treatment for this widespread problem is directly related to our limited understanding of disc development, maintenance and degeneration. The aim of this study was to determine the developmental origins of nucleus pulposus cells within the intervertebral disc using a novel notochord-specific Cre mouse. To trace the fate of notochordal cells within the intervertebral disc, we derived a notochord-specific Cre mouse line by targeting the homeobox gene Noto. Expression of this gene is restricted to the node and the posterior notochord during gastrulation [embryonic day 7.5 (E7.5)-E12.5]. The Noto-cre mice were crossed with a conditional lacZ reporter for visualization of notochord fate in whole-mount embryos. We performed lineage-tracing experiments to examine the contribution of the notochord to spinal development from E12.5 through to skeletally mature mice (9 months). Fate mapping studies demonstrated that, following elongation and formation of the primitive axial skeleton, the notochord gives rise to the nucleus pulposus in fully formed intervertebral discs. Cellular localization of β-galactosidase (encoded by lacZ) and cytokeratin-8 demonstrated that both notochordal cells and chondrocyte-like nucleus pulposus cells are derived from the embryonic notochord. These studies establish conclusively that notochordal cells act as embryonic precursors to all cells found within the nucleus pulposus of the mature intervertebral disc. This suggests that notochordal cells might serve as tissue-specific progenitor cells within the disc and establishes the Noto-cre mouse as a unique tool to interrogate the contribution of notochordal cells to both intervertebral disc development and disc degeneration.

Direct inhibition of interleukin-2 receptor alpha-mediated signaling pathway induces G1 arrest and apoptosis in human head-and-neck cancer cells.

PubMed

Kuhn, Deborah J; Dou, Q Ping

2005-05-15

Overexpression of the interleukin-2 receptor (IL-2R) alpha chain in tumor cells is associated with tumor progression and a poor patient prognosis. IL-2Ralpha is responsible for the high affinity binding of the receptor to IL-2, leading to activation of several proliferative and anti-apoptotic intracellular signaling pathways. We have previously shown that human squamous cell carcinoma of a head-and-neck line (PCI-13) genetically engineered to overexpress IL-2Ralpha exhibit increased transforming activity, proliferation, and drug resistance, compared to the vector control cells (J Cell Biochem 2003;89:824-836). In this study, we report that IL-2Ralpha(+) cells express high levels of total and phosphorylated Jak3 protein and are more resistant to apoptosis induced by a Jak3 inhibitor than the control LacZ cells. Furthermore, we used daclizumab, a monoclonal antibody specific to IL-2Ralpha, and determined the effects of IL-2Ralpha inhibition on cell cycle and apoptosis as well as the involvement of potential cell cycle and apoptosis regulatory proteins. We found that daclizumab induces G(1) arrest, associated with down-regulation of cyclin A protein, preferentially in IL-2Ralpha(+) cells, but not in LacZ cells. In addition, daclizumab activates apoptotic death program via Bcl-2 down-regulation preferentially in IL-2Ralpha(+) cells. Finally, daclizumab also sensitizes IL-2Ralpha(+) cells to other apoptotic stimuli, although the effect is moderate. These results indicate that daclizumab inhibits the proliferative potential of IL-2Ralpha(+) cells via inhibition of cell cycle progression and induction of apoptosis.

Tracing notochord-derived cells using a Noto-cre mouse: implications for intervertebral disc development

PubMed Central

McCann, Matthew R.; Tamplin, Owen J.; Rossant, Janet; Séguin, Cheryle A.

2012-01-01

SUMMARY Back pain related to intervertebral disc degeneration is the most common musculoskeletal problem, with a lifetime prevalence of 82%. The lack of effective treatment for this widespread problem is directly related to our limited understanding of disc development, maintenance and degeneration. The aim of this study was to determine the developmental origins of nucleus pulposus cells within the intervertebral disc using a novel notochord-specific Cre mouse. To trace the fate of notochordal cells within the intervertebral disc, we derived a notochord-specific Cre mouse line by targeting the homeobox gene Noto. Expression of this gene is restricted to the node and the posterior notochord during gastrulation [embryonic day 7.5 (E7.5)-E12.5]. The Noto-cre mice were crossed with a conditional lacZ reporter for visualization of notochord fate in whole-mount embryos. We performed lineage-tracing experiments to examine the contribution of the notochord to spinal development from E12.5 through to skeletally mature mice (9 months). Fate mapping studies demonstrated that, following elongation and formation of the primitive axial skeleton, the notochord gives rise to the nucleus pulposus in fully formed intervertebral discs. Cellular localization of β-galactosidase (encoded by lacZ) and cytokeratin-8 demonstrated that both notochordal cells and chondrocyte-like nucleus pulposus cells are derived from the embryonic notochord. These studies establish conclusively that notochordal cells act as embryonic precursors to all cells found within the nucleus pulposus of the mature intervertebral disc. This suggests that notochordal cells might serve as tissue-specific progenitor cells within the disc and establishes the Noto-cre mouse as a unique tool to interrogate the contribution of notochordal cells to both intervertebral disc development and disc degeneration. PMID:22028328

Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5' region

PubMed Central

Steshina, Ekaterina Y; Carr, Michael S; Glick, Elena A; Yevtodiyenko, Aleksey; Appelbe, Oliver K; Schmidt, Jennifer V

2006-01-01

Background The Dlk1 and Gtl2 genes define a region of mouse chromosome 12 that is subject to genomic imprinting, the parental allele-specific expression of a gene. Although imprinted genes play important roles in growth and development, the mechanisms by which imprinting is established and maintained are poorly understood. Differentially methylated regions (DMRs), which carry methylation on only one parental allele, are involved in imprinting control at many loci. The Dlk1-Gtl2 region contains three known DMRs, the Dlk1 DMR in the 3' region of Dlk1, the intergenic DMR 15 kb upstream of Gtl2, and the Gtl2 DMR at the Gtl2 promoter. Three mouse models are analyzed here that provide new information about the regulation of Dlk1-Gtl2 imprinting. Results A previously existing insertional mutation (Gtl2lacZ), and a targeted deletion in which the Gtl2 upstream region was replaced by a Neo cassette (Gtl2Δ5'Neo), display partial lethality and dwarfism upon paternal inheritance. Molecular characterization shows that both mutations cause loss of imprinting and changes in expression of the Dlk1, Gtl2 and Meg8/Rian genes. Dlk1 levels are decreased upon paternal inheritance of either mutation, suggesting Dlk1 may be causative for the lethality and dwarfism. Loss of imprinting on the paternal chromosome in both Gtl2lacZ and Gtl2Δ5'Neo mice is accompanied by the loss of paternal-specific Gtl2 DMR methylation, while maternal loss of imprinting suggests a previously unknown regulatory role for the maternal Gtl2 DMR. Unexpectedly, when the Neo gene is excised, Gtl2Δ5' animals are of normal size, imprinting is unchanged and the Gtl2 DMR is properly methylated. The exogenous DNA sequences integrated upstream of Gtl2 are therefore responsible for the growth and imprinting effects. Conclusion These data provide further evidence for the coregulation of the imprinted Dlk1 and Gtl2 genes, and support a role for Dlk1 as an important neonatal growth factor. The ability of the Gtl2lacZ and Gtl2Δ5'Neo mutations to cause long-range changes in imprinting and gene expression suggest that regional imprinting regulatory elements may lie in proximity to the integration site. PMID:17014736

Expression of Mineralized Tissue Associated Proteins: Dentin Sialoprotein and Phosphophoryn in Rodent Hair Follicles

PubMed Central

Tang, Xu-na; Zhu, Ya-qin; Marcelo, Cynthia L.; Ritchie, Helena H.

2012-01-01

Background Mammalian hair development and tooth development are controlled by a series of reciprocal epithelial-mesenchymal interactions. Similar growth factors and transcription factors, such as fibroblast growth factor (FGF), sonic hedgehog homolog (SHH), bone morphogenetic proteins (BMPs) and Wnt10a, were reported to be involved in both of these interactions. Dentin sialoprotein (DSP) and phosphophoryn (PP) are the two major non-collagenous proteins secreted by odontoblasts that participate in dentin mineralization during tooth development. Because of striking similarities between tooth development and hair follicle development, we investigated whether DSP and/or PP proteins may also play a role in hair follicle development. Objective In this study, we examined the presence and location of DSP/PP proteins during hair follicle development. Methods Rat PP proteins were detected using immunohistochemical/immunofluorescent staining. DSP-PP mRNAs were detected by in situ hybridization with riboprobes. LacZ expression was detected in mouse tissues using a DSP-PP promoter-driven LUC in transgenic mice. Results We found that PP proteins and DSP-PP mRNAs are present in rat hair follicles. We also demonstrate that an 8 kb DSP-PP promoter is able to drive lacZ expression in hair follicles. Conclusion We have firmly established the presence of DSP/PP in mouse and rat hair follicles by immunohistochemical/immunofluorescent staining, in situ hybridization with riboprobes and transgenic mice studies. The expression of DSP/PP in hair follicles is the first demonstration that major mineralization proteins likely may also contribute to soft tissue development. This finding opens a new avenue for future investigations into the molecular-genetic management of soft tissue development. PMID:21908176

Expression of mineralized tissue associated proteins: dentin sialoprotein and phosphophoryn in rodent hair follicles.

PubMed

Tang, Xu-na; Zhu, Ya-qin; Marcelo, Cynthia L; Ritchie, Helena H

2011-11-01

Mammalian hair development and tooth development are controlled by a series of reciprocal epithelial-mesenchymal interactions. Similar growth factors and transcription factors, such as fibroblast growth factor (FGF), sonic hedgehog homolog (SHH), bone morphogenetic proteins (BMPs) and Wnt10a, were reported to be involved in both of these interactions. Dentin sialoprotein (DSP) and phosphophoryn (PP) are the two major non-collagenous proteins secreted by odontoblasts that participate in dentin mineralization during tooth development. Because of striking similarities between tooth development and hair follicle development, we investigated whether DSP and/or PP proteins may also play a role in hair follicle development. In this study, we examined the presence and location of DSP/PP proteins during hair follicle development. Rat PP proteins were detected using immunohistochemical/immunofluorescent staining. DSP-PP mRNAs were detected by in situ hybridization with riboprobes. LacZ expression was detected in mouse tissues using a DSP-PP promoter-driven LUC in transgenic mice. We found that PP proteins and DSP-PP mRNAs are present in rat hair follicles. We also demonstrate that an 8 kb DSP-PP promoter is able to drive lacZ expression in hair follicles. We have firmly established the presence of DSP/PP in mouse and rat hair follicles by immunohistochemical/immunofluorescent staining, in situ hybridization with riboprobes and transgenic mice studies. The expression of DSP/PP in hair follicles is the first demonstration that major mineralization proteins likely may also contribute to soft tissue development. This finding opens a new avenue for future investigations into the molecular-genetic management of soft tissue development. Copyright © 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

A Constitutive Expression System for Cellulase Secretion in Escherichia coli and Its Use in Bioethanol Production

PubMed Central

Munjal, Neha; Jawed, Kamran; Wajid, Saima; Yazdani, Syed Shams

2015-01-01

The production of biofuels from lignocellulosic biomass appears to be attractive and viable due to the abundance and availability of this biomass. The hydrolysis of this biomass, however, is challenging because of the complex lignocellulosic structure. The ability to produce hydrolytic cellulase enzymes in a cost-effective manner will certainly accelerate the process of making lignocellulosic ethanol production a commercial reality. These cellulases may need to be produced aerobically to generate large amounts of protein in a short time or anaerobically to produce biofuels from cellulose via consolidated bioprocessing. Therefore, it is important to identify a promoter that can constitutively drive the expression of cellulases under both aerobic and anaerobic conditions without the need for an inducer. Using lacZ as reporter gene, we analyzed the strength of the promoters of four genes, namely lacZ, gapA, ldhA and pflB, and found that the gapA promoter yielded the maximum expression of the β-galactosidase enzyme under both aerobic and anaerobic conditions. We further cloned the genes for two cellulolytic enzymes, β-1,4-endoglucanase and β-1,4-glucosidase, under the control of the gapA promoter, and we expressed these genes in Escherichia coli, which secreted the products into the extracellular medium. An ethanologenic E. colistrain transformed with the secretory β-glucosidase gene construct fermented cellobiose in both defined and complex medium. This recombinant strain also fermented wheat straw hydrolysate containing glucose, xylose and cellobiose into ethanol with an 85% efficiency of biotransformation. An ethanologenic strain that constitutively secretes a cellulolytic enzyme is a promising platform for producing lignocellulosic ethanol. PMID:25768292

Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes

PubMed Central

Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.

2016-01-01

DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167

Development and evaluation of an efficient heterologous gene knock-in reporter system in Lactococcus lactis.

PubMed

Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing

2017-09-18

Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.

Comparative toxic potential of market formulation of two organophosphate pesticides in transgenic Drosophila melanogaster (hsp70-lacZ).

PubMed

Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar

2005-01-01

This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.

5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

PubMed Central

Beck, Heather J.; Fleming, Ian M. C.

2016-01-01

Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

Intermittent PTH treatment can delay the transformation of mature osteoblasts into lining cells on the periosteal surfaces.

PubMed

Jang, Mi-Gyeong; Lee, Ji Yeon; Yang, Jae-Yeon; Park, Hyojung; Kim, Jung Hee; Kim, Jung-Eun; Shin, Chan Soo; Kim, Seong Yeon; Kim, Sang Wan

2016-09-01

Mature osteoblasts have three fates: as osteocytes, quiescent lining cells, or osteoblasts that undergo apoptosis. However, whether intermittent parathyroid hormone (PTH) can modulate the fate of mature osteoblasts in vivo is uncertain. We performed a lineage-tracing study using an inducible gene system. Dmp1-CreERt2 mice were crossed with Rosa26R reporter mice to obtain targeted mature osteoblasts and their descendants, lining cells or osteocytes, which were detected using X-gal staining. Rosa26R:Dmp1-CreERt2(+) mice were injected with 0.25 mg 4-OH-tamoxifen (4-OHTam) on postnatal days 5, 7, 9, 16, and 23. In a previous study, at 22 days after the last 4-OHTam, most LacZ+ cells on the periosteal surface were inactive lining cells. On day 25 (D25), the mice were challenged with an injection of human PTH (1-34, 80 μg/kg) or vehicle daily for 10 (D36) or 20 days (D46). We evaluated the number and thickness of LacZ+ osteoblast descendants in the calvaria and tibia. In the vehicle group, the number and thickness of LacZ+ osteoblast descendants at both D36 and D46 significantly decreased compared to D25, which was attenuated in the PTH group. In line with these results, PTH inhibited the decrease in the number of LacZ+/osteocalcin-positive cells compared to vehicle at both D36 and D46. As well, the serum levels of sclerostin decreased, as did the protein expression of sclerostin in the cortical bone. These results suggest that intermittent PTH treatment can increase the number of periosteal osteoblasts by preventing mature osteoblasts from transforming into lining cells in vivo.

A DNA fragment of Leptospira interrogans encodes a protein which shares epitopes with equine cornea.

PubMed

Lucchesi, P M; Parma, A E

1999-11-30

Horses infected with Leptospira interrogans present several clinical disorders, one of them being recurrent uveitis. An antigenic relationship between this bacterium and equine cornea has been described in previous studies. With the aim to make progress on defining the molecular basis and pathogenesis of equine recurrent uveitis, here we describe the cloning of one DNA fragment from a Leptospira interrogans serovar pomona genomic lambda gt11 library. Although there are references of transcription of leptospiral genes in E. coli from their own leptospiral promoters, in this recombinant construction the leptospiral DNA was located under the control of lacZ promoter since no expression could be detected in the absence of IPTG. This clone, isolated by expression screening with polyclonal serum raised against equine corneal proteins, encodes a 90 kDa protein of L. interrogans which crossreacts with equine cornea as proved Western-blotting. Antibodies directed against this leptospiral protein strongly recognised a 66 kDa equine corneal protein, one of those recognised by an anti-equine cornea serum. Our findings suggest that an immune response to 90 kDa protein participates in pathogenesis of equine uveitis.

Functional conservation between rodents and chicken of regulatory sequences driving skeletal muscle gene expression in transgenic chickens

PubMed Central

2010-01-01

Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC) 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species. PMID:20184756

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

Baculovirus-mediated vascular endothelial growth factor-D(ΔNΔC) gene transfer induces angiogenesis in rabbit skeletal muscle.

PubMed

Heikura, Tommi; Nieminen, Tiina; Roschier, Miia M; Karvinen, Henna; Kaikkonen, Minna U; Mähönen, Anssi J; Lesch, Hanna P; Rissanen, Tuomas T; Laitinen, Olli H; Airenne, Kari J; Ylä-Herttuala, Seppo

2012-01-01

Occluded arteries and ischemic tissues cannot always be treated by angioplasty, stenting or by-pass-surgery. Under such circumstances, viral gene therapy may be useful in inducing increased blood supply to ischemic area. There is evidence of improved blood flow in ischemic skeletal muscle and myocardium in both animal and human studies using adenoviral vascular endothelial growth factor (VEGF) gene therapy. However, the expression is transient and repeated gene transfers with the same vector are inefficient due to immune responses. Different baculoviral vectors pseudotyped with or without vesicular stomatitis virus glycoprotein (VSV-G) and/or carrying woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) were tested both in vitro and in vivo. VEGF-D(ΔNΔC) was used as therapeutic transgene and lacZ as a control. In vivo efficacy was evaluated as capillary enlargement and transgene expression in New Zealand White (NZW) rabbit skeletal muscle. A statistically significant capillary enlargement was detected 6 days after gene transfer in transduced areas compared to the control gene transfers with baculovirus and adenovirus encoding β-galactosidase (lacZ). Substantially improved gene transfer efficiency was achieved with a modified baculovirus pseudotyped with VSV-G and carrying Wpre. Dose escalation experiments revealed that either too large volume or too many virus particles caused inflammation and necrosis in the target tissue, whereas 10(9) plaque forming units injected in multiple aliquots resulted in transgene expression with only mild immune reactions. We show the first evidence of biologically significant baculoviral gene transfer in skeletal muscle of NZW rabbits using VEGF-D(ΔNΔC) as a therapeutic transgene. Copyright © 2012 John Wiley & Sons, Ltd.

Overexpression of the human VPAC2 receptor in the suprachiasmatic nucleus alters the circadian phenotype of mice

PubMed Central

Shen, Sanbing; Spratt, Christopher; Sheward, W. John; Kallo, Imre; West, Katrine; Morrison, Christine F.; Coen, Clive W.; Marston, Hugh M.; Harmar, Anthony J.

2000-01-01

The neuropeptides vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) belong to a superfamily of structurally related peptide hormones that includes glucagon, glucagon-like peptides, secretin, and growth hormone-releasing hormone. Microinjection of VIP or PACAP into the rodent suprachiasmatic nucleus (SCN) phase shifts the circadian pacemaker and VIP antagonists, and antisense oligodeoxynucleotides have been shown to disrupt circadian function. VIP and PACAP have equal potency as agonists of the VPAC2 receptor (VPAC2R), which is expressed abundantly in the SCN, in a circadian manner. To determine whether manipulating the level of expression of the VPAC2R can influence the control of the circadian clock, we have created transgenic mice overexpressing the human VPAC2R gene from a yeast artificial chromosome (YAC) construct. The YAC was modified by a strategy using homologous recombination to introduce (i) the HA epitope tag sequence (from influenza virus hemagglutinin) at the carboxyl terminus of the VPAC2R protein, (ii) the lacZ reporter gene, and (iii) a conditional centromere, enabling YAC DNA to be amplified in culture in the presence of galactose. High levels of lacZ expression were detected in the SCN, habenula, pancreas, and testis of the transgenic mice, with lower levels in the olfactory bulb and various hypothalamic areas. Transgenic mice resynchronized more quickly than wild-type controls to an advance of 8 h in the light-dark (LD) cycle and exhibited a significantly shorter circadian period in constant darkness (DD). These data suggest that the VPAC2R can influence the rhythmicity and photic entrainment of the circadian clock. PMID:11027354

Effects of heme oxygenase-1 gene modulated mesenchymal stem cells on vasculogenesis in ischemic swine hearts.

PubMed

Jiang, Yi-Bo; Zhang, Xiao-Li; Tang, Yao-Liang; Ma, Gen-Shan; Shen, Cheng-Xing; Wei, Qin; Zhu, Qi; Yao, Yu-Yu; Liu, Nai-Feng

2011-02-01

Mesenchymal stem cells (MSCs) transplantation may partially restore heart function in the treatment of acute myocardial infarction (AMI). The aim of this study was to explore the beneficial effects of MSCs modified with heme xygenase-1 (HO-1) on post-infarct swine hearts to determine whether the induction of therapeutic angiogenesis is modified by the angiogenic cytokines released from the implanted cells. In vitro, MSCs were divided into four groups: (1) non-transfected MSCs (MSCs group), (2) MSCs transfected with the pcDNA3.1-Lacz plasmid (Lacz-MSCs group), (3) MSCs transfected with pcDNA3.1-hHO-1 (HO-1-MSCs group), and (4) MSCs transfected with pcDNA3.1-hHO-1 and pretreatment with an HO inhibitor, tin protoporphyrin (SnPP) (HO-1-MSCs + SnPP group). Cells were cultured in an airtight incubation bottle for 24 hours, in which the oxygen concentration was maintained at < 1%, followed by 12 hours of reoxygenation. After hypoxia/reoxygen treatment, ELISA was used to measure transforming growth factor (TGF-β) and fibroblast growth factor (FGF-2) in the supernatant. In vivo, 28 Chinese mini-pigs were randomly allocated to the following treatment groups: (1) control group (saline), (2) Lacz-MSCs group, (3) HO-1-MSCs group, and (4) HO-1-MSCs + SnPP group. About 1 × 10(7) of autologous stem cells or an identical volume of saline was injected intracoronary into porcine hearts 1 hour after MI. Magnetic resonance imaging (MRI) assay and postmortem analysis were assessed four weeks after stem cell transplantation. Post hypoxia/reoxygenation in vitro, TGF-β in the supernatant was significantly increased in the HO-1-MSCs ((874.88 ± 68.23) pg/ml) compared with Lacz-MSCs ((687.81 ± 57.64) pg/ml, P < 0.001). FGF-2 was also significantly increased in the HO-1-MSCs ((1106.48 ± 107.06) pg/ml) compared with the Lacz-MSCs ((853.85 ± 74.44) pg/ml, P < 0.001). In vivo, at four weeks after transplantation, HO-1 gene transfer increased the capillary density in the peri-infarct area compared with the Lacz-MSCs group (14.24 ± 1.66/HPFs vs. 11.51 ± 1.34/HPFs, P < 0.001). Arteriolar density was also significantly higher in HO-1-MSCs group than in the Lacz-MSCs group (7.86 ± 2.00/HPFs vs. 6.45 ± 1.74/HPFs, P = 0.001). At the same time, the cardiac function was significantly improved in the HO-1-MSCs group compared with the Lacz-MSCs group ((53.17 ± 3.55)% vs. (48.82 ± 2.98)%, P < 0.05). However, all these effects were significantly abrogated by SnPP. MSCs provided a beneficial effect on cardiac function after ischemia/reperfusion by the induction of therapeutic angiogenesis, and this effect was amplified by HO-1 overexpression.

Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.

PubMed

Adebali, Ogun; Sancar, Aziz; Selby, Christopher P

2017-11-10

Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Increased resistance to ionizing and ultraviolet radiation in Escherichia coli JM83 is associated with a chromosomal rearrangement.

PubMed

McLean, K M; Gutman, P D; Minton, K W; Clark, E P

1992-06-01

Cells cope with radiation damage through several mechanisms: (1) increased DNA repair activity, (2) scavenging and inactivation of radiation-induced radical molecules, and (3) entry into a G0-like quiescent state. We have investigated a chromosomal rearrangement to elucidate further the molecular and genetic mechanisms underlying these phenomena. A mutant of Escherichia coli JM83 (phi 80dlacZ delta M15) was isolated that demonstrated significantly increased resistance to both ionizing and ultraviolet radiation. Surviving fractions of mutant and wild-type cells were measured following exposure to standardized doses of radiation. Increased radioresistance was directly related to a chromosomal alteration near the bacteriophage phi 80 attachment site (attB), as initially detected by the LacZ- phenotype of the isolate. Southern hybridization of chromosomal DNA from the mutant and wild-type E. coli JM83 strains indicated that a deletion had occurred. We propose that the deletion near the attB locus produces the radioresistant phenotype of the E. coli JM83 LacZ- mutant, perhaps through the alteration or inactivation of a gene or its controlling element(s).

The involvement of the nif-associated ferredoxin-like genes fdxA and fdxN of Herbaspirillum seropedicae in nitrogen fixation.

PubMed

Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2010-02-01

The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.

Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.

PubMed Central

Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C

1990-01-01

Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625

Adenoviral vector gene delivery via the round window membrane in guinea pigs.

PubMed

Suzuki, Mitsuya; Yamasoba, Tatsuya; Suzukawa, Keigo; Kaga, Kimitaka

2003-10-27

We have found that damage from a local anesthetic solution containing phenol permitted beta-galactosidase (beta-gal) gene delivery to the guinea pig inner ear via the round window membrane (RWM). RWM damage was evident as degeneration of the outer epithelium. After adenovirus lacZ vector was applied to the damaged RWM, immunohistochemistry showed strong beta-gal expression in the RWM, mesothelial cells, organ of Corti, spiral limbus, spiral ligament and spiral ganglion. In the vestibular labyrinth, expression was seen in the sensory and supporting cells, transitional cells, and the dark-cell area. Thus, adenovirus can transfect a variety of inner ear cells in the guinea pig through a damaged RWM.

Mice expressing GFP and CreER in osteochondro progenitor cells in the periosteum.

PubMed

Kawanami, Aya; Matsushita, Takehiko; Chan, Yuk Yu; Murakami, Shunichi

2009-08-28

We generated Prx1CreER-GFP transgenic mice that express tamoxifen-inducible Cre recombinase and GFP under the control of a 2.4 kb Prx1 promoter. The transgene is expressed in osteochondro progenitor cells in the developing limb buds and in a subpopulation of periosteal cells that is closely associated with the cortical bone. GFP-expressing cells isolated from the diaphyses of long bones by cell sorting express multiple markers of periosteal cells, including Prx1, Fgf18, Tenascin-W, Periostin, and Thrombospondin 2. In addition, these cells undergo chondrogenic and osteogenic differentiation in culture upon induction. Cell fate analysis using the Rosa26 LacZ reporter indicated that transgene-expressing cells give rise to some of the chondrocytes and osteoblasts in the fracture callus. Collectively, these observations strongly suggest that the transgene-expressing cells are osteochondro progenitor cells in the periosteum. The established Prx1CreER-GFP mice would offer novel approaches for analyzing the functions of periosteal cells in vitro and in vivo.

Regulation of Hoxb2 by APL-associated PLZF protein.

PubMed

Ivins, Sarah; Pemberton, Kieran; Guidez, Fabien; Howell, Louise; Krumlauf, Robb; Zelent, Arthur

2003-06-12

The PLZF gene is translocated in a subset of all-trans-retinoic acid resistant acute promyelocytic leukaemia (APL) cases, encodes a DNA binding transcription factor and is expressed highly in haematopoietic progenitor cells as well-developing central nervous system (CNS). The spatially restricted and temporally dynamic pattern of PLZF expression in the developing CNS suggested that it might play a role in the circuitry regulating hindbrain segmentation. We have now identified a PLZF binding site (PLZF-RE) in an enhancer region of Hoxb2 that itself is required for directing high-level expression in rhombomers 3 and 5 of the developing hindbrain. The wild-type r3/r5 enhancer linked to a heterologous promoter was responsive to regulation by PLZF, and this activity was lost in variants containing a mutated PLZF-RE. Compared with the wild-type protein, the binding of the APL-associated reciprocal RARalpha-PLZF fusion to PLZF-RE was much stronger, suggesting that the N-terminal PLZF sequences missing from the fusion may play a role in the regulation of DNA binding. Consistent with this, the N-terminal POZ domain was required for cooperative binding of PLZF to a multimerized PLZF-RE. In the context of the r3/r5 enhancer, the PLZF-RE cooperated for PLZF binding with an additional A/T-rich motif positioned downstream of the PLZF-RE. This A/T motif was previously shown to be essential for the regulation of Hoxb2 expression in r3 and r5 in cooperation with another Krüppel-like zinc finger protein Krox 20. The presence of both the PLZF-RE and the A/T-rich motif was required for a maximal effect of PLZF on a heterologous promoter and was essential in vivo to direct the expression of a lacZ reporter in the chick neural tube. Hence, both PLZF and Krox20 cooperate with a common A/T motif in mediating in vivo activity of the Hoxb2 enhancer. Our findings indicate that Hoxb2 is a direct target for regulation by PLZF in the developing CNS and suggest that deregulation of Hox gene expression may contribute to APL pathogenesis.

Abcg2 expression marks tissue-specific stem cells in multiple organs in a mouse progeny tracking model.

PubMed

Fatima, Soghra; Zhou, Sheng; Sorrentino, Brian P

2012-02-01

The side population phenotype is associated with the Hoechst dye efflux activity of the Abcg2 transporter and identifies hematopoietic stem cells (HSCs) in the bone marrow. This association suggests the direct use of Abcg2 expression to identify adult stem cells in various other organs. We have generated a lineage tracing mouse model based on an allele that coexpresses both Abcg2 and a CreERT2 expression cassette. By crossing these mice with lox-STOP-lox reporter lines (LacZ or YFP), cells that express Abcg2 and their progeny were identified following treatment with tamoxifen (Tam). In the liver and kidney, in which mature cells express Abcg2, reporter gene expression verified the expected physiologic expression pattern of the recombinant allele. Long-term marking of HSCs was seen in multiple peripheral blood lineages from adult mice, demonstrating that Abcg2(+) bone marrow HSCs contribute to steady-state hematopoiesis. Stem cell tracing patterns were seen in the small intestine and in seminiferous tubules in the testis 20 months after Tam treatment, proving that stem cells from these organs express Abcg2. Interstitial cells from skeletal and cardiac muscle were labeled, and some cells were costained with endothelial markers, raising the possibility that these cells may function in the repair response to muscle injury. Altogether, these studies prove that Abcg2 is a stem cell marker for blood, small intestine, testicular germ cells, and possibly for injured skeletal and/or cardiac muscle and provide a new model for studying stem cell activity that does not require transplant-based assays. Copyright © 2011 AlphaMed Press.

Orgyia pseudotsugata baculovirus p10 and polyhedron envelope protein genes: analysis of their relative expression levels and role in polyhedron structure.

PubMed

Gross, C H; Russell, R L; Rohrmann, G F

1994-05-01

To investigate the regulation of p10 and polyhedron envelope protein (PEP) gene expression and their role in polyhedron development, Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis viruses lacking these genes were constructed. Recombinant viruses were produced, in which the p10 gene, the PEP gene or both genes were disrupted with the beta-glucuronidase (GUS) or beta-galactosidase (lacZ) genes. GUS activity under the control of the PEP protein promoter was observed later in infection and its maximal expression was less than 10% the level for p10 promoter-GUS constructs. Tissues from O. pseudotsugata larvae infected with these recombinants were examined by electron microscopy. Cells from insects infected with the p10- viruses lacked p10-associated fibrillar structures, but fragments of polyhedron envelope-like structures were observed on the surface of some polyhedra. Immunogold labelling of cells infected with the p10-GUS+ virus with an antibody directed against PEP showed that the PEP was concentrated at the surface of polyhedra. Although polyhedra produced by p10 and PEP gene deletion mutants demonstrated what appeared to be a polyhedron envelope by transmission electron microscopy, scanning electron microscopy showed that they had irregular, pitted surfaces that were different from wild-type polyhedra. These data suggested that both p10 and PEP are important for the proper formation of the periphery of polyhedra.

The transcription factor GCN4 regulates PHM8 and alters triacylglycerol metabolism in Saccharomyces cerevisiae.

PubMed

Yadav, Kamlesh Kumar; Rajasekharan, Ram

2016-11-01

PHM8 is a very important enzyme in nonpolar lipid metabolism because of its role in triacylglycerol (TAG) biosynthesis under phosphate stress conditions. It is positively regulated by the PHO4 transcription factor under low phosphate conditions; however, its regulation has not been explored under normal physiological conditions. General control nonderepressible (GCN4), a basic leucine-zipper transcription factor activates the transcription of amino acids, purine biosynthesis genes and many stress response genes under various stress conditions. In this study, we demonstrate that the level of TAG is regulated by the transcription factor GCN4. GCN4 directly binds to its consensus recognition sequence (TGACTC) in the PHM8 promoter and controls its expression. The analysis of cells expressing the P PHM8 -lacZ reporter gene showed that mutations (TGACTC-GGGCCC) in the GCN4-binding sequence caused a significant increase in β-galactosidase activity. Mutation in the GCN4 binding sequence causes an increase in PHM8 expression, lysophosphatidic acid phosphatase activity and TAG level. PHM8, in conjunction with DGA1, a mono- and diacylglycerol transferase, controls the level of TAG. These results revealed that GCN4 negatively regulates PHM8 and that deletion of GCN4 causes de-repression of PHM8, which is responsible for the increased TAG content in gcn4∆ cells.

Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.

PubMed

Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G

2011-12-23

Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.

The glpD gene is a novel reporter gene for E. coli that is superior to established reporter genes like lacZ and gusA.

PubMed

Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg

2016-12-01

Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.

Gene transfer as a strategy to achieve permanent cardioprotection II: rAAV-mediated gene therapy with heme oxygenase-1 limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Ou, Qinghui; Wu, Wen-Jian; Chen, Ning; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Dawn, Buddhadeb; Luo, Li; Hunt, Gregory N; Bolli, Roberto

2011-11-01

Extensive evidence indicates that heme oxygenase-1 (HO-1) exerts potent cytoprotective effects in response to stress. Previous studies have shown that gene therapy with HO-1 protects against myocardial ischemia/reperfusion injury for up to 8 weeks after gene transfer. However, the long-term effects of HO-1 gene therapy on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the HO-1 gene (rAAV/HO-1) that enables long-lasting transgene expression. Mice received injections in the anterior LV wall of rAAV/LacZ (LacZ group) or rAAV/HO-1 (HO-1 group); 1 year later, they were subjected to a 30-min coronary occlusion (O) and 4 h of reperfusion (R). Cardiac HO-1 gene expression was confirmed at 1 month and 1 year after gene transfer by immunoblotting and immunohistochemistry analyses. In the HO-1 group, infarct size (% of risk region) was dramatically reduced at 1 year after gene transfer (11.2 ± 2.1%, n = 12, vs. 44.7 ± 3.6%, n = 8, in the LacZ group; P < 0.05). The infarct-sparing effects of HO-1 gene therapy at 1 year were as powerful as those observed 24 h after ischemic PC (six 4-min O/4-min R cycles) (15.0 ± 1.7%, n = 10). There were no appreciable changes in LV fractional shortening, LV ejection fraction, or LV end-diastolic or end-systolic diameter at 1 year after HO-1 gene transfer as compared to the age-matched controls or with the LacZ group. Histology showed no inflammation in the myocardium 1 year after rAAV/HO-1-mediated gene transfer. These results demonstrate, for the first time, that rAAV-mediated HO-1 gene transfer confers long-term (1 year), possibly permanent, cardioprotection without adverse functional consequences, providing proof of principle for the concept of achieving prophylactic cardioprotection (i.e., "immunization against infarction").

GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.

PubMed

Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G

2016-09-13

The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

PubMed

Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

2014-03-01

Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

CARTILAGE CONSTRUCTS ENGINEERED FROM CHONDROCYTES OVEREXPRESSING IGF-I IMPROVE THE REPAIR OF OSTEOCHONDRAL DEFECTS IN A RABBIT MODEL

PubMed Central

Madry, Henning; Kaul, Gunter; Zurakowski, David; Vunjak-Novakovic, Gordana; Cucchiarini, Magali

2015-01-01

Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes over expressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-over expressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects. PMID:23588785

Bacillus subtilis as a Platform for Molecular Characterisation of Regulatory Mechanisms of Enterococcus faecalis Resistance against Cell Wall Antibiotics

PubMed Central

Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M.; Mascher, Thorsten; Gebhard, Susanne

2014-01-01

To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators. PMID:24676422

Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

PubMed

Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

2014-01-01

To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

Marek's disease virus protein kinase gene identified within the short unique region of the viral genome is not essential for viral replication in cell culture and vaccine-induced immunity in chickens.

PubMed

Sakaguchi, M; Urakawa, T; Hirayama, Y; Miki, N; Yamamoto, M; Zhu, G S; Hirai, K

1993-07-01

The open reading frame (ORF) of 1206 bp within the short unique region (Us) of Marek's disease virus type 1 (MDV1) shows significant homology with the herpes simplex virus type 1 US3 gene encoding protein kinase (PK). The lacZ gene of Escherichia coli was inserted within the ORF, designated MDV1-US3, of MDV1 K544 strain DNA by homologous recombination. The plaque-purified recombinant MDV1 stably expressed the beta-galactosidase encoded by the inserted lacZ gene in infected cells and replicated well as the parental K544 strain. Antibodies against both MDV1 antigen and beta-galactosidase were detected in the sera of chickens immunized with recombinant MDV1. Chickens vaccinated with the recombinant MDV1 were protected from challenge with virulent MDV1. The MDV1 US3 gene expressed by a baculovirus vector encoded a 44-kDa protein. Mouse antisera against the 44-kDa protein reacted with two proteins of 44 and 45 kDa in extracts of cells infected with MDV1 but not with MDV types 2 or 3. The PK activity was detected in immune complexes of the anti-44-kDa sera with extracts of cells infected with MDV1 but not with the recombinant MDV1. Thus, PK encoded from the MDV1-US3 is not essential for virus replication in cell culture and vaccine-induced immunity.

A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.

PubMed Central

Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S

1997-01-01

The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477

Programmable probiotics for detection of cancer in urine

PubMed Central

Danino, Tal; Prindle, Arthur; Kwong, Gabriel A.; Skalak, Matthew; Li, Howard; Allen, Kaitlin; Hasty, Jeff; Bhatia, Sangeeta N.

2015-01-01

Rapid advances in the forward engineering of genetic circuitry in living cells has positioned synthetic biology as a potential means to solve numerous biomedical problems, including disease diagnosis and therapy. One challenge in exploiting synthetic biology for translational applications is to engineer microbes that are well tolerated by patients and seamlessly integrate with existing clinical methods. We use the safe and widely used probiotic Escherichia coli Nissle 1917 to develop an orally administered diagnostic that can noninvasively indicate the presence of liver metastasis by producing easily detectable signals in urine. Our microbial diagnostic generated a high-contrast urine signal through selective expansion in liver metastases (106-fold enrichment) and high expression of a lacZ reporter maintained by engineering a stable plasmid system. The lacZ reporter cleaves a substrate to produce a small molecule that can be detected in urine. E. coli Nissle 1917 robustly colonized tumor tissue in rodent models of liver metastasis after oral delivery but did not colonize healthy organs or fibrotic liver tissue. We saw no deleterious health effects on the mice for more than 12 months after oral delivery. Our results demonstrate that probiotics can be programmed to safely and selectively deliver synthetic gene circuits to diseased tissue microenvironments in vivo. PMID:26019220

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

PubMed Central

Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

2015-01-01

ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

Prostate Cancer Evaluation: Design, Synthesis, and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2007-10-01

colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly used reporter system.[34] However, the well-established...Figure 7 Moreover, we are deeply encouraged by the success on the synthesis of the target molecule M7, as shown in Figure 8. f e d cba OH N

Cre-mediated recombination in pituitary somatotropes

PubMed Central

Nasonkin, Igor O.; Potok, Mary Anne; Camper, Sally A.

2009-01-01

We report a transgenic line with highly penetrant cre recombinase activity in the somatotrope cells of the anterior pituitary gland. Expression of the cre transgene is under the control of the locus control region of the human growth hormone gene cluster and the rat growth hormone promoter. Cre recombinase activity was assessed with two different lacZ reporter genes that require excision of a floxed stop sequence for expression: a chick β-actin promoter with the CMV enhancer transgene and a ROSA26 knock-in. Cre activity is detectable in the developing pituitary after initiation of Gh transcription and persists through adulthood with high penetrance in Gh expressing cells and lower penetrance in lactotropes, a cell type that shares a common origin with somatotropes. This Gh-cre transgenic line is suitable for efficient, cell-specific deletion of floxed regions of genomic DNA in differentiated somatotropes and a subset of lactotrope cells of the anterior pituitary gland. PMID:19039787

Noninfectious virus-like particles produced by Moloney murine leukemia virus-based retrovirus packaging cells deficient in viral envelope become infectious in the presence of lipofection reagents

PubMed Central

Sharma, Sanjai; Murai, Fukashi; Miyanohara, Atsushi; Friedmann, Theodore

1997-01-01

Retrovirus packaging cell lines expressing the Moloney murine leukemia virus gag and pol genes but lacking virus envelope genes produce virus-like particles constitutively, whether or not they express a transcript from an integrated retroviral provirus. In the absence of a proviral transcript, the assembled particles contain processed gag and reverse transcriptase, and particles made by cells expressing an integrated lacZ provirus also contain viral RNA. The virus-like particles from both cell types are enveloped and are secreted/budded into the extracellular space but are noninfectious. Their physicochemical properties are similar to those of mature retroviral particles. The noninfectious gag pol RNA particles can readily be made infectious by the addition of lipofection reagents to produce preparations with titers of up to 105 colony-forming units per ml. PMID:9380714

Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.

PubMed

Lisovsky, Alexandra; Sefton, Michael V

2016-09-01

Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.

The switch from fermentation to respiration in Saccharomyces cerevisiae is regulated by the Ert1 transcriptional activator/repressor.

PubMed

Gasmi, Najla; Jacques, Pierre-Etienne; Klimova, Natalia; Guo, Xiao; Ricciardi, Alessandra; Robert, François; Turcotte, Bernard

2014-10-01

In the yeast Saccharomyces cerevisiae, fermentation is the major pathway for energy production, even under aerobic conditions. However, when glucose becomes scarce, ethanol produced during fermentation is used as a carbon source, requiring a shift to respiration. This adaptation results in massive reprogramming of gene expression. Increased expression of genes for gluconeogenesis and the glyoxylate cycle is observed upon a shift to ethanol and, conversely, expression of some fermentation genes is reduced. The zinc cluster proteins Cat8, Sip4, and Rds2, as well as Adr1, have been shown to mediate this reprogramming of gene expression. In this study, we have characterized the gene YBR239C encoding a putative zinc cluster protein and it was named ERT1 (ethanol regulated transcription factor 1). ChIP-chip analysis showed that Ert1 binds to a limited number of targets in the presence of glucose. The strongest enrichment was observed at the promoter of PCK1 encoding an important gluconeogenic enzyme. With ethanol as the carbon source, enrichment was observed with many additional genes involved in gluconeogenesis and mitochondrial function. Use of lacZ reporters and quantitative RT-PCR analyses demonstrated that Ert1 regulates expression of its target genes in a manner that is highly redundant with other regulators of gluconeogenesis. Interestingly, in the presence of ethanol, Ert1 is a repressor of PDC1 encoding an important enzyme for fermentation. We also show that Ert1 binds directly to the PCK1 and PDC1 promoters. In summary, Ert1 is a novel factor involved in the regulation of gluconeogenesis as well as a key fermentation gene. Copyright © 2014 by the Genetics Society of America.

Down-regulation of collagen synthesis and matrix metalloproteinase expression in myofibroblasts from Dupuytren nodule using adenovirus-mediated relaxin gene therapy.

PubMed

Kang, Young-Mi; Choi, Yun-Rak; Yun, Chae-Ok; Park, Jin-Oh; Suk, Kyung-Soo; Kim, Hak-Sun; Park, Moon-Soo; Lee, Byung-Ho; Lee, Hwan-Mo; Moon, Seong-Hwan

2014-04-01

Dupuytren's disease is a fibroproliferative connective tissue disorder characterized by contracture of the palmer fascia of the hand. Relaxin (RLN) is a multifunctional factor which contributes to the remodeling of the pelvic ligament by inhibiting fibrosis and inflammatory activities. The aim of this study was to investigate the effect of the RLN gene on the inhibition of fibrosis in myofibroblastic cells. Myofibroblast cells with adenovirus LacZ (Ad-LacZ) as a marker gene or adenovirus relaxin (Ad-RLN) as therapeutic gene showed transgene expressions in beta-galactosidase assay and Western blot analysis. Myofibroblastic cells with Ad-RLN demonstrated a 22% and 48% reduction in collagen I and III mRNA expressions respectively, a 50% decrease in MMP-1, 70% decrease in MMP-2, 80% decrease in MMP-9, and a 15% reduction in MMP-13 protein expression compared with cultures with viral control and saline control. In addition, myofibroblastic cells with Ad-RLN showed a 40% decrease in TIMP 1 and a 15% increase in TIMP 3 protein expression at 48 h compared to cultures with viral control and saline control. Also, myofibroblastic cell with Ad-RLN demonstrated a 74% inhibition of fibronectin and a 52% decrease in total collagen synthesis at 48 h compared with cultures with viral control and saline control. In conclusion, the RLN gene render antifibrogenic effect on myofibroblastic cells from Dupuytren's nodule via direct inhibition of collagen synthesis not through collagenolytic pathway such as MMP-1, -13, TIMP 1, and 3. Therefore relaxin can be an alternative therapeutic strategy in initial stage of Dupuytren's disease by its antifibrogenic effect. © 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition

PubMed Central

Condon, Jennifer C.; Jeyasuria, Pancharatnam; Faust, Julie M.; Mendelson, Carole R.

2004-01-01

Parturition is timed to begin only after the developing embryo is sufficiently mature to survive outside the womb. It has been postulated that the signal for the initiation of parturition arises from the fetus although the nature and source of this signal remain obscure. Herein, we provide evidence that this signal originates from the maturing fetal lung. In the mouse, secretion of the major lung surfactant protein, surfactant protein A (SP-A), was first detected in amniotic fluid (AF) at 17 days postcoitum, rising progressively to term (19 days postcoitum). Expression of IL-1β in AF macrophages and activation of NF-κB in the maternal uterus increased with the gestational increase in SP-A. SP-A stimulated IL-1β and NF-κB expression in cultured AF macrophages. Studies using Rosa 26 Lac-Z (B6;129S-Gt(rosa)26Sor) (Lac-Z) mice revealed that fetal AF macrophages migrate to the uterus with the gestational increase in AF SP-A. Intraamniotic (i.a.) injection of SP-A caused preterm delivery of fetuses within 6-24 h. By contrast, injection of an SP-A antibody or NF-κB inhibitor into AF delayed labor by >24 h. We propose that augmented production of SP-A by the fetal lung near term causes activation and migration of fetal AF macrophages to the maternal uterus, where increased production of IL-1β activates NF-κB, leading to labor. We have revealed a response pathway that ties augmented surfactant production by the maturing fetal lung to the initiation of labor. We suggest that SP-A secreted by the fetal lung serves as a hormone of parturition. PMID:15044702

Extracorporeal circulation as a new experimental pathway for myoblast implantation in mdx mice.

PubMed

Torrente, Y; D'Angelo, M G; Del Bo, R; DeLiso, A; Casati, R; Benti, R; Corti, S; Comi, G P; Gerundini, P; Anichini, A; Scarlato, G; Bresolin, N

1999-01-01

The deficiency of dystrophin, a sarcolemmal associated protein, is responsible for Duchenne muscular dystrophy (DMD). Gene replacement is attractive as a potential therapy. In this article, we describe a new method for myoblast transplantation and expression of dystrophin in skeletal muscle tissue of dystrophin-deficient mdx mouse through iliac vessels extracorporeal circulation. We evaluated the extracorporeal circulation as an alternative route of delivering myoblasts to the target tissue. Two series of experiments were performed with the extracorporeal circulation. In a first series, L6 rat myoblasts, transfected with LacZ reporter gene, were perfused in limbs of 15 rats. In the second series, the muscle limbs of three 6-8-week-old mdx were perfused with myoblasts of donor C57BL10J mice. Before these perfusions, the right tibialis anterior (TA) muscle of the rats and mdx was injected three times at several sites with bupivacaine (BPVC) and hyaluronidase. The ability of injected cells to migrate in the host tissue was assessed in rats by technetium-99m cell labeling. No radioactivity was detected in the lungs, bowels, and liver of animals treated with extracorporeal circulation. The tissue integration and viability of the myoblasts were ultimately confirmed by genetic and histochemical analysis of LacZ reporter gene. Following a single extracorporeal perfusion of myoblasts from donor C57BL10J, sarcolemmal expression of dystrophin was observed in clusters of myofibers in tibialis anterior muscles previously treated with BPVC and hyaluronidase. Furthermore, large clusters of dystrophin-positive fibers were observed in muscles up to 21 days after repeated treatments. These clusters represented an average of 4.2% of the total muscle fibers. These results demonstrate that the extracorporeal circulation allows selective myoblast-mediated gene transfer to muscles, opening new perspectives in muscular dystrophy gene therapy.

Comparative analysis of conditional reporter alleles in the developing embryo and embryonic nervous system.

PubMed

Ellisor, Debra; Koveal, Dorothy; Hagan, Nellwyn; Brown, Ashly; Zervas, Mark

2009-10-01

A long-standing problem in development is understanding how progenitor cells transiently expressing genes contribute to complex anatomical and functional structures. In the developing nervous system an additional level of complexity arises when considering how cells of distinct lineages relate to newly established neural circuits. To address these problems, we used both cumulative marking with Cre/loxP and Genetic Inducible Fate Mapping (GIFM), which permanently and heritably marks small populations of progenitors and their descendants with fine temporal control using CreER/loxP. A key component used in both approaches is a conditional phenotyping allele that has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked Stop sequence, which precedes a reporter allele. Upon recombination, the resulting phenotyping allele is 'turned on' and then constitutively expressed. Thus, the reporter functions as a high fidelity genetic lineage tracer in vivo. Currently there is an array of reporter alleles that can be used in marking strategies, but their recombination efficiency and applicability to a wide array of tissues has not been thoroughly described. To assess the recombination/marking potential of the reporters, we utilized CreER(T) under the control of a Wnt1 transgene (Wnt1-CreER(T)) as well as a cumulative, non-inducible En1(Cre) knock-in line in combination with three different reporters: R26R (LacZ reporter), Z/EG (EGFP reporter), and Tau-Lox-STOP-Lox-mGFP-IRES-NLS-LacZ (membrane-targeted GFP/nuclear LacZ reporter). We marked the Wnt1 lineage using each of the three reporters at embryonic day (E) 8.5 followed by analysis at E10.0, E12.5, and in the adult. We also compared cumulative marking of cells with a history of En1 expression at the same stages. We evaluated the reporters by whole-mount and section analysis and ascertained the strengths and weaknesses of each of the reporters. Comparative analysis with the reporters elucidated complexities of how the Wnt1 and En1 lineages contribute to developing embryos and to axonal projection patterns of neurons derived from these lineages.

Aging effects on intestinal homeostasis associated with expansion and dysfunction of intestinal epithelial stem cells

PubMed Central

Moorefield, Emily C.; Andres, Sarah F.; Blue, R. Eric; Van Landeghem, Laurianne; Mah, Amanda T.; Santoro, M. Agostina; Ding, Shengli

2017-01-01

Intestinal epithelial stem cells (IESCs) are critical to maintain intestinal epithelial function and homeostasis. We tested the hypothesis that aging promotes IESC dysfunction using old (18-22 months) and young (2-4 month) Sox9-EGFP IESC reporter mice. Different levels of Sox9-EGFP permit analyses of active IESC (Sox9-EGFPLow), activatable reserve IESC and enteroendocrine cells (Sox9-EGFPHigh), Sox9-EGFPSublow progenitors, and Sox9-EGFPNegative differentiated lineages. Crypt-villus morphology, cellular composition and apoptosis were measured by histology. IESC function was assessed by crypt culture, and proliferation by flow cytometry and histology. Main findings were confirmed in Lgr5-EGFP and Lgr5-LacZ mice. Aging-associated gene expression changes were analyzed by Fluidigm mRNA profiling. Crypts culture from old mice yielded fewer and less complex enteroids. Histology revealed increased villus height and Paneth cells per crypt in old mice. Old mice showed increased numbers and hyperproliferation of Sox9-EGFPLow IESC and Sox9-EGFPHigh cells. Cleaved caspase-3 staining demonstrated increased apoptotic cells in crypts and villi of old mice. Gene expression profiling revealed aging-associated changes in mRNAs associated with cell cycle, oxidative stress and apoptosis specifically in IESC. These findings provide new, direct evidence for aging associated IESC dysfunction, and define potential biomarkers and targets for translational studies to assess and maintain IESC function during aging. PMID:28854151

Recombinant avian adeno-associated virus: transgene expression in vivo and enhancement of expression in vitro.

PubMed

Estevez, Carlos; Villegas, Pedro

2006-06-01

Recombinant avian adeno-associated viruses coding for the LacZ gene were used to inoculate embryonating chicken eggs, to assess the usefulness of the system for the expression of a transgene in vivo. The results obtained indicate significantly higher levels of expression of the reporter gene at various time intervals in the embryos inoculated with the recombinant virus in comparison with the mock-inoculated controls. At the embryo level, significant differences were evident at 120 hr postinoculation; hatched chicks showed transgene expression up to 14 days of age. In a second experiment, different cell-line cultures were transfected with plasmids encoding for a reporter gene flanked by the avian adeno-associated virus inverted terminal repeats (ITR), either alone or in the presence of the major nonstructural proteins of the virus (Rep 78/68) to assess the ability of these proteins and DNA elements to enhance gene expression. Results indicate that the inclusion of the viral ITR alone or during coexpression of the Rep proteins significantly enhances the expression of the transgene in all cell lines tested, as evidenced by the detection of the beta-galacrosidase protein through chemiluminescence reactions and staining of transfected monolayers.

Hox cluster polarity in early transcriptional availability: a high order regulatory level of clustered Hox genes in the mouse.

PubMed

Roelen, Bernard A J; de Graaff, Wim; Forlani, Sylvie; Deschamps, Jacqueline

2002-11-01

The molecular mechanism underlying the 3' to 5' polarity of induction of mouse Hox genes is still elusive. While relief from a cluster-encompassing repression was shown to lead to all Hoxd genes being expressed like the 3'most of them, Hoxd1 (Kondo and Duboule, 1999), the molecular basis of initial activation of this 3'most gene, is not understood yet. We show that, already before primitive streak formation, prior to initial expression of the first Hox gene, a dramatic transcriptional stimulation of the 3'most genes, Hoxb1 and Hoxb2, is observed upon a short pulse of exogenous retinoic acid (RA), whereas it is not in the case for more 5', cluster-internal, RA-responsive Hoxb genes. In contrast, the RA-responding Hoxb1lacZ transgene that faithfully mimics the endogenous gene (Marshall et al., 1994) did not exhibit the sensitivity of Hoxb1 to precocious activation. We conclude that polarity in initial activation of Hoxb genes reflects a greater availability of 3'Hox genes for transcription, suggesting a pre-existing (susceptibility to) opening of the chromatin structure at the 3' extremity of the cluster. We discuss the data in the context of prevailing models involving differential chromatin opening in the directionality of clustered Hox gene transcription, and regarding the importance of the cluster context for correct timing of initial Hox gene expression.Interestingly, Cdx1 manifested the same early transcriptional availability as Hoxb1. Copyright 2002 Elsevier Science Ireland Ltd.

Homodimeric β-Galactosidase from Lactobacillus delbrueckii subsp. bulgaricus DSM 20081: Expression in Lactobacillus plantarum and Biochemical Characterization

PubMed Central

2012-01-01

The lacZ gene from Lactobacillus delbrueckii subsp. bulgaricus DSM 20081, encoding a β-galactosidase of the glycoside hydrolase family GH2, was cloned into different inducible lactobacillal expression vectors for overexpression in the host strain Lactobacillus plantarum WCFS1. High expression levels were obtained in laboratory cultivations with yields of approximately 53000 U of β-galactosidase activity per liter of medium, which corresponds to ∼170 mg of recombinant protein per liter and β-galactosidase levels amounting to 63% of the total intracellular protein of the host organism. The wild-type (nontagged) and histidine-tagged recombinant enzymes were purified to electrophoretic homogeneity and further characterized. β-Galactosidase from L. bulgaricus was used for lactose conversion and showed very high transgalactosylation activity. The maximum yield of galacto-oligosaccharides (GalOS) was approximately 50% when using an initial concentration of 600 mM lactose, indicating that the enzyme can be of interest for the production of GalOS. PMID:22283494

Homodimeric β-galactosidase from Lactobacillus delbrueckii subsp. bulgaricus DSM 20081: expression in Lactobacillus plantarum and biochemical characterization.

PubMed

Nguyen, Tien-Thanh; Nguyen, Hoang Anh; Arreola, Sheryl Lozel; Mlynek, Georg; Djinović-Carugo, Kristina; Mathiesen, Geir; Nguyen, Thu-Ha; Haltrich, Dietmar

2012-02-22

The lacZ gene from Lactobacillus delbrueckii subsp. bulgaricus DSM 20081, encoding a β-galactosidase of the glycoside hydrolase family GH2, was cloned into different inducible lactobacillal expression vectors for overexpression in the host strain Lactobacillus plantarum WCFS1. High expression levels were obtained in laboratory cultivations with yields of approximately 53000 U of β-galactosidase activity per liter of medium, which corresponds to ~170 mg of recombinant protein per liter and β-galactosidase levels amounting to 63% of the total intracellular protein of the host organism. The wild-type (nontagged) and histidine-tagged recombinant enzymes were purified to electrophoretic homogeneity and further characterized. β-Galactosidase from L. bulgaricus was used for lactose conversion and showed very high transgalactosylation activity. The maximum yield of galacto-oligosaccharides (GalOS) was approximately 50% when using an initial concentration of 600 mM lactose, indicating that the enzyme can be of interest for the production of GalOS.

The phzA2-G2 Transcript Exhibits Direct RsmA-Mediated Activation in Pseudomonas aeruginosa M18

PubMed Central

Ren, Bin; Shen, Huifeng; Lu, Zhi John; Liu, Haiming; Xu, Yuquan

2014-01-01

In bacteria, RNA-binding proteins of the RsmA/CsrA family act as post-transcriptional regulators that modulate translation initiation at target transcripts. The Pseudomonas aeruginosa genome contains two phenazine biosynthetic (phz) gene clusters, phzA1-G1 (phz1) and phzA2-G2 (phz2), each of which is responsible for phenazine-1-carboxylic acid (PCA) biosynthesis. In the present study, we show that RsmA exhibits differential gene regulation on two phz clusters in P. aeruginosa M18 at the post-transcriptional level. Based on the sequence analysis, four GGA motifs, the potential RsmA binding sites, are found on the 5′-untranslated region (UTR) of the phz2 transcript. Studies with a series of lacZ reporter fusions, and gel mobility shift assays suggest that the third GGA motif (S3), located 21 nucleotides upstream of the Shine-Dalgarno (SD) sequence, is involved in direct RsmA-mediated activation of phz2 expression. We therefore propose a novel model in which the binding of RsmA to the target S3 results in the destabilization of the stem-loop structure and the enhancement of ribosome access. This model could be fully supported by RNA structure prediction, free energy calculations, and nucleotide replacement studies. In contrast, various RsmA-mediated translation repression mechanisms have been identified in which RsmA binds near the SD sequence of target transcripts, thereby blocking ribosome access. Similarly, RsmA is shown to negatively regulate phz1 expression. Our new findings suggest that the differential regulation exerted by RsmA on the two phz clusters may confer an advantage to P. aeruginosa over other pseudomonads containing only a single phz cluster in their genomes. PMID:24586939

A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase

PubMed Central

Aguilar, Pablo S.; Cronan, John E.; de Mendoza, Diego

1998-01-01

Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desaturase of B. subtilis. This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis. The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria. Expression of the des gene in E. coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B. subtilis des gene product is a Δ5 acyl-lipid desaturase. The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures. The des null mutant strain grew as well as its congenic parent at 20 or 37°C but showed severely reduced survival during stationary phase. Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37°C, but a shift of cultures from 37 to 20°C resulted in a 10- to 15-fold increase in transcription. This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase. PMID:9555904

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Generation of a mouse with conditionally activated signaling through the BMP receptor, ALK2.

PubMed

Fukuda, Tomokazu; Scott, Gregory; Komatsu, Yoshihiro; Araya, Runa; Kawano, Masako; Ray, Manas K; Yamada, Masahisa; Mishina, Yuji

2006-04-01

BMP signaling plays pleiotropic roles in various tissues. Transgenic mouse lines that overexpress BMP signaling in a tissue-specific manner would be beneficial; however, production of each tissue-specific transgenic mouse line is labor-intensive. Here, using a Cre-loxP system, we generated a conditionally overexpressing mouse line for BMP signaling through the type I receptor ALK2 (alternatively known as AVCRI, ActRI, or ActRIA). By mating this line with Cre-expression mouse lines, Cre-mediated recombination removes an intervening floxed lacZ expression cassette and thereby permits the expression of a constitutively active form of Alk2 (caAlk2) driven by a ubiquitous promoter, CAG. Tissue specificity of Cre recombination was monitored by a bicistronically expressed EGFP following Alk2 cDNA. Increased BMP signaling was confirmed by ectopic phosphorylation of SMAD1/5/8 in the areas where Cre recombination had occurred. The conditional overexpression system described here provides versatility in investigating gene functions in a tissue-specific manner without having to generate independent tissue-specific transgenic lines. Published 2006 Wiley-Liss, Inc.

Frameshifting in the expression of the Escherichia coli trpR gene is modulated by translation initiation.

PubMed Central

Benhar, I; Miller, C; Engelberg-Kulka, H

1993-01-01

The Escherichia coli trpR gene encodes the 108-amino-acid-long Trp repressor. We have shown previously that a +1 frameshifting event occurs during the expression of trpR, resulting in the synthesis of an additional (+1 frame) polypeptide. Using trpR-lac'Z fusions, we have recently found that the transition from the 0 to the +1 frame occurs via the bypassing of a 55-nucleotide-long segment of the trpR+1-lac'Z mRNA (I. Benhar, and H. Engelberg-Kulka, Cell 72:121-130, 1993). Here we show that the frequency of trpR frameshifting (or bypassing) can be regulated both in vivo and in vitro. This frequency is inversely proportional to the rate of initiation of translation of the trpR gene. Hence, modulating the level of translation initiation affects the frequency of frameshifting. Images PMID:8491735

Protective effects of brain-derived neurotrophic factor on the noise-damaged cochlear spiral ganglion.

PubMed

Zhai, S-Q; Guo, W; Hu, Y-Y; Yu, N; Chen, Q; Wang, J-Z; Fan, M; Yang, W-Y

2011-05-01

To explore the protective effects of brain-derived neurotrophic factor on the noise-damaged cochlear spiral ganglion. Recombinant adenovirus brain-derived neurotrophic factor vector, recombinant adenovirus LacZ and artificial perilymph were prepared. Guinea pigs with audiometric auditory brainstem response thresholds of more than 75 dB SPL, measured seven days after four hours of noise exposure at 135 dB SPL, were divided into three groups. Adenovirus brain-derived neurotrophic factor vector, adenovirus LacZ and perilymph were infused into the cochleae of the three groups, variously. Eight weeks later, the cochleae were stained immunohistochemically and the spiral ganglion cells counted. The auditory brainstem response threshold recorded before and seven days after noise exposure did not differ significantly between the three groups. However, eight weeks after cochlear perfusion, the group receiving brain-derived neurotrophic factor had a significantly decreased auditory brainstem response threshold and increased spiral ganglion cell count, compared with the adenovirus LacZ and perilymph groups. When administered via cochlear infusion following noise damage, brain-derived neurotrophic factor appears to improve the auditory threshold, and to have a protective effect on the spiral ganglion cells.

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.

Aging effects on intestinal homeostasis associated with expansion and dysfunction of intestinal epithelial stem cells.

PubMed

Moorefield, Emily C; Andres, Sarah F; Blue, R Eric; Van Landeghem, Laurianne; Mah, Amanda T; Santoro, M Agostina; Ding, Shengli

2017-08-29

Intestinal epithelial stem cells (IESCs) are critical to maintain intestinal epithelial function and homeostasis. We tested the hypothesis that aging promotes IESC dysfunction using old (18-22 months) and young (2-4 month) Sox9-EGFP IESC reporter mice. Different levels of Sox9-EGFP permit analyses of active IESC (Sox9-EGFP Low ), activatable reserve IESC and enteroendocrine cells (Sox9-EGFP High ), Sox9-EGFP Sublow progenitors, and Sox9-EGFP Negative differentiated lineages. Crypt-villus morphology, cellular composition and apoptosis were measured by histology. IESC function was assessed by crypt culture, and proliferation by flow cytometry and histology. Main findings were confirmed in Lgr5-EGFP and Lgr5-LacZ mice. Aging-associated gene expression changes were analyzed by Fluidigm mRNA profiling. Crypts culture from old mice yielded fewer and less complex enteroids. Histology revealed increased villus height and Paneth cells per crypt in old mice. Old mice showed increased numbers and hyperproliferation of Sox9-EGFP Low IESC and Sox9-EGFP High cells. Cleaved caspase-3 staining demonstrated increased apoptotic cells in crypts and villi of old mice. Gene expression profiling revealed aging-associated changes in mRNAs associated with cell cycle, oxidative stress and apoptosis specifically in IESC. These findings provide new, direct evidence for aging associated IESC dysfunction, and define potential biomarkers and targets for translational studies to assess and maintain IESC function during aging.

Regulation of the yeast EKI1-encoded ethanolamine kinase by inositol and choline.

PubMed

Kersting, Michael C; Choi, Hyeon-Son; Carman, George M

2004-08-20

Regulation of the EKI1-encoded ethanolamine kinase by inositol and choline was examined in Saccharomyces cerevisiae. Transcription of the EKI1 gene was monitored by following the expression of beta-galactosidase activity driven by a P(EKI1)-lacZ reporter gene. The addition of inositol to the growth medium resulted in a dose-dependent decrease in EKI1 expression. Supplementation of choline to inositol-containing growth medium brought about a further decrease in expression, whereas choline supplementation alone had no effect. Analysis of EKI1 expression in ino2Delta, ino4Delta, and opi1Delta mutants indicated that the transcription factors Ino2p, Ino4p, and Opi1p played a role in this regulation. Moreover, mutational analysis showed that the UAS(INO) element in the EKI1 promoter was required for the inositol-mediated regulation. The regulation of EKI1 expression by inositol and choline was confirmed by corresponding changes in ethanolamine kinase mRNA, protein, and activity levels. The repression of ethanolamine kinase by inositol supplementation correlated with a decrease in the incorporation of ethanolamine into CDP-ethanolamine pathway intermediates and into phosphatidylethanolamine and phosphatidylcholine.

Regulation of notochord-specific expression of Ci-Bra downstream genes in Ciona intestinalis embryos.

PubMed

Takahashi, Hiroki; Hotta, Kohji; Takagi, Chiyo; Ueno, Naoto; Satoh, Nori; Shoguchi, Eiichi

2010-02-01

Brachyury, a T-box transcription factor, is expressed in ascidian embryos exclusively in primordial notochord cells and plays a pivotal role in differentiation of notochord cells. Previously, we identified approximately 450 genes downstream of Ciona intestinalis Brachyury (Ci-Bra), and characterized the expression profiles of 45 of these in differentiating notochord cells. In this study, we looked for cisregulatory sequences in minimal enhancers of 20 Ci-Bra downstream genes by electroporating region within approximately 3 kb upstream of each gene fused with lacZ. Eight of the 20 reporters were expressed in notochord cells. The minimal enchancer for each of these eight genes was narrowed to a region approximately 0.5-1.0-kb long. We also explored the genome-wide and coordinate regulation of 43 Ci-Bra-downstream genes. When we determined their chromosomal localization, it became evident that they are not clustered in a given region of the genome, but rather distributed evenly over 13 of the 14 pairs of chromosomes, suggesting that gene clustering does not contribute to coordinate control of the Ci-Bra downstream gene expression. Our results might provide Insights Into the molecular mechanisms underlying notochord formation in chordates.

An Approach for Treating the Hepatobiliary Disease of Cystic Fibrosis by Somatic Gene Transfer

NASA Astrophysics Data System (ADS)

Yang, Yiping; Raper, Steven E.; Cohn, Jonathan A.; Engelhardt, John F.; Wilson, James M.

1993-05-01

Cystic fibrosis (CF) is an inherited disease of epithelial cell ion transport that is associated with pathology in multiple organ systems, including lung, pancreas, and liver. As treatment of the pulmonary manifestations of CF has improved, management of CF liver disease has become increasingly important in adult patients. This report describes an approach for treating CF liver disease by somatic gene transfer. In situ hybridization and immunocytochemistry analysis of rat liver sections indicated that the endogenous CFTR (cystic fibrosis transmembrane conductance regulator) gene is primarily expressed in the intrahepatic biliary epithelial cells. To specifically target recombinant genes to the biliary epithelium in vivo, recombinant adenoviruses expressing lacZ or human CFTR were infused retrograde into the biliary tract through the common bile duct. Conditions were established for achieving recombinant gene expression in virtually all cells of the intrahepatic bile ducts in vivo. Expression persisted in the smaller bile ducts for the duration of the experiment, which was 21 days. These studies suggest that it may be feasible to prevent CF liver disease by genetically reconstituting CFTR expression in the biliary tract, using an approach that is clinically feasible.

Hes1 expression is reduced in Tbx1 null cells and is required for the development of structures affected in 22q11 deletion syndrome

PubMed Central

van Bueren, Kelly Lammerts; Papangeli, Irinna; Rochais, Francesca; Pearce, Kerra; Roberts, Catherine; Calmont, Amelie; Szumska, Dorota; Kelly, Robert G.; Bhattacharya, Shoumo; Scambler, Peter J.

2010-01-01

22q11 deletion syndrome (22q11DS) is characterised by aberrant development of the pharyngeal apparatus and the heart with haploinsufficiency of the transcription factor TBX1 being considered the major underlying cause of the disease. Tbx1 mutations in mouse phenocopy the disorder. In order to identify the transcriptional dysregulation in Tbx1-expressing lineages we optimised fluorescent-activated cell sorting of β-galactosidase expressing cells (FACS-Gal) to compare the expression profile of Df1/Tbx1lacZ (effectively Tbx1 null) and Tbx1 heterozygous cells isolated from mouse embryos. Hes1, a major effector of Notch signalling, was identified as downregulated in Tbx1−/− mutants. Hes1 mutant mice exhibited a partially penetrant range of 22q11DS-like defects including pharyngeal arch artery (PAA), outflow tract, craniofacial and thymic abnormalities. Similar to Tbx1 mice, conditional mutagenesis revealed that Hes1 expression in embryonic pharyngeal ectoderm contributes to thymus and pharyngeal arch artery development. These results suggest that Hes1 acts downstream of Tbx1 in the morphogenesis of pharyngeal-derived structures. PMID:20122914

Dlx homeobox gene family expression in osteoclasts.

PubMed

Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

2010-06-01

Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

Intraarticular expression of biologically active interleukin 1-receptor-antagonist protein by ex vivo gene transfer.

PubMed Central

Bandara, G; Mueller, G M; Galea-Lauri, J; Tindal, M H; Georgescu, H I; Suchanek, M K; Hung, G L; Glorioso, J C; Robbins, P D; Evans, C H

1993-01-01

Gene therapy offers a radical different approach to the treatment of arthritis. Here we have demonstrated that two marker genes (lacZ and neo) and cDNA coding for a potentially therapeutic protein (human interleukin 1-receptor-antagonist protein; IRAP or IL-1ra) can be delivered, by ex vivo techniques, to the synovial lining of joints; intraarticular expression of IRAP inhibited intraarticular responses to interleukin 1. To achieve this, lapine synoviocytes were first transduced in culture by retroviral infection. The genetically modified synovial cells were then transplanted by intraarticular injection into the knee joints of rabbits, where they efficiently colonized the synovium. Assay of joint lavages confirmed the in vivo expression of biologically active human IRAP. With allografted cells, IRAP expression was lost by 12 days after transfer. In contrast, autografted synoviocytes continued to express IRAP for approximately 5 weeks. Knee joints expressing human IRAP were protected from the leukocytosis that otherwise follows the intraarticular injection of recombinant human interleukin 1 beta. Thus, we report the intraarticular expression and activity of a potentially therapeutic protein by gene-transfer technology; these experiments demonstrate the feasibility of treating arthritis and other joint disorders with gene therapy. Images Fig. 1 Fig. 2 PMID:8248169

Genetics in methylotrophic bacteria: Appendix. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lidstrom, M.E.

This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Evidence that the Dictyostelium STAT protein Dd-STATa plays a role in the differentiation of inner basal disc cells and identification of a promoter element essential for expression in these cells.

PubMed

Shimada, Nao; Maruo, Toshinari; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi

2005-02-01

Dd-STATa, a Dictyostelium homolog of the metazoan STAT (signal transducers and activators of transcription) proteins, is necessary in the slug for correct entry into culmination. Dd-STATa-null mutant fails to culminate and its phenotype correlates with the loss of a funnel-shaped core region, the pstAB core region, which expresses both the ecmA and ecmB genes. To understand how the differentiation of pstAB core cells is regulated, we identified an EST that is expressed in the core cells of normal slugs but down-regulated in the Dd-STATa-null mutant. This EST, SSK348, encodes a close homolog of the Dictyostelium acetyl-CoA synthetase (ACS). A promoter fragment of the cognate gene, aslA (acetyl-CoA synthetase-like A), was fused to a lacZ reporter and the expression pattern determined. As expected from the behavior of the endogenous aslA gene, the aslA::lacZ fusion gene is not expressed in Dd-STATa-null slugs. In parental cells, the aslA promoter is first activated in the funnel-shaped core cells located at the slug anterior, the "pstAB core." During culmination, the pstAB core cells move down, through the prespore cells, to form the inner part of the basal disc. As the spore mass climbs the stalk, the aslA gene comes to be expressed in cells of the upper and lower cups, structures that cradle the spore head. Deletion and point mutation analyses of the promoter identified an AT-rich sequence that is necessary for expression in the pstAB core. This acts in combination with repressor regions that prevent ectopic aslA expression in the pre-stalk regions of slugs and the stalks of culminants. Thus, this study confirms that Dd-STATa is necessary for the differentiation of pstAB core cells, by showing that it is needed for the activation of the aslA gene. It also identifies aslA promoter elements that are likely to be regulated, directly or indirectly, by Dd-STATa.

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

Transcriptional analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi

2006-08-01

The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.

[Quasi-adaptive response to alkylating agents in Escherichia coli and Ada-protein functions].

PubMed

Vasil'eva, S V; Moshkovskaia, E Iu; Terekhov, A S; Mikoian, V D; Vanin, A F

2008-01-01

In 2005 we have described in exponentially growing E. coli cells a new fundamental genetic phenomenon,--quasi-adaptive response to alkylating compounds (quasi-Ada). Phenotypic expression of quasi-Ada is similar to the true Ada response. However, in contrast to the letter, it develops in the course of pretreatment of the cells by a sublethal dose of nonalkylating agent, an NO-containing dinitrosyl iron complex with glutathione (DNICglu). To reveal the mechanisms of quasi-adaptation and its association with the function of the Ada regulatory protein, here we used a unique property of dual gene expression regulation of aidB1 gene, a part of the Ada-regulon, namely its relative independence from Ada protein in anaerobic conditions. Based on the results of aidB1 gene expression analysis an EPR spectra of E. coli MV2176 cells (aidB1::lacZ) in aerobic and anaerobic conditions after the corresponding treatments, we conclude that the function and the spatial structure of meAda and [(Cys-)2Fe+(NO+)2]Ada are identical and thus the nitrosylated protein represents a regulator of the Ada regulon gene expression during quasi-adaptation development.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Expression of Dentin Sialophosphoprotein in Non-mineralized Tissues

PubMed Central

Prasad, Monica; Zhu, Qinglin; Sun, Yao; Wang, Xiaofang; Kulkarni, Ashok; Boskey, Adele; Feng, Jian Q.

2011-01-01

Dentin sialophosphoprotein (DSPP) and its cleaved products, dentin phosphoprotein (DPP) and dentin sialoprotein (DSP), play important roles in biomineralization. Believed to be tooth specific, the authors’ group revealed its expression in bone, and more recently, they and other groups also showed its expression in a few types of soft tissues. In this study, the authors systematically examined the expression of DSPP in a variety of non-mineralized tissues using reverse-transcription polymerase chain reaction (RT-PCR), real-time PCR, Western immunoblotting, and immunohistochemistry analyses in wild-type mice as well as β-galactosidase assays in the Dspp lacZ knock-in mice. These approaches showed the presence of DSPP in the salivary glands, cartilage, liver, kidney, and brain and its absence in the heart and spleen. Real-time PCR showed that the expression levels of DSPP mRNA in salivary glands, cartilage, liver, and kidney were higher than in the bone. Interestingly, DSPP was observed in the pericytes of blood vessels in the dental pulp, which are believed to be able to differentiate into odontoblasts. On the basis of these observations, the authors conclude that DSPP and/or its cleaved products may fulfill important functions in certain non-mineralized tissues in addition to its role in biomineralization. PMID:22043023

Tissue-specific expression of FoxD reporter constructs in amphioxus embryos.

PubMed

Yu, Jr-Kai; Holland, Nicholas D; Holland, Linda Z

2004-10-15

Cephalochordates (amphioxus), the closest living invertebrate relatives of the vertebrates, are key to understanding the evolution of developmental mechanisms during the invertebrate-to-vertebrate transition. However, a major impediment to amphioxus as a model organism for developmental biology has been the inability to introduce transgenes or other macromolecules into the embryos. Here, we report the development of a reproducible method for microinjection of amphioxus eggs. Specifically, we show that expression of a LacZ reporter construct including 6.3 kb of AmphiFoxD upstream regulatory DNA recapitulates expression of the endogenous gene in the nerve cord, somites, and notochord. We have also identified the 1.6 kb at the 5' end of this region as essential for expression in the first two of these domains and the 4.7 kb at the 3' end as sufficient for expression in the notochord. This study, which is the first report of a method for introduction of large molecules such as DNA into amphioxus embryos, opens the way for studies of gene regulation and function in amphioxus and for comparative studies with vertebrates to understand the relationship between the extensive gene duplications that occurred within the vertebrate lineage and the evolution of vertebrate innovations such as neural crest.

Differential endothelial transcriptomics identifies semaphorin 3G as a vascular class 3 semaphorin.

PubMed

Kutschera, Simone; Weber, Holger; Weick, Anja; De Smet, Frederik; Genove, Guillem; Takemoto, Minoru; Prahst, Claudia; Riedel, Maria; Mikelis, Constantinos; Baulande, Sylvain; Champseix, Catherine; Kummerer, Petra; Conseiller, Emmanuel; Multon, Marie-Christine; Heroult, Melanie; Bicknell, Roy; Carmeliet, Peter; Betsholtz, Christer; Augustin, Hellmut G

2011-01-01

To characterize the role of a vascular-expressed class 3 semaphorin (semaphorin 3G [Sema3G]). Semaphorins have been identified as axon guidance molecules. Yet, they have more recently also been characterized as attractive and repulsive regulators of angiogenesis. Through a transcriptomic screen, we identified Sema3G as a molecule of angiogenic endothelial cells. Sema3G-deficient mice are viable and exhibit no overt vascular phenotype. Yet, LacZ expression in the Sema3G locus revealed intense arterial vascular staining in the angiogenic vasculature, starting at E9.5, which was detectable throughout adolescence and downregulated in adult vasculature. Sema3G is expressed as a full-length 100-kDa secreted molecule that is processed by furin proteases to yield 95- and a 65-kDa Sema domain-containing subunits. Full-length Sema3G binds to NP2, whereas processed Sema3G binds to NP1 and NP2. Expression profiling and cellular experiments identified autocrine effects of Sema3G on endothelial cells and paracrine effects on smooth muscle cells. Although the mouse knockout phenotype suggests compensatory mechanisms, the experiments identify Sema3G as a primarily endothelial cell-expressed class 3 semaphorin that controls endothelial and smooth muscle cell functions in autocrine and paracrine manners, respectively.

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

PubMed

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

Comparison between S+L- assay and LacZ marker rescue assay for detecting replication-competent gammaretroviruses.

PubMed

Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T

2015-09-01

To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Overexpression of cystatin C in synovium does not reduce synovitis or cartilage degradation in established osteoarthritis.

PubMed

Kyostio-Moore, Sirkka; Piraino, Susan; Berthelette, Patricia; Moran, Nance; Serriello, Joseph; Bendele, Alison; Sookdeo, Cathleen; Nambiar, Bindu; Ewing, Patty; Armentano, Donna; Matthews, Gloria L

2015-01-16

Cathepsin K (catK) expression is increased in cartilage, bone and synovium during osteoarthritis (OA). To study the role of catK expression and elevated cathepsin activity in the synovium on cartilage destruction in established OA, we overexpressed cystatin C (cysC), a natural cysteine protease inhibitor, in the synovium of rabbit OA joints. The ability of cysC to inhibit activity of cathepsins in rabbit OA synovium lysates was tested in vitro using protease activity assay. In vivo, the tissue localization of recombinant adeno-associated virus (rAAV) with LacZ gene after intra-articular injection was determined by β-galactosidase staining of rabbit joints 4 weeks later. To inhibit cathepsin activity in the synovium, a rAAV2-encoding cysC was delivered intra-articularly into rabbit joints 4 weeks after OA was induced by anterior cruciate ligament transection (ACLT). Seven weeks postinjection, endogenous catK and cysC levels as well as the vector-derived cysC expression in the synovium of normal and OA joints were examined by RNA quantification. Synovial cathepsin activity and catK, catB and catL protein levels were determined by activity and Western blot analyses, respectively. Synovitis and cartilage degradation were evaluated by histopathological scoring. In vitro, the ability of cysC to efficiently inhibit activity of purified catK and OA-induced cathepsins in rabbit synovial lysates was demonstrated. In vivo, the intra-articular delivery of rAAV2/LacZ showed transduction of mostly synovium. Induction of OA in rabbit joints resulted in fourfold increase in catK mRNA compared to sham controls while no change was detected in endogenous cysC mRNA levels in the synovium. Protein levels for catK, catB and catL were also increased in the synovium with a concomitant fourfold increase in cathepsin activity. Joints treated with rAAV2/cysC showed both detection of vector genomes and vector-derived cysC transcripts in the synovium. Production of functional cysC by the vector was demonstrated by complete block of cathepsin activity in the synovium. However, this did not decrease synovitis, bone sclerosis or progression of cartilage degradation. Increased production of natural cathepsin inhibitor, cysC, in OA synovium does not alleviate synovitis or cartilage pathology during a preexisting OA.

Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein.

PubMed Central

Stevenson, S C; Rollence, M; Marshall-Neff, J; McClelland, A

1997-01-01

The adenovirus fiber protein is responsible for attachment of the virion to unidentified cell surface receptors. There are at least two distinct adenovirus fiber receptors which interact with the group B (Ad3) and group C (Ad5) adenoviruses. We have previously shown by using expressed adenovirus fiber proteins that it is possible to change the specificity of the fiber protein by exchanging the head domain with another serotype which recognizes a different receptor (S. C. Stevenson et al., J. Virol. 69:2850-2857, 1995). A chimeric fiber cDNA containing the Ad3 fiber head domain fused to the Ad5 fiber tail and shaft was incorporated into the genome of an adenovirus vector with E1 and E3 deleted encoding beta-galactosidase to generate Av9LacZ4, an adenovirus particle which contains a chimeric fiber protein. Western blot analysis of the chimeric fiber vector confirmed expression of the chimeric fiber protein and its association with the adenovirus capsid. Transduction experiments with fiber protein competitors demonstrated the altered receptor tropism of the chimeric fiber vector compared to that of the parental Av1LacZ4 vector. Transduction of a panel of human cell lines with the chimeric and parental vectors provided evidence for a different cellular distribution of the Ad5 and Ad3 receptors. Three cell lines (THP-1, MRC-5, and FaDu) were more efficiently transduced by the vector containing the Ad3 fiber head than by the Ad5 fiber vector. In contrast, human coronary artery endothelial cells were transduced more readily with the vector containing the Ad5 fiber than with the chimeric fiber vector. HeLa and human umbilical vein endothelial cells were transduced at equivalent levels compared with human diploid fibroblasts, which were refractory to transduction with both vectors. These results provide evidence for the differential expression of the Ad5 and Ad3 receptors on human cell lines derived from clinically relevant target tissues. Furthermore, we show that exchange of the fiber head domain is a viable approach to the production of adenovirus vectors with cell-type-selective transduction properties. It may be possible to extend this approach to the use of ligands for a range of different cellular receptors in order to target gene transfer to specific cell types at the level of transduction. PMID:9151872

The cyclic AMP receptor protein, CRP, is required for both virulence and expression of the minimal CRP regulon in Yersinia pestis biovar microtus.

PubMed

Zhan, Lingjun; Han, Yanping; Yang, Lei; Geng, Jing; Li, Yingli; Gao, He; Guo, Zhaobiao; Fan, Wei; Li, Gang; Zhang, Lianfeng; Qin, Chuan; Zhou, Dongsheng; Yang, Ruifu

2008-11-01

The cyclic AMP receptor protein (CRP) is a bacterial regulator that controls more than 100 promoters, including those involved in catabolite repression. In the present study, a null deletion of the crp gene was constructed for Yersinia pestis bv. microtus strain 201. Microarray expression analysis disclosed that at least 6% of Y. pestis genes were affected by this mutation. Further reverse transcription-PCR and electrophoretic mobility shift assay analyses disclosed a set of 37 genes or putative operons to be the direct targets of CRP, and thus they constitute the minimal CRP regulon in Y. pestis. Subsequent primer extension and DNase I footprinting assays mapped transcriptional start sites, core promoter elements, and CRP binding sites within the DNA regions upstream of pla and pst, revealing positive and direct control of these two laterally acquired plasmid genes by CRP. The crp disruption affected both in vitro and in vivo growth of the mutant and led to a >15,000-fold loss of virulence after subcutaneous infection but a <40-fold increase in the 50% lethal dose by intravenous inoculation. Therefore, CRP is required for the virulence of Y. pestis and, particularly, is more important for infection by subcutaneous inoculation. It can further be concluded that the reduced in vivo growth phenotype of the crp mutant should contribute, at least partially, to its attenuation of virulence by both routes of infection. Consistent with a previous study of Y. pestis bv. medievalis, lacZ reporter fusion analysis indicated that the crp deletion resulted in the almost absolute loss of pla promoter activity. The plasminogen activator encoded by pla was previously shown to specifically promote Y. pestis dissemination from peripheral infection routes (subcutaneous infection [flea bite] or inhalation). The above evidence supports the notion that in addition to the reduced in vivo growth phenotype, the defect of pla expression in the crp mutant will greatly contribute to the huge loss of virulence of this mutant strain in subcutaneous infection.

Lgr5-EGFP marks taste bud stem/progenitor cells in posterior tongue

PubMed Central

Yee, Karen K.; Li, Yan; Redding, Kevin M.; Iwatsuki, Ken; Margolskee, Robert F.; Jiang, Peihua

2013-01-01

Until recently, reliable markers for adult stem cells have been lacking for many regenerative mammalian tissues. Lgr5 (leucine-rich repeat-containing G-protein coupled receptor 5) has been identified as a marker for adult stem cells in intestine, stomach, and hair follicle; Lgr5-expressing cells give rise to all types of cells in these tissues. Taste epithelium also regenerates constantly, yet the identity of adult taste stem cells remains elusive. In this study, we found that Lgr5 is strongly expressed in cells at the bottom of trench areas at the base of circumvallate and foliate taste papillae and weakly expressed in the basal area of taste buds and that Lgr5-expressing cells in posterior tongue are a subset of K14-positive epithelial cells. Lineage-tracing experiments using an inducible Cre knock-in allele in combination with Rosa26-LacZ and Rosa26-tdTomato reporter strains showed that Lgr5-expressing cells gave rise to taste cells, perigemmal cells, along with self-renewing cells at the bottom of trench areas at the base of circumvallate and foliate papillae. Moreover, using subtype-specific taste markers, we found that Lgr5-expressing cell progeny include all three major types of adult taste cells. Our results indicate that Lgr5 may mark adult taste stem or progenitor cells in the posterior portion of the tongue. PMID:23377989

Lgr5-EGFP marks taste bud stem/progenitor cells in posterior tongue.

PubMed

Yee, Karen K; Li, Yan; Redding, Kevin M; Iwatsuki, Ken; Margolskee, Robert F; Jiang, Peihua

2013-05-01

Until recently, reliable markers for adult stem cells have been lacking for many regenerative mammalian tissues. Lgr5 (leucine-rich repeat-containing G-protein-coupled receptor 5) has been identified as a marker for adult stem cells in intestine, stomach, and hair follicle; Lgr5-expressing cells give rise to all types of cells in these tissues. Taste epithelium also regenerates constantly, yet the identity of adult taste stem cells remains elusive. In this study, we found that Lgr5 is strongly expressed in cells at the bottom of trench areas at the base of circumvallate (CV) and foliate taste papillae and weakly expressed in the basal area of taste buds and that Lgr5-expressing cells in posterior tongue are a subset of K14-positive epithelial cells. Lineage-tracing experiments using an inducible Cre knockin allele in combination with Rosa26-LacZ and Rosa26-tdTomato reporter strains showed that Lgr5-expressing cells gave rise to taste cells, perigemmal cells, along with self-renewing cells at the bottom of trench areas at the base of CV and foliate papillae. Moreover, using subtype-specific taste markers, we found that Lgr5-expressing cell progeny include all three major types of adult taste cells. Our results indicate that Lgr5 may mark adult taste stem or progenitor cells in the posterior portion of the tongue. Copyright © 2013 AlphaMed Press.

Regulation of the Carnitine Pathway in Escherichia coli: Investigation of the cai-fix Divergent Promoter Region

PubMed Central

Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée

1998-01-01

The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142

Tissue-specific in vivo genetic toxicity of nine polycyclic aromatic hydrocarbons assessed using the Muta™Mouse transgenic rodent assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, Alexandra S., E-mail: alexandra.long@hc-sc.gc.ca; Mechanistic Studies Division, Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON; Lemieux, Christine L.

Test batteries to screen chemicals for mutagenic hazard include several endpoints regarded as effective for detecting genotoxic carcinogens. Traditional in vivo methods primarily examine clastogenic endpoints in haematopoietic tissues. Although this approach is effective for identifying systemically distributed clastogens, some mutagens may not induce clastogenic effects; moreover, genotoxic effects may be restricted to the site of contact and/or related tissues. An OECD test guideline for transgenic rodent (TGR) gene mutation assays was released in 2011, and the TGR assays permit assessment of mutagenicity in any tissue. This study assessed the responses of two genotoxicity endpoints following sub-chronic oral exposures ofmore » male Muta™Mouse to 9 carcinogenic polycyclic aromatic hydrocarbons (PAHs). Clastogenicity was assessed via induction of micronuclei in peripheral blood, and mutagenicity via induction of lacZ transgene mutations in bone marrow, glandular stomach, small intestine, liver, and lung. Additionally, the presence of bulky PAH-DNA adducts was examined. Five of the 9 PAHs elicited positive results across all endpoints in at least one tissue, and no PAHs were negative or equivocal across all endpoints. All PAHs were positive for lacZ mutations in at least one tissue (sensitivity = 100%), and for 8 PAHs, one or more initial sites of chemical contact (i.e., glandular stomach, liver, small intestine) yielded a greater response than bone marrow. Five PAHs were positive in the micronucleus assay (sensitivity = 56%). Furthermore, all PAHs produced DNA adducts in at least one tissue. The results demonstrate the utility of the TGR assay for mutagenicity assessment, especially for compounds that may not be systemically distributed. - Highlights: • The Muta™Mouse is a reliable tool for in vivo mutagenicity assessment of PAHs. • All 9 PAHs induced lacZ transgene mutations in small intestine. • Only 5 of 9 PAHs induced lacZ mutations and micronuclei in haematopoietic tissue. • Tissue-specific results are likely related to metabolism, repair, and proliferation. • For oral exposures, it is important to examine effects at the site-of-contact.« less

ICP22 and the UL13 Protein Kinase Are both Required for Herpes Simplex Virus-Induced Modification of the Large Subunit of RNA Polymerase II

PubMed Central

Long, Melissa C.; Leong, Vivian; Schaffer, Priscilla A.; Spencer, Charlotte A.; Rice, Stephen A.

1999-01-01

Herpes simplex virus type 1 (HSV-1) infection alters the phosphorylation of the large subunit of RNA polymerase II (RNAP II), resulting in the depletion of the hypophosphorylated and hyperphosphorylated forms of this polypeptide (known as IIa and IIo, respectively) and induction of a novel, alternatively phosphorylated form (designated IIi). We previously showed that the HSV-1 immediate-early protein ICP22 is involved in this phenomenon, since induction of IIi and depletion of IIa are deficient in cells infected with 22/n199, an HSV-1 ICP22 nonsense mutant (S. A. Rice, M. C. Long, V. Lam, P. A. Schaffer, and C. A. Spencer, J. Virol. 69:5550–5559, 1995). However, depletion of IIo still occurs in 22/n199-infected cells. This suggests either that another viral gene product affects the RNAP II large subunit or that the truncated ICP22 polypeptide encoded by 22/n199 retains residual activity which leads to IIo depletion. To distinguish between these possibilities, we engineered an HSV-1 ICP22 null mutant, d22-lacZ, and compared it to 22/n199. The two mutants are indistinguishable in their effects on the RNAP II large subunit, suggesting that an additional viral gene product is involved in altering RNAP II. Two candidates are UL13, a protein kinase which has been implicated in ICP22 phosphorylation, and the virion host shutoff (Vhs) factor, the expression of which is positively regulated by ICP22 and UL13. To test whether UL13 is involved, a UL13-deficient viral mutant, d13-lacZ, was engineered. This mutant was defective in IIi induction and IIa depletion, displaying a phenotype very similar to that of d22-lacZ. In contrast, a Vhs mutant had effects that were indistinguishable from wild-type HSV-1. Therefore, UL13 but not the Vhs function plays a role in modifying the RNAP II large subunit. To study the potential role of UL13 in viral transcription, we carried out nuclear run-on transcription analyses in infected human embryonic lung cells. Infections with either UL13 or ICP22 mutants led to significantly reduced amounts of viral genome transcription at late times after infection. Together, our results suggest that ICP22 and UL13 are involved in a common pathway that alters RNAP II phosphorylation and that in some cell lines this change promotes viral late transcription. PMID:10364308

Induction of neutral trehalase Nth1 by heat and osmotic stress is controlled by STRE elements and Msn2/Msn4 transcription factors: variations of PKA effect during stress and growth.

PubMed

Zähringer, H; Thevelein, J M; Nwaka, S

2000-01-01

Saccharomyces cerevisiae neutral trehalase, encoded by NTH1, controls trehalose hydrolysis in response to multiple stress conditions, including nutrient limitation. The presence of three stress responsive elements (STREs, CCCCT) in the NTH1 promoter suggested that the transcriptional activator proteins Msn2 and Msn4, as well as the cAMP-dependent protein kinase (PKA), control the stress-induced expression of Nth1. Here, we give direct evidence that Msn2/Msn4 and the STREs control the heat-, osmotic stress- and diauxic shift-dependent induction of Nth1. Disruption of MSN2 and MSN4 abolishes or significantly reduces the heat- and NaCl-induced increases in Nth1 activity and transcription. Stress-induced increases in activity of a lacZ reporter gene put under control of the NTH1 promoter is nearly absent in the double mutant. In all instances, basal expression is also reduced by about 50%. The trehalose concentration in the msn2 msn4 double mutant increases less during heat stress and drops more slowly during recovery than in wild-type cells. This shows that Msn2/Msn4-controlled expression of enzymes of trehalose synthesis and hydrolysis help to maintain trehalose concentration during stress. However, the Msn2/Msn4-independent mechanism exists for heat control of trehalose metabolism. Site-directed mutagenesis of the three STREs (CCCCT changed to CATCT) in NTH1 promoter fused to a reporter gene indicates that the relative proximity of STREs to each other is important for the function of NTH1. Elimination of the three STREs abolishes the stress-induced responses and reduces basal expression by 30%. Contrary to most STRE-regulated genes, the PKA effect on the induction of NTH1 by heat and sodium chloride is variable. During diauxic growth, NTH1 promoter-controlled reporter activity strongly increases, as opposed to the previously observed decrease in Nth1 activity, suggesting a tight but opposite control of the enzyme at the transcriptional and post-translational levels. Apparently, inactive trehalase is accumulated concomitant with the accumulation of trehalose. These results might help to elucidate the general connection between control by STREs, Msn2/Msn4 and PKA and, in particular, how these components play a role in control of trehalose metabolism.

PecS and PecT coregulate the synthesis of HrpN and pectate lyases, two virulence determinants in Erwinia chrysanthemi 3937.

PubMed

Nasser, William; Reverchon, Sylvie; Vedel, Regine; Boccara, Martine

2005-11-01

Erwinia chrysanthemi strain 3937 is a necrotrophic bacterial plant pathogen. Pectinolytic enzymes and, in particular, pectate lyases play a key role in soft rot symptoms; however, the efficient colonization of plants by E. chrysanthemi requires additional factors. These factors include HrpN (harpin), a heat-stable, glycine-rich hydrophilic protein, which is secreted by the type III secretion system. We investigated the expression of hrpN in E. chrysanthemi 3937 in various environmental conditions and different regulatory backgrounds. Using lacZ fusions, hrpN expression was markedly influenced by the carbon source, osmolarity, growth phase, and growth substrate. hrpN was repressed when pectinolysis started and negatively regulated by the repressors of pectate lyase synthesis, PecS and PecT. Primer extension data and in vitro DNA-protein interaction experiments support a model whereby PecS represses hrpN expression by binding to the hrpN regulatory region and inhibiting transcript elongation. The results suggest coordinated regulation of HrpN and pectate lyases by PecS and PecT. A putative model of the synthesis of these two virulence factors in E. chrysanthemi during pathogenesis is presented.

Identification and characterization of PhbF: a DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1.

PubMed

Kadowaki, Marco A S; Müller-Santos, Marcelo; Rego, Fabiane G M; Souza, Emanuel M; Yates, Marshall G; Monteiro, Rose A; Pedrosa, Fabio O; Chubatsu, Leda S; Steffens, Maria B R

2011-10-14

Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta.

The PR/SET Domain Zinc Finger Protein Prdm4 Regulates Gene Expression in Embryonic Stem Cells but Plays a Nonessential Role in the Developing Mouse Embryo

PubMed Central

Bogani, Debora; Morgan, Marc A. J.; Nelson, Andrew C.; Costello, Ita; McGouran, Joanna F.; Kessler, Benedikt M.

2013-01-01

Prdm4 is a highly conserved member of the Prdm family of PR/SET domain zinc finger proteins. Many well-studied Prdm family members play critical roles in development and display striking loss-of-function phenotypes. Prdm4 functional contributions have yet to be characterized. Here, we describe its widespread expression in the early embryo and adult tissues. We demonstrate that DNA binding is exclusively mediated by the Prdm4 zinc finger domain, and we characterize its tripartite consensus sequence via SELEX (systematic evolution of ligands by exponential enrichment) and ChIP-seq (chromatin immunoprecipitation-sequencing) experiments. In embryonic stem cells (ESCs), Prdm4 regulates key pluripotency and differentiation pathways. Two independent strategies, namely, targeted deletion of the zinc finger domain and generation of a EUCOMM LacZ reporter allele, resulted in functional null alleles. However, homozygous mutant embryos develop normally and adults are healthy and fertile. Collectively, these results strongly suggest that Prdm4 functions redundantly with other transcriptional partners to cooperatively regulate gene expression in the embryo and adult animal. PMID:23918801

Low Level Exposure to Sulfur Mustard: Development of a SOP for Analysis of Albumin Adducts and of a System for Non-Invasive Diagnosis on Skin

DTIC Science & Technology

2004-12-01

were primarily responsible for the organic chemistry and the analytical chemistry, and to Dr. F . Bikker, Mrs. Roos Mars and Mrs. Helma van Dijk for...study as hosts for bacteriophages: TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36proA+ B+ laclq lacZ AM 15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B...TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36 proA+ B+ lacPq lacZ AM15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B+ laclq Z AM15]. Both strains were

Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

PubMed Central

Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

2014-01-01

Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

Bax-inhibitor-1 knockdown phenotypes are suppressed by Buffy and exacerbate degeneration in a Drosophila model of Parkinson disease

PubMed Central

2017-01-01

Background Bax inhibitor-1 (BI-1) is an evolutionarily conserved cytoprotective transmembrane protein that acts as a suppressor of Bax-induced apoptosis by regulation of endoplasmic reticulum stress-induced cell death. We knocked down BI-1 in the sensitive dopa decarboxylase (Ddc) expressing neurons of Drosophila melanogaster to investigate its neuroprotective functions. We additionally sought to rescue the BI-1-induced phenotypes by co-expression with the pro-survival Buffy and determined the effect of BI-1 knockdown on the neurodegenerative α-synuclein-induced Parkinson disease (PD) model. Methods We used organismal assays to assess longevity of the flies to determine the effect of the altered expression of BI-1 in the Ddc-Gal4-expressing neurons by employing two RNAi transgenic fly lines. We measured the locomotor ability of these RNAi lines by computing the climbing indices of the climbing ability and compared them to a control line that expresses the lacZ transgene. Finally, we performed biometric analysis of the developing eye, where we counted the number of ommatidia and calculated the area of ommatidial disruption. Results The knockdown of BI-1 in these neurons was achieved under the direction of the Ddc-Gal4 transgene and resulted in shortened lifespan and precocious loss of locomotor ability. The co-expression of Buffy, the Drosophila anti-apoptotic Bcl-2 homologue, with BI-1-RNAi resulted in suppression of the reduced lifespan and impaired climbing ability. Expression of human α-synuclein in Drosophila dopaminergic neurons results in neuronal degeneration, accompanied by the age-dependent loss in climbing ability. We exploited this neurotoxic system to investigate possible BI-1 neuroprotective function. The co-expression of α-synuclein with BI-1-RNAi results in a slight decrease in lifespan coupled with an impairment in climbing ability. In supportive experiments, we employed the neuron-rich Drosophila compound eye to investigate subtle phenotypes that result from altered gene expression. The knockdown of BI-1 in the Drosophila developing eye under the direction of the GMR-Gal4 transgene results in reduced ommatidia number and increased disruption of the ommatidial array. Similarly, the co-expression of BI-1-RNAi with Buffy results in the suppression of the eye phenotypes. The expression of α-synuclein along with the knockdown of BI-1 resulted in reduction of ommatidia number and more disruption of the ommatidial array. Conclusion Knockdown of BI-1 in the dopaminergic neurons of Drosophila results in a shortened lifespan and premature loss in climbing ability, phenotypes that appear to be strongly associated with models of PD in Drosophila, and which are suppressed upon overexpression of Buffy and worsened by co-expression with α-synuclein. This suggests that BI-1 is neuroprotective and its knockdown can be counteracted by the overexpression of the pro-survival Bcl-2 homologue. PMID:28243526

Adamts5 (aggrecanase-2) is widely expressed in the mouse musculoskeletal system and is induced in specific regions of knee joint explants by inflammatory cytokines.

PubMed

Wylie, James D; Ho, Jason C; Singh, Shweta; McCulloch, Daniel R; Apte, Suneel S

2012-02-01

ADAMTS5 (aggrecanase-2) is an extracellular matrix-degrading protease implicated in cartilage destruction in arthritis. Our goals were to determine expression sites of Adamts5 in the murine musculoskeletal system and in an ex vivo joint inflammation model. In mice with an intragenic LacZ reporter controlled by the Adamts5 promoter, β-galactosidase staining was used to identify Adamts5 expressing cells. Mice expressing one wild-type Adamts5 allele were used to determine distribution of Adamts5 mRNA, cleaved aggrecan and versican, and the ADAMTS5 activating enzymes furin and PACE4. Quantitative RT-PCR and immunoblotting were used to validate the immunohistochemistry results. Adamts5 was expressed in mouse synovium, tenosynovium, bone marrow sinusoids, tendons, ligaments, ligament insertions, periosteal cells, and bone vasculature. In knee joint explants treated with IL-1α and TNFα, Adamts5 expression was induced in tenocytes, synovium, and in patellar, but not femoral or tibial articular cartilage. In contrast, increased proteoglycan breakdown in tibial and femoral articular cartilage was associated with increased immunohistochemical staining of PACE4 and furin. These studies identify diverse cell types in the musculoskeletal system that express Adamts5. They also suggest that Adamts5 induction in joint components other than cartilage, and its post-translational activation by PACE4 and/or furin may be important in the pathophysiology of arthritis. Copyright © 2011 Orthopaedic Research Society.

Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.

PubMed

Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li

2017-05-20

TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.

Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae.

PubMed Central

Gilon, T; Chomsky, O; Kulka, R G

1998-01-01

Combinations of different ubiquitin-conjugating (Ubc) enzymes and other factors constitute subsidiary pathways of the ubiquitin system, each of which ubiquitinates a specific subset of proteins. There is evidence that certain sequence elements or structural motifs of target proteins are degradation signals which mark them for ubiquitination by a particular branch of the ubiquitin system and for subsequent degradation. Our aim was to devise a way of searching systematically for degradation signals and to determine to which ubiquitin system subpathways they direct the proteins. We have constructed two reporter gene libraries based on the lacZ or URA3 genes which, in Saccharomyces cerevisiae, express fusion proteins with a wide variety of C-terminal extensions. From these, we have isolated clones producing unstable fusion proteins which are stabilized in various ubc mutants. Among these are 10 clones whose products are stabilized in ubc6, ubc7 or ubc6ubc7 double mutants. The C-terminal extensions of these clones, which vary in length from 16 to 50 amino acid residues, are presumed to contain degradation signals channeling proteins for degradation via the UBC6 and/or UBC7 subpathways of the ubiquitin system. Some of these C-terminal tails share similar sequence motifs, and a feature common to almost all of these sequences is a highly hydrophobic region such as is usually located inside globular proteins or inserted into membranes. PMID:9582269

Low levels of citrin (SLC25A13) expression in adult mouse brain restricted to neuronal clusters.

PubMed

Contreras, Laura; Urbieta, Almudena; Kobayashi, Keiko; Saheki, Takeyori; Satrústegui, Jorgina

2010-04-01

The mitochondrial aspartate-glutamate carriers (AGC) aralar (SLC25A12) and citrin (SLC25A13) are components of the malate aspartate shuttle (MAS), a major intracellular pathway to transfer reducing equivalents from NADH to the mitochondrial matrix. Aralar is the main AGC isoform present in the adult brain, and it is expressed mainly in neurons. To search for the other AGC isoform, citrin, in brain glial cells, we used a citrin knockout mouse in which the lacZ gene was inserted into the citrin locus as reporter gene. In agreement with the low citrin levels known to be present in the adult mouse brain, beta-galactosidase expression was very low. Surprisingly, unlike the case with astroglial cultures that express citrin, no beta-galactosidase was found in brain glial cells. It was confined to neuronal cells within discrete neuronal clusters. Double-immunolabelling experiments showed that beta-galactosidase colocalized not with glial cell markers but with the pan-neuronal marker NeuN. The deep cerebellar nuclei and a few midbrain nuclei (reticular tegmental pontine nuclei; magnocellular red nuclei) were the regions where beta-galactosidase expression was highest, and it was up-regulated in fasted mice, as was also the case for liver beta-galactosidase. The results support the notion that glial cells have much lower AGC levels and MAS activity than neurons. (c) 2009 Wiley-Liss, Inc.

A Novel Population of Inner Cortical Cells in the Adrenal Gland That Displays Sexually Dimorphic Expression of Thyroid Hormone Receptor-β1

PubMed Central

Huang, Chen-Che Jeff; Kraft, Cary; Moy, Nicole; Ng, Lily

2015-01-01

The development of the adrenal cortex involves the formation and then subsequent regression of immature or fetal inner cell layers as the mature steroidogenic outer layers expand. However, controls over this remodeling, especially in the immature inner layer, are incompletely understood. Here we identify an inner cortical cell population that expresses thyroid hormone receptor-β1 (TRβ1), one of two receptor isoforms encoded by the Thrb gene. Using mice with a Thrbb1 reporter allele that expresses lacZ instead of TRβ1, β-galactosidase was detected in the inner cortex from early stages. Expression peaked at juvenile ages in an inner zone that included cells expressing 20-α-hydroxysteroid dehydrogenase, a marker of the transient, so-called X-zone in mice. The β-galactosidase-positive zone displayed sexually dimorphic regression in males after approximately 4 weeks of age but persisted in females into adulthood in either nulliparous or parous states. T3 treatment promoted hypertrophy of inner cortical cells, induced some markers of mature cortical cells, and, in males, delayed the regression of the TRβ1-positive zone, suggesting that TRβ1 could partly divert the differentiation fate and counteract male-specific regression of inner zone cells. TRβ1-deficient mice were resistant to these actions of T3, supporting a functional role for TRβ1 in the inner cortex. PMID:25774556

Adenovirus-mediated tissue factor pathway inhibitor gene transfer induces apoptosis by blocking the phosphorylation of JAK-2/STAT-3 pathway in vascular smooth muscle cells.

PubMed

Fu, Yu; Zhao, Yong; Liu, Yue; Zhu, Yejing; Chi, Jinyu; Hu, Jing; Zhang, Xiaohui; Yin, Xinhua

2012-10-01

In our previous study, we have demonstrated that tissue factor pathway inhibitor (TFPI) gene could induce vascular smooth muscle cell (VSMC) apoptosis. This study was conducted to investigate whether the overexpression of the TFPI gene can induce VSMC apoptosis by inhibiting JAK-2/STAT-3 pathway phosphorylation and thereby inhibiting the expression of such downstream targets as the apoptotic protein Bcl-2 and cell cycle protein cyclin D1. The effect of TFPI on the expression of survivin, a central molecule in cell survival, was also investigated. Rat VSMCs were infected with recombinant adenovirus containing either the TFPI (Ad-TFPI) or LacZ (Ad-LacZ) gene or DMEM in vitro. TFPI expression was detected by ELISA. TUNEL staining and electron microscope were carried out to determine the apoptosis of VSMCs. The expression levels of JAK-2, p-JAK-2, STAT-3, p-STAT-3, cyclin D1, Bcl-2 and survivin were examined by western blot analysis. TFPI protein was detected in the TFPI group after gene transfer and the peak expression was at the 3rd day. At the 3rd, 5th and 7th days after gene transfer, the apoptotic rates by TUNEL assay in the TFPI group were 10.91 ± 1.66%, 13.46 ± 1.28% and 17.04 ± 1.95%, respectively, whereas those in the LacZ group were 3.28 ± 0.89%, 4.01 ± 0.72% and 4.89 ± 1.17%, respectively. We observed cell contraction, slight mitochondrial swelling, nuclear pyknosis and apoptotic body formation in TFPI-treated VSMCs using electron microscopy. JAK-2, p-JAK-2, STAT-3, p-STAT-3, cyclin D1 and Bcl-2, which are all involved in the JAK-2/STAT-3 pathway, were detected in the VSMCs on the 3rd, 5th and 7th days after gene transfer, which is consistent with previously demonstrated time points when VSMCs apoptosis occurred. The expression levels of p-JAK-2, p-STAT-3, cyclin D1 and Bcl-2 were significantly decreased over time in the TFPI group (each P<0.05) but not in the Ad-LacZ and DMEM groups. However, this attenuation of expression was not observed for JAK-2 and STAT-3 in any of the groups at any time points after gene transfer (each P>0.05). The expression level of survivin in the TFPI group also weakened significantly over time compared with the levels in the Ad-LacZ and DMEM groups (each P<0.05) at the 3rd, 5th and 7th days after gene transfer. The results demonstrated that TFPI played an apoptosis-inducing role in VSMCs in a manner that involves both the suppression of JAK-2/STAT-3 pathway phosphorylation and the down-regulation of survivin. Our data show for the first time that targeting the JAK-2/STAT-3 pathway and survivin by overexpressing TFPI may be a new avenue for the treatment of restenosis. Copyright © 2012 Elsevier Inc. All rights reserved.

Adenovirus-mediated RNA interference against foot-and-mouth disease virus infection both in vitro and in vivo.

PubMed

Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin

2006-04-01

Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.

The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

PubMed Central

Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

2015-01-01

ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of β-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

Mutations in a novel gene, NHS, cause the pleiotropic effects of Nance-Horan syndrome, including severe congenital cataract, dental anomalies, and mental retardation.

PubMed

Burdon, Kathryn P; McKay, James D; Sale, Michèle M; Russell-Eggitt, Isabelle M; Mackey, David A; Wirth, M Gabriela; Elder, James E; Nicoll, Alan; Clarke, Michael P; FitzGerald, Liesel M; Stankovich, James M; Shaw, Marie A; Sharma, Shiwani; Gajovic, Srecko; Gruss, Peter; Ross, Shelley; Thomas, Paul; Voss, Anne K; Thomas, Tim; Gécz, Jozef; Craig, Jamie E

2003-11-01

Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features, and, in some cases, mental retardation. NHS has been mapped to a 1.3-Mb interval on Xp22.13. We have confirmed the same localization in the original, extended Australian family with NHS and have identified protein-truncating mutations in a novel gene, which we have called "NHS," in five families. The NHS gene encompasses approximately 650 kb of genomic DNA, coding for a 1,630-amino acid putative nuclear protein. NHS orthologs were found in other vertebrates, but no sequence similarity to known genes was identified. The murine developmental expression profile of the NHS gene was studied using in situ hybridization and a mouse line containing a lacZ reporter-gene insertion in the Nhs locus. We found a complex pattern of temporally and spatially regulated expression, which, together with the pleiotropic features of NHS, suggests that this gene has key functions in the regulation of eye, tooth, brain, and craniofacial development.

Mutations in a Novel Gene, NHS, Cause the Pleiotropic Effects of Nance-Horan Syndrome, Including Severe Congenital Cataract, Dental Anomalies, and Mental Retardation

PubMed Central

Burdon, Kathryn P.; McKay, James D.; Sale, Michèle M.; Russell-Eggitt, Isabelle M.; Mackey, David A.; Wirth, M. Gabriela; Elder, James E.; Nicoll, Alan; Clarke, Michael P.; FitzGerald, Liesel M.; Stankovich, James M.; Shaw, Marie A.; Sharma, Shiwani; Gajovic, Srecko; Gruss, Peter; Ross, Shelley; Thomas, Paul; Voss, Anne K.; Thomas, Tim; Gécz, Jozef; Craig, Jamie E.

2003-01-01

Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features, and, in some cases, mental retardation. NHS has been mapped to a 1.3-Mb interval on Xp22.13. We have confirmed the same localization in the original, extended Australian family with NHS and have identified protein-truncating mutations in a novel gene, which we have called “NHS,” in five families. The NHS gene encompasses ∼650 kb of genomic DNA, coding for a 1,630–amino acid putative nuclear protein. NHS orthologs were found in other vertebrates, but no sequence similarity to known genes was identified. The murine developmental expression profile of the NHS gene was studied using in situ hybridization and a mouse line containing a lacZ reporter-gene insertion in the Nhs locus. We found a complex pattern of temporally and spatially regulated expression, which, together with the pleiotropic features of NHS, suggests that this gene has key functions in the regulation of eye, tooth, brain, and craniofacial development. PMID:14564667

Recombinant vaccine for canine parvovirus in dogs.

PubMed

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-05-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection.

Recombinant vaccine for canine parvovirus in dogs.

PubMed Central

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-01-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection. Images PMID:1313899

Construction of a simple biocatalyst using psychrophilic bacterial cells and its application for efficient 3-hydroxypropionaldehyde production from glycerol.

PubMed

Tajima, Takahisa; Fuki, Koji; Kataoka, Naoya; Kudou, Daizou; Nakashimada, Yutaka; Kato, Junichi

2013-12-05

Most whole cell biocatalysts have some problems with yields and productivities because of various metabolites produced as byproducts and limitations of substrate uptake. We propose a psychrophile-based simple biocatalyst for efficient bio-production using mesophilic enzymes expressed in psychrophilic Shewanella livingstonensis Ac10 cells whose basic metabolism was inactivated by heat treatment. The 45°C heat-treated cells expressing lacZ showed maximum beta-galactosidase activity as well as chloroform/SDS-treated cells to increase membrane permeability. The fluorescent dye 5-cyano-2,3-ditolyl-tetrazolium chloride staining indicated that most basic metabolism of Ac10 was lost by heat treatment at 45˚C for 10 min. The simple biocatalyst was applied for 3-HPA production by using Klebsiella pneumoniae dhaB genes. 3-HPA was stoichiometrically produced with the complete consumption of glycerol at a high production rate of 8.85 mmol 3-HPA/g dry cell/h. The amount of 3-HPA production increased by increasing the concentrations of biocatalyst and glycerol. Furthermore, it could convert biodiesel-derived crude glycerol to 3-HPA.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

PubMed

Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

2016-10-01

Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Generation of stable cell line by using chitosan as gene delivery system.

PubMed

Şalva, Emine; Turan, Suna Özbaş; Ekentok, Ceyda; Akbuğa, Jülide

2016-08-01

Establishing stable cell lines are useful tools to study the function of various genes and silence or induce the expression of a gene of interest. Nonviral gene transfer is generally preferred to generate stable cell lines in the manufacturing of recombinant proteins. In this study, we aimed to establish stable recombinant HEK-293 cell lines by transfection of chitosan complexes preparing with pDNA which contain LacZ and GFP genes. Chitosan which is a cationic polymer was used as gene delivery system. Stable HEK-293 cell lines were established by transfection of cells with complexes which were prepared with chitosan and pVitro-2 plasmid vector that contains neomycin drug resistance gene, beta gal and GFP genes. The transfection efficiency was shown with GFP expression in the cells using fluorescence microscopy. Beta gal protein expression in stable cells was examined by beta-galactosidase assay as enzymatically and X-gal staining method as histochemically. Full complexation was shown in the above of 1/1 ratio in the chitosan/pDNA complexes. The highest beta-galactosidase activity was obtained with transfection of chitosan complexes. Beta gal gene expression was 15.17 ng/ml in the stable cells generated by chitosan complexes. In addition, intensive blue color was observed depending on beta gal protein expression in the stable cell line with X-gal staining. We established a stable HEK-293 cell line that can be used for recombinant protein production or gene expression studies by transfecting the gene of interest.

Mapping the Shh long-range regulatory domain

PubMed Central

Anderson, Eve; Devenney, Paul S.; Hill, Robert E.; Lettice, Laura A.

2014-01-01

Coordinated gene expression controlled by long-distance enhancers is orchestrated by DNA regulatory sequences involving transcription factors and layers of control mechanisms. The Shh gene and well-established regulators are an example of genomic composition in which enhancers reside in a large desert extending into neighbouring genes to control the spatiotemporal pattern of expression. Exploiting the local hopping activity of the Sleeping Beauty transposon, the lacZ reporter gene was dispersed throughout the Shh region to systematically map the genomic features responsible for expression activity. We found that enhancer activities are retained inside a genomic region that corresponds to the topological associated domain (TAD) defined by Hi-C. This domain of approximately 900 kb is in an open conformation over its length and is generally susceptible to all Shh enhancers. Similar to the distal enhancers, an enhancer residing within the Shh second intron activates the reporter gene located at distances of hundreds of kilobases away, suggesting that both proximal and distal enhancers have the capacity to survey the Shh topological domain to recognise potential promoters. The widely expressed Rnf32 gene lying within the Shh domain evades enhancer activities by a process that may be common among other housekeeping genes that reside in large regulatory domains. Finally, the boundaries of the Shh TAD do not represent the absolute expression limits of enhancer activity, as expression activity is lost stepwise at a number of genomic positions at the verges of these domains. PMID:25252942

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

Use of lipolanthionine peptide, a toll-like receptor 2 inhibitor, enhances transdermal delivery efficiency.

PubMed

Chen, Bin; Liu, Da-Lie; Pan, Wen-Yan; Yang, Xiao-Hui; Shou, Jia-Bao; Wu, Ju-Hua; Mao, Qing-Long; Wang, Jia

2014-08-01

The transdermal delivery system (TDS) is able to obtain a systemic therapeutic effect by administration through the skin, which has low side effects and is able to maintain a sustained blood concentration. However, due to the barrier presented by the stratum corneum, numerous drugs have poor percutaneous permeability. Therefore, the improvement of skin permeability is key to TDS. The main method of promoting transdermal absorption is through the usage of penetration enhancers. Dimethyl sulfoxide (DMSO) is a commonly used penetration enhancer, which has anti‑inflammatory analgesic effects and is able to penetrate the skin. Retinoic acid (RA) and lipolanthionine peptide (LP) may also benefit the permeation efficiency of TDS. Therefore, the present study examined the function of DMSO, RA and LP as penetration enhancers in TDS. Firstly, the optimum concentration of DMSO was confirmed by detecting the expression of the LacZ gene in vitro. Secondly, different combinations of LP, RA and DMSO were applied to mouse skin to analyze the penetration enhancer combination with the greatest efficacy. All the animals were divided into five groups: The RA + LP + DMSO + pORF‑LacZ group, the RA + DMSO + pORF‑LacZ group, the LP + DMSO + pORF‑LacZ group, the DMSO + pORF-LacZ group and the control group. Skin was soaked in combinations of LP, RA and DMSO for seven days and then the pORF‑LacZ plasmids were daubed onto the skin once daily three days. On the 11th day, all the animals were sacrificed by cervical dislocation and the skin and blood samples were collected. The blood samples were used to detect the expression of the LacZ gene by quantitative polymerase chain reaction and the skin samples were used to detect the expression of claudin‑4 and zonula occluden‑1 (ZO‑1) proteins by immunohistochemistry and western blot analysis. The results demonstrated that the combination of LP, RA and DMSO exhibited the greatest transdermal delivery efficiency, which verified that RA and LP were able to increase the penetration effects. Following treatment with LP, the symptoms of dermal edema were relieved and the capillaries contracted, which suggested that LP was a safe and effective penetration enhancer able to reduce the side‑effects caused by DMSO. The present study provides a guideline for the synthesis of novel penetration enhancers.

A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury.

PubMed

Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M

2015-08-01

Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.

Maturation of the myogenic program is induced by postmitotic expression of insulin-like growth factor I.

PubMed

Musarò, A; Rosenthal, N

1999-04-01

The molecular mechanisms underlying myogenic induction by insulin-like growth factor I (IGF-I) are distinct from its proliferative effects on myoblasts. To determine the postmitotic role of IGF-I on muscle cell differentiation, we derived L6E9 muscle cell lines carrying a stably transfected rat IGF-I gene under the control of a myosin light chain (MLC) promoter-enhancer cassette. Expression of MLC-IGF-I exclusively in differentiated L6E9 myotubes, which express the embryonic form of myosin heavy chain (MyHC) and no endogenous IGF-I, resulted in pronounced myotube hypertrophy, accompanied by activation of the neonatal MyHC isoform. The hypertrophic myotubes dramatically increased expression of myogenin, muscle creatine kinase, beta-enolase, and IGF binding protein 5 and activated the myocyte enhancer factor 2C gene which is normally silent in this cell line. MLC-IGF-I induction in differentiated L6E9 cells also increased the expression of a transiently transfected LacZ reporter driven by the myogenin promoter, demonstrating activation of the differentiation program at the transcriptional level. Nuclear reorganization, accumulation of skeletal actin protein, and an increased expression of beta1D integrin were also observed. Inhibition of the phosphatidyl inositol (PI) 3-kinase intermediate in IGF-I-mediated signal transduction confirmed that the PI 3-kinase pathway is required only at early stages for IGF-I-mediated hypertrophy and neonatal MyHC induction in these cells. Expression of IGF-I in postmitotic muscle may therefore play an important role in the maturation of the myogenic program.

Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti

2005-06-24

Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild typemore » CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.« less

staggerer phenotype in retinoid-related orphan receptor α-deficient mice

PubMed Central

Steinmayr, Markus; André, Elisabeth; Conquet, François; Rondi-Reig, Laure; Delhaye-Bouchaud, Nicole; Auclair, Nathalie; Daniel, Hervé; Crépel, Francis; Mariani, Jean; Sotelo, Constantino; Becker-André, Michael

1998-01-01

Retinoid-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily. To study its physiological role we generated null-mutant mice by targeted insertion of a lacZ reporter gene encoding the enzyme β-galactosidase. In heterozygous RORα+/− mice we found β-galactosidase activity, indicative of RORα protein expression, confined to the central nervous system, skin and testis. In the central nervous system, the RORα gene is expressed in cerebellar Purkinje cells, the thalamus, the suprachiasmatic nuclei, and retinal ganglion cells. In skin, RORα is strongly expressed in the hair follicle, the epidermis, and the sebaceous gland. Finally, the peritubular cells of the testis and the epithelial cells of the epididymis also strongly express RORα. Recently, it was reported that the ataxic mouse mutant staggerer (sg/sg) is caused by a deletion in the RORα gene. The analysis of the cerebellar and the behavioral phenotype of homozygous RORα−/− mice proves identity to sg/sg mice. Although the absence of RORα causes dramatic developmental effects in the cerebellum, it has no apparent morphological effect on thalamus, hypothalamus, and retina. Similarly, testis and skin of RORα−/− mice display a normal phenotype. However, the pelage hair of both sg/sg and RORα−/− is significantly less dense and when shaved shows reluctance to regrow. PMID:9520475

Magnetic Resonance Microscopy (MRM) of Single Mammalian Myofibers and Myonuclei.

PubMed

Lee, Choong H; Bengtsson, Niclas; Chrzanowski, Stephen M; Flint, Jeremy J; Walter, Glenn A; Blackband, Stephen J

2017-01-03

Recently, the first magnetic resonance microscopy (MRM) images at the cellular level in isolated mammalian brain tissues were obtained using microsurface coils. These methods can elucidate the cellular origins of MR signals and describe how these signals change over the course of disease progression and therapy. In this work, we explore the capability of these microimaging techniques to visualize mouse muscle fibers and their nuclei. Isolated myofibers expressing lacZ were imaged with and without a stain for β-galactosidase activity (S-Gal + ferric ammonium citrate) that produces both optical and MR contrast. We found that MRM can be used to image single myofibers with 6-μm resolution. The ability to image single myofibers will serve as a valuable tool to study MR properties attributed to healthy and myopathic cells. The ability to image nuclei tagged with MR/Optical gene markers may also find wide use in cell lineage MRI studies.

Magnetic Resonance Microscopy (MRM) of Single Mammalian Myofibers and Myonuclei

PubMed Central

Lee, Choong H.; Bengtsson, Niclas; Chrzanowski, Stephen M.; Flint, Jeremy J.; Walter, Glenn A.; Blackband, Stephen J.

2017-01-01

Recently, the first magnetic resonance microscopy (MRM) images at the cellular level in isolated mammalian brain tissues were obtained using microsurface coils. These methods can elucidate the cellular origins of MR signals and describe how these signals change over the course of disease progression and therapy. In this work, we explore the capability of these microimaging techniques to visualize mouse muscle fibers and their nuclei. Isolated myofibers expressing lacZ were imaged with and without a stain for β-galactosidase activity (S-Gal + ferric ammonium citrate) that produces both optical and MR contrast. We found that MRM can be used to image single myofibers with 6-μm resolution. The ability to image single myofibers will serve as a valuable tool to study MR properties attributed to healthy and myopathic cells. The ability to image nuclei tagged with MR/Optical gene markers may also find wide use in cell lineage MRI studies. PMID:28045071

A detailed study of gerJ mutants of Bacillus subtilis.

PubMed

Warburg, R J; Buchanan, C E; Parent, K; Halvorson, H O

1986-08-01

A total of nine gerJ mutants have now been isolated in Bacillus subtilis. All are defective in their spore germination properties, being blocked at an intermediate (phase grey) stage. The dormant spores are sensitive to heating at 90 degrees C and two of the mutants (generated by transposon insertion) produce spores sensitive at 80 degrees C. The spores of these two more extreme mutants had a visibly defective cortex when studied by electron microscopy, as did some of the other mutants. During sporulation, the acquisition of spore resistance properties and the appearance of the sporulation-specific penicillin-binding protein PBP5* were delayed. A strain probably carrying a lacZ fusion to the gerJ promoter demonstrated increased expression between t2 and t4. We propose that the gerJ locus is involved in the control of one or more sporulation-specific genes.

Identification and characterization of PhbF: A DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1

PubMed Central

2011-01-01

Background Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. Results In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Conclusions Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta. PMID:21999748

Stage-specific control of connective tissue growth factor (CTGF/CCN2) expression in chondrocytes by Sox9 and beta-catenin.

PubMed

Huang, Bau-Lin; Brugger, Sean M; Lyons, Karen M

2010-09-03

CCN2/connective tissue growth factor is highly expressed in hypertrophic chondrocytes and is required for chondrogenesis. However, the transcriptional mechanisms controlling its expression in cartilage are largely unknown. The activity of the Ccn2 promoter was, therefore, investigated in osteochondro-progenitor cells and hypertrophic chondrocytes to ascertain these mechanisms. Sox9 and T-cell factor (TCF) x lymphoid enhancer factor (LEF) factors contain HMG domains and bind to related consensus sites. TCF x LEF factors are normally repressive but when bound to DNA in a complex with beta-catenin become activators of gene expression. In silico analysis of the Ccn2 proximal promoter identified multiple consensus TCF x LEF elements, one of which was also a consensus binding site for Sox9. Using luciferase reporter constructs, the TCF x LEF x Sox9 site was found to be involved in stage-specific expression of Ccn2. Luciferase, electrophoretic mobility shift assay (EMSA), and ChIP analysis revealed that Sox9 represses Ccn2 expression by binding to the consensus TCF x LEF x Sox9 site. On the other hand, the same assays showed that in hypertrophic chondrocytes, TCF x LEF x beta-catenin complexes occupy the consensus TCF x LEF x Sox9 site and activate Ccn2 expression. Furthermore, transgenic mice in which lacZ expression is driven under the control of the proximal Ccn2 promoter revealed that the proximal Ccn2 promoter responded to Wnt signaling in cartilage. Hence, we propose that differential occupancy of the TCF x LEF x Sox9 site by Sox9 versus beta-catenin restricts high levels of Ccn2 expression to hypertrophic chondrocytes.

De Novo-Synthesized Retinoic Acid in Ovarian Antral Follicles Enhances FSH-Mediated Ovarian Follicular Cell Differentiation and Female Fertility

PubMed Central

Kawai, Tomoko; Yanaka, Noriyuki; Richards, JoAnne S.

2016-01-01

Retinoic acid (RA) is the active form of vitamin A and is synthesized from retinol by two key enzymes, alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH). As the physiological precursor of RA, retinol impacts female reproductive functions and fertility. The expression of Adh1 and Adh5 as well as Aldh1a1 and Aldh1a7 are significantly increased in the ovaries of mice treated with equine chorionic gonadotropin/FSH. The RA receptor is expressed and localized in granulosa cells and is activated by endogenous RA as indicated by LacZ expression in granulosa cells of RA-responsive transgene-LacZ transgenic mice (RA reporter mice). Coinjection of the ADH inhibitor, 4-methylpyrazole, with equine chorionic gonadotropin significantly decreases the number and developmental competence of oocytes ovulated in response to human chorionic gonadotropin/LH as compared with controls. Injections of RA completely reverse the effects of the inhibitor of ovulation and oocyte development. When mice were fed a retinol-free, vitamin A-deficient diet that significantly reduced the serum levels of retinol, the expression of the LH receptor (Lhcgr) was significantly lower in the ovaries of the vitamin A-deficient mice, and injections of human chorionic gonadotropin failed to induce genes controlling ovulation. These results indicate that ovarian de novo biosynthesis of RA is required for the follicular expression of Lhcgr in granulosa cells and their ability to respond to the ovulatory LH surge. PMID:27022678

Role of CCK-A receptor for pancreatic function in mice: a study in CCK-A receptor knockout mice.

PubMed

Takiguchi, Soichi; Suzuki, Shinji; Sato, Yuko; Kanai, Setsuko; Miyasaka, Kyoko; Jimi, Atsuo; Shinozaki, Hirotsugu; Takata, Yutaka; Funakoshi, Akihiro; Kono, Akira; Minowa, Osamu; Kobayashi, Tomoko; Noda, Tetsuo

2002-04-01

The cholecystokinin (CCK) family of peptides and receptors is present throughout the brain and gastrointestinal tract. The CCK receptors can be pharmacologically subdivided into two subtypes: CCK-A and CCK-B. CCK-A receptor is enriched in the pancreas of mice. To determine pancreatic functions in a CCK-A receptor deficient mouse mutant generated by gene targeting in embryonic stem cells. The targeting vector contained lacZ and neo insertions in exon 2. To examine exocrine functions, amylase release from the dispersed acini in vitro was examined. In the in vivo study, the mixture of bile-pancreatic juice was collected, and amylase, bicarbonate, and bile acid outputs were determined after the administration of various stimulants. The cystic duct of the gallbladder and the pylorus were ligated to exclude the involvement of gallbladder contraction and gastric acid. Pancreatic enzyme content was measured, and histologic examinations by HE and lacZ staining were conducted. To examine endocrine functions, oral glucose tolerance test (2 g/kg) was determined. The body weight, pancreatic wet weight, and enzyme content in the pancreas were similar among the three genotypes. Amylase release in vivo and in vitro and bicarbonate secretion in vivo were not stimulated by CCK-8 in CCK-AR (-/-) mice, whereas the responses to other stimulants were substantial in (-/-) mice. Administration of secretin did not increase bicarbonate secretion regardless of genotype. A normal glucose tolerance was observed in (-/-) mice. Acinar cells, islets, and duct cells were stained by lacZ, and HE staining revealed no pathologic findings. The CCK-A receptor is important for pancreatic exocrine secretion, but not essential for maintaining glucose concentration and pancreatic growth in mice.

The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate.

PubMed Central

Julias, J G; Kim, T; Arnold, G; Pathak, V K

1997-01-01

It was previously observed that the nucleoside analog 5-azacytidine increased the spleen necrosis virus (SNV) mutation rate 13-fold in one cycle of retrovirus replication (V. K. Pathak and H. M. Temin, J. Virol. 66:3093-3100, 1992). Based on this observation, we hypothesized that nucleoside analogs used as antiviral drugs may also increase retrovirus mutation rates. We sought to determine if 3'-azido-3'-deoxythymidine (AZT), the primary treatment for human immunodeficiency virus type 1 (HIV-1) infection, increases the retrovirus mutation rate. Two assays were used to determine the effects of AZT on retrovirus mutation rates. The strategy of the first assay involved measuring the in vivo rate of inactivation of the lacZ gene in one replication cycle of SNV- and murine leukemia virus-based retroviral vectors. We observed 7- and 10-fold increases in the SNV mutant frequency following treatment of target cells with 0.1 and 0.5 microM AZT, respectively. The murine leukemia virus mutant frequency increased two- and threefold following treatment of target cells with 0.5 and 1.0 microM AZT, respectively. The second assay used an SNV-based shuttle vector containing the lacZ alpha gene. Proviruses were recovered as plasmids in Escherichia coli, and the rate of inactivation of lacZ alpha was measured. The results indicated that treatment of target cells increased the overall mutation rate two- to threefold. DNA sequence analysis of mutant proviruses indicated that AZT increased both the deletion and substitution rates. These results suggest that AZT treatment of HIV-1 infection may increase the degree of viral variation and alter virus evolution or pathogenesis. PMID:9151812

Development of multiplex PCR for the detection of total coliform bacteria for Escherichia coli and Clostridium perfringens in drinking water.

PubMed

Tantawiwat, Suwalee; Tansuphasiri, Unchalee; Wongwit, Waranya; Wongchotigul, Varee; Kitayaporn, Dwip

2005-01-01

Multiplex PCR amplification of lacZ, uidA and plc genes was developed for the simultaneous detection of total coliform bacteria for Escherichia coli and Clostridium perfringens, in drinking water. Detection by agarose gel electrophoresis yielded a band of 876 bp for the lacZ gene of all coliform bacteria; a band of 147 bp for the uidA gene and a band of 876 bp for the lacZ gene of all strains of E. coli; a band of 280 bp for the p/c gene for all strains of C. perfringens; and a negative result for all three genes when tested with other bacteria. The detection limit was 100 pg for E. coli and C. perfringens, and 1 ng for coliform bacteria when measured with purified DNA. This assay was applied to the detection of these bacteria in spiked water samples. Spiked water samples with 0-1,000 CFU/ml of coliform bacteria and/or E. coli and/or C. perfringens were detected by this multiplex PCR after a pre-enrichment step to increase the sensitivity and to ensure that the detection was based on the presence of cultivable bacteria. The result of bacterial detection from the multiplex PCR was comparable with that of a standard plate count on selective medium (p=0.62). When using standard plate counts as a gold standard, the sensitivity for this test was 99.1% (95% CI 95.33, 99.98) and the specificity was 90.9 % (95% CI 75.67, 98.08). Multiplex PCR amplification with a pre-enrichment step was shown to be an effective, sensitive and rapid method for the simultaneous detection of these three microbiological parameters in drinking water.

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

2013-01-01

Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800

Transduction of satellite cells after prenatal intramuscular administration of lentiviral vectors.

PubMed

MacKenzie, Tippi C; Kobinger, Gary P; Louboutin, Jean-Pierre; Radu, Antoneta; Javazon, Elizabeth H; Sena-Esteves, Miguel; Wilson, James M; Flake, Alan W

2005-01-01

We have previously reported long-term expression of lacZ in myocytes after in utero intramuscular injection of Mokola and Ebola pseudotyped lentiviral vectors. In further experiments, we have noted that these vectors also transduce small cells at the periphery of the muscle fibers that have the morphology of satellite cells, or muscle stem cells. In this study we performed experiments to further define the morphology and function of these cells. Balb/c mice at 14-15 days gestation were injected intramuscularly with Ebola or Mokola pseudotyped lentiviral vectors carrying CMV-lacZ. Animals were harvested at various time points, muscles were stained with X-gal, and processed for electron microscopy (EM) and immunofluorescence. To determine whether transduced satellite cells were functionally capable of regenerating injured muscles, animals were injected with notexin in the same area 8 weeks after the in utero injection of viral vector. Transmission EM of transduced cells confirmed the ultrastructural appearance of satellite cells. Double immunofluorescence for beta-galactosidase and satellite cell markers demonstrated co-localization of these markers in transduced cells. In the notexin-injured animals, small blue cells were seen at the areas of regeneration that co-localized beta-galactosidase with markers of regenerating satellite cells. Central nucleated blue fibers were seen at late time points, indicating regenerated muscle fibers arising from a transduced satellite cell. This study demonstrates transduction of muscle satellite cells following prenatal viral vector mediated gene transfer. These findings may have important implications for gene therapy strategies directed toward muscular dystrophy.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

PubMed Central

Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

2016-01-01

The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

Chronology of Islet Differentiation Revealed By Temporal Cell Labeling

PubMed Central

Miyatsuka, Takeshi; Li, Zhongmei; German, Michael S.

2009-01-01

OBJECTIVE Neurogenin 3 plays a pivotal role in pancreatic endocrine differentiation. Whereas mouse models expressing reporters such as eGFP or LacZ under the control of the Neurog3 gene enable us to label cells in the pancreatic endocrine lineage, the long half-life of most reporter proteins makes it difficult to distinguish cells actively expressing neurogenin 3 from differentiated cells that have stopped transcribing the gene. RESEARCH DESIGN AND METHODS In order to separate the transient neurogenin 3 –expressing endocrine progenitor cells from the differentiating endocrine cells, we developed a mouse model (Ngn3-Timer) in which DsRed-E5, a fluorescent protein that shifts its emission spectrum from green to red over time, was expressed transgenically from the NEUROG3 locus. RESULTS In the Ngn3-Timer embryos, green-dominant cells could be readily detected by microscopy or flow cytometry and distinguished from green/red double-positive cells. When fluorescent cells were sorted into three different populations by a fluorescence-activated cell sorter, placed in culture, and then reanalyzed by flow cytometry, green-dominant cells converted to green/red double-positive cells within 6 h. The sorted cell populations were then used to determine the temporal patterns of expression for 145 transcriptional regulators in the developing pancreas. CONCLUSIONS The precise temporal resolution of this model defines the narrow window of neurogenin 3 expression in islet progenitor cells and permits sequential analyses of sorted cells as well as the testing of gene regulatory models for the differentiation of pancreatic islet cells. PMID:19478145

Analysis of a homologue of the adducin head gene which is a potential target for the Dictyostelium STAT protein Dd-STATa.

PubMed

Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi

2006-01-01

A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

Putative signaling action of amelogenin utilizes the Wnt/beta-catenin pathway.

PubMed

Matsuzawa, M; Sheu, T-J; Lee, Y-J; Chen, M; Li, T-F; Huang, C T; Holz, J D; Puzas, J E

2009-06-01

While it has long been known that amelogenin is essential for the proper development of enamel, its role has generally been seen as structural in nature. However, our new data implicate this protein in the regulation of cell signaling pathways in periodontal ligament cells and osteoblasts. In this article we report the successful purification of a recombinant mouse amelogenin protein and demonstrate that it has signaling activity in isolated mouse calvarial cells and human periodontal ligament cells. To determine the regulatory function of canonical Wnt signaling by amelogenin, we used TOPGAL transgenic mice. These mice express a beta-galactosidase transgene under the control of a LEF/TCF and beta-catenin-inducible promoter. To investigate in greater detail the molecular mechanisms involved in the beta-catenin signaling pathway, isolated osteoblasts and periodontal ligament cells were exposed to full-length recombinant mouse amelogenin and were evaluated for phenotypic changes and beta-catenin signaling using a TOPFLASH construct and the LacZ reporter gene. In these in vitro models, we showed that amelogenin can activate beta-catenin signaling. Using the TOPGAL transgenic mouse we showed that amelogenin expression in vivo is localized mainly around the root, the periodontal ligament and the alveolar bone.

Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a. beta. -mannanase from the extremely thermophilic bacterium Caldocellum saccharolyticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luethi, E.; Jasmat, N.B.; Grayling, R.A.

1991-03-01

A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less

E.coli polynucleotide phosphorylase expression is autoregulated through an RNase III-dependent mechanism.

PubMed Central

Robert-Le Meur, M; Portier, C

1992-01-01

It has been previously shown that the pnp messenger RNAs are cleaved by RNase III at the 5' end and that these cleavages induce a rapid decay of these messengers. A translational fusion between pnp and lacZ was introduced into the chromosome of a delta lac strain to study the expression of pnp. In the presence of increased cellular concentrations of polynucleotide phosphorylase, the level of the hybrid beta-galactosidase is repressed, whereas the synthesis rate of the corresponding message is not significantly affected. In the absence of pnp, the level of the hybrid protein increases strongly. Thus, polynucleotide phosphorylase is post-transcriptionally autocontrolled. However, autocontrol is totally abolished in strains where the RNase III site on the pnp message has been deleted or in strains devoid of RNase III. These results suggest that polynucleotide phosphorylase requires RNase III cleavages to autoregulate the translation of its message. Other mutations in the ribosome binding site region support the hypothesis that this 3' to 5' processive enzyme could recognize a specific repressor binding site at the 5' end of pnp mRNA. Implications of these results on the mechanism of regulation and on messenger degradation are discussed. Images PMID:1628624

E.coli polynucleotide phosphorylase expression is autoregulated through an RNase III-dependent mechanism.

PubMed

Robert-Le Meur, M; Portier, C

1992-07-01

It has been previously shown that the pnp messenger RNAs are cleaved by RNase III at the 5' end and that these cleavages induce a rapid decay of these messengers. A translational fusion between pnp and lacZ was introduced into the chromosome of a delta lac strain to study the expression of pnp. In the presence of increased cellular concentrations of polynucleotide phosphorylase, the level of the hybrid beta-galactosidase is repressed, whereas the synthesis rate of the corresponding message is not significantly affected. In the absence of pnp, the level of the hybrid protein increases strongly. Thus, polynucleotide phosphorylase is post-transcriptionally autocontrolled. However, autocontrol is totally abolished in strains where the RNase III site on the pnp message has been deleted or in strains devoid of RNase III. These results suggest that polynucleotide phosphorylase requires RNase III cleavages to autoregulate the translation of its message. Other mutations in the ribosome binding site region support the hypothesis that this 3' to 5' processive enzyme could recognize a specific repressor binding site at the 5' end of pnp mRNA. Implications of these results on the mechanism of regulation and on messenger degradation are discussed.

Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice.

PubMed

Doran, Joanne; Walters, Cara; Kyle, Victoria; Wooding, Peter; Hammett-Burke, Rebecca; Colledge, William Henry

2016-07-01

The Mfsd14a gene, previously called Hiat1, encodes a transmembrane protein of unknown function with homology to the solute carrier protein family. To study the function of the MFSD14A protein, mutant mice (Mus musculus, strain 129S6Sv/Ev) were generated with the Mfsd14a gene disrupted with a LacZ reporter gene. Homozygous mutant mice are viable and healthy, but males are sterile due to a 100-fold reduction in the number of spermatozoa in the vas deferens. Male mice have adequate levels of testosterone and show normal copulatory behaviour. The few spermatozoa that are formed show rounded head defects similar to those found in humans with globozoospermia. Spermatogenesis proceeds normally up to the round spermatid stage, but the subsequent structural changes associated with spermiogenesis are severely disrupted with failure of acrosome formation, sperm head condensation and mitochondrial localization to the mid-piece of the sperm. Staining for β-galactosidase activity as a surrogate for Mfsd14a expression indicates expression in Sertoli cells, suggesting that MFSD14A may transport a solute from the bloodstream that is required for spermiogenesis. © 2016 Society for Reproduction and Fertility.

[High-level expression of heterologous protein based on increased copy number in Saccharomyces cerevisiae].

PubMed

Zhang, Xinjie; He, Peng; Tao, Yong; Yang, Yi

2013-11-04

High-level expression system of heterologous protein mediated by internal ribosome entry site (IRES) in Saccharomyces cerevisiae was constructed, which could be used for other applications of S. cerevisiae in metabolic engineering. We constructed co-expression cassette (promoter-mCherry-TIF4631 IRES-URA3) containing promoters Pilv5, Padh2 and Ptdh3 and recombined the co-expression cassette into the genome of W303-1B-A. The URA3+ transformants were selected. By comparing the difference in the mean florescence value of mCherry in transformants, the effect of three promoters was detected in the co-expression cassette. The copy numbers of the interested genes in the genome were determined by Real-Time PCR. We analyzed genetic stability by continuous subculturing transformants in the absence of selection pressure. To verify the application of co-expression cassette, the ORF of mCherry was replaced by beta-galactosidase (LACZ) and xylose reductase (XYL1). The enzyme activities and production of beta-galactosidase and xylose reductase were detected. mCherry has been expressed in the highest-level in transformants with co-expression cassette containing Pilv5 promoter. The highest copy number of DNA fragment integrating in the genome was 47 in transformants containing Pilv5. The engineering strains showed good genetic stability. Xylose reductase was successfully expressed in the co-expression cassette containing Pilv5 promoter and TIF4631 IRES. The highest enzyme activity was 0. 209 U/mg crude protein in the transformants WIX-10. Beta-galactosidase was also expressed successfully. The transformants that had the highest enzyme activity was WIL-1 and the enzyme activity was 12.58 U/mg crude protein. The system mediated by Pilv5 promoter and TIF4631 IRES could express heterologous protein efficiently in S. cerevisiae. This study offered a new strategy for expression of heterologous protein in S. cerevisiae and provided sufficient experimental evidence for metabolic engineering application of this system in yeast.

Rescue of the colony-stimulating factor 1 (CSF-1)-nullizygous mouse (Csf1(op)/Csf1(op)) phenotype with a CSF-1 transgene and identification of sites of local CSF-1 synthesis.

PubMed

Ryan, G R; Dai, X M; Dominguez, M G; Tong, W; Chuan, F; Chisholm, O; Russell, R G; Pollard, J W; Stanley, E R

2001-07-01

Colony-stimulating factor 1 (CSF-1) regulates the survival, proliferation, and differentiation of mononuclear phagocytes. It is expressed as a secreted glycoprotein or proteoglycan found in the circulation or as a biologically active cell-surface glycoprotein. To investigate tissue CSF-1 regulation, CSF-1-null Csf1(op)/Csf1(op) mice expressing transgenes encoding the full-length membrane-spanning CSF-1 precursor driven by 3.13 kilobases of the mouse CSF-1 promoter and first intron were characterized. Transgene expression corrected the gross osteopetrotic, neurologic, weight, tooth, and reproductive defects of Csf1(op)/Csf1(op) mice. Detailed analysis of one transgenic line revealed that circulating CSF-1, tissue macrophage numbers, hematopoietic tissue cellularity, and hematopoietic parameters were normalized. Tissue CSF-1 levels were normal except for elevations in 4 secretory tissues. Skin fibroblasts from the transgenic mice secreted normal amounts of CSF-1 but also expressed some cell-surface CSF-1. Also, lacZ driven by the same promoter/first intron revealed beta-galactosidase expression in hematopoietic, reproductive, and other tissue locations proximal to CSF-1 cellular targets, consistent with local regulation by CSF-1 at these sites. These studies indicate that the 3.13-kilobase promoter/first intron confers essentially normal CSF-1 expression. They also pinpoint new cellular sites of CSF-1 expression, including ovarian granulosa cells, mammary ductal epithelium, testicular Leydig cells, serous acinar cells of salivary gland, Paneth cells of the small intestine, as well as local sites in several other tissues.

Selection of yeast Saccharomyces cerevisiae promoters available for xylose cultivation and fermentation.

PubMed

Nambu-Nishida, Yumiko; Sakihama, Yuri; Ishii, Jun; Hasunuma, Tomohisa; Kondo, Akihiko

2018-01-01

To efficiently utilize xylose, a major sugar component of hemicelluloses, in Saccharomyces cerevisiae requires the proper expression of varied exogenous and endogenous genes. To expand the repertoire of promoters in engineered xylose-utilizing yeast strains, we selected promoters in S. cerevisiae during cultivation and fermentation using xylose as a carbon source. To select candidate promoters that function in the presence of xylose, we performed comprehensive gene expression analyses using xylose-utilizing yeast strains both during xylose and glucose fermentation. Based on microarray data, we chose 29 genes that showed strong, moderate, and weak expression in xylose rather than glucose fermentation. The activities of these promoters in a xylose-utilizing yeast strain were measured by lacZ reporter gene assays over time during aerobic cultivation and microaerobic fermentation, both in xylose and glucose media. In xylose media, P TDH3 , P FBA1 , and P TDH1 were favorable for high expression, and P SED1 , P HXT7 , P PDC1 , P TEF1 , P TPI1 , and P PGK1 were acceptable for medium-high expression in aerobic cultivation, and moderate expression in microaerobic fermentation. P TEF2 allowed moderate expression in aerobic culture and weak expression in microaerobic fermentation, although it showed medium-high expression in glucose media. P ZWF1 and P SOL4 allowed moderate expression in aerobic cultivation, while showing weak but clear expression in microaerobic fermentation. P ALD3 and P TKL2 showed moderate promoter activity in aerobic cultivation, but showed almost no activity in microaerobic fermentation. The knowledge of promoter activities in xylose cultivation obtained in this study will permit the control of gene expression in engineered xylose-utilizing yeast strains that are used for hemicellulose fermentation. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Development of a Recombination System for the Generation of Occlusion Positive Genetically Modified Anticarsia Gemmatalis Multiple Nucleopolyhedrovirus

PubMed Central

Haase, Santiago; McCarthy, Christina B.; Ferrelli, M. Leticia; Pidre, Matias L.; Sciocco-Cap, Alicia; Romanowski, Victor

2015-01-01

Anticarsia gemmatalis is an important pest in legume crops in South America and it has been successfully controlled using Anticarsia gemmatalis Multiple Nucleopolyhedrovirus (AgMNPV) in subtropical climate zones. Nevertheless, in temperate climates its speed of kill is too slow. Taking this into account, genetic modification of AgMNPV could lead to improvements of its biopesticidal properties. Here we report the generation of a two-component system that allows the production of recombinant AgMNPV. This system is based on a parental AgMNPV in which the polyhedrin gene (polh) was replaced by a bacterial β-galactosidase (lacZ) gene flanked by two target sites for the homing endonuclease I-PpoI. Co-transfection of insect cells with linearized (I-PpoI-digested) parental genome and a transfer vector allowed the restitution of polh and the expression of a heterologous gene upon homologous recombination, with a low background of non-recombinant AgMNPV. The system was validated by constructing a recombinant occlusion-positive (polh+) AgMNPV expressing the green fluorescent protein gene (gfp). This recombinant virus infected larvae normally per os and led to the expression of GFP in cell culture as well as in A. gemmatalis larvae. These results demonstrate that the system is an efficient method for the generation of recombinant AgMNPV expressing heterologous genes, which can be used for manifold purposes, including biotechnological and pharmaceutical applications and the production of orally infectious recombinants with improved biopesticidal properties. PMID:25835531

The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

PubMed

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

Equus caballus Major Histocompatibility Complex Class I Is an Entry Receptor for Equine Herpesvirus Type 1▿

PubMed Central

Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.

2010-01-01

In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718

The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

PubMed Central

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

Foxc2CreERT2 knock-in mice mark stage-specific Foxc2-expressing cells during mouse organogenesis.

PubMed

Amin, Mohammed Badrul; Miura, Naoyuki; Uddin, Mohammad Khaja Mafij; Islam, Mohammod Johirul; Yoshida, Nobuaki; Iseki, Sachiko; Kume, Tsutomu; Trainor, Paul A; Saitsu, Hirotomo; Aoto, Kazushi

2017-01-01

Foxc2, a member of the winged helix transcription factor family, is essential for eye, calvarial bone, cardiovascular and kidney development in mice. Nevertheless, how Foxc2-expressing cells and their descendent cells contribute to the development of these tissues and organs has not been elucidated. Here, we generated a Foxc2 knock-in (Foxc2 CreERT2 ) mouse, in which administration of estrogen receptor antagonist tamoxifen induces nuclear translocation of Cre recombinase in Foxc2-expressing cells. By crossing with ROSA-LacZ reporter mice (Foxc2 CreERT2 ; R26R), the fate of Foxc2 positive (Foxc2 + ) cells was analyzed through LacZ staining at various embryonic stages. We found Foxc2 + cell descendants in the supraoccipital and exoccipital bone in E18.5 embryos, when tamoxifen was administered at embryonic day (E) 8.5. Furthermore, Foxc2 + descendant cranial neural crest cells at E8-10 were restricted to the corneal mesenchyme, while Foxc2 + cell derived cardiac neural crest cells at E6-12 were found in the aorta, pulmonary trunk and valves, and endocardial cushions. Foxc2 + cell descendant contributions to the glomerular podocytes in the kidney were also observed following E6.5 tamoxifen treatment. Our results are consistent with previous reports of Foxc2 expression during early embryogenesis and the Foxc2 CreERT2 mouse provides a tool to investigate spatiotemporal roles of Foxc2 and contributions of Foxc2 + expressing cells during mouse embryogenesis. © 2016 Japanese Teratology Society.

Characterization of Novel Plant Symbiosis Mutants Using a New Multiple Gene-Expression Reporter Sinorhizobium meliloti Strain

PubMed Central

Lang, Claus; Smith, Lucinda S.; Haney, Cara H.; Long, Sharon R.

2018-01-01

The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a PexoY-mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a PbacA-mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a PnifH-uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context. PMID:29467773

Characterization of Novel Plant Symbiosis Mutants Using a New Multiple Gene-Expression Reporter Sinorhizobium meliloti Strain.

PubMed

Lang, Claus; Smith, Lucinda S; Long, Sharon R

2018-01-01

The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a P exoY -mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a P bacA -mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a P nifH -uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context.

A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

PubMed

Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

2012-07-01

A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

PubMed

Treger, J M; Magee, T R; McEntee, K

1998-02-04

The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

Neuronal activity-dependent membrane traffic at the neuromuscular junction

PubMed Central

Miana-Mena, Francisco Javier; Roux, Sylvie; Benichou, Jean-Claude; Osta, Rosario; Brûlet, Philippe

2002-01-01

During development and also in adulthood, synaptic connections are modulated by neuronal activity. To follow such modifications in vivo, new genetic tools are designed. The nontoxic C-terminal fragment of tetanus toxin (TTC) fused to a reporter gene such as LacZ retains the retrograde and transsynaptic transport abilities of the holotoxin itself. In this work, the hybrid protein is injected intramuscularly to analyze in vivo the mechanisms of intracellular and transneuronal traffics at the neuromuscular junction (NMJ). Traffic on both sides of the synapse are strongly dependent on presynaptic neural cell activity. In muscle, a directional membrane traffic concentrates β-galactosidase-TTC hybrid protein into the NMJ postsynaptic side. In neurons, the probe is sorted across the cell to dendrites and subsequently to an interconnected neuron. Such fusion protein, sensitive to presynaptic neuronal activity, would be extremely useful to analyze morphological changes and plasticity at the NMJ. PMID:11880654

Expression of receptor-type protein tyrosine phosphatase in developing and adult renal vasculature

PubMed Central

Takahashi, Keiko; Kim, Rachel; Lauhan, Colette; Park, Yuna; Nguyen, Nghiep G.; Vestweber, Dietmar; Dominguez, Melissa G.; Valenzuela, David M.; Murphy, Andrew J.; Yancopoulos, George D.; Gale, Nicholas W.; Takahashi, Takamune

2017-01-01

Renal vascular development is a coordinated process that requires ordered endothelial cell proliferation, migration, intercellular adhesion, and morphogenesis. In recent decades, studies have defined the pivotal role of endothelial receptor tyrosine kinases (RPTKs) in the development and maintenance of renal vasculature. However, the expression and the role of receptor tyrosine phosphatases (RPTPs) in renal endothelium are poorly understood, though coupled and counterbalancing roles of RPTKs and RPTPs are well defined in other systems. In this study, we evaluated the promoter activity and immunolocalization of two endothelial RPTPs, VE-PTP and PTPμ, in developing and adult renal vasculature using the heterozygous LacZ knock-in mice and specific antibodies. In adult kidneys, both VE-PTP and PTPμ were expressed in the endothelium of arterial, glomerular, and medullary vessels, while their expression was highly limited in peritubular capillaries and venous endothelium. VE-PTP and PTPμ promoter activity was also observed in medullary tubular segments in adult kidneys. In embryonic (E12.5, E13.5, E15.5, E17.5) and postnatal (P0, P3, P7) kidneys, these RPTPs were expressed in ingrowing renal arteries, developing glomerular microvasculature (as early as the S-shaped stage), and medullary vessels. Their expression became more evident as the vasculatures matured. Peritubular capillary expression of VE-PTP was also noted in embryonic and postnatal kidneys. Compared to VE-PTP, PTPμ immunoreactivity was relatively limited in embryonic and neonatal renal vasculature and evident immunoreactivity was observed from the P3 stage. These findings indicate 1) VE-PTP and PTPμ are expressed in endothelium of arterial, glomerular, and medullary renal vasculature, 2) their expression increases as renal vascular development proceeds, suggesting that these RPTPs play a role in maturation and maintenance of these vasculatures, and 3) peritubular capillary VE-PTP expression is down-regulated in adult kidneys, suggesting a role of VE-PTP in the development of peritubular capillaries. PMID:28542220

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

PubMed Central

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

Autoregulation of the partition genes of the mini-F plasmid and the intracellular localization of their products in Escherichia coli.

PubMed

Hirano, M; Mori, H; Onogi, T; Yamazoe, M; Niki, H; Ogura, T; Hiraga, S

1998-02-01

The sopAB operon and the sopC sequence, which acts as a centromere, are essential for stable maintenance of the mini-F plasmid. Immunoprecipitation experiments with purified SopA and SopB proteins have demonstrated that these proteins interact in vitro. Expression studies using the lacZ gene as a reporter revealed that the sopAB operon is repressed by the cooperative action of SopA and SopB. Using immunofluorescence microscopy, we found discrete fluorescent foci of SopA and SopB in cells that produce both SopA and SopB in the presence of the sopC DNA segment, but not in the absence of sopC, suggesting the SopA-SopB complex binds to sopC segments. SopA was exclusively found to colocalize with nucleoids in cells that produced only SopA, while, in the absence of SopA, SopB was distributed in the cytosolic spaces.

Case Study: Polycystic Livers in a Transgenic Mouse Line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.

Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycysticmore » livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.« less

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†

PubMed Central

Grass, Gregor; Große, Cornelia; Nies, Dietrich H.

2000-01-01

Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463

Hypervitaminosis A resulting in DNA aberration in fetal transgenic mice (Muta Mouse).

PubMed

Inomata, Tomo; Kiuchi, Akio; Yoshida, Tomoo; Hisamatsu, Shin; Takizawa, Akiko; Kashiwazaki, Naomi; Akahori, Fumiaki; Ninomiya, Hiroyoshi

2005-09-05

Treatment with excessive amounts of Vitamin A during maternity induces fetal malformations. However, it is unclear whether these malformations are due to gene mutations or not. Using transgenic mice (containing lacZ gene showing beta-galactosidase enzymatic activity), we planned to observe whether gene mutations occur in the fetal tissues after treatment during maternity with Vitamin A (retinol palmitate). On the 11th day of pregnancy, mothers were given 30 mg (group 2), 150 mg (group 3) and 300 mg (group 4) of Vitamin A/kg body weight orally. Fetuses obtained on the 18th day of gestation showed malformations, such as cleft palate, origodactyly, brachydactyly and ectromeria. Most notably, cleft palate occurred dose dependently. The incidental rates were 100% in group 4, 58% in group 3 and 6% in group 2. The number of dead and absorbed fetuses also increased dose dependently with the treatments. DNA (integrated vectors containing lacZ genes) extracted from each fetus showed Vitamin A-induced lacZ mutations, especially in the malformed fetuses. The mutation frequencies were 4.99x10(-5) in group 4, 5.28x10(-5) in group 3 and 4.26x10(-5) in group 2. The frequencies of group 3 were significantly higher (p<0.05) than that of the controls (group 1), 2.79x10(-5). Maternal treatment with Vitamin A (150 mg/kg of body weight) was carried out on the 11th day of pregnancy. Fetuses obtained on the 14th day of gestation showed a much higher incidence of mutation, approximately 8.91x10(-5) (group 6) that was significantly higher (p<0.0001) than those from the controls (group 5), 2.94x10(-5). The present study indicates a possibility that hypervitaminosis A-induced fetal malformation and death might be caused by gene mutations.

Preemptive heme oxygenase-1 gene delivery reveals reduced mortality and preservation of left ventricular function 1 yr after acute myocardial infarction.

PubMed

Liu, Xiaoli; Simpson, Jeremy A; Brunt, Keith R; Ward, Christopher A; Hall, Sean R R; Kinobe, Robert T; Barrette, Valerie; Tse, M Yat; Pang, Stephen C; Pachori, Alok S; Dzau, Victor J; Ogunyankin, Kofo O; Melo, Luis G

2007-07-01

We reported previously that predelivery of heme oxygenase-1 (HO-1) gene to the heart by adeno-associated virus-2 (AAV-2) markedly reduces ischemia and reperfusion (I/R)-induced myocardial injury. However, the effect of preemptive HO-1 gene delivery on long-term survival and prevention of postinfarction heart failure has not been determined. We assessed the effect of HO-1 gene delivery on long-term survival, myocardial function, and left ventricular (LV) remodeling 1 yr after myocardial infarction (MI) using echocardiographic imaging, pressure-volume (PV) analysis, and histomorphometric approaches. Two groups of Lewis rats were injected with 2 x 10(11) particles of AAV-LacZ (control) or AAV-human HO-1 (hHO-1) in the anterior-posterior apical region of the LV wall. Six weeks after gene transfer, animals were subjected to 30 min of ischemia by ligation of the left anterior descending artery followed by reperfusion. Echocardiographic measurements and PV analysis of LV function were obtained at 2 wk and 12 mo after I/R. One year after acute MI, mortality was markedly reduced in the HO-1-treated animals compared with the LacZ-treated animals. PV analysis demonstrated significantly enhanced LV developed pressure, elevated maximal dP/dt, and lower end-diastolic volume in the HO-1 animals compared with the LacZ animals. Echocardiography showed a larger apical anterior-to-posterior wall ratio in HO-1 animals compared with LacZ animals. Morphometric analysis revealed extensive myocardial scarring and fibrosis in the infarcted LV area of LacZ animals, which was reduced by 62% in HO-1 animals. These results suggest that preemptive HO-1 gene delivery may be useful as a therapeutic strategy to reduce post-MI LV remodeling and heart failure.

Using thermal energy produced by irradiation of Mn-Zn ferrite magnetic nanoparticles (MZF-NPs) for heat-inducible gene expression.

PubMed

Tang, Qiu-sha; Zhang, Dong-sheng; Cong, Xiao-ming; Wan, Mei-ling; Jin, Li-qiang

2008-06-01

One of the main advantages of gene therapy over traditional therapy is the potential to target the expression of therapeutic genes in desired cells or tissues. To achieve targeted gene expression, we developed a novel heat-inducible gene expression system in which thermal energy generated by Mn-Zn ferrite magnetic nanoparticles (MZF-NPs) under an alternating magnetic field (AMF) was used to activate gene expression. MZF-NPs, obtained by co-precipitation method, were firstly surface modified with cation poly(ethylenimine) (PEI). Then thermodynamic test of various doses of MZF-NPs was preformed in vivo and in vitro. PEI-MZF-NPs showed good DNA binding ability and high transfection efficiency. In AMF, they could rise to a steady temperature. To analyze the heat-induced gene expression under an AMF, we combined P1730OR vector transfection with hyperthermia produced by irradiation of MZF-NPs. By using LacZ gene as a reporter gene and Hsp70 as a promoter, it was demonstrated that expression of a heterogeneous gene could be elevated to 10 to 500-fold over background by moderate hyperthermia (added 12.24 or 25.81 mg MZF-NPs to growth medium) in tissue cultured cells. When injected with 2.6 or 4.6 mg MZF-NPs, the temperature of tumor-bearing nude mice could rise to 39.5 or 42.8 degrees C, respectively, and the beta-gal concentration could increase up to 3.8 or 8.1 mU/mg proteins accordingly 1 day after hyperthermia treatment. Our results therefore supported hyperthermia produced by irradiation of MZF-NPs under an AMF as a feasible approach for targeted heat-induced gene expression. This novel system made use of the relative low Curie point of MZF-NPs to control the in vivo hyperthermia temperature and therefore acquired safe and effective heat-inducible transgene expression.

Anti-Tumor Activity of Cytotoxic T Lymphocytes Elicited with Recombinant and Synthetic Forms of a Model Tumor-Associated Antigen

PubMed Central

Wang, Michael; Chen, Pauline W.; Bronte, Vincenzo; Rosenberg, Steven A.; Restifo, Nicholas P.

2008-01-01

Summary The recent cloning of tumor-associated antigens (TAAs) recognized by CD8 + T lymphocytes (TCD8−) has made it possible to use recombinant and synthetic forms of TAAs to generate TCD8− with anti-tumor activity. To explore new therapeutic strategies in a mouse model, we retrovirally transduced the experimental murine tumor CT26 (H-2d), with the lacZ gene encoding our model TAA, (β-galactosidase (β-gal). The transduced cell line, CT26.CL25, grew as rapidly and as lethally as the parental cell line in normal, immuno-competent animals. In an attempt to elicit TCD8+ directed against our model TAA by using purely recombinant and synthetic forms of our model TAA, we synthesized a nine-amino-acid long immunodominant peptide of (β-gal (TPH-PARIGL), corresponding to amino acid residues 876–884, which was known to be presented by the Ld major histocompatibility complex (MHC) class I molecule, and a recombinant vaccinia virus encoding the full-length β-gal protein (VJS6). Splenocytes obtained from naïve mice and co-cultured with (β-gal peptide could not be expanded in primary ex vivo cultures. However, mice immunized with VJS6, but not with a control recombinant vaccinia virus, yielded splenocytes that were capable of specifically lysing CT26.CL25 in vitro after co-culture with (β-gal peptide. Most significantly, adoptive transfer of these cells could effectively treat mice bearing 3-day-old established pulmonary metastases. These observations show that therapeutic TCD8+ directed against a model TAA could be generated by using purely recombinant and synthetic forms of this antigen. These findings point the way to a potentially useful immunotherapeutic strategy, which has been made possible by the recent cloning of immunogenic TAAs that are expressed by human malignancies. PMID:8770769

Generation and characterization of Atoh1-Cre knock-in mouse line

PubMed Central

Yang, Hua; Xie, Xiaoling; Deng, Min; Chen, Xiaowei; Gan, Lin

2010-01-01

Summary Atoh1 encodes a basic helix-loop-helix (bHLH) transcription factor required for the development of the inner ear sensory epithelia, the dorsal spinal cord, brainstem, cerebellum, and intestinal secretory cells. In this study to create a genetic tool for the research on gene function in the ear sensory organs, we generated an Atoh1-Cre knock-in mouse line by replacing the entire Atoh1 coding sequences with the Cre coding sequences. Atoh1Cre/+mice were viable, fertile, and displayed no visible defects whereas the Atoh1Cre/Cremice died perinatally. The spatiotemporal activities of Cre recombinase were examined by crossing Atoh1-Cre mice with the R26R-lacZ conditional reporter mice. Atoh1-Cre activities were detected in the developing inner ear, the hindbrain, the spinal cord, and the intestine. In the inner ear, Atoh1-Cre activities were confined to the sensory organs in which lacZ expression is detected in nearly all of the hair cells and in many supporting cells. Thus, Atoh1-Cre mouse line serves as a useful tool for the functional study of genes in the inner ear. In addition, our results demonstrate that Atoh1 is expressed in the common progenitors destined for both hair and supporting cells. PMID:20533400

Progressive neurologic and somatic disease in a novel mouse model of human mucopolysaccharidosis type IIIC

PubMed Central

Marcó, Sara; Pujol, Anna; Roca, Carles; Motas, Sandra; Ribera, Albert; Garcia, Miguel; Molas, Maria; Villacampa, Pilar; Melia, Cristian S.; Sánchez, Víctor; Sánchez, Xavier; Bertolin, Joan; Ruberte, Jesús; Haurigot, Virginia

2016-01-01

ABSTRACT Mucopolysaccharidosis type IIIC (MPSIIIC) is a severe lysosomal storage disease caused by deficiency in activity of the transmembrane enzyme heparan-α-glucosaminide N-acetyltransferase (HGSNAT) that catalyses the N-acetylation of α-glucosamine residues of heparan sulfate. Enzyme deficiency causes abnormal substrate accumulation in lysosomes, leading to progressive and severe neurodegeneration, somatic pathology and early death. There is no cure for MPSIIIC, and development of new therapies is challenging because of the unfeasibility of cross-correction. In this study, we generated a new mouse model of MPSIIIC by targeted disruption of the Hgsnat gene. Successful targeting left LacZ expression under control of the Hgsnat promoter, allowing investigation into sites of endogenous expression, which was particularly prominent in the CNS, but was also detectable in peripheral organs. Signs of CNS storage pathology, including glycosaminoglycan accumulation, lysosomal distension, lysosomal dysfunction and neuroinflammation were detected in 2-month-old animals and progressed with age. Glycosaminoglycan accumulation and ultrastructural changes were also observed in most somatic organs, but lysosomal pathology seemed most severe in liver. Furthermore, HGSNAT-deficient mice had altered locomotor and exploratory activity and shortened lifespan. Hence, this animal model recapitulates human MPSIIIC and provides a useful tool for the study of disease physiopathology and the development of new therapeutic approaches. PMID:27491071

Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b: cloning, sequencing, and expression of the tyrosinase gene mepA.

PubMed Central

Mercado-Blanco, J; García, F; Fernández-López, M; Olivares, J

1993-01-01

Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b (140 MDa). Transfer of this plasmid to GR4-cured derivatives or to Agrobacterium tumefaciens enables these bacteria to produce melanin. Sequence analysis of a 3.5-kb PstI fragment of plasmid pRmeGR4b has revealed the presence of a open reading frame 1,481-bp that codes for a protein whose sequence shows strong homology to two conserved regions involved in copper binding in tyrosinases and hemocyanins. In vitro-coupled transcription-translation experiments showed that this open reading frame codes for a 55-kDa polypeptide. Melanin production in GR4 is not under the control of the RpoN-NifA regulatory system, unlike that in R. leguminosarum bv. phaseoli 8002. The GR4 tyrosinase gene could be expressed in Escherichia coli under the control of the lacZ promoter. For avoiding confusion with mel genes (for melibiose), a change of the name of the previously reported mel genes of R. leguminosarum bv. phaseoli and other organisms to mep genes (for melanin production) is proposed. Images PMID:8366027

A rapid generation of adenovirus vector with a genetic modification in hexon protein.

PubMed

Di, Bingyan; Mao, Qinwen; Zhao, Junli; Li, Xing; Wang, Dongyang; Xia, Haibin

2012-02-10

The generation of hexon-modified adenovirus vector has proven difficult. In this paper, we developed a novel method for rapid generation of hexon-modified adenoviral vector via one step ligation in vitro followed by quick white/blue color screening. The new system has the following features. First, eGFP expression driven by the CMV promoter in E1 region functions as a reporter to evaluate the tropism of hexon-modified adenovirus in vitro. Second, it has two unique restriction enzyme sites with sticky ends located in the hexon HVR5 region. Third, a lacZ expression cassette under the control of plac promoter is placed between the two restriction enzyme sites, which allows recombinants to be selected using blue/white screening. To prove the principle of the method, genetically modified adenoviruses were successfully produced by insertion of NGR, RGD or Tat PTD peptide into hexon HVR5. Furthermore, the transduction efficiency of the Tat PTD modified virus was shown to be a significant enhancement in A172 and CHO-K1 cells. In conclusion, the novel system makes the production of truly retargeted vectors more promising, which would be of substantial benefit for cancer gene therapy. Copyright © 2012 Elsevier B.V. All rights reserved.

Eukaryote-like Ser/Thr protein kinase PrkA modulates sporulation via regulating the transcriptional factor σ(K) in Bacillus subtilis.

PubMed

Yan, Jinyuan; Zou, Wei; Fang, Juan; Huang, Xiaowei; Gao, Feng; He, Zeying; Zhang, Keqin; Zhao, Ninghui

2015-01-01

Protein kinase A (PrkA), also known as AMP-activated protein kinase, functions as a serine/threonine protein kinase (STPK), has been shown to be involved in a variety of important biologic processes, including pathogenesis of many important diseases in mammals. However, the biological functions of PrkA are less known in prokaryote cells. Here, we explored the function of PrkA as well as its underlying molecular mechanisms using the model bacterium Bacillus subtilis168. When PrkA is inhibited by 9-β-D-arabinofuranosyladenine (ara-A) in the wild type strain or deleted in the ΔprkA mutant strain, we observed sporulation defects in B. subtilis 168, suggesting that PrkA functions as a sporulation-related protein. Transcriptional analysis using the lacZ reporter gene demonstrated that deletion of prkA significantly reduced the expression of the transcriptional factor σ(K) and its downstream genes. Complementation of sigK gene in prkA knockout mutant partially rescued the phenotype of ΔprkA, further supporting the hypothesis that the decreased σ(K) expression should be one of the reasons for the sporulation defect resulting from prkA disruption. Finally, our data confirmed that Hpr (ScoC) negatively controlled the expression of transcriptional factor σ(K), and thus PrkA accelerated sporulation and the expression of σ(K) by suppression of Hpr (ScoC). Taken together, our study discovered a novel function of the eukaryotic-like STPK PrkA in spore development as well as its underlying molecular mechanism in B. subtilis.

Transgenic rats with green, red, and blue fluorescence: powerful tools for bioimaging, cell trafficking, and differentiation

NASA Astrophysics Data System (ADS)

Murakami, Takashi; Kobayashi, Eiji

2005-04-01

The rat represents a perfect animal for broadening medical experiments, because its physiology has been well understood in the history of experimental animals. In addition, its larger body size takes enough advantage for surgical manipulation, compared to the mouse. Many rat models mimicking human diseases, therefore, have been used in a variety of biomedical studies including physiology, pharmacology, transplantation, and immunology. In an effort to create the specifically designed rats for biomedical research and regenerative medicine, we have developed the engineered rat system on the basis of transgenic technology and succeeded in establishing various transgenic rat strains. The transgenic rats with green fluorescent protein (GFP) were generated in the two different strains (Wistar and Lewis), in which GFP is driven under the chicken beta-actin promoter and cytomegalovirus enhancer (CAG promoter). Their GFP expression levels were different in each organ, but the Lewis line expressed GFP strongly and ubiquitously in most of the organs compared with that of Wistar. For red fluorescence, DsRed2 was transduced to the Wistar rats: one line specifically expresses DsRed2 in the liver under the mouse albumin promoter, another is designed for the Cre/LoxP system as the double reporter rat (the initial DsRed2 expression turns on GFP in the presence of Cre recombinase). LacZ-transgenic rats represent blue color, and LacZ is driven the CAG (DA) or ROSA26 promoter (Lewis). Our unique transgenic rats" system highlights the powerful performance for the elucidation of many cellular processes in regenerative medicine, leading to innovative medical treatments.

Biomineralization, life-time of odontogenic cells and differential expression of the two homeobox genes MSX-1 and DLX-2 in transgenic mice.

PubMed

Lézot, F; Thomas, B; Hotton, D; Forest, N; Orestes-Cardoso, S; Robert, B; Sharpe, P; Berdal, A

2000-03-01

Msx and Dlx homeobox genes encode for transcription factors that control early morphogenesis. More specifically, Msx-1, Msx-2, and Dlx-2 homeobox genes contribute to the initial patterning of the dentition. The present study is devoted to the potential role of those homeobox genes during the late formation of mineralized tissues, using the rodent incisor as an experimental system. The continuously erupting mandibular incisor allows (1) the coinvestigation of the whole sequences of amelogenesis and dentinogenesis, aligned along the main dental axis in a single sample in situ and (2) the differential characterization of transcripts generated by epithelial and ectomesenchymal odontogenic cells. Northern blot experiments on microdissected cells showed the continuing expression of Msx-2 and Dlx-2 in the later stages of dental biomineralization, differentially in epithelial and ectomesenchymal compartments. Transgenic mice produced with LacZ reporter constructs for Dlx-2 and Msx-1 were used to detect different components of the gene expression patterns with the sensitive beta-galactosidase histoenzymology. The results show a prominent epithelial involvement of Dlx-2, with stage-specific variations in the cells involved in enamel formation. Quantitative analyses identified specific modulations of Dlx-2 expression in ameloblasts depending on the anatomical sites of the incisor, showing more specifically an inverse linear relationship between the Dlx-2 promoter activity level and enamel thickness. This investigation extends the role of homeoproteins to postmitotic stages, which would control secretory cell activity, in a site-specific manner as shown here for Dlx-2.

A novel, broad-range, CTXΦ-derived stable integrative expression vector for functional studies.

PubMed

Das, Bhabatosh; Kumari, Reena; Pant, Archana; Sen Gupta, Sourav; Saxena, Shruti; Mehta, Ojasvi; Nair, Gopinath Balakrish

2014-12-01

CTXΦ, a filamentous vibriophage encoding cholera toxin, uses a unique strategy for its lysogeny. The single-stranded phage genome forms intramolecular base-pairing interactions between two inversely oriented XerC and XerD binding sites (XBS) and generates a functional phage attachment site, attP(+), for integration. The attP(+) structure is recognized by the host-encoded tyrosine recombinases XerC and XerD (XerCD), which enables irreversible integration of CTXΦ into the chromosome dimer resolution site (dif) of Vibrio cholerae. The dif site and the XerCD recombinases are widely conserved in bacteria. We took advantage of these conserved attributes to develop a broad-host-range integrative expression vector that could irreversibly integrate into the host chromosome using XerCD recombinases without altering the function of any known open reading frame (ORF). In this study, we engineered two different arabinose-inducible expression vectors, pBD62 and pBD66, using XBS of CTXΦ. pBD62 replicates conditionally and integrates efficiently into the dif of the bacterial chromosome by site-specific recombination using host-encoded XerCD recombinases. The expression level of the gene of interest could be controlled through the PBAD promoter by modulating the functions of the vector-encoded transcriptional factor AraC. We validated the irreversible integration of pBD62 into a wide range of pathogenic and nonpathogenic bacteria, such as V. cholerae, Vibrio fluvialis, Vibrio parahaemolyticus, Escherichia coli, Salmonella enterica, and Klebsiella pneumoniae. Gene expression from the PBAD promoter of integrated vectors was confirmed in V. cholerae using the well-studied reporter genes mCherry, eGFP, and lacZ. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Hyccin, the Molecule Mutated in the Leukodystrophy Hypomyelination and Congenital Cataract (HCC), Is a Neuronal Protein

PubMed Central

Giacomini, Caterina; Musante, Veronica; Fruscione, Floriana; La Padula, Veronica; Biancheri, Roberta; Scarfì, Sonia; Prada, Valeria; Sotgia, Federica; Duncan, Ian D.; Zara, Federico; Werner, Hauke B.; Lisanti, Michael P.; Nobbio, Lucilla; Corradi, Anna; Minetti, Carlo

2012-01-01

“Hypomyelination and Congenital Cataract”, HCC (MIM #610532), is an autosomal recessive disorder characterized by congenital cataract and diffuse cerebral and peripheral hypomyelination. HCC is caused by deficiency of Hyccin, a protein whose biological role has not been clarified yet. Since the identification of the cell types expressing a protein of unknown function can contribute to define the physiological context in which the molecule is explicating its function, we analyzed the pattern of Hyccin expression in the central and peripheral nervous system (CNS and PNS). Using heterozygous mice expressing the b-galactosidase (LacZ) gene under control of the Hyccin gene regulatory elements, we show that the gene is primarily expressed in neuronal cells. Indeed, Hyccin-LacZ signal was identified in CA1 hippocampal pyramidal neurons, olfactory bulb, and cortical pyramidal neurons, while it did not colocalize with oligodendroglial or astrocytic markers. In the PNS, Hyccin was detectable only in axons isolated from newborn mice. In the brain, Hyccin transcript levels were higher in early postnatal development (postnatal days 2 and 10) and then declined in adult mice. In a model of active myelinogenesis, organotypic cultures of rat Schwann cells (SC)/Dorsal Root Ganglion (DRG) sensory neurons, Hyccin was detected along the neurites, while it was absent from SC. Intriguingly, the abundance of the molecule was upregulated at postnatal days 10 and 15, in the initial steps of myelinogenesis and then declined at 30 days when the process is complete. As Hyccin is primarily expressed in neurons and its mutation leads to hypomyelination in human patients, we suggest that the protein is involved in neuron-to-glia signalling to initiate or maintain myelination. PMID:22461884

Superoxide radical-generating compounds activate a predicted promoter site for paraquat-inducible genes of the Chromobacterium violaceum bacterium in a dose-dependent manner.

PubMed

Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R

2015-08-21

The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner.

Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers.

PubMed Central

Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A

1995-01-01

Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357

Activating Hair Follicle Stem Cells via R-spondin2 to Stimulate Hair Growth.

PubMed

Smith, Andrew A; Li, Jingtao; Liu, Bo; Hunter, Daniel; Pyles, Malcolm; Gillette, Martin; Dhamdhere, Girija R; Abo, Arie; Oro, Anthony; Helms, Jill A

2016-08-01

Wnt signaling is required for the development of the hair follicle, and for inciting the growth (anagen) phase of the hair cycle. Most strategies to enhance Wnt signaling for hair growth create a state of constitutive Wnt activation, which leads to neoplastic transformation of the epithelial hair matrix. Using Axin2(LacZ/+) and Axin2(Cre/+)R26R(mTmG/+) reporter mice and RNA analyses, we show that Wnt signaling is elevated during anagen, is reduced at the onset of catagen, and can be reamplified in the skin and surrounding hair follicles via intradermal injection of recombinant R-spondin2 protein. Using Lgr5(LacZ/+) reporter mice, we demonstrate that this amplified Wnt environment leads to activation of leucine-rich repeat-containing G-protein coupled receptor 5-positive stem cells in the hair follicle. The onset of catagen is repressed by R-spondin2 injection, and the anagen phase persists. As a consequence, hair shafts grow longer. We conclude that R-spondin2 treatment activates hair follicle stem cells and therefore may have therapeutic potential to promote hair growth. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

PubMed

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-03-06

Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

PubMed Central

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-01-01

Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

Highly conserved proximal promoter element harbouring paired Sox9-binding sites contributes to the tissue- and developmental stage-specific activity of the matrilin-1 gene.

PubMed

Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya

2005-08-01

The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Mutagenicity testing with transgenic mice. Part I: Comparison with the mouse bone marrow micronucleus test

PubMed Central

Wahnschaffe, U; Bitsch, A; Kielhorn, J; Mangelsdorf, I

2005-01-01

As part of a larger literature study on transgenic animals in mutagenicity testing, test results from the transgenic mutagenicity assays (lacI model; commercially available as the Big Blue® mouse, and the lacZ model; commercially available as the Muta™Mouse), were compared with the results on the same substances in the more traditional mouse bone marrow micronucleus test. 39 substances were found which had been tested in the micronucleus assay and in the above transgenic mouse systems. Although, the transgenic animal mutation assay is not directly comparable with the micronucleus test, because different genetic endpoints are examined: chromosome aberration versus gene mutation, the results for the majority of substances were in agreement. Both test systems, the transgenic mouse assay and the mouse bone marrow micronucleus test, have advantages and they complement each other. However, the transgenic animal assay has some distinct advantages over the micronucleus test: it is not restricted to one target organ and detects systemic as well as local mutagenic effects. PMID:15655069

Escherichia coli K1-Specific Bacteriophage CUS-3 Distribution and Function in Phase-Variable Capsular Polysialic Acid O Acetylation▿ †

PubMed Central

King, Michael R.; Vimr, Ross P.; Steenbergen, Susan M.; Spanjaard, Lodewijk; Plunkett, Guy; Blattner, Frederick R.; Vimr, Eric R.

2007-01-01

Escherichia coli K1 is the leading cause of human neonatal sepsis and meningitis and is important in other clinical syndromes of both humans and domestic animals; in this strain the polysialic acid capsule (K1 antigen) functions by inhibiting innate immunity. Recent discovery of the phase-variable capsular O acetylation mechanism indicated that the O-acetyltransferase gene, neuO, is carried on a putative K1-specific prophage designated CUS-3 (E. L. Deszo, S. M. Steenbergen, D. I. Freedberg, and E. R. Vimr, Proc. Natl. Acad. Sci. USA 102:5564-5569, 2005). Here we describe the isolation and characterization of a CUS-3 derivative (CUS-3a), demonstrating its morphology, lysogenization of a sensitive host, and the distribution of CUS-3 among a collection of 111 different K1 strains. The 40,207-bp CUS-3 genome was annotated from the strain RS218 genomic DNA sequence, indicating that most of the 63 phage open reading frames have their closest homologues in one of seven different lambdoid phages. Translational fusion of a reporter lacZ fragment to the hypervariable poly-Ψ domain facilitated measurement of phase variation frequencies, indicating no significant differences between switch rates or effects on rates of the methyl-directed mismatch repair system. PCR analysis of poly-Ψ domain length indicated preferential loss or gain of single 5′-AAGACTC-3′ nucleotide repeats. Analysis of a K1 strain previously reported as “locked on” indicated a poly-Ψ region with the least number of heptad repeats compatible with in-frame neuO expression. The combined results establish CUS-3 as an active mobile contingency locus in E. coli K1, indicating its capacity to mediate population-wide capsule variation. PMID:17601779

The Homogentisate Pathway: a Central Catabolic Pathway Involved in the Degradation of l-Phenylalanine, l-Tyrosine, and 3-Hydroxyphenylacetate in Pseudomonas putida

PubMed Central

Arias-Barrau, Elsa; Olivera, Elías R.; Luengo, José M.; Fernández, Cristina; Galán, Beatriz; García, José L.; Díaz, Eduardo; Miñambres, Baltasar

2004-01-01

Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Whereas the phh, tyr, and hpd genes are not linked in the P. putida genome, the hmgABC genes appear to form a single transcriptional unit. Gel retardation assays and lacZ translational fusion experiments have shown that hmgR encodes a specific repressor that controls the inducible expression of the divergently transcribed hmgABC catabolic genes, and homogentisate is the inducer molecule. Footprinting analysis revealed that HmgR protects a region in the Phmg promoter that spans a 17-bp palindromic motif and an external direct repetition from position −16 to position 29 with respect to the transcription start site. The HmgR protein is thus the first IclR-type regulator that acts as a repressor of an aromatic catabolic pathway. We engineered a broad-host-range mobilizable catabolic cassette harboring the hmgABC, hpd, and tyrB genes that allows heterologous bacteria to use Tyr as a unique carbon and energy source. Remarkably, we show here that the catabolism of 3-hydroxyphenylacetate in P. putida U funnels also into the homogentisate central pathway, revealing that the hmg cluster is a key catabolic trait for biodegradation of a small number of aromatic compounds. PMID:15262943

The homogentisate pathway: a central catabolic pathway involved in the degradation of L-phenylalanine, L-tyrosine, and 3-hydroxyphenylacetate in Pseudomonas putida.

PubMed

Arias-Barrau, Elsa; Olivera, Elías R; Luengo, José M; Fernández, Cristina; Galán, Beatriz; García, José L; Díaz, Eduardo; Miñambres, Baltasar

2004-08-01

Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Whereas the phh, tyr, and hpd genes are not linked in the P. putida genome, the hmgABC genes appear to form a single transcriptional unit. Gel retardation assays and lacZ translational fusion experiments have shown that hmgR encodes a specific repressor that controls the inducible expression of the divergently transcribed hmgABC catabolic genes, and homogentisate is the inducer molecule. Footprinting analysis revealed that HmgR protects a region in the Phmg promoter that spans a 17-bp palindromic motif and an external direct repetition from position -16 to position 29 with respect to the transcription start site. The HmgR protein is thus the first IclR-type regulator that acts as a repressor of an aromatic catabolic pathway. We engineered a broad-host-range mobilizable catabolic cassette harboring the hmgABC, hpd, and tyrB genes that allows heterologous bacteria to use Tyr as a unique carbon and energy source. Remarkably, we show here that the catabolism of 3-hydroxyphenylacetate in P. putida U funnels also into the homogentisate central pathway, revealing that the hmg cluster is a key catabolic trait for biodegradation of a small number of aromatic compounds.

Escherichia coli K1-specific bacteriophage CUS-3 distribution and function in phase-variable capsular polysialic acid O acetylation.

PubMed

King, Michael R; Vimr, Ross P; Steenbergen, Susan M; Spanjaard, Lodewijk; Plunkett, Guy; Blattner, Frederick R; Vimr, Eric R

2007-09-01

Escherichia coli K1 is the leading cause of human neonatal sepsis and meningitis and is important in other clinical syndromes of both humans and domestic animals; in this strain the polysialic acid capsule (K1 antigen) functions by inhibiting innate immunity. Recent discovery of the phase-variable capsular O acetylation mechanism indicated that the O-acetyltransferase gene, neuO, is carried on a putative K1-specific prophage designated CUS-3 (E. L. Deszo, S. M. Steenbergen, D. I. Freedberg, and E. R. Vimr, Proc. Natl. Acad. Sci. USA 102:5564-5569, 2005). Here we describe the isolation and characterization of a CUS-3 derivative (CUS-3a), demonstrating its morphology, lysogenization of a sensitive host, and the distribution of CUS-3 among a collection of 111 different K1 strains. The 40,207-bp CUS-3 genome was annotated from the strain RS218 genomic DNA sequence, indicating that most of the 63 phage open reading frames have their closest homologues in one of seven different lambdoid phages. Translational fusion of a reporter lacZ fragment to the hypervariable poly-Psi domain facilitated measurement of phase variation frequencies, indicating no significant differences between switch rates or effects on rates of the methyl-directed mismatch repair system. PCR analysis of poly-Psi domain length indicated preferential loss or gain of single 5'-AAGACTC-3' nucleotide repeats. Analysis of a K1 strain previously reported as "locked on" indicated a poly-Psi region with the least number of heptad repeats compatible with in-frame neuO expression. The combined results establish CUS-3 as an active mobile contingency locus in E. coli K1, indicating its capacity to mediate population-wide capsule variation.

Fracture induced mobilization and incorporation of bone marrow-derived endothelial progenitor cells for bone healing.

PubMed

Matsumoto, Tomoyuki; Mifune, Yutaka; Kawamoto, Atsuhiko; Kuroda, Ryosuke; Shoji, Taro; Iwasaki, Hiroto; Suzuki, Takahiro; Oyamada, Akira; Horii, Miki; Yokoyama, Ayumi; Nishimura, Hiromi; Lee, Sang Yang; Miwa, Masahiko; Doita, Minoru; Kurosaka, Masahiro; Asahara, Takayuki

2008-04-01

We recently reported that systemic administration of peripheral blood (PB) CD34+ cells, an endothelial progenitor cell (EPC)-enriched population, contributed to fracture healing via vasculogenesis/angiogenesis. However, pathophysiological role of EPCs in fracture healing process has not been fully clarified. Therefore, we investigated the hypothesis whether mobilization and incorporation of bone marrow (BM)-derived EPCs may play a pivotal role in appropriate fracture healing. Serial examinations of Laser doppler perfusion imaging and histological capillary density revealed that neovascularization activity at the fracture site peaked at day 7 post-fracture, the early phase of endochondral ossifification. Fluorescence-activated cell sorting (FACS) analysis demonstrated that the frequency of BM cKit+Sca1+Lineage- (Lin-) cells and PB Sca1+Lin- cells, which are EPC-enriched fractions, significantly increased post-fracture. The Sca1+ EPC-derived vasuculogenesis at the fracture site was confirmed by double immunohistochemistry for CD31 and Sca1. BM transplantation from transgenic donors expressing LacZ transcriptionally regulated by endothelial cell-specific Tie-2 promoter into wild type also provided direct evidence that EPCs contributing to enhanced neovascularization at the fracture site were specifically derived from BM. Animal model of systemic administration of PB Sca1+Lin- Green Fluorescent Protein (GFP)+ cells further confirmed incorporation of the mobilized EPCs into the fracture site for fracture healing. These findings indicate that fracture may induce mobilization of EPCs from BM to PB and recruitment of the mobilized EPCs into fracture sites, thereby augment neovascularization during the process of bone healing. EPCs may play an essential role in fracture healing by promoting a favorable environment through neovascularization in damaged skeletal tissue. (c) 2008 Wiley-Liss, Inc.

Partial rescue of glomerular laminin alpha5 mutations by wild-type endothelia produce hybrid glomeruli.

PubMed

Abrahamson, Dale R; St John, Patricia L; Isom, Kathryn; Robert, Barry; Miner, Jeffrey H

2007-08-01

Both endothelial cells and podocytes are sources for laminin alpha1 at the inception of glomerulogenesis and then for laminin alpha5 during glomerular maturation. Why glomerular basement membranes (GBM) undergo laminin transitions is unknown, but this may dictate glomerular morphogenesis. In mice that genetically lack laminin alpha5, laminin alpha5beta2gamma1 is not assembled, vascularized glomeruli fail to form, and animals die at midgestation with neural tube closure and placental deficits. It was previously shown that renal cortices of newborn mice contain endothelial progenitors (angioblasts) and that when embryonic day 12 kidneys are transplanted into newborn kidney, hybrid glomeruli (host-derived endothelium and donor-derived podocytes) result. Reasoning that host endothelium may correct the glomerular phenotype that is seen in laminin alpha5 mutants, alpha5 null embryonic day 12 metanephroi were grafted into wild-type newborn kidney. Hybrid glomeruli were identified in grafts by expression of a host-specific LacZ lineage marker. Labeling of glomerular hybrid GBM with chain-specific antibodies showed a markedly stratified distribution of laminins: alpha5 was found only on the inner endothelial half of GBM, whereas alpha1 located to outer layers beneath mutant podocytes. For measurement of the contribution of host endothelium to hybrid GBM, immunofluorescent signals for laminin alpha5 were quantified: Hybrid GBM contained approximately 50% the normal alpha5 complement as wild-type GBM. Electron microscopy of glomerular hybrids showed vascularization, but podocyte foot processes were absent. It was concluded that (1) endothelial and podocyte-derived laminins remain tethered to their cellular origin, (2) developing endothelial cells contribute large amounts of GBM laminins, and (3) podocyte foot process differentiation may require direct exposure to laminin alpha5.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1

PubMed Central

Jiang, Bei; Xiao, Bo; Liu, Linde; Ge, Yihe; Hu, Xiaomei

2016-01-01

Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1) and phz2 (phzA2B2C2D2E2F2G2)] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1. PMID:26735915

Osteocytes, not Osteoblasts or Lining Cells, are the Main Source of the RANKL Required for Osteoclast Formation in Remodeling Bone

PubMed Central

Xiong, Jinhu; Piemontese, Marilina; Onal, Melda; Campbell, Josh; Goellner, Joseph J.; Dusevich, Vladimir; Bonewald, Lynda; Manolagas, Stavros C.; O’Brien, Charles A.

2015-01-01

The cytokine receptor activator of nuclear factor kappa B ligand (RANKL), encoded by the Tnfsf11 gene, is essential for osteoclastogenesis and previous studies have shown that deletion of the Tnfsf11 gene using a Dmp1-Cre transgene reduces osteoclast formation in cancellous bone by more than 70%. However, the Dmp1-Cre transgene used in those studies leads to recombination in osteocytes, osteoblasts, and lining cells making it unclear whether one or more of these cell types produce the RANKL required for osteoclast formation in cancellous bone. Because osteoblasts, osteocytes, and lining cells have distinct locations and functions, distinguishing which of these cell types are sources of RANKL is essential for understanding the orchestration of bone remodeling. To distinguish between these possibilities, we have now created transgenic mice expressing the Cre recombinase under the control of regulatory elements of the Sost gene, which is expressed in osteocytes but not osteoblasts or lining cells in murine bone. Activity of the Sost-Cre transgene in osteocytes, but not osteoblast or lining cells, was confirmed by crossing Sost-Cre transgenic mice with tdTomato and R26R Cre-reporter mice, which express tdTomato fluorescent protein or LacZ, respectively, only in cells expressing the Cre recombinase or their descendants. Deletion of the Tnfsf11 gene in Sost-Cre mice led to a threefold decrease in osteoclast number in cancellous bone and increased cancellous bone mass, mimicking the skeletal phenotype of mice in which the Tnfsf11 gene was deleted using the Dmp1-Cre transgene. These results demonstrate that osteocytes, not osteoblasts or lining cells, are the main source of the RANKL required for osteoclast formation in remodeling cancellous bone. PMID:26393791

Core element characterization of Rhodococcus promoters and development of a promoter-RBS mini-pool with different activity levels for efficient gene expression.

PubMed

Jiao, Song; Yu, Huimin; Shen, Zhongyao

2018-09-25

To satisfy the urgent demand for promoter engineering that can accurately regulate the metabolic circuits and expression of specific genes in the Rhodococcus microbial platform, a promoter-ribosome binding site (RBS) coupled mini-pool with fine-tuning of different activity levels was successfully established. Transcriptome analyses of R. ruber TH revealed several representative promoters with different activity levels, e.g., Pami, Pcs, Pnh, P50sl36, PcbiM, PgroE and Pniami. β-Galactosidase (LacZ) reporter measurement demonstrated that different gene expression levels could be obtained with these natural promoters combined with an optimal RBS of ami. Further use of these promoters to overexpress the nitrile hydratase (NHase) gene with RBSami in R. ruber THdAdN produced different expression levels consistent with the transcription analyses. The -35 and -10 core elements of different promoters were further analyzed, and the conserved sequences were revealed to be TTGNNN and (T/C)GNNA(A/C)AAT. By mutating the core elements of the strong promoters, Pnh and Pami, into the above consensus sequence, two even stronger promoters, PnhM and PamiM, were obtained with 2.2-fold and 7.7-fold improvements in transcription, respectively. Integrating several strategies, including transcriptome promoter screening, -35 and -10 core element identification, core element point-mutation, RBS optimization and diverse reporter verification, a fine-tuning promoter-RBS combination mini-pool with different activity levels in Rhodococcus strains was successfully established. This development is significant for broad applications of the Rhodococcus genus as a microbial platform. Copyright © 2018 Elsevier B.V. All rights reserved.

Carbon Limitation Induces ςS-Dependent Gene Expression in Pseudomonas fluorescens in Soil

PubMed Central

Koch, Birgit; Worm, Jakob; Jensen, Linda E.; Højberg, Ole; Nybroe, Ole

2001-01-01

Recent studies employing reporter gene technology indicate that the availabilities of the major nutrients nitrogen, phosphate, and iron to Pseudomonas are not severely limited in bulk soil. Indirect evidence has pointed to carbon limitation as a severe nutritional stress in this environment. We show that a plasmid (pGM115)-borne transcriptional fusion between the ςS-dependent Escherichia coli promoter Pfic and lacZ functions as a reliable reporter for carbon availability in Pseudomonas fluorescens. When P. fluorescens strain DF57(pGM115) was introduced into bulk soil, carbon-limiting conditions were indicated by citrate-repressible induction of β-galactosidase activity. To address carbon availability at the single-cell level, we developed an immunofluorescence double-staining procedure for individual DF57 cells expressing β-galactosidase from Pfic. Changes in cell size and expression of β-galactosidase were analyzed by flow cytometry. Cells extracted from soil microcosms reduced their size less than carbon-starved cells in pure culture and showed an increased tendency to aggregate. The single-cell analysis revealed that for cells residing in soil, the expression of β-galactosidase became heterogeneous and only a DF57 subpopulation appeared to be carbon limited. In soil amended with barley straw, limited nitrogen availability has been determined by use of the bioluminescent reporter strain P. fluorescens DF57-N3. We used strain DF57-N3(pGM115) as a double reporter for carbon and nitrogen limitation that allowed us to study the dynamics of carbon and nitrogen availabilities in more detail. In straw-amended soil β-galactosidase activity remained low, while nitrogen limitation-dependent bioluminescence appeared after a few days. Hence, nitrogen became limited under conditions where carbon resources were not completely exhausted. PMID:11472905

Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum.

PubMed

Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun

2018-05-01

Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.

A Novel Mgp-Cre Knock-In Mouse Reveals an Anticalcification/Antistiffness Candidate Gene in the Trabecular Meshwork and Peripapillary Scleral Region.

PubMed

Borrás, Teresa; Smith, Matthew H; Buie, LaKisha K

2015-04-01

Soft tissue calcification is a pathological condition. Matrix Gla (MGP) is a potent mineralization inhibitor secreted by cartilage chondrocytes and arteries' vascular smooth muscle cells. Mgp knock-out mice die at 6 weeks due to massive arterial calcification. Arterial calcification results in arterial stiffness and higher systolic blood pressure. Intriguingly, MGP was highly abundant in trabecular meshwork (TM). Because tissue stiffness is relevant to glaucoma, we investigated which additional eye tissues use Mgp's function using knock-in mice. An Mgp-Cre-recombinase coding sequence (Cre) knock-in mouse, containing Mgp DNA plus an internal ribosomal entry site (IRES)-Cre-cassette was generated by homologous recombination. Founders were crossed with Cre-mediated reporter mouse R26R-lacZ. Their offspring expresses lacZ where Mgp is transcribed. Eyes from MgpCre/+;R26RlacZ/+ (Mgp-lacZ knock-in) and controls, 1 to 8 months were assayed for β-gal enzyme histochemistry. As expected, Mgp-lacZ knock-in's TM was intensely blue. In addition, this mouse revealed high specific expression in the sclera, particularly in the peripapillary scleral region (ppSC). Ciliary muscle and sclera above the TM were also positive. Scleral staining was located immediately underneath the choroid (chondrocyte layer), began midsclera and was remarkably high in the ppSC. Cornea, iris, lens, ciliary body, and retina were negative. All mice exhibited similar staining patterns. All controls were negative. Matrix Gla's restricted expression to glaucoma-associated tissues from anterior and posterior segments suggests its involvement in the development of the disease. Matrix Gla's anticalcification/antistiffness properties in the vascular tissue, together with its high TM and ppCS expression, place this gene as a strong candidate for TM's softness and sclera's stiffness regulation in glaucoma.

Adult exposure to tributyltin affects hypothalamic neuropeptide Y, Y1 receptor distribution, and circulating leptin in mice.

PubMed

Bo, E; Farinetti, A; Marraudino, M; Sterchele, D; Eva, C; Gotti, S; Panzica, G

2016-07-01

Tributyltin (TBT), a pesticide used in antifouling paints, is toxic for aquatic invertebrates. In vertebrates, TBT may act in obesogen- inducing adipogenetic gene transcription for adipocyte differentiation. In a previous study, we demonstrated that acute administration of TBT induces c-fos expression in the arcuate nucleus. Therefore, in this study, we tested the hypothesis that adult exposure to TBT may alter a part of the nervous pathways controlling animal food intake. In particular, we investigated the expression of neuropeptide Y (NPY) immunoreactivity. This neuropeptide forms neural circuits dedicated to food assumption and its action is mediated by Y1 receptors that are widely expressed in the hypothalamic nuclei responsible for the regulation of food intake and energy homeostasis. To this purpose, TBT was orally administered at a dose of 0.025 mg/kg/day/body weight to adult animals [male and female C57BL/6 (Y1-LacZ transgenic mice] for 4 weeks. No differences were found in body weight and fat deposition, but we observed a significant increase in feed efficiency in TBT-treated male mice and a significant decrease in circulating leptin in both sexes. Computerized quantitative analysis of NPY immunoreactivity and Y1-related β-galactosidase activity demonstrated a statistically significant reduction in NPY and Y1 transgene expression in the hypothalamic circuit controlling food intake of treated male mice in comparison with controls. In conclusion, the present results indicate that adult exposure to TBT is profoundly interfering with the nervous circuits involved in the stimulation of food intake. © 2016 American Society of Andrology and European Academy of Andrology.

Local sources of retinoic acid coincide with retinoid-mediated transgene activity during embryonic development.

PubMed Central

Colbert, M C; Linney, E; LaMantia, A S

1993-01-01

We have assessed whether retinoic acid (RA) comes from local sources or is available widely to activate gene expression in embryos. We used an RA-responsive indicator cell line, L-C2A5, to localize RA sources. In these cells, an RA-sensitive promoter/lacZ reporter construct used previously by us to produce indicator transgenic mice is induced globally by RA in medium or locally by RA released at physiological concentrations (1 nM) from AG-1X2 resin beads. Furthermore, the cells are differentially responsive to the 9-cis and all-trans isomers of RA at low concentrations. Indicator transgenic mice with the same promoter/reporter construct were used to identify regions of RA-mediated gene activation. There are distinct domains of lacZ expression in the cervical and lumbar spinal cords of embryonic indicator mice. This pattern might reflect localized RA sources or restricted spatial and temporal expression of RA receptors, binding proteins, or other factors. To resolve this issue we compared the pattern of transgene activation in indicator cell monolayers cocultured with normal embryonic spinal cords with that in transgenic spinal cords. The explants induced reporter gene expression in L-C2A5 monolayers in a pattern identical to that in transgenic mice: alar regions of the cervical and lumbar cord were positive whereas those in the thoracic and sacral regions were not. We conclude that restricted sources of RA in the developing spinal cord mediate the local activation of RA-inducible genes. Thus, region-specific gene activation in embryos can be mediated by precisely localized sources of inductive molecules like RA. Images Fig. 1 Fig. 2 Fig. 3 PMID:8341670

Glucose-Specific Enzyme IIA of the Phosphoenolpyruvate:Carbohydrate Phosphotransferase System Modulates Chitin Signaling Pathways in Vibrio cholerae.

PubMed

Yamamoto, Shouji; Ohnishi, Makoto

2017-09-15

In Vibrio cholerae , the genes required for chitin utilization and natural competence are governed by the chitin-responsive two-component system (TCS) sensor kinase ChiS. In the classical TCS paradigm, a sensor kinase specifically phosphorylates a cognate response regulator to activate gene expression. However, our previous genetic study suggested that ChiS stimulates the non-TCS transcriptional regulator TfoS by using mechanisms distinct from classical phosphorylation reactions (S. Yamamoto, J. Mitobe, T. Ishikawa, S. N. Wai, M. Ohnishi, H. Watanabe, and H. Izumiya, Mol Microbiol 91:326-347, 2014, https://doi.org/10.1111/mmi.12462). TfoS specifically activates the transcription of tfoR , encoding a small regulatory RNA essential for competence gene expression. Whether ChiS and TfoS interact directly remains unknown. To determine if other factors mediate the communication between ChiS and TfoS, we isolated transposon mutants that turned off tfoR :: lacZ expression but possessed intact chiS and tfoS genes. We demonstrated an unexpected association of chitin-induced signaling pathways with the glucose-specific enzyme IIA (EIIA glc ) of the phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) for carbohydrate uptake and catabolite control of gene expression. Genetic and physiological analyses revealed that dephosphorylated EIIA glc inactivated natural competence and tfoR transcription. Chitin-induced expression of the chb operon, which is required for chitin transport and catabolism, was also repressed by dephosphorylated EIIA glc Furthermore, the regulation of tfoR and chb expression by EIIA glc was dependent on ChiS and intracellular levels of ChiS were not affected by disruption of the gene encoding EIIA glc These results define a previously unknown connection between the PTS and chitin signaling pathways in V. cholerae and suggest a strategy whereby this bacterium can physiologically adapt to the existing nutrient status. IMPORTANCE The EIIA glc protein of the PTS coordinates a wide variety of physiological functions with carbon availability. In this report, we describe an unexpected association of chitin-activated signaling pathways in V. cholerae with EIIA glc The signaling pathways are governed by the chitin-responsive TCS sensor kinase ChiS and lead to the induction of chitin utilization and natural competence. We show that dephosphorylated EIIA glc inhibits both signaling pathways in a ChiS-dependent manner. This inhibition is different from classical catabolite repression that is caused by lowered levels of cyclic AMP. This work represents a newly identified connection between the PTS and chitin signaling pathways in V. cholerae and suggests a strategy whereby this bacterium can physiologically adapt to the existing nutrient status. Copyright © 2017 American Society for Microbiology.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Developmental expression of membrane type 4-matrix metalloproteinase (Mt4-mmp/Mmp17) in the mouse embryo

PubMed Central

Clemente, Cristina; Montalvo, María Gregoria; Seiki, Motoharu; Arroyo, Alicia G.

2017-01-01

Matrix metalloproteinases (MMPs) constitute a large group of endoproteases that play important functions during embryonic development, tumor metastasis and angiogenesis by degrading components of the extracellular matrix. Within this family, we focused our study on Mt4-mmp (also called Mmp17) that belongs to a distinct subset that is anchored to the cell surface via a glycosylphosphatidylinositol (GPI) moiety and with the catalytic site exposed to the extracellular space. Information about its function and substrates is very limited to date, and little has been reported on its role in the developing embryo. Here, we report a detailed expression analysis of Mt4-mmp during mouse embryonic development by using a LacZ reporter transgenic mouse line. We showed that Mt4-mmp is detected from early stages of development to postnatal stages following a dynamic and restricted pattern of expression. Mt4-mmp was first detected at E8.5 limited to the intersomitic vascularization, the endocardial endothelium and the dorsal aorta. Mt4-mmpLacZ/+ cells were also observed in the neural crest cells, somites, floor plate and notochord at early stages. From E10.5, expression localized in the limb buds and persists during limb development. A strong expression in the brain begins at E12.5 and continues to postnatal stages. Specifically, staining was observed in the olfactory bulb, cerebral cortex, hippocampus, striatum, septum, dorsal thalamus and the spinal cord. In addition, LacZ-positive cells were also detected during eye development, initially at the hyaloid artery and later on located in the lens and the neural retina. Mt4-mmp expression was confirmed by quantitative RT-PCR and western blot analysis in some embryonic tissues. Our data point to distinct functions for this metalloproteinase during embryonic development, particularly during brain formation, angiogenesis and limb development. PMID:28926609

Regulation of expression and biochemical characterization of a beta-class carbonic anhydrase from the plant growth-promoting rhizobacterium, Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti Nath; Tripathi, Anil K

2009-10-01

Carbonic anhydrase (CA; [EC 4.2.1.1]) is a ubiquitous enzyme catalysing the reversible hydration of CO(2) to bicarbonate, a reaction that supports various biochemical and physiological functions. Genome analysis of Azospirillum brasilense, a nonphotosynthetic, nitrogen-fixing, rhizobacterium, revealed an ORF with homology to beta-class carbonic anhydrases (CAs). Biochemical characteristics of the beta-class CA of A. brasilense, analysed after cloning the gene (designated as bca), overexpressing in Escherichia coli and purifying the protein by affinity purification, revealed that the native recombinant enzyme is a homotetramer, inhibited by the known CA inhibitors. CA activity in A. brasilense cell extracts, reverse transcriptase (RT)-PCR and Western blot analyses showed that bca was constitutively expressed under aerobic conditions. Lower beta-galactosidase activity in A. brasilense cells harbouring bca promoter: lacZ fusion during the stationary phase or during growth on 3% CO(2) enriched air or at acidic pH indicated that the transcription of bca was downregulated by the stationary phase, elevated CO(2) levels and acidic pH conditions. These observations were also supported by RT-PCR analysis. Thus, beta-CA in A. brasilense seems to be required for scavenging CO(2) from the ambient air and the requirement of CO(2) hydration seems to be higher for the cultures growing exponentially at neutral to alkaline pH.

Progressive neurologic and somatic disease in a novel mouse model of human mucopolysaccharidosis type IIIC.

PubMed

Marcó, Sara; Pujol, Anna; Roca, Carles; Motas, Sandra; Ribera, Albert; Garcia, Miguel; Molas, Maria; Villacampa, Pilar; Melia, Cristian S; Sánchez, Víctor; Sánchez, Xavier; Bertolin, Joan; Ruberte, Jesús; Haurigot, Virginia; Bosch, Fatima

2016-09-01

Mucopolysaccharidosis type IIIC (MPSIIIC) is a severe lysosomal storage disease caused by deficiency in activity of the transmembrane enzyme heparan-α-glucosaminide N-acetyltransferase (HGSNAT) that catalyses the N-acetylation of α-glucosamine residues of heparan sulfate. Enzyme deficiency causes abnormal substrate accumulation in lysosomes, leading to progressive and severe neurodegeneration, somatic pathology and early death. There is no cure for MPSIIIC, and development of new therapies is challenging because of the unfeasibility of cross-correction. In this study, we generated a new mouse model of MPSIIIC by targeted disruption of the Hgsnat gene. Successful targeting left LacZ expression under control of the Hgsnat promoter, allowing investigation into sites of endogenous expression, which was particularly prominent in the CNS, but was also detectable in peripheral organs. Signs of CNS storage pathology, including glycosaminoglycan accumulation, lysosomal distension, lysosomal dysfunction and neuroinflammation were detected in 2-month-old animals and progressed with age. Glycosaminoglycan accumulation and ultrastructural changes were also observed in most somatic organs, but lysosomal pathology seemed most severe in liver. Furthermore, HGSNAT-deficient mice had altered locomotor and exploratory activity and shortened lifespan. Hence, this animal model recapitulates human MPSIIIC and provides a useful tool for the study of disease physiopathology and the development of new therapeutic approaches. © 2016. Published by The Company of Biologists Ltd.

periostin Null Mice Exhibit Dwarfism, Incisor Enamel Defects, and an Early-Onset Periodontal Disease-Like Phenotype

PubMed Central

Rios, Hector; Koushik, Shrinagesh V.; Wang, Haiyan; Wang, Jian; Zhou, Hong-Ming; Lindsley, Andrew; Rogers, Rhonda; Chen, Zhi; Maeda, Manabu; Kruzynska-Frejtag, Agnieszka; Feng, Jian Q.; Conway, Simon J.

2005-01-01

Periostin was originally identified as an osteoblast-specific factor and is highly expressed in the embryonic periosteum, cardiac valves, placenta, and periodontal ligament as well as in many adult cancerous tissues. To investigate its role during development, we generated mice that lack the periostin gene and replaced the translation start site and first exon with a lacZ reporter gene. Surprisingly, although periostin is widely expressed in many developing organs, periostin-deficient (perilacZ) embryos are grossly normal. Postnatally, however, ∼14% of the nulls die before weaning and all of the remaining perilacZ nulls are severely growth retarded. Skeletal analysis revealed that trabecular bone in adult homozygous skeletons was sparse, but overall bone growth was unaffected. Furthermore, by 3 months, the nulls develop an early-onset periodontal disease-like phenotype. Unexpectedly, these mice also show a severe incisor enamel defect, although there is no apparent change in ameloblast differentiation. Significantly, placing the perilacZ nulls on a soft diet that alleviated mechanical strain on the periodontal ligament resulted in a partial rescue of both the enamel and periodontal disease-like phenotypes. Combined, these data suggest that a healthy periodontal ligament is required for normal amelogenesis and that periostin is critically required for maintenance of the integrity of the periodontal ligament in response to mechanical stresses. PMID:16314533

The methionine salvage pathway in Bacillus subtilis

PubMed Central

Sekowska, Agnieszka; Danchin, Antoine

2002-01-01

Background Polyamine synthesis produces methylthioadenosine, which has to be disposed of. The cell recycles it into methionine through methylthioribose (MTR). Very little was known about MTR recycling for methionine salvage in Bacillus subtilis. Results Using in silico genome analysis and transposon mutagenesis in B. subtilis we have experimentally uncovered the major steps of the dioxygen-dependent methionine salvage pathway, which, although similar to that found in Klebsiella pneumoniae, recruited for its implementation some entirely different proteins. The promoters of the genes have been identified by primer extension, and gene expression was analyzed by Northern blotting and lacZ reporter gene expression. Among the most remarkable discoveries in this pathway is the role of an analog of ribulose diphosphate carboxylase (Rubisco, the plant enzyme used in the Calvin cycle which recovers carbon dioxide from the atmosphere) as a major step in MTR recycling. Conclusions A complete methionine salvage pathway exists in B. subtilis. This pathway is chemically similar to that in K. pneumoniae, but recruited different proteins to this purpose. In particular, a paralogue or Rubisco, MtnW, is used at one of the steps in the pathway. A major observation is that in the absence of MtnW, MTR becomes extremely toxic to the cell, opening an unexpected target for new antimicrobial drugs. In addition to methionine salvage, this pathway protects B. subtilis against dioxygen produced by its natural biotope, the surface of leaves (phylloplane). PMID:12022921

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.

PubMed

Kim, H; You, S; Foster, L K; Farris, J; Foster, D N

2001-08-23

The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.

Transcriptional regulation of the tad locus in Aggregatibacter actinomycetemcomitans: a termination cascade.

PubMed

Kram, Karin E; Hovel-Miner, Galadriel A; Tomich, Mladen; Figurski, David H

2008-06-01

The tad (tight adherence) locus of Aggregatibacter actinomycetemcomitans includes genes for the biogenesis of Flp pili, which are necessary for bacterial adhesion to surfaces, biofilm formation, and pathogenesis. Although studies have elucidated the functions of some of the Tad proteins, little is known about the regulation of the tad locus in A. actinomycetemcomitans. A promoter upstream of the tad locus was previously identified and shown to function in Escherichia coli. Using a specially constructed reporter plasmid, we show here that this promoter (tadp) functions in A. actinomycetemcomitans. To study expression of the pilin gene (flp-1) relative to that of tad secretion complex genes, we used Northern hybridization analysis and a lacZ reporter assay. We identified three terminators, two of which (T1 and T2) can explain flp-1 mRNA abundance, while the third (T3) is at the end of the locus. T1 and T3 have the appearance and behavior of intrinsic terminators, while T2 has a different structure and is inhibited by bicyclomycin, indicating that T2 is probably Rho dependent. To help achieve the appropriate stoichiometry of the Tad proteins, we show that a transcriptional-termination cascade is important to the proper expression of the tad genes. These data indicate a previously unreported mechanism of regulation in A. actinomycetemcomitans and lead to a more complete understanding of its Flp pilus biogenesis.

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R.

2001-01-01

Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals.

A novel positive transcriptional feedback loop in midbrain-hindbrain boundary development is revealed through analysis of the zebrafish pax2.1 promoter in transgenic lines.

PubMed

Picker, Alexander; Scholpp, Steffen; Böhli, Heike; Takeda, Hiroyuki; Brand, Michael

2002-07-01

The pax2.1 gene encodes a paired-box transcription factor that is one of the earliest genes to be specifically activated in development of the midbrain and midbrain-hindbrain boundary (MHB), and is required for the development and organizer activity of this territory. To understand how this spatially restricted transcriptional activity of pax2.1 is achieved, we have isolated and characterized the pax2.1-promoter using a lacZ and a GFP reporter gene in transient injection assays and transgenic lines. Stable transgenic expression of this reporter gene shows that a 5.3-kb fragment of the 5' region contains most, but not all, elements required for driving pax2.1 expression. The expressing tissues include the MHB, hindbrain, spinal cord, ear and pronephros. Transgene activation in the pronephros and developing ear suggests that these pax2.1-expressing tissues are composed of independently regulated subdomains. In addition, ectopic but spatially restricted activation of the reporter genes in rhombomeres 3 and 5 and in the forebrain, which do not normally express endogenous pax2.1, demonstrates the importance of negative regulation of pax2.1. Comparison of transgene expression in wild-type and homozygous pax2.1 mutant no isthmus (noi) embryos reveals that the transgene contains control element(s) for a novel, positive transcriptional feedback loop in MHB development. Transcription of endogenous pax2.1 at the MHB is known to be initially Pax2.1 independent, during activation in late gastrulation. In contrast, transgene expression requires the endogenous Pax2.1 function. Transplantations, mRNA injections and morpholino knock-down experiments show that this feedback regulation of pax2.1 transcription occurs cell-autonomously, and that it requires eng2 and eng3 as known targets for Pax2.1 regulation. We suggest that this novel feedback loop may allow continuation of pax2.1 expression, and hence development of the MHB organizer, to become independent of the patterning machinery of the gastrula embryo.

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

LKB1, an upstream AMPK kinase, regulates glucose and lipid metabolism in cultured liver and muscle cells.

PubMed

Imai, Kenta; Inukai, Kouichi; Ikegami, Yuichi; Awata, Takuya; Katayama, Shigehiro

2006-12-22

LKB1 is a 50 kDa serine/threonine kinase that phosphorylates and activates the catalytic subunit of AMPK at its T-loop residue Thr 172. We prepared adenoviruses expressing the constitutive active (wild-type) form (CA) or dominant negative (kinase inactive, D194A mutant) form (DN) of LKB1 and overexpressed these proteins in cultured myotubes (C2C12 cells) and rat hepatoma cells (FAO cells). When analyzed by immunoblotting with the antibody against Thr172-phosphorylated AMPK, the phosphorylation of AMPK was increased (2.5-fold) and decreased (0.4-fold) in cells expressing CA and DN LKB1, respectively, as compared with Lac-Z expressing control cells. Immunoprecipitation experiments, using isoform-specific antibody, revealed these alterations of AMPK phosphorylation to be attributable to altered phosphorylation of AMPK alpha2, but not alpha1 catalytic subunits, strongly suggesting the alpha2 catalytic subunit to be the major substrate for LKB1 in mammalian cells. In addition, adiponectin or AICAR-stimulated AMPK phosphorylation was inhibited by overexpression of DN LKB1, while phenformin-stimulated phosphorylation was unaffected. These results may explain the difference in AMPK activation mechanisms between AMP and phenformin, and also indicate that AMPK phosphorylation by LKB1 is involved in AMP-stimulated AMPK activation. As a downstream target for AMPK, AICAR-induced glucose uptake and ACCbeta phosphorylation were found to be significantly reduced in DN LKB1 expressing C2C12 cells. The expression of key enzymes for gluconeogenesis, glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, was also dependent on LKB1 activities in FAO cells. These results demonstrate that LKB1 is a crucial regulator of AMPK activation in muscle and liver cells and, therefore, that LKB1 activity is potentially of importance to our understanding of glucose and lipid metabolism.

Sex-dependent regulation of hypothalamic neuropeptide Y-Y1 receptor gene expression in moderate/high fat, high-energy diet-fed mice

PubMed Central

Zammaretti, Francesca; Panzica, Giancarlo; Eva, Carola

2007-01-01

In this study we investigated whether long-term consumption of a moderate/high fat (MHF), high-energy diet can affect the gene expression of the Y1 receptor (Y1R) for neuropeptide Y (NPY) in the dorsomedial (DMH), ventromedial (VMH), arcuate (ARC) and paraventricular (PVN) hypothalamic nuclei of male and female Y1R/LacZ transgenic mice, carrying the murine Y1R promoter linked to the LacZ gene. MHF diet-fed male mice showed an increased consumption of metabolizable energy that was associated with a significant increase in body weight as compared with chow-fed controls. In parallel, consumption of a MHF diet for 8 weeks significantly decreased Y1R/LacZ transgene expression in the DMH and VMH of male mice whereas no changes were found in the ARC and PVN. Leptin treatment reduced body weight of both MHF diet- and chow-fed male mice but failed to prevent the decrease in Y1R/LacZ transgene expression apparent in the DMH and VMH of male mice after 8 weeks of MHF diet intake. Conversely, no significant changes of metabolizable energy intake, body weight or hypothalamic β-galactosidase expression were found in MHF diet-fed female Y1R/LacZ transgenic mice. A gender-related difference of Y1R/LacZ transgenic mice was also observed in response to leptin treatment that failed to decrease body weight of both MHF diet- and chow-fed female mice. Results herein demonstrate that Y1R/LacZ FVB mice show a sexual dimorphism both on energy intake and on nucleus-specific regulation of the NPY Y1R system in the hypothalamus. Overall, these results provide new insights into the mechanism by which diet composition affects the hypothalamic circuit that controls energy homeostasis. PMID:17584829

Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci

DTIC Science & Technology

1992-07-20

steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as

Distinct signatures for mutator sensitivity of lacZ reversions and for the spectrum of lacI/lacO forward mutations on the chromosome of nondividing Escherichia coli.

PubMed Central

Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J

2004-01-01

A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most likely to be fixed as a mutation if it allows the cell to immediately exit the nondividing state. PMID:15020459

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment

PubMed Central

2013-01-01

Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. Conclusions The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations. PMID:23521820

Differential expression of a BMP4 reporter allele in anterior fungiform versus posterior circumvallate taste buds of mice.

PubMed

Nguyen, Ha M; Barlow, Linda A

2010-10-13

Bone Morphogenetic Protein 4 (BMP4) is a diffusible factor which regulates embryonic taste organ development. However, the role of BMP4 in taste buds of adult mice is unknown. We utilized transgenic mice with LacZ under the control of the BMP4 promoter to reveal the expression of BMP4 in the tongues of adult mice. Further we evaluate the pattern of BMP4 expression with that of markers of specific taste bud cell types and cell proliferation to define and compare the cell populations expressing BMP4 in anterior (fungiform papillae) and posterior (circumvallate papilla) tongue. BMP4 is expressed in adult fungiform and circumvallate papillae, i.e., lingual structures composed of non-taste epithelium and taste buds. Unexpectedly, we find both differences and similarities with respect to expression of BMP4-driven ß-galactosidase. In circumvallate papillae, many fusiform cells within taste buds are BMP4-ß-gal positive. Further, a low percentage of BMP4-expressing cells within circumvallate taste buds is immunopositive for markers of each of the three differentiated taste cell types (I, II and III). BMP4-positive intragemmal cells also expressed a putative marker of immature taste cells, Sox2, and consistent with this finding, intragemmal cells expressed BMP4-ß-gal within 24 hours after their final mitosis, as determined by BrdU birthdating. By contrast, in fungiform papillae, BMP4-ß-gal positive cells are never encountered within taste buds. However, in both circumvallate and fungiform papillae, BMP4-ß-gal expressing cells are located in the perigemmal region, comprising basal and edge epithelial cells adjacent to taste buds proper. This region houses the proliferative cell population that gives rise to adult taste cells. However, perigemmal BMP4-ß-gal cells appear mitotically silent in both fungiform and circumvallate taste papillae, as we do not find evidence of their active proliferation using cell cycle immunomarkers and BrdU birthdating. Our data suggest that intragemmal BMP4-ß-gal cells in circumvallate papillae are immature taste cells which eventually differentiate into each of the 3 taste cell types, whereas perigemmal BMP4-ß-gal cells in both circumvallate and fungiform papillae may be slow cycling stem cells, or belong to the stem cell niche to regulate taste cell renewal from the proliferative cell population.

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

PubMed

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

Glucose uptake in Azotobacter vinelandii occurs through a GluP transporter that is under the control of the CbrA/CbrB and Hfq-Crc systems.

PubMed

Quiroz-Rocha, Elva; Moreno, Renata; Hernández-Ortíz, Armando; Fragoso-Jiménez, Juan Carlos; Muriel-Millán, Luis Felipe; Guzmán, Josefina; Espín, Guadalupe; Rojo, Fernando; Núñez, Cinthia

2017-04-12

Azotobacter vinelandii, a strict aerobic, nitrogen fixing bacterium in the Pseudomonadaceae family, exhibits a preferential use of acetate over glucose as a carbon source. In this study, we show that GluP (Avin04150), annotated as an H + -coupled glucose-galactose symporter, is the glucose transporter in A. vinelandii. This protein, which is widely distributed in bacteria and archaea, is uncommon in Pseudomonas species. We found that expression of gluP was under catabolite repression control thorugh the CbrA/CbrB and Crc/Hfq regulatory systems, which were functionally conserved between A. vinelandii and Pseudomonas species. While the histidine kinase CbrA was essential for glucose utilization, over-expression of the Crc protein arrested cell growth when glucose was the sole carbon source. Crc and Hfq proteins from either A. vinelandii or P. putida could form a stable complex with an RNA A-rich Hfq-binding motif present in the leader region of gluP mRNA. Moreover, in P. putida, the gluP A-rich Hfq-binding motif was functional and promoted translational inhibition of a lacZ reporter gene. The fact that gluP is not widely distributed in the Pseudomonas genus but is under control of the CbrA/CbrB and Crc/Hfq systems demonstrates the relevance of these systems in regulating metabolism in the Pseudomonadaceae family.

Spontaneous gene transfection of human bone cells using 3D mineralized alginate-chitosan macrocapsules.

PubMed

Green, David W; Kim, Eun-Jung; Jung, Han-Sung

2015-09-01

The effectiveness of nonviral gene therapy remains uncertain because of low transfection efficiencies and high toxicities compared with viral-based strategies. We describe a simple system for transient transfection of continuous human cell lines, with low toxicity, using mineral-coated chitosan and alginate capsules. As proof-of-concept, we demonstrate transfection of Saos-2 and MG63 human osteosarcoma continuous cell lines with gfp, LacZ reporter genes, and a Sox-9 carrying plasmid, to illustrate expression of a functional gene with therapeutic relevance. We show that continuous cell lines transfect with significant efficiency of up to 65% possibly through the interplay between chitosan and DNA complexation and calcium/phosphate-induced translocation into cells entrapped within the 3D polysaccharide based environment, as evidenced by an absence of transfection in unmineralized and chitosan-free capsules. We demonstrated that our transfection system was equally effective at transfection of primary human bone marrow stromal cells. To illustrate, the Sox-9, DNA plasmid was spontaneously expressed in primary human bone marrow stromal cells at 7 days with up to 90% efficiency in two repeats. Mineralized polysaccharide macrocapsules are gene delivery vehicles with a number of biological and practical advantages. They are highly efficient at self-transfecting primary bone cells, with programmable spatial and temporal delivery prospects, premineralized bone-like environments, and have no cytotoxic effects, as compared with many other nonviral systems. © 2015 Wiley Periodicals, Inc.

Fetal microchimeric cells in a fetus-treats-its-mother paradigm do not contribute to dystrophin production in serially parous mdx females.

PubMed

Seppanen, Elke Jane; Hodgson, Samantha Susan; Khosrotehrani, Kiarash; Bou-Gharios, George; Fisk, Nicholas M

2012-10-10

Throughout every pregnancy, genetically distinct fetal microchimeric stem/progenitor cells (FMCs) engraft in the mother, persist long after delivery, and may home to damaged maternal tissues. Phenotypically normal fetal lymphoid progenitors have been described to develop in immunodeficient mothers in a fetus-treats-its-mother paradigm. Since stem cells contribute to muscle repair, we assessed this paradigm in the mdx mouse model of Duchenne muscular dystrophy. mdx females were bred serially to either ROSAeGFP males or mdx males to obtain postpartum microchimeras that received either wild-type FMCs or dystrophin-deficient FMCs through serial gestations. To enhance regeneration, notexin was injected into the tibialis anterior of postpartum mice. FMCs were detected by qPCR at a higher frequency in injected compared to noninjected side muscle (P=0.02). However, the number of dystrophin-positive fibers was similar in mothers delivering wild-type compared to mdx pups. In addition, there was no correlation between FMC detection and percentage dystrophin, and no GFP+ve FMCs were identified that expressed dystrophin. In 10/11 animals, GFP+ve FMCs were detected by immunohistochemistry, of which 60% expressed CD45 with 96% outside the basal lamina defining myofiber contours. Finally we confirmed lack of FMC contribution to statellite cells in postpartum mdx females mated with Myf5-LacZ males. We conclude that the FMC contribution to regenerating muscles is insufficient to have a functional impact.

The Molecular Basis of the Response to Radiation

DTIC Science & Technology

1999-07-01

S. cerevisiae and S. pombe ). After PCR amplification of human cDNA libraries as described below, PCR products are analyzed on 4% NuSieve agarose...media lacking uracil as well as counterselected against on media containing uracil and 0.1% 5-fluoroorotic acid (5FOA). Induction of the LacZ gene...evolutionarily distant species (S. cerevisiae andS. pombe ) to develop degenerate PCR based primers. For example, a fission yeast homolog of RAD9 named rhp9 was

The Vibrio parahaemolyticus ToxRS Regulator Is Required for Stress Tolerance and Colonization in a Novel Orogastric Streptomycin-Induced Adult Murine Model

PubMed Central

Whitaker, W. Brian; Parent, Michelle A.; Boyd, Aoife; Richards, Gary P.

2012-01-01

Vibrio parahaemolyticus, a marine bacterium, is the causative agent of gastroenteritis associated with the consumption of seafood. It contains a homologue of the toxRS operon that in V. cholerae is the key regulator of virulence gene expression. We examined a nonpolar mutation in toxRS to determine the role of these genes in V. parahaemolyticus RIMD2210633, an O3:K6 isolate, and showed that compared to the wild type, ΔtoxRS was significantly more sensitive to acid, bile salts, and sodium dodecyl sulfate stresses. We demonstrated that ToxRS is a positive regulator of ompU expression, and that the complementation of ΔtoxRS with ompU restores stress tolerance. Furthermore, we showed that ToxRS also regulates type III secretion system genes in chromosome I via the regulation of the leuO homologue VP0350. We examined the effect of ΔtoxRS in vivo using a new orogastric adult murine model of colonization. We demonstrated that streptomycin-treated adult C57BL/6 mice experienced prolonged intestinal colonization along the entire intestinal tract by the streptomycin-resistant V. parahaemolyticus. In contrast, no colonization occurred in non-streptomycin-treated mice. A competition assay between the ΔtoxRS and wild-type V. parahaemolyticus strains marked with the β-galactosidase gene lacZ demonstrated that the ΔtoxRS strain was defective in colonization compared to the wild-type strain. This defect was rescued by ectopically expressing ompU. Thus, the defect in stress tolerance and colonization in ΔtoxRS is solely due to OmpU. To our knowledge, the orogastric adult murine model reported here is the first showing sustained intestinal colonization by V. parahaemolyticus. PMID:22392925

Active Immunotherapy of Cancer with a Nonreplicating Recombinant Fowlpox Virus Encoding a Model Tumor-Associated Antigen

PubMed Central

Wang, Michael; Bronte, Vincenzo; Chen, Pauline W.; Gritz, Linda; Panicali, Dennis; Rosenberg, Steven A.; Restifo, Nicholas P.

2007-01-01

Some tumor cells express Ags that are potentially recognizable by T lymphocytes and yet do not elicit significant immune responses. To explore new immunotherapeutic strategies aimed at enhancing the recognition of these tumor-associated Ags (TAA), we developed an experimental mouse model consisting of a lethal clone of the BALB/c tumor line CT26 designated CT26.WT, which was transduced with the lacZ gene encoding β-galactosidase, to create CT26.CL25. The growth rate and lethality of CT26.CL25 and CT26.WT were virtually identical despite the expression by CT26.CL25 of the model tumor Ag in vivo. A recombinant fowlpox virus (rFPV), which is replication incompetent in mammalian cells, was constructed that expressed the model TAA, β-galactosidase, under the influence of the 40-kDa vaccinia virus early/late promoter. This recombinant, FPV.bg40k, functioned effectively in vivo as an immunogen, eliciting CD8+ T cells that could effectively lyse CT26.CL25 in vitro. FPV.bg40k protected mice from both subcutaneous and intravenous tumor challenge by CT26.CL25, and most surprisingly, mice bearing established 3-day pulmonary metastasis were found to have significant, Ag-specific decreases in tumor burden and prolonged survival after treatment with the rFPV. These observations constitute the first reported use of rFPV in the prevention and treatment of an experimental cancer and suggest that changing the context in which the immune system encounters a TAA can significantly and therapeutically alter the host immune response against cancer. PMID:7722321

A model system for testing gene vectors using murine tumor cells on the chorioallantoic membrane of the chick embryo.

PubMed

Dani, Sergio U; Espindola, Rachel

2002-06-30

We developed a model system for testing gene vectors, based on the growth of murine tumors on the chorioallantoic membrane (CAM) of embryonic chickens. The ability of selected murine cells to grow on the CAM was rated according to the following criteria: i) formation of tumor masses; ii) metastasis formation; iii) reproducibility; iv) yield, indicated as the number of embryos surviving to assessment time with visible tumors on the CAM; v) maintainability of the cell, both in the original host and the embryonic chick, or 'shuttle maintainability'; vi) detection by the naked eye, and vii) cost/benefit relation. The murine melanoma cell lineage, B16F10, which efficiently forms distinct, pigmented tumor masses and metastases on the CAM, performed better in this model than the murine B61 cell line. In vitro transduction of B16F10 cells with a recombinant adenovirus carrying a construct of the E. coli LacZ gene followed by inoculation onto the CAM resulted in beta-galactosidase expression in the tumor mass growing on the CAM. This model is potentially applicable to preclinical evaluation of gene vectors, especially for gene therapy of cancer.

A multi-scaled approach for simulating chemical reaction systems.

PubMed

Burrage, Kevin; Tian, Tianhai; Burrage, Pamela

2004-01-01

In this paper we give an overview of some very recent work, as well as presenting a new approach, on the stochastic simulation of multi-scaled systems involving chemical reactions. In many biological systems (such as genetic regulation and cellular dynamics) there is a mix between small numbers of key regulatory proteins, and medium and large numbers of molecules. In addition, it is important to be able to follow the trajectories of individual molecules by taking proper account of the randomness inherent in such a system. We describe different types of simulation techniques (including the stochastic simulation algorithm, Poisson Runge-Kutta methods and the balanced Euler method) for treating simulations in the three different reaction regimes: slow, medium and fast. We then review some recent techniques on the treatment of coupled slow and fast reactions for stochastic chemical kinetics and present a new approach which couples the three regimes mentioned above. We then apply this approach to a biologically inspired problem involving the expression and activity of LacZ and LacY proteins in E. coli, and conclude with a discussion on the significance of this work. Copyright 2004 Elsevier Ltd.

In vivo retroviral gene transfer into human bronchial epithelia of xenografts.

PubMed

Engelhardt, J F; Yankaskas, J R; Wilson, J M

1992-12-01

Cystic fibrosis (CF) is the most common lethal inherited disease in the Caucasian population with an incidence of approximately 1 in 2,500 live births. Pulmonary complications of CF, which are the most morbid aspects of the disease, are caused by primary abnormalities in epithelial cells that lead to impaired mucociliary clearance. One potential therapeutic strategy is to reconstitute expression of the CF gene in airway epithelia by somatic gene transfer. To this end, we have developed an animal model of the human airway using bronchial xenografts and have tested the efficiency of in vivo retroviral gene transfer. Using the LacZ reporter gene, we find the efficiency of in vivo retroviral gene transfer to be dramatically dependent on the regenerative and mitotic state of the epithelium. Within an undifferentiated regenerating epithelium in which 40% of nuclei labeled with BrdU, 5-10% retroviral gene transfer was obtained. In contrast, no gene transfer was noted in a fully differentiated epithelium in which 1% of nuclei labeled with BrdU. These findings suggest that retroviral mediated gene transfer to the airway in vivo may be feasible if the proper regenerative state can be induced.

Graded and discontinuous EphA-ephrinB expression patterns in the developing auditory brainstem

PubMed Central

Wallace, Matthew M.; Harris, J. Aaron; Brubaker, Donald Q.; Klotz, Caitlyn A.; Gabriele, Mark L.

2016-01-01

Eph-ephrin interactions guide topographic mapping and pattern formation in a variety of systems. In contrast to other sensory pathways, their precise role in the assembly of central auditory circuits remains poorly understood. The auditory midbrain, or inferior colliculus (IC) is an intriguing structure for exploring guidance of patterned projections as adjacent subdivisions exhibit distinct organizational features. The central nucleus of the IC (CNIC) and deep aspects of its neighboring lateral cortex (LCIC, Layer 3) are tonotopically-organized and receive layered inputs from primarily downstream auditory sources. While less is known about more superficial aspects of the LCIC, its inputs are multimodal, lack a clear tonotopic order, and appear discontinuous, terminating in modular, patch/matrix-like distributions. Here we utilize X-Gal staining approaches in lacZ mutant mice (ephrin-B2, -B3, and EphA4) to reveal EphA-ephrinB expression patterns in the nascent IC during the period of projection shaping that precedes hearing onset. We also report early postnatal protein expression in the cochlear nuclei, the superior olivary complex, the nuclei of the lateral lemniscus, and relevant midline structures. Continuous ephrin-B2 and EphA4 expression gradients exist along frequency axes of the CNIC and LCIC Layer 3. In contrast, more superficial LCIC localization is not graded, but confined to a series of discrete ephrin-B2 and EphA4-positive Layer 2 modules. While heavily expressed in the midline, much of the auditory brainstem is devoid of ephrin-B3, including the CNIC, LCIC Layer 2 modular fields, the dorsal nucleus of the lateral lemniscus (DNLL), as well as much of the superior olivary complex and cochlear nuclei. Ephrin-B3 LCIC expression appears complementary to that of ephrin-B2 and EphA4, with protein most concentrated in presumptive extramodular zones. Described tonotopic gradients and seemingly complementary modular/extramodular patterns suggest Eph-ephrin guidance in establishing juxtaposed continuous and discrete neural maps in the developing IC prior to experience. PMID:26906676

Graded and discontinuous EphA-ephrinB expression patterns in the developing auditory brainstem.

PubMed

Wallace, Matthew M; Harris, J Aaron; Brubaker, Donald Q; Klotz, Caitlyn A; Gabriele, Mark L

2016-05-01

Eph-ephrin interactions guide topographic mapping and pattern formation in a variety of systems. In contrast to other sensory pathways, their precise role in the assembly of central auditory circuits remains poorly understood. The auditory midbrain, or inferior colliculus (IC) is an intriguing structure for exploring guidance of patterned projections as adjacent subdivisions exhibit distinct organizational features. The central nucleus of the IC (CNIC) and deep aspects of its neighboring lateral cortex (LCIC, Layer 3) are tonotopically-organized and receive layered inputs from primarily downstream auditory sources. While less is known about more superficial aspects of the LCIC, its inputs are multimodal, lack a clear tonotopic order, and appear discontinuous, terminating in modular, patch/matrix-like distributions. Here we utilize X-Gal staining approaches in lacZ mutant mice (ephrin-B2, -B3, and EphA4) to reveal EphA-ephrinB expression patterns in the nascent IC during the period of projection shaping that precedes hearing onset. We also report early postnatal protein expression in the cochlear nuclei, the superior olivary complex, the nuclei of the lateral lemniscus, and relevant midline structures. Continuous ephrin-B2 and EphA4 expression gradients exist along frequency axes of the CNIC and LCIC Layer 3. In contrast, more superficial LCIC localization is not graded, but confined to a series of discrete ephrin-B2 and EphA4-positive Layer 2 modules. While heavily expressed in the midline, much of the auditory brainstem is devoid of ephrin-B3, including the CNIC, LCIC Layer 2 modular fields, the dorsal nucleus of the lateral lemniscus (DNLL), as well as much of the superior olivary complex and cochlear nuclei. Ephrin-B3 LCIC expression appears complementary to that of ephrin-B2 and EphA4, with protein most concentrated in presumptive extramodular zones. Described tonotopic gradients and seemingly complementary modular/extramodular patterns suggest Eph-ephrin guidance in establishing juxtaposed continuous and discrete neural maps in the developing IC prior to experience. Copyright © 2016 Elsevier B.V. All rights reserved.

Metameric pattern of intervertebral disc/vertebral body is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somites in the mouse embryo.

PubMed

Takahashi, Yu; Yasuhiko, Yukuto; Takahashi, Jun; Takada, Shinji; Johnson, Randy L; Saga, Yumiko; Kanno, Jun

2013-08-15

The vertebrae are derived from the sclerotome of somites. Formation of the vertebral body involves a process called resegmentation, by which the caudal half of a sclerotome is combined with the rostral half of the next sclerotome. To elucidate the relationship between resegmentation and rostro-caudal patterning of somite, we used the Uncx4.1-LacZ transgene to characterize the resegmentation process. Our observations suggested that in the thoracic and lumbar vertebrae, the Uncx4.1-expressing caudal sclerotome gave rise to the intervertebral disc (IVD) and rostral portion of the vertebral body (VB). In the cervical vertebrae, the Uncx4.1-expressing caudal sclerotome appeared to contribute to the IVD and both caudal and rostral ends of the VB. This finding suggests that the rostro-caudal gene expression boundary does not necessarily coincide with the resegmentation boundary. This conclusion was supported by analyses of Mesp2 KO and Ripply1/2 double KO embryos lacking rostral and caudal properties, respectively. Resegmentation was not observed in Mesp2 KO embryos, but both the IVD and whole VB were formed from the caudalized sclerotome. Expression analysis of IVD marker genes including Pax1 in the wild-type, Mesp2 KO, and Ripply1/2 DKO embryos also supported the idea that a metameric pattern of IVD/VB is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somite. However, in the lumbar region, IVD differentiation appeared to be stimulated by the caudal property and suppressed by the rostral property. Therefore, we propose that rostro-caudal patterning of somites is not a prerequisite for metameric patterning of the IVD and VB, but instead required to stimulate IVD differentiation in the caudal half of the sclerotome. Copyright © 2013 Elsevier Inc. All rights reserved.

Stimulation of glioma cell motility by expression, proteolysis, and release of the L1 neural cell recognition molecule.

PubMed

Yang, Muhua; Adla, Shalini; Temburni, Murali K; Patel, Vivek P; Lagow, Errin L; Brady, Owen A; Tian, Jing; Boulos, Magdy I; Galileo, Deni S

2009-10-29

Malignant glioma cells are particularly motile and can travel diffusely through the brain parenchyma, apparently without following anatomical structures to guide their migration. The neural adhesion/recognition protein L1 (L1CAM; CD171) has been implicated in contributing to stimulation of motility and metastasis of several non-neural cancer types. We explored the expression and function of L1 protein as a stimulator of glioma cell motility using human high-grade glioma surgical specimens and established rat and human glioma cell lines. L1 protein expression was found in 17 out of 18 human high-grade glioma surgical specimens by western blotting. L1 mRNA was found to be present in human U-87/LacZ and rat C6 and 9L glioma cell lines. The glioma cell lines were negative for surface full length L1 by flow cytometry and high resolution immunocytochemistry of live cells. However, fixed and permeablized cells exhibited positive staining as numerous intracellular puncta. Western blots of cell line extracts revealed L1 proteolysis into a large soluble ectodomain (~180 kDa) and a smaller transmembrane proteolytic fragment (~32 kDa). Exosomal vesicles released by the glioma cell lines were purified and contained both full-length L1 and the proteolyzed transmembrane fragment. Glioma cell lines expressed L1-binding alphavbeta5 integrin cell surface receptors. Quantitative time-lapse analyses showed that motility was reduced significantly in glioma cell lines by 1) infection with an antisense-L1 retroviral vector and 2) L1 ectodomain-binding antibodies. Our novel results support a model of autocrine/paracrine stimulation of cell motility in glioma cells by a cleaved L1 ectodomain and/or released exosomal vesicles containing L1. This mechanism could explain the diffuse migratory behavior of high-grade glioma cancer cells within the brain.

Stimulation of glioma cell motility by expression, proteolysis, and release of the L1 neural cell recognition molecule

PubMed Central

Yang, Muhua; Adla, Shalini; Temburni, Murali K; Patel, Vivek P; Lagow, Errin L; Brady, Owen A; Tian, Jing; Boulos, Magdy I; Galileo, Deni S

2009-01-01

Background Malignant glioma cells are particularly motile and can travel diffusely through the brain parenchyma, apparently without following anatomical structures to guide their migration. The neural adhesion/recognition protein L1 (L1CAM; CD171) has been implicated in contributing to stimulation of motility and metastasis of several non-neural cancer types. We explored the expression and function of L1 protein as a stimulator of glioma cell motility using human high-grade glioma surgical specimens and established rat and human glioma cell lines. Results L1 protein expression was found in 17 out of 18 human high-grade glioma surgical specimens by western blotting. L1 mRNA was found to be present in human U-87/LacZ and rat C6 and 9L glioma cell lines. The glioma cell lines were negative for surface full length L1 by flow cytometry and high resolution immunocytochemistry of live cells. However, fixed and permeablized cells exhibited positive staining as numerous intracellular puncta. Western blots of cell line extracts revealed L1 proteolysis into a large soluble ectodomain (~180 kDa) and a smaller transmembrane proteolytic fragment (~32 kDa). Exosomal vesicles released by the glioma cell lines were purified and contained both full-length L1 and the proteolyzed transmembrane fragment. Glioma cell lines expressed L1-binding αvβ5 integrin cell surface receptors. Quantitative time-lapse analyses showed that motility was reduced significantly in glioma cell lines by 1) infection with an antisense-L1 retroviral vector and 2) L1 ectodomain-binding antibodies. Conclusion Our novel results support a model of autocrine/paracrine stimulation of cell motility in glioma cells by a cleaved L1 ectodomain and/or released exosomal vesicles containing L1. This mechanism could explain the diffuse migratory behavior of high-grade glioma cancer cells within the brain. PMID:19874583

Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis.

PubMed

Howery, Kristen E; Clemmer, Katy M; Şimşek, Emrah; Kim, Minsu; Rather, Philip N

2015-08-01

A key regulator of swarming in Proteus mirabilis is the Rcs phosphorelay, which represses flhDC, encoding the master flagellar regulator FlhD4C2. Mutants in rcsB, the response regulator in the Rcs phosphorelay, hyperswarm on solid agar and differentiate into swarmer cells in liquid, demonstrating that this system also influences the expression of genes central to differentiation. To gain a further understanding of RcsB-regulated genes involved in swarmer cell differentiation, transcriptome sequencing (RNA-Seq) was used to examine the RcsB regulon. Among the 133 genes identified, minC and minD, encoding cell division inhibitors, were identified as RcsB-activated genes. A third gene, minE, was shown to be part of an operon with minCD. To examine minCDE regulation, the min promoter was identified by 5' rapid amplification of cDNA ends (5'-RACE), and both transcriptional lacZ fusions and quantitative real-time reverse transcriptase (qRT) PCR were used to confirm that the minCDE operon was RcsB activated. Purified RcsB was capable of directly binding the minC promoter region. To determine the role of RcsB-mediated activation of minCDE in swarmer cell differentiation, a polar minC mutation was constructed. This mutant formed minicells during growth in liquid, produced shortened swarmer cells during differentiation, and exhibited decreased swarming motility. This work describes the regulation and role of the MinCDE cell division system in P. mirabilis swarming and swarmer cell elongation. Prior to this study, the mechanisms that inhibit cell division and allow swarmer cell elongation were unknown. In addition, this work outlines for the first time the RcsB regulon in P. mirabilis. Taken together, the data presented in this study begin to address how P. mirabilis elongates upon contact with a solid surface. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Survival of Escherichia coli, enterococci and Campylobacter jejuni in Canada goose faeces on pasture.

PubMed

Moriarty, E M; Weaver, L; Sinton, L W; Gilpin, B

2012-11-01

Freshly excreted Canada goose faeces pose a public health risk as they contain pathogenic microorganisms. Accordingly, a study was carried out on the growth and survival of resident indicator bacteria (enterococci and Escherichia coli) and inoculated Campylobacter jejuni in freshly excreted faeces over summer and winter. Canada goose faeces were collected, mixed thoroughly and inoculated with 10⁸ g⁻¹ C. jejuni. The faeces were mixed again before making the Canada goose dropping. The simulated goose droppings (N = 70) were placed on pasture, and the concentrations of E. coli, enterococci and the pathogen, C. jejuni, were monitored. In summer only, the molecular marker of E. coli LacZ and the avian-associated bacteria E2 was also monitored. Results of the survival study indicated that significant growth of enterococci and E. coli occurred in summer, before concentrations decreased to less than 15% of the original concentration (day 77) for enterococci and 0.01% for E. coli. LacZ followed a similar pattern to E. coli, while the E2 marker dropped to below 0.1% of the original concentration within 4 days. In winter, enterococci grew slightly, while no growth of E. coli occurred. In both summer and winter, C. jejuni was rapidly inactivated. This research highlights the ability of bacterial indicators to replicate and survive in the environment when harboured by avian faeces, and the limited risk aged Canada goose faeces pose as an environmental source of Campylobacter spp. © 2012 Blackwell Verlag GmbH.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Dual Regulation of the Small RNA MicC and the Quiescent Porin OmpN in Response to Antibiotic Stress in Escherichia coli

PubMed Central

Dam, Sushovan; Pagès, Jean-Marie

2017-01-01

Antibiotic resistant Gram-negative bacteria are a serious threat for public health. The permeation of antibiotics through their outer membrane is largely dependent on porin, changes in which cause reduced drug uptake and efficacy. Escherichia coli produces two major porins, OmpF and OmpC. MicF and MicC are small non-coding RNAs (sRNAs) that modulate the expression of OmpF and OmpC, respectively. In this work, we investigated factors that lead to increased production of MicC. micC promoter region was fused to lacZ, and the reporter plasmid was transformed into E. coli MC4100 and derivative mutants. The response of micC–lacZ to antimicrobials was measured during growth over a 6 h time period. The data showed that the expression of micC was increased in the presence of β-lactam antibiotics and in an rpoE depleted mutant. Interestingly, the same conditions enhanced the activity of an ompN–lacZ fusion, suggesting a dual transcriptional regulation of micC and the quiescent adjacent ompN. Increased levels of OmpN in the presence of sub-inhibitory concentrations of chemicals could not be confirmed by Western blot analysis, except when analyzed in the absence of the sigma factor σE. We suggest that the MicC sRNA acts together with the σE envelope stress response pathway to control the OmpC/N levels in response to β-lactam antibiotics. PMID:29211019

Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III

PubMed Central

Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.

2014-01-01

The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106

Preaxial Polydactyly in Sost/Sostdc1 Double Knockouts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yee, C M; Collette, N M; Loots, G G

2011-07-29

In the United States, {approx}5% are born with congenital birth defects due to abnormal function of cellular processes and interactions. Sclerosteosis, a rare autosomal recessive disease, causes hyperostosis of the axial and appendicular skeleton, and patients present radial deviation, digit syndactyly, nail dysplasia, and overall high bone mineral density. Sclerosteosis is due to a loss of function of sclerostin (Sost). Sost is a Wnt (abbrev.) antagonist; when mutated, nonfunctional Sost results in hyperactive osteoblast activity which leads to abnormal high bone mass. Previous studies have shown that Sost overexpression in transgenic mice causes reduced bone mineral density and a varietymore » of limb phenotypes ranging from lost, fused, and split phalanges. Consistent with clinical manifestations of Sclerosteosis, Sost knockout mice exhibit increased generalized bone mineral density and syndactyly of the digits. Sostdc1 is a paralog of Sost that has also been described as an antagonist of Wnt signaling, in developing tooth buds. Unlike Sost knockouts, Sostdc1 null mice do not display any limb abnormalities. To determine if Sost and Sostdc1 have redundant functions during limb patterning, we examined Sost; Sostdc1 mice determined that they exhibit a novel preaxial polydactyly phenotype with a low penetrance. LacZ staining, skeletal preparations, and in situ hybridization experiments were used to help characterize this novel phenotype and understand how this phenotype develops. We find Sost and Sostdc1 to have complementary expression patterns during limb development, and the loss of their expression alters the transcription of several key limb regulators, such as Fgf8, Shh and Grem.« less

Single-Step Conversion of Cells to Retrovirus Vector Producers with Herpes Simplex Virus–Epstein-Barr Virus Hybrid Amplicons

PubMed Central

Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.

1999-01-01

We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361

Agrobacterium tumefaciens Integrates Transfer DNA into Single Chromosomal Sites of Dimorphic Fungi and Yields Homokaryotic Progeny from Multinucleate Yeast

PubMed Central

Sullivan, Thomas D.; Rooney, Peggy J.; Klein, Bruce S.

2002-01-01

The dimorphic fungi Blastomyces dermatitidis and Histoplasma capsulatum cause systemic mycoses in humans and other animals. Forward genetic approaches to generating and screening mutants for biologically important phenotypes have been underutilized for these pathogens. The plant-transforming bacterium Agrobacterium tumefaciens was tested to determine whether it could transform these fungi and if the fate of transforming DNA was suited for use as an insertional mutagen. Yeast cells from both fungi and germinating conidia from B. dermatitidis were transformed via A. tumefaciens by using hygromycin resistance for selection. Transformation frequencies up to 1 per 100 yeast cells were obtained at high effector-to-target ratios of 3,000:1. B. dermatitidis and H. capsulatum ura5 lines were complemented with transfer DNA vectors expressing URA5 at efficiencies 5 to 10 times greater than those obtained using hygromycin selection. Southern blot analyses indicated that in 80% of transformants the transferred DNA was integrated into chromosomal DNA at single, unique sites in the genome. Progeny of B. dermatitidis transformants unexpectedly showed that a single round of colony growth under hygromycin selection or visible selection of transformants by lacZ expression generated homokaryotic progeny from multinucleate yeast. Theoretical analysis of random organelle sorting suggests that the majority of B. dermatitidis cells would be homokaryons after the ca. 20 generations necessary for colony formation. Taken together, the results demonstrate that A. tumefaciens efficiently transfers DNA into B. dermatitidis and H. capsulatum and has the properties necessary for use as an insertional mutagen in these fungi. PMID:12477790

Role of fimV in type II secretion system-dependent protein secretion of Pseudomonas aeruginosa on solid medium.

PubMed

Michel, Gérard P F; Aguzzi, Anthony; Ball, Geneviève; Soscia, Chantal; Bleves, Sophie; Voulhoux, Romé

2011-07-01

Although classical type II secretion systems (T2SSs) are widely present in Gram-negative bacteria, atypical T2SSs can be found in some species. In Pseudomonas aeruginosa, in addition to the classical T2SS Xcp, it was reported that two genes, xphA and xqhA, located outside the xcp locus were organized in an operon (PaQa) which encodes the orphan PaQa subunit. This subunit is able to associate with other components of the classical Xcp machinery to form a functional hybrid T2SS. In the present study, using a transcriptional lacZ fusion, we found that the PaQa operon was more efficiently expressed (i) on solid LB agar than in liquid LB medium, (ii) at 25 °C than at 37 °C and (iii) at an early stage of growth. These results suggested an adaptation of the hybrid system to particular environmental conditions. Transposon mutagenesis led to the finding that vfr and fimV genes are required for optimal expression of the orphan PaQa operon in the defined growth conditions used. Using an original culturing device designed to monitor secretion on solid medium, the ring-plate system, we found that T2SS-dependent secretion of exoproteins, namely the elastase LasB, was affected in a fimV deletion mutant. Our findings led to the discovery of an interplay between FimV and the global regulator Vfr triggering the modulation of the level of Vfr and consequently the modulation of T2SS-dependent secretion on solid medium.

Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

PubMed

Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

2008-05-02

Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2005-11-28

This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

In vivo marking of spontaneous or vaccine-induced fibrosarcomas in the domestic house cat, using an adenoviral vector containing a bifunctional fusion protein, GAL-TEK.

PubMed

Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N

1995-09-01

We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.

Growth phase-dependent induction of stationary-phase promoters of Escherichia coli in different gram-negative bacteria.

PubMed Central

Miksch, G; Dobrowolski, P

1995-01-01

RSF1010-derived plasmids carrying a fusion of a promoterless lacZ gene with the sigma s-dependent growth phase-regulated promoters of Escherichia coli, bolAp1 and fic, were constructed. The plasmids were mobilized into the gram-negative bacterial species Acetobacter methanolicus, Xanthomonas campestris, Pseudomonas putida, and Rhizobium meliloti. The beta-galactosidase activities of bacterial cultures were determined during exponential and stationary growth phases. Transcriptional activation of the fic promoter in the different bacteria was growth phase dependent as in E. coli and was initiated generally during the transition to stationary phase. The induction of the bolA promoter was also growth phase dependent in the bacteria tested. While the expression in E. coli and R. meliloti was initiated during the transition from exponential to stationary phase, the induction in A. methanolicus, P. putida, and X. campestris started some hours after stationary growth phase was reached. In all the species tested, DNA fragments hybridizing with the rpoS gene of E. coli were detected. The results show that in different gram-negative bacteria, stationary-phase-specific sigma factors which are structurally and functionally homologous to sigma s and are able to recognize the promoter sequences of both bolA and fic exist. PMID:7665531

Metabolic engineering of Escherichia coli to produce 2'-fucosyllactose via salvage pathway of guanosine 5'-diphosphate (GDP)-l-fucose.

PubMed

Chin, Young-Wook; Seo, Nari; Kim, Jae-Han; Seo, Jin-Ho

2016-11-01

2'-Fucosyllactose (2-FL) is one of the key oligosaccharides in human milk. In the present study, the salvage guanosine 5'-diphosphate (GDP)-l-fucose biosynthetic pathway from fucose was employed in engineered Escherichia coli BL21star(DE3) for efficient production of 2-FL. Introduction of the fkp gene coding for fucokinase/GDP-l-fucose pyrophosphorylase (Fkp) from Bacteroides fragilis and the fucT2 gene encoding α-1,2-fucosyltransferase from Helicobacter pylori allows the engineered E. coli to produce 2-FL from fucose, lactose and glycerol. To enhance the lactose flux to 2-FL production, the attenuated, and deleted mutants of β-galactosidase were employed. Moreover, the 2-FL yield and productivity were further improved by deletion of the fucI-fucK gene cluster coding for fucose isomerase (FucI) and fuculose kinase (FucK). Finally, fed-batch fermentation of engineered E. coli BL21star(DE3) deleting lacZ and fucI-fucK, and expressing fkp and fucT2 resulted in 23.1 g/L of extracellular concentration of 2-FL and 0.39 g/L/h productivity. Biotechnol. Bioeng. 2016;113: 2443-2452. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The Transcription Factor Atonal homolog 8 Regulates Gata4 and Friend of Gata-2 during Vertebrate Development

PubMed Central

Rawnsley, David R.; Xiao, Jiping; Lee, John S.; Liu, Xi; Mericko-Ishizuka, Patricia; Kumar, Vinayak; He, Jie; Basu, Arindam; Lu, MinMin; Lynn, Francis C.; Pack, Michael; Gasa, Rosa; Kahn, Mark L.

2013-01-01

GATA and Friend of GATA (FOG) form a transcriptional complex that plays a key role in cardiovascular development in both fish and mammals. In the present study we demonstrate that the basic helix-loop-helix transcription factor Atonal homolog 8 (Atoh8) is required for development of the heart in fish but not in mice. Genetic studies reveal that Atoh8 interacts specifically with Gata4 and Fog1 during development of the heart and swim bladder in the fish. Biochemical studies reveal that ATOH8, GATA4, and FOG2 associate in a single complex in vitro. In contrast to fish, ATOH8-deficient mice exhibit normal cardiac development and loss of ATOH8 does not alter cardiac development in Gata4+/− mice. This species difference in the role of ATOH8 is explained in part by LacZ and GFP reporter alleles that reveal restriction of Atoh8 expression to atrial but not ventricular myocardium in the mouse. Our findings identify ATOH8 as a novel regulator of GATA-FOG function that is required for cardiac development in the fish but not the mouse. Whether ATOH8 modulates GATA-FOG function at other sites or in more subtle ways in mammals is not yet known. PMID:23836893

Disruption of PLZP in mice leads to increased T-lymphocyte proliferation, cytokine production, and altered hematopoietic stem cell homeostasis.

PubMed

Piazza, Francesco; Costoya, José A; Merghoub, Taha; Hobbs, Robin M; Pandolfi, Pier Paolo

2004-12-01

Deregulated function of members of the POK (POZ and Kruppel) family of transcriptional repressors, such as promyelocytic leukemia zinc finger (PLZF) and B-cell lymphoma 6 (BCL-6), plays a critical role in the pathogenesis of acute promyelocytic leukemia (APL) and non-Hodgkin's lymphoma, respectively. PLZP, also known as TZFP, FAZF, or ROG, is a novel POK protein that displays strong homology with PLZF and has been implicated in the pathogenesis of the cancer-predisposing syndrome, Fanconi's anemia, and of APL, in view of its ability to heterodimerize with the FANC-C and PLZF proteins, respectively. Here we report the generation and characterization of mice in which we have specifically inactivated the PLZP gene through in-frame insertion of a lacZ reporter and without perturbing the expression of the neighboring MLL2 gene. We show that PLZP-deficient mice display defects in cell cycle control and cytokine production in the T-cell compartment. Importantly, PLZP inactivation perturbs the homeostasis of the hematopoietic stem and/or progenitor cell. On the basis of our data, a deregulation of PLZP function in Fanconi's anemia and APL may affect the biology of the hematopoietic stem cell, in turn contributing to the pathogenesis of these disorders.

The retrograde delivery of adenovirus vector carrying the gene for brain-derived neurotrophic factor protects neurons and oligodendrocytes from apoptosis in the chronically compressed spinal cord of twy/twy mice.

PubMed

Uchida, Kenzo; Nakajima, Hideaki; Hirai, Takayuki; Yayama, Takafumi; Chen, Kebing; Guerrero, Alexander Rodriguez; Johnson, William Eustace; Baba, Hisatoshi

2012-12-15

The twy/twy mouse undergoes spontaneous chronic mechanical compression of the spinal cord; this in vivo model system was used to examine the effects of retrograde adenovirus (adenoviral vector [AdV])-mediated brain-derived neurotrophic factor (BDNF) gene delivery to spinal neural cells. To investigate the targeting and potential neuroprotective effect of retrograde AdV-mediated BDNF gene transfection in the chronically compressed spinal cord in terms of prevention of apoptosis of neurons and oligodendrocytes. Several studies have investigated the neuroprotective effects of neurotrophins, including BDNF, in spinal cord injury. However, no report has described the effects of retrograde neurotrophic factor gene delivery in compressed spinal cords, including gene targeting and the potential to prevent neural cell apoptosis. AdV-BDNF or AdV-LacZ (as a control gene) was injected into the bilateral sternomastoid muscles of 18-week old twy/twy mice for retrograde gene delivery via the spinal accessory motor neurons. Heterozygous Institute of Cancer Research mice (+/twy), which do not undergo spontaneous spinal compression, were used as a control for the effects of such compression on gene delivery. The localization and cell specificity of β-galactosidase expression (produced by LacZ gene transfection) and BDNF expression in the spinal cord were examined by coimmunofluorescence staining for neural cell markers (NeuN, neurons; reactive immunology protein, oligodendrocytes; glial fibrillary acidic protein, astrocytes; OX-42, microglia) 4 weeks after gene injection. The possible neuroprotection afforded by retrograde AdV-BDNF gene delivery versus AdV-LacZ-transfected control mice was assessed by scoring the prevalence of apoptotic cells (terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-positive cells) and immunoreactivity to active caspases -3, -8, and -9, p75, neurofilament 200 kD (NF), and for the oligodendroglial progenitor marker, NG2. RESULTS.: Four weeks after injection, the retrograde delivery of the LacZ marker gene was identified in cervical spinal neurons and some glial cells, including oligodendrocytes in the white matter of the spinal cord, in both the twy/twy mouse and the heterozygous Institute of Cancer Research mouse (+/twy). In the compressed spinal cord of twy/twy mouse, AdV-BDNF gene transfection resulted in a significant decrease in the number of terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-positive cells present in the spinal cord and a downregulation in the caspase apoptotic pathway compared with AdV-LacZ (control) gene transfection. There was a marked and significant increase in the areas of the spinal cord of AdV-BDNF-injected mice that were NF- and NG2-immunopositive compared with AdV-LacZ-injected mice, indicating the increased presence of neurons and oligodendrocytes in response to BDNF transfection. Our results demonstrate that targeted retrograde BDNF gene delivery suppresses apoptosis in neurons and oligodendrocytes in the chronically compressed spinal cord of twy/twy mouse. Further work is required to establish whether this method of gene delivery may provide neuroprotective effects in other situations of compressive spinal cord injury.

Audiogenic seizure activity following HSV-1 GAD65 sense or antisense injection into inferior colliculus of Long-Evans rat.

PubMed

Coleman, James R; Thompson, Karen C; Wilson, Marlene A; Wilson, Steven P

2017-06-01

Herpes virus technology involving manipulation of GAD65 was used to study effects on audiogenic seizures (AGS). Audiogenic seizure behaviors were examined following injections of replication-defective herpes simplex virus (HSV-1) vectors incorporating sense or antisense toward GAD65 along with 10% lac-Z into the central nucleus of inferior colliculus (CNIC) of Long-Evans rats. In seizure-sensitive animals developmentally primed by intense sound exposure, injection of GAD65 in the sense orientation increased wild running latencies and reduced incidence of clonus compared with lac-Z only, unoperated, and vehicle seizure groups. In contrast, infection of CNIC with GAD65 antisense virus resulted in 100% incidence of wild running and clonus behaviors in AGS animals. Unprimed animals not operated continued to show uniform absence of seizure activity. Administration of GAD65 antisense virus into CNIC produced novel wild running and clonus behaviors in some unprimed animals. Staining for β-galactosidase in all vector animals revealed no differences in pattern or numbers of immunoreactive cells at injection sites. Qualitatively, typical small and medium multipolar/stellate and medium fusiform neurons appeared in the CNIC of vector animals. These results demonstrate that HSV-1 vector constructs implanted into the CNIC can predictably influence incidence and severity of AGS and suggest that viral vectors can be useful in studying GABA mechanisms with potential for therapeutic application in epilepsy. This article is part of a Special Issue entitled "Genetic and Reflex Epilepsies, Audiogenic Seizures and Strains: From Experimental Models to the Clinic". Copyright © 2016 Elsevier Inc. All rights reserved.

Cartilage constructs engineered from chondrocytes overexpressing IGF-I improve the repair of osteochondral defects in a rabbit model.

PubMed

Madry, H; Kaul, G; Zurakowski, D; Vunjak-Novakovic, G; Cucchiarini, M

2013-04-16

Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes overexpressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-overexpressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects.

Molecular method for detection of total coliforms in drinking water samples.

PubMed

Maheux, Andrée F; Boudreau, Dominique K; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G; Rodriguez, Manuel J

2014-07-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Molecular Method for Detection of Total Coliforms in Drinking Water Samples

PubMed Central

Boudreau, Dominique K.; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G.; Rodriguez, Manuel J.

2014-01-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. PMID:24771030

Intrapleural Adenoviral Delivery of Human Plasminogen Activator Inhibitor–1 Exacerbates Tetracycline-Induced Pleural Injury in Rabbits

PubMed Central

Karandashova, Sophia; Florova, Galina; Azghani, Ali O.; Komissarov, Andrey A.; Koenig, Kathy; Tucker, Torry A.; Allen, Timothy C.; Stewart, Kris; Tvinnereim, Amy

2013-01-01

Elevated concentrations of plasminogen activator inhibitor–1 (PAI-1) are associated with pleural injury, but its effects on pleural organization remain unclear. A method of adenovirus-mediated delivery of genes of interest (expressed under a cytomegalovirus promoter) to rabbit pleura was developed and used with lacZ and human (h) PAI-1. Histology, β-galactosidase staining, Western blotting, enzymatic and immunohistochemical analyses of pleural fluids (PFs), lavages, and pleural mesothelial cells were used to evaluate the efficiency and effects of transduction. Transduction was selective and limited to the pleural mesothelial monolayer. The intrapleural expression of both genes was transient, with their peak expression at 4 to 5 days. On Day 5, hPAI-1 (40–80 and 200–400 nM of active and total hPAI-1 in lavages, respectively) caused no overt pleural injury, effusions, or fibrosis. The adenovirus-mediated delivery of hPAI-1 with subsequent tetracycline-induced pleural injury resulted in a significant exacerbation of the pleural fibrosis observed on Day 5 (P = 0.029 and P = 0.021 versus vehicle and adenoviral control samples, respectively). Intrapleural fibrinolytic therapy (IPFT) with plasminogen activators was effective in both animals overexpressing hPAI-1 and control animals with tetracycline injury alone. An increase in intrapleural active PAI-1 (from 10–15 nM in control animals to 20–40 nM in hPAI-1–overexpressing animals) resulted in the increased formation of PAI-1/plasminogen activator complexes in vivo. The decrease in intrapleural plasminogen-activating activity observed at 10 to 40 minutes after IPFT correlates linearly with the initial concentration of active PAI-1. Therefore, active PAI-1 in PFs affects the outcome of IPFT, and may be both a biomarker of pleural injury and a molecular target for its treatment. PMID:23002099

Myocardial deletion of transcription factor CHF1/Hey2 results in altered myocyte action potential and mild conduction system expansion but does not alter conduction system function or promote spontaneous arrhythmias.

PubMed

Hartman, Matthew E; Liu, Yonggang; Zhu, Wei-Zhong; Chien, Wei-Ming; Weldy, Chad S; Fishman, Glenn I; Laflamme, Michael A; Chin, Michael T

2014-07-01

CHF1/Hey2 is a Notch-responsive basic helix-loop-helix transcription factor involved in cardiac development. Common variants in Hey2 are associated with Brugada syndrome. We hypothesized that absence of CHF1/Hey2 would result in abnormal cellular electrical activity, altered cardiac conduction system (CCS) development, and increased arrhythmogenesis. We isolated neonatal CHF/Hey2-knockout (KO) cardiac myocytes and measured action potentials and ion channel subunit gene expression. We also crossed myocardial-specific CHF1/Hey2-KO mice with cardiac conduction system LacZ reporter mice and stained for conduction system tissue. We also performed ambulatory ECG monitoring for arrhythmias and heart rate variability. Neonatal cardiomyocytes from CHF1/Hey2-KO mice demonstrate a 50% reduction in action potential dV/dT, a 50-75% reduction in SCN5A, KCNJ2, and CACNA1C ion channel subunit gene expression, and an increase in delayed afterdepolarizations from 0/min to 12/min. CHF1/Hey2 cKO CCS-lacZ mice have a ∼3-fold increase in amount of CCS tissue. Ambulatory ECG monitoring showed no difference in cardiac conduction, arrhythmias, or heart rate variability. Wild-type cells or animals were used in all experiments. CHF1/Hey2 may contribute to Brugada syndrome by influencing the expression of SCN5A and formation of the cardiac conduction system, but its absence does not cause baseline conduction defects or arrhythmias in the adult mouse.-Hartman, M. E., Liu, Y., Zhu, W.-Z., Chien, W.-M., Weldy, C. S., Fishman, G. I., Laflamme, M. A., Chin, M. T. Myocardial deletion of transcription factor CHF1/Hey2 results in altered myocyte action potential and mild conduction system expansion but does not alter conduction system function or promote spontaneous arrhythmias. © FASEB.

Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.

PubMed Central

Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G

1992-01-01

opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590

Enhanced Fluorescent Siderophore Biosynthesis and Loss of Phenazine-1-Carboxamide in Phenotypic Variant of Pseudomonas chlororaphis HT66.

PubMed

Liu, Yang; Wang, Zheng; Bilal, Muhammad; Hu, Hongbo; Wang, Wei; Huang, Xianqing; Peng, Huasong; Zhang, Xuehong

2018-01-01

Pseudomonas chlororaphis HT66 is a plant-beneficial bacterium that exhibits wider antagonistic spectrum against a variety of plant pathogenic fungi due to its main secondary metabolite, i.e., phenazine-1-carboxamide (PCN). In the present study, a spontaneous phenotypic variant designated as HT66-FLUO was isolated from the fermentation process of wild-type HT66 strain. The newly isolated phenotypic variant was morphologically distinct from the wild-type strain such as larger cell size, semi-transparent, non-production of PCN (Green or yellow crystals) and enhanced fluorescence under UV light. The whole-genome, RNA-sequencing, and phenotypic assays were performed to identify the reason of phenotypic variation in HT66-FLUO as compared to the HT66. Transcriptomic analysis revealed that 1,418 genes, representing approximately 22% of the 6393 open reading frames (ORFs) had undergone substantial reprogramming of gene expression in the HT66-FLUO. The whole-genome sequence indicated no gene alteration in HT66-FLUO as compared to HT66 according to the known reference sequence. The levels of global regulatory factor gacA and gacS expression were not significantly different between HT66 and HT66-FLUO. It was observed that overexpressing gacS rather than gacA in HT66-FLUO can recover switching of the variant to HT66. The β-galactosidase ( LacZ ) activity and qRT-PCR results indicate the downregulated expression of rsmX, rsmY , and rsmZ in HT66-FLUO as compared to HT66. Overexpressing three small RNAs in HT66-FLUO can revert switching of colony phenotype toward wild-type HT66 up to a certain degree, restore partial PCN production and reduces the fluorescent siderophores yield. However, the origin of the spontaneous phenotypic variant was difficult to be determined. In conclusion, this study helps to understand the gene regulatory effect in the spontaneous phenotypic variant.

Expression of a novel gene, gluP, is essential for normal Bacillus subtilis cell division and contributes to glucose export

PubMed Central

Mesak, Lili R; Mesak, Felix M; Dahl, Michael K

2004-01-01

Background The Bacillus subtilis glucokinase operon was predicted to be comprised of the genes, yqgP (now named gluP), yqgQ, and glcK. We have previously established a role for glcK in glucose metabolism. In the absence of enzymes that phosphorylate glucose, such as GlcK and/or enzyme IIGlc, accumulated cytoplasmic glucose can be transported out of the cell. Genes within the glucokinase operon were not previously known to play a role in glucose transport. Here we describe the expression of gluP and its function in glucose transport. Results We found that transcription of the glucokinase operon was regulated, putatively, by two promoters: σA and σH. Putative σA and σH-recognition sites were located upstream of and within gluP, respectively. Transcriptional glucokinase operon – lacZ fusions and Northern blotting were used to analyze the expression of gluP. GluP was predicted to be an integral membrane protein. Moreover, the prediction of GluP structure revealed interesting signatures: a rhomboid domain and two tetracopeptide repeat (TPR) motifs. Microscopic analysis showed that GluP minus cells were unable to divide completely, resulting in a filamentous phenotype. The cells were grown in either rich or minimal medium. We found GluP may be involved in glucose transport. [14C]-glucose uptake by the GluP minus strain was slightly less than in the wild type. On the other hand, trehalose-derived glucose in the growth medium of the GluP minus strain was detected in very low amounts. Experimental controls comprised of single or multiple genes mutations within the glucose transporting phosphotransferase system. Conclusions gluP seems to be regulated only by a putative σA-dependent promoter. The glucose uptake and export assays suggest that GluP is important for glucose export and may act as an exporter. This also supports the role of the glucokinase operon in glucose utilization. PMID:15050034

Enhanced Fluorescent Siderophore Biosynthesis and Loss of Phenazine-1-Carboxamide in Phenotypic Variant of Pseudomonas chlororaphis HT66

PubMed Central

Liu, Yang; Wang, Zheng; Bilal, Muhammad; Hu, Hongbo; Wang, Wei; Huang, Xianqing; Peng, Huasong; Zhang, Xuehong

2018-01-01

Pseudomonas chlororaphis HT66 is a plant-beneficial bacterium that exhibits wider antagonistic spectrum against a variety of plant pathogenic fungi due to its main secondary metabolite, i.e., phenazine-1-carboxamide (PCN). In the present study, a spontaneous phenotypic variant designated as HT66-FLUO was isolated from the fermentation process of wild-type HT66 strain. The newly isolated phenotypic variant was morphologically distinct from the wild-type strain such as larger cell size, semi-transparent, non-production of PCN (Green or yellow crystals) and enhanced fluorescence under UV light. The whole-genome, RNA-sequencing, and phenotypic assays were performed to identify the reason of phenotypic variation in HT66-FLUO as compared to the HT66. Transcriptomic analysis revealed that 1,418 genes, representing approximately 22% of the 6393 open reading frames (ORFs) had undergone substantial reprogramming of gene expression in the HT66-FLUO. The whole-genome sequence indicated no gene alteration in HT66-FLUO as compared to HT66 according to the known reference sequence. The levels of global regulatory factor gacA and gacS expression were not significantly different between HT66 and HT66-FLUO. It was observed that overexpressing gacS rather than gacA in HT66-FLUO can recover switching of the variant to HT66. The β-galactosidase (LacZ) activity and qRT-PCR results indicate the downregulated expression of rsmX, rsmY, and rsmZ in HT66-FLUO as compared to HT66. Overexpressing three small RNAs in HT66-FLUO can revert switching of colony phenotype toward wild-type HT66 up to a certain degree, restore partial PCN production and reduces the fluorescent siderophores yield. However, the origin of the spontaneous phenotypic variant was difficult to be determined. In conclusion, this study helps to understand the gene regulatory effect in the spontaneous phenotypic variant. PMID:29740409

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

Incudomalleal joint formation: the roles of apoptosis, migration and downregulation

PubMed Central

Amin, Susan; Matalova, Eva; Simpson, Carol; Yoshida, Hiroki; Tucker, Abigail S

2007-01-01

Background The middle ear of mammals is composed of three endochondrial ossicles, the stapes, incus and malleus. Joints link the malleus to the incus and the incus to the stapes. In the mouse the first arch derived malleus and incus are formed from a single Sox9 and Type II collagen expressing condensation that later subdivides to give rise to two separate ossicles. In contrast the stapes forms from a separate condensation derived from the second branchial arch. Fusion of the malleus and incus is observed in a number of human syndromes and results in conductive hearing loss. Understanding how this joint forms during normal development is thus an important step in furthering our understanding of such defects. Results We show that the developing incudomalleal joint is characterised by a lack of proliferation and discrete areas of apoptosis. Apoptosis has been suggested to aid in the removal of pre-cartilaginous cells from the joint region, allowing for the physical separation of the cartilaginous elements, however, we show that joint initiation is unaffected by blocking apoptosis. There is also no evidence of cell migration out of the presumptive joint region, as observed by labelling of joint and ossicle cells in culture. Using Type II collagen lacZ reporter mice, however, it is evident that cells in the presumptive joint region remain in place and downregulate cartilage markers. Conclusion The malleus and incus first appear as a single united condensation expressing early cartilage markers. The incudomalleal joint region forms by cells in the presumptive joint region switching off cartilage markers and turning on joint markers. Failure in this process may result in fusion of this joint, as observed in human syndromes such as Branchio-Oto-Renal Syndrome or Treacher Collins Syndrome. PMID:18053235

Adenovirus-mediated gene delivery to hypothalamic magnocellular neurons in mice

NASA Technical Reports Server (NTRS)

Vasquez, E. C.; Beltz, T. G.; Meyrelles, S. S.; Johnson, A. K.

1999-01-01

Vasopressin is synthesized by magnocellular neurons in supraoptic (SON) and paraventricular (PVN) hypothalamic nuclei and released by their axon terminals in the neurohypophysis (NH). With its actions as an antidiuretic hormone and vasoactive agent, vasopressin plays a pivotal role in the control of body fluids and cardiovascular homeostasis. Because of its well-defined neurobiology and functional importance, the SON/PVN-NH system is ideal to establish methods for gene transfer of genetic material into specific pathways in the mouse central nervous system. In these studies, we compared the efficiency of transferring the gene lacZ, encoding for beta-galactosidase (beta-gal), versus a gene encoding for green fluorescent protein by using replication-deficient adenovirus (Ad) vectors in adult mice. Transfection with viral concentrations up to 2 x 10(7) plaque-forming units per coverslip of NH, PVN, and SON in dissociated, cultured cells caused efficient transfection without cytotoxicity. However, over an extended period of time, higher levels (50% to 75% of the cells) of beta-gal expression were detected in comparison with green fluorescent protein (5% to 50% of the cells). With the use of a stereotaxic approach, the pituitary glands of mice were injected with Ad (4 x 10(6) plaque-forming units). In material from these animals, we were able to visualize the expression of the beta-gal gene in the NH and in magnocellular neurons of both the PVN and SON. The results of these experiments indicate that Ad-Rous sarcoma virus promoter-beta-gal is taken up by nerve terminals at the injection site (NH) and retrogradely transported to the soma of the neurons projecting to the NH. We conclude that the application of these experimental approaches will provide powerful tools for physiological studies and potential approaches to deliver therapeutic genes to treat diseases.

Neointimal hyperplasia on a cell-seeded polytetrafluoroethylene graft is promoted by transfer of tissue plasminogen activator gene and inhibited by transfer of nitric oxide synthase gene.

PubMed

Yu, Hong; Dai, Wangde; Yang, Zhe; Romaguera, Rita L; Kirkman, Paul; Rowe, Vincent L

2005-01-01

The objective of this study was to examine the effect of tissue plasminogen activator (tPA) and endothelial nitric oxide synthase (eNOS) on thrombosis and neointimal hyperplasia on a polytetrafluoroethylene (PTFE) graft seeded with smooth muscle cells (SMCs). SMCs retrovirally transduced with tPA and eNOS genes were seeded on PTFE grafts and then implanted into the infrarenal rabbit aorta. Thrombosis and neointimal hyperplasia on the grafts were examined after 30 and 100 days of implantation. At 30 days of implantation, thrombus was observed on the luminal surface of both unseeded and SMC seeded control grafts, whereas grafts seeded with SMCs secreting tPA were nearly free of thrombus. At 100 days, the neointima on grafts seeded with tPA transduced SMCs was significantly thicker (925 +/- 150 microm, n = 5) than neointima on the other grafts (range, 132 to 374 microm; P < .001). Neointima thickness on grafts seeded with eNOS transduced SMCs (154 +/- 27 microm) was similar to that of unseeded grafts (132 +/- 16 microm, P > .05); both were thinner than those on grafts seeded with SMCs transduced with only lacZ gene (287 +/- 35 microm). The ratio of seeded cells in the neointima was significantly higher on SMC/tPA grafts (46% +/- 8%) than SMC/NOS grafts (21% +/- 6%, P < .05), indicating tPA transduced cells proliferated more than eNOS transduced cells. Engineered tPA expression in seeded SMCs causes significantly more neointimal hyperplasia, despite the favorable inhibition of luminal thrombus. eNOS expression in the seeded cells inhibits neointimal hyperplasia.

Improved graft mesenchymal stem cell survival in ischemic heart with a hypoxia-regulated heme oxygenase-1 vector.

PubMed

Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

2005-10-04

The goal of this study was to modify mesenchymal stem cells (MSCs) cells with a hypoxia-regulated heme oxygenase-1 (HO-1) plasmid to enhance the survival of MSCs in acute myocardial infarction (MI) heart. Although stem cells are being tested clinically for cardiac repair, graft cells die in the ischemic heart because of the effects of hypoxia/reoxygenation, inflammatory cytokines, and proapoptotic factors. Heme oxygenase-1 is a key component in inhibiting most of these factors. Mesenchymal stem cells from bone marrow were transfected with either HO-1 or LacZ plasmids. Cell apoptosis was assayed in vitro after hypoxia-reoxygen treatment. In vivo, 1 x 10(6) of male MSC(HO-1), MSC(LacZ), MSCs, or medium was injected into mouse hearts 1 h after MI (n = 16/group). Cell survival was assessed in a gender-mismatched transplantation model. Apoptosis, left ventricular remodeling, and cardiac function were tested in a gender-matched model. In the ischemic myocardium, the MSC(HO-1) group had greater expression of HO-1 and a 2-fold reduction in the number of terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end labeling-positive cells compared with the MSC(LacZ) group. At seven days after implantation, the survival MSC(HO-1) was five-fold greater than the MSC(LacZ) group; MSC(HO-1) also attenuated left ventricular remodeling and enhanced the functional recovery of infarcted hearts two weeks after MI. A hypoxia-regulated HO-1 vector modification of MSCs enhances the tolerance of engrafted MSCs to hypoxia-reoxygen injury in vitro and improves their viability in ischemic hearts. This demonstration is the first showing that a physiologically inducible vector expressing of HO-1 genes improves the survival of stem cells in myocardial ischemia.

A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo.

PubMed

Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian

2005-12-01

The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

Implantation of Vascular Grafts Lined with Genetically Modified Endothelial Cells

NASA Astrophysics Data System (ADS)

Wilson, James M.; Birinyi, Louis K.; Salomon, Robert N.; Libby, Peter; Callow, Allan D.; Mulligan, Richard C.

1989-06-01

The possibility of using the vascular endothelial cell as a target for gene replacement therapy was explored. Recombinant retroviruses were used to transduce the lacZ gene into endothelial cells harvested from mongrel dogs. Prosthetic vascular grafts seeded with the genetically modified cells were implanted as carotid interposition grafts into the dogs from which the original cells were harvested. Analysis of the graft 5 weeks after implantation revealed genetically modified endothelial cells lining the luminal surface of the graft. This technology could be used in the treatment of atherosclerosis disease and the design of new drug delivery systems.

Detection of Protein Interactions in T3S Systems Using Yeast Two-Hybrid Analysis.

PubMed

Nilles, Matthew L

2017-01-01

Two-hybrid systems, sometimes termed interaction traps, are genetic systems designed to find and analyze interactions between proteins. The most common systems are yeast based (commonly Saccharomyces cerevisae) and rely on the functional reconstitution of the GAL4 transcriptional activator. Reporter genes, such as the lacZ gene of Escherichia coli (encodes β-galactosidase), are placed under GAL4-dependent transcriptional control to provide quick and reliable detection of protein interactions. In this method the use of a yeast-based two-hybrid system is described to study protein interactions between components of type III secretion systems.

To Be or Not To Be a Poly(3-Hydroxybutyrate) (PHB) Depolymerase: PhaZd1 (PhaZ6) and PhaZd2 (PhaZ7) of Ralstonia eutropha, Highly Active PHB Depolymerases with No Detectable Role in Mobilization of Accumulated PHB

PubMed Central

Sznajder, Anna

2014-01-01

The putative physiological functions of two related intracellular poly(3-hydroxybutyrate) (PHB) depolymerases, PhaZd1 and PhaZd2, of Ralstonia eutropha H16 were investigated. Purified PhaZd1 and PhaZd2 were active with native PHB granules in vitro. Partial removal of the proteinaceous surface layer of native PHB granules by trypsin treatment or the use of PHB granules isolated from ΔphaP1 or ΔphaP1-phaP5 mutant strains resulted in increased specific PHB depolymerase activity, especially for PhaZd2. Constitutive expression of PhaZd1 or PhaZd2 reduced or even prevented the accumulation of PHB under PHB-permissive conditions in vivo. Expression of translational fusions of enhanced yellow fluorescent protein (EYFP) with PhaZd1 and PhaZd2 in which the active-site serines (S190 and Ser193) were replaced with alanine resulted in the colocalization of only PhaZd1 fusions with PHB granules. C-terminal fusions of inactive PhaZd2(S193A) with EYFP revealed the presence of spindle-like structures, and no colocalization with PHB granules was observed. Chromosomal deletion of phaZd1, phaZd2, or both depolymerase genes had no significant effect on PHB accumulation and mobilization during growth in nutrient broth (NB) or NB-gluconate medium. Moreover, neither proteome analysis of purified native PHB granules nor lacZ fusion studies gave any indication that PhaZd1 or PhaZd2 was detectably present in the PHB granule fraction or expressed at all during growth on NB-gluconate medium. In conclusion, PhaZd1 and PhaZd2 are two PHB depolymerases with a high capacity to degrade PHB when artificially expressed but are apparently not involved in PHB mobilization in the wild type. The true in vivo functions of PhaZd1 and PhaZd2 remain obscure. PMID:24907326

To be or not to be a poly(3-hydroxybutyrate) (PHB) depolymerase: PhaZd1 (PhaZ6) and PhaZd2 (PhaZ7) of Ralstonia eutropha, highly active PHB depolymerases with no detectable role in mobilization of accumulated PHB.

PubMed

Sznajder, Anna; Jendrossek, Dieter

2014-08-01

The putative physiological functions of two related intracellular poly(3-hydroxybutyrate) (PHB) depolymerases, PhaZd1 and PhaZd2, of Ralstonia eutropha H16 were investigated. Purified PhaZd1 and PhaZd2 were active with native PHB granules in vitro. Partial removal of the proteinaceous surface layer of native PHB granules by trypsin treatment or the use of PHB granules isolated from ΔphaP1 or ΔphaP1-phaP5 mutant strains resulted in increased specific PHB depolymerase activity, especially for PhaZd2. Constitutive expression of PhaZd1 or PhaZd2 reduced or even prevented the accumulation of PHB under PHB-permissive conditions in vivo. Expression of translational fusions of enhanced yellow fluorescent protein (EYFP) with PhaZd1 and PhaZd2 in which the active-site serines (S190 and Ser193) were replaced with alanine resulted in the colocalization of only PhaZd1 fusions with PHB granules. C-terminal fusions of inactive PhaZd2(S193A) with EYFP revealed the presence of spindle-like structures, and no colocalization with PHB granules was observed. Chromosomal deletion of phaZd1, phaZd2, or both depolymerase genes had no significant effect on PHB accumulation and mobilization during growth in nutrient broth (NB) or NB-gluconate medium. Moreover, neither proteome analysis of purified native PHB granules nor lacZ fusion studies gave any indication that PhaZd1 or PhaZd2 was detectably present in the PHB granule fraction or expressed at all during growth on NB-gluconate medium. In conclusion, PhaZd1 and PhaZd2 are two PHB depolymerases with a high capacity to degrade PHB when artificially expressed but are apparently not involved in PHB mobilization in the wild type. The true in vivo functions of PhaZd1 and PhaZd2 remain obscure. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

PubMed

Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

1998-03-01

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

Intestinal stem cells remain viable after prolonged tissue storage

PubMed Central

Fuller, Megan K.; Faulk, Denver M.; Sundaram, Nambirajan; Mahe, Maxime M.; Stout, Kara M.; von Furstenberg, Richard J.; Smith, Brian J.; McNaughton, Kirk K.; Shroyer, Noah F.; Helmrath, Michael A.; Henning, Susan J.

2013-01-01

Intestinal stem cells (ISCs) are responsible for renewal of the epithelium both during normal homeostasis and following injury. As such they have significant therapeutic potential. However, it is unknown whether ISCs can survive tissue storage. We hypothesized that, although the majority of epithelial cells may die, ISCs would remain viable for at least 24 h at 4°C. To explore this hypothesis, jejuni of C57Bl6/J or Lgr5-LacZ mice were removed and either processed immediately or placed in phosphate buffered saline (PBS) at 4°C. Delayed isolations of epithelia were performed after 24, 30, or 48 h storage. At the light microscope level, despite extensive apoptosis of villus epithelial cells, small intestinal crypts remained morphologically intact through 30 h and ISCs were identifiable via Lgr5-LacZ positivity. Electron microscopy showed that ISCs retain high integrity through 24 h. When assessed by flow cytometry, ISCs were more resistant to degeneration than the rest of the epithelium, including neighboring Paneth cells, with higher viability across all time points. Culture of isolated crypts showed no loss of capacity to form complex enteroids after 24 h tissue storage, with efficiencies after 7 days of culture remaining above 80%. By 30 h storage, efficiencies declined but budding capability was retained. We conclude that, with delay in isolation, ISCs remain viable and retain their proliferative capacity. In contrast, the remainder of the epithelium, including the Paneth cells, exhibits degeneration and programmed cell death. If these findings are recapitulated with human tissue, storage at 4°C may offer a valuable temporal window for harvest of crypts or ISCs for therapeutic application. PMID:23820734

Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

PubMed Central

Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

2013-01-01

β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

High-Level Carbapenem Resistance in a Klebsiella pneumoniae Clinical Isolate Is Due to the Combination of blaACT-1 β-Lactamase Production, Porin OmpK35/36 Insertional Inactivation, and Down-Regulation of the Phosphate Transport Porin PhoE

PubMed Central

Kaczmarek, Frank M.; Dib-Hajj, Fadia; Shang, Wenchi; Gootz, Thomas D.

2006-01-01

Clinical isolates of Klebsiella pneumoniae resistant to carbapenems and essentially all other antibiotics (multidrug resistant) are being isolated from some hospitals in New York City with increasing frequency. A highly related pair of K. pneumoniae strains isolated on the same day from one patient in a hospital in New York City were studied for antibiotic resistance. One (KP-2) was resistant to imipenem, meropenem, and sulopenem (MICs of 16 to 32 μg/ml) while the other (KP-1) was susceptible (MIC of 0.5 μg/ml); both contained the blaACT-1, blaSHV-1, and blaTEM-1 β-lactamases. blaACT-1 in both strains was encoded on a large ∼150-kb plasmid. Both isolates contained an identical class 1 integron encoding resistance to aminoglycosides and chloramphenicol. They each had identical insertions in ompK35 and ompK36, resulting in disruption of these key porin genes. The carbapenem-resistant and -susceptible isolates were extensively studied for differences in the structural and regulatory genes for the operons acrRAB, marORAB, romA-ramA, soxRS, micF, micC, phoE, phoBR, rpoS, and hfq. No changes were detected between the isolates except for a significant down-regulation of ompK37, phoB, and phoE in KP-2 as deduced from reverse transcription-PCR analysis of mRNA and polyacrylamide gel electrophoresis separation of outer membrane proteins. Backcross analysis was conducted using the wild-type phoE gene cloned into the vector pGEM under regulation of its native promoter as well as the lacZ promoter following transformation into the resistant KP-2 isolate. The wild-type gene reversed carbapenem resistance only when under control of the heterologous lacZ promoter. In the background of ompK35-ompK36 gene disruption, the up-regulation of phoE in KP-1 apparently compensated for porin loss and conferred carbapenem susceptibility. Down-regulation of phoE in KP-2 may represent the normal state of this gene, or it may have been selected from KP-1 in vivo under antibiotic pressure, generating the carbapenem-resistant clone. This is the first study in the Enterobacteriaceae where expression of the phosphate-regulated PhoE porin has been associated with resistance to antimicrobials. Our results with this pair of Klebsiella clinical isolates highlight the complex and evolving nature of multiple drug resistance in this species. PMID:17005822

High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of bla(ACT-1) beta-lactamase production, porin OmpK35/36 insertional inactivation, and down-regulation of the phosphate transport porin phoe.

PubMed

Kaczmarek, Frank M; Dib-Hajj, Fadia; Shang, Wenchi; Gootz, Thomas D

2006-10-01

Clinical isolates of Klebsiella pneumoniae resistant to carbapenems and essentially all other antibiotics (multidrug resistant) are being isolated from some hospitals in New York City with increasing frequency. A highly related pair of K. pneumoniae strains isolated on the same day from one patient in a hospital in New York City were studied for antibiotic resistance. One (KP-2) was resistant to imipenem, meropenem, and sulopenem (MICs of 16 to 32 microg/ml) while the other (KP-1) was susceptible (MIC of 0.5 microg/ml); both contained the bla(ACT-1), bla(SHV-1), and bla(TEM-1) beta-lactamases. bla(ACT-1) in both strains was encoded on a large approximately 150-kb plasmid. Both isolates contained an identical class 1 integron encoding resistance to aminoglycosides and chloramphenicol. They each had identical insertions in ompK35 and ompK36, resulting in disruption of these key porin genes. The carbapenem-resistant and -susceptible isolates were extensively studied for differences in the structural and regulatory genes for the operons acrRAB, marORAB, romA-ramA, soxRS, micF, micC, phoE, phoBR, rpoS, and hfq. No changes were detected between the isolates except for a significant down-regulation of ompK37, phoB, and phoE in KP-2 as deduced from reverse transcription-PCR analysis of mRNA and polyacrylamide gel electrophoresis separation of outer membrane proteins. Backcross analysis was conducted using the wild-type phoE gene cloned into the vector pGEM under regulation of its native promoter as well as the lacZ promoter following transformation into the resistant KP-2 isolate. The wild-type gene reversed carbapenem resistance only when under control of the heterologous lacZ promoter. In the background of ompK35-ompK36 gene disruption, the up-regulation of phoE in KP-1 apparently compensated for porin loss and conferred carbapenem susceptibility. Down-regulation of phoE in KP-2 may represent the normal state of this gene, or it may have been selected from KP-1 in vivo under antibiotic pressure, generating the carbapenem-resistant clone. This is the first study in the Enterobacteriaceae where expression of the phosphate-regulated PhoE porin has been associated with resistance to antimicrobials. Our results with this pair of Klebsiella clinical isolates highlight the complex and evolving nature of multiple drug resistance in this species.

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Chondrogenic Differentiation Processes in Human Bone Marrow Aspirates Seeded in Three-Dimensional Woven Poly(ε-Caprolactone) Scaffolds Enhanced by rAAV-Mediated SOX9 Gene Transfer.

PubMed

Venkatesan, Jagadeesh Kumar; Moutos, Franklin T; Rey-Rico, Ana; Estes, Bradley T; Frisch, Janina; Schmitt, Gertrud; Madry, Henning; Guilak, Farshid; Cucchiarini, Magali

2018-05-02

Combining gene therapy approaches with tissue engineering procedures is an active area of translational research for the effective treatment of articular cartilage lesions, especially to target chondrogenic progenitor cells such as those derived from the bone marrow. Here, we evaluated the effect of genetically modifying concentrated human mesenchymal stem cells from bone marrow to induce chondrogenesis by recombinant adeno-associated viral (rAAV) vector gene transfer of the sex-determining region Y-type high-mobility group box 9 (SOX9) factor upon seeding in three-dimensional (3D) woven poly(ε-caprolactone) (PCL) scaffolds that provide mechanical properties mimicking those of native articular cartilage. Prolonged, effective SOX9 expression was reported in the constructs for at least 21 days, the longest time point evaluated, leading to enhanced metabolic and chondrogenic activities relative to the control conditions (reporter lacZ gene transfer or absence of vector treatment) but without affecting the proliferative activities in the samples. The application of the rAAV SOX9 vector also prevented undesirable hypertrophic and terminal differentiation in the seeded concentrates. As bone marrow is readily accessible during surgery, such findings reveal the therapeutic potential of providing rAAV-modified marrow concentrates within 3D woven PCL scaffolds for repair of focal cartilage lesions.

Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440.

PubMed

Fernández, Matilde; Udaondo, Zulema; Niqui, José-Luis; Duque, Estrella; Ramos, Juan-Luis

2014-10-01

The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted ars1 and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of P(ars1) and P(ars2) to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in ars1 and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the ars1 operon appears to only occur in the KT2440 strain, suggesting that ars1 was acquired by horizontal gene transfer. The presence of ars1 in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.

Evaluation of genotoxic potential of neurotoxin anatoxin-a with the use of umuC test.

PubMed

Sieroslawska, Anna; Rymuszka, Anna

2010-01-01

The aim of this study was to evaluate genotoxicity of anatoxin-a, cyanotoxin of neurotoxic activity. Additionally, other frequently detected cyanotoxin of previously described genotoxic potential, microcystin-LR, was used at the same concentrations, as well as the mixture of both toxins, anatoxin-a and microcystin-LR. Genotoxicity of the toxins was determined with the use of the umuC assay, in which the induction and expression of the umuC - lacZ reporter gene was assessed. The test was conducted on Salmonella typhimurium TA 1535/pSK1002 strain, with and without metabolic transformation. The toxin concentrations were 0.25, 0.5, 1 and 2 µg/ml. The exposure time was 2 h. The highest inefficient concentration of anatoxin-a without metabolic transformation was 0.25 µg/ml, of microcystin-LR was 0.5 µg/ml and in case of the toxin mixture all used concentrations induced the umuC gene. When S9 fraction was added to the samples, no effects were detected. To our knowledge, this is the first report on genotoxic effects of anatoxin-a. Although the study is preliminary and needs further research, however, indicates the new potential activity of the toxin, as well as the possible increase of genotoxicity of other cyanotoxins, more stable in the environment, e.g. microcystin-LR.

Xer1-Mediated Site-Specific DNA Inversions and Excisions in Mycoplasma agalactiae▿ ‡

PubMed Central

Czurda, Stefan; Jechlinger, Wolfgang; Rosengarten, Renate; Chopra-Dewasthaly, Rohini

2010-01-01

Surface antigen variation in Mycoplasma agalactiae, the etiologic agent of contagious agalactia in sheep and goats, is governed by site-specific recombination within the vpma multigene locus encoding the Vpma family of variable surface lipoproteins. This high-frequency Vpma phase switching was previously shown to be mediated by a Xer1 recombinase encoded adjacent to the vpma locus. In this study, it was demonstrated in Escherichia coli that the Xer1 recombinase is responsible for catalyzing vpma gene inversions between recombination sites (RS) located in the 5′-untranslated region (UTR) in all six vpma genes, causing cleavage and strand exchange within a 21-bp conserved region that serves as a recognition sequence. It was further shown that the outcome of the site-specific recombination event depends on the orientation of the two vpma RS, as direct or inverted repeats. While recombination between inverted vpma RS led to inversions, recombination between direct repeat vpma RS led to excisions. Using a newly developed excision assay based on the lacZ reporter system, we were able to successfully demonstrate under native conditions that such Xer1-mediated excisions can indeed also occur in the M. agalactiae type strain PG2, whereas they were not observed in the control xer1-disrupted VpmaY phase-locked mutant (PLMY), which lacks Xer1 recombinase. Unless there are specific regulatory mechanisms preventing such excisions, this might be the cost that the pathogen has to render at the population level for maintaining this high-frequency phase variation machinery. PMID:20562305

The effects of Eph-ephrin mutations on pre-pulse inhibition in mice.

PubMed

Liuzzo, Andrea; Gray, Lincoln; Wallace, Matthew; Gabriele, Mark

2014-08-01

Eph-ephrin signaling is known to be important in directing topographic projections in the afferent auditory pathway, including connections to various subdivisions of the inferior colliculus (IC). The acoustic startle-response (ASR) is a reliable reflexive behavioral response in mammals elicited by an unexpected intense acoustic startle-eliciting stimulus (ES). It is mediated by a sub-cortical pathway that includes the IC. The ASR amplitude can be measured with an accelerometer under the subject and can be decreased in amplitude by presenting a less intense, non-startling stimulus 5-300ms before the ES. This reflexive decrement in ASR is called pre-pulse inhibition (PPI) and indicates that the relatively soft pre-pulse was heard. PPI is a general trait among mammals. Mice have been used recently to study this response and to reveal how genetic mutations affect neural circuits and hence the ASR and PPI. In this experiment, we measured the effect of Eph-ephrin mutations using control mice (C57BL/6J), mice with compromised EphA4 signaling (EphA4(lacZ/+), EphA4(lacZ/lacZ)), and knockout ephrin-B3 mice (ephrin-B3 (+/-, -/-)). Control and EphA4(lacZ/+s)trains showed robust PPI (up to 75% decrement in ASR) to an offset of a 70dB SPL background noise at 50ms before the ES. Ephrin-B3 knockout mice and EphA4 homozygous mutants were only marginally significant in PPI (<25% decrement and <33% decrement, respectively) to the same conditions. This decrement in PPI highlights the importance of ephrin-B3 and EphA4 interactions in ordering auditory behavioral circuits. Thus, different mutations in certain members of the signaling family produce a full range of changes in PPI, from minimal to nearly maximal. This technique can be easily adapted to study other aspects of hearing in a wider range of mutations. Along with ongoing neuroanatomical studies, this allows careful quantification of how the auditory anatomical, physiological and now behavioral phenotype is affected by changes in Eph-ephrin expression and functionality. Copyright © 2014 Elsevier Inc. All rights reserved.

Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.

PubMed

Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han

2002-04-05

We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Reproducible and efficient murine CNS gene delivery using a microprocessor-controlled injector.

PubMed

Brooks, A I; Halterman, M W; Chadwick, C A; Davidson, B L; Haak-Frendscho, M; Radel, C; Porter, C; Federoff, H J

1998-04-30

To develop a reproducible gene transfer method for the murine CNS we evaluated delivery of various gene vehicles using mechanical or manual stereotaxic intracranial inoculation. A microprocessor controlled microsyringe pump (The World Precision Instruments/UltraMicroPump) programmable for volume, rate and syringe size and designed to dispense nanoliter and picoliter volumes was compared to a standard manual deliver method. Gene transfer efficiency of two viral vectors, two synthetic cationic lipid molecules, and naked DNA were evaluated in mice injected unilaterally in two brain regions. Animals received 1 microl over 10 min. of either HSVlac (1 x 10(5) b.f.u), AdLac (1 x 10(5) p.f.u), Tfx-10 or Tfx-20 (2.6 microg DNA in 2.0 microl Tfx; 1:1 charge ratio of DNA to liposome), or naked DNA (HSVlac plasmid, 10 microg/microl). After 4 days, animals from each group were perfused and tissue prepared for X-gal histochemical detection of beta-galactosidase expression. Blue cells were observed in the HSV, Adenovirus, and Tfx-20 groups only at the injection site in animals injected using the UMP. Animals injected manually exhibited fewer blue cells and positive cells were not restricted to the injection site. To quantify expression, tissue punches harvested from the injection sites as well as other brain regions were analyzed using a chemiluminescent reporter assay to detect beta-galactosidase (Galacto-Light). These data indicated increased activity in all animals injected with a lacZ containing vector via the UMP as compared to manual delivery: A 41% increase in the expression levels of beta-gal in HSVlac infected animals (p = 0.0029); a 29% increase in Adlac infected animals (p = 0.01); a 56% increase in Tfx-10 transduced animals (p = 0.04); a 24% increase in Tfx-20 transduced animals (p = 0.01); and a 69% increase in naked DNA gene transfer (p = 0.05). Total beta-galactosidase activity was greatest in HSVlac infected mice followed by Adlac > Tfx-20 > Tfx-10 = naked DNA.

CCN Family Member 2/Connective Tissue Growth Factor (CCN2/CTGF) Has Anti-Aging Effects That Protect Articular Cartilage from Age-Related Degenerative Changes

PubMed Central

Itoh, Shinsuke; Hattori, Takako; Tomita, Nao; Aoyama, Eriko; Yutani, Yasutaka; Yamashiro, Takashi; Takigawa, Masaharu

2013-01-01

To examine the role of connective tissue growth factor CCN2/CTGF (CCN2) in the maintenance of the articular cartilaginous phenotype, we analyzed knee joints from aging transgenic mice (TG) overexpressing CCN2 driven by the Col2a1 promoter. Knee joints from 3-, 14-, 40-, and 60-day-old and 5-, 12-, 18-, 21-, and 24-month-old littermates were analyzed. Ccn2-LacZ transgene expression in articular cartilage was followed by X-gal staining until 5 months of age. Overexpression of CCN2 protein was confirmed through all ages in TG articular cartilage and in growth plates. Radiographic analysis of knee joints showed a narrowing joint space and other features of osteoarthritis in 50% of WT, but not in any of the TG mice. Transgenic articular cartilage showed enhanced toluidine blue and safranin-O staining as well as chondrocyte proliferation but reduced staining for type X and I collagen and MMP-13 as compared with those parameters for WT cartilage. Staining for aggrecan neoepitope, a marker of aggrecan degradation in WT articular cartilage, increased at 5 and 12 months, but disappeared at 24 months due to loss of cartilage; whereas it was reduced in TG articular cartilage after 12 months. Expression of cartilage genes and MMPs under cyclic tension stress (CTS) was measured by using primary cultures of chondrocytes obtained from wild-type (WT) rib cartilage and TG or WT epiphyseal cartilage. CTS applied to primary cultures of mock-transfected rib chondrocytes from WT cartilage and WT epiphyseal cartilage induced expression of Col1a1, ColXa1, Mmp-13, and Mmp-9 mRNAs; however, their levels were not affected in CCN2-overexpressing chondrocytes and TG epiphyseal cartilage. In conclusion, cartilage-specific overexpression of CCN2 during the developmental and growth periods reduced age-related changes in articular cartilage. Thus CCN2 may play a role as an anti-aging factor by stabilizing articular cartilage. PMID:23951098

Activation of Wnt Signaling by Mechanical Loading Is Impaired in the Bone of Old Mice

PubMed Central

Holguin, Nilsson; Brodt, Michael D; Silva, Matthew J

2017-01-01

Aging diminishes bone formation engendered by mechanical loads, but the mechanism for this impairment remains unclear. Because Wnt signaling is required for optimal loading-induced bone formation, we hypothesized that aging impairs the load-induced activation of Wnt signaling. We analyzed dynamic histomorphometry of 5-month-old, 12-month-old, and 22-month-old C57Bl/6JN mice subjected to multiple days of tibial compression and corroborated an age-related decline in the periosteal loading response on day 5. Similarly, 1 day of loading increased periosteal and endocortical bone formation in young-adult (5-month-old) mice, but old (22-month-old) mice were unresponsive. These findings corroborated mRNA expression of genes related to bone formation and the Wnt pathway in tibias after loading. Multiple bouts (3 to 5 days) of loading upregulated bone formation–related genes, e.g., Osx and Col1a1, but older mice were significantly less responsive. Expression of Wnt negative regulators, Sost and Dkk1, was suppressed with a single day of loading in all mice, but suppression was sustained only in young-adult mice. Moreover, multiple days of loading repeatedly suppressed Sost and Dkk1 in young-adult, but not in old tibias. The age-dependent response to loading was further assessed by osteocyte staining for Sclerostin and LacZ in tibia of TOPGAL mice. After 1 day of loading, fewer osteocytes were Sclerostin-positive and, corroboratively, more osteocytes were LacZ-positive (Wnt active) in both 5-month-old and 12-month-old mice. However, although these changes were sustained after multiple days of loading in 5-month-old mice, they were not sustained in 12-month-old mice. Last, Wnt1 and Wnt7b were the most load-responsive of the 19 Wnt ligands. However, 4 hours after a single bout of loading, although their expression was upregulated threefold to 10-fold in young-adult mice, it was not altered in old mice. In conclusion, the reduced bone formation response of aged mice to loading may be due to failure to sustain Wnt activity with repeated loading. PMID:27357062

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

PubMed

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

2017-07-01

Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

PEGylation enhances tumor targeting of plasmid DNA by an artificial cationized protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2004-05-31

The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.

Long-Term Correction of Sandhoff Disease Following Intravenous Delivery of rAAV9 to Mouse Neonates

PubMed Central

Walia, Jagdeep S; Altaleb, Naderah; Bello, Alexander; Kruck, Christa; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Chowdhury, Biswajit; Hurlbut, David; Hemming, Richard; Kobinger, Gary P; Triggs-Raine, Barbara

2015-01-01

GM2 gangliosidoses are severe neurodegenerative disorders resulting from a deficiency in β-hexosaminidase A activity and lacking effective therapies. Using a Sandhoff disease (SD) mouse model (Hexb−/−) of the GM2 gangliosidoses, we tested the potential of systemically delivered adeno-associated virus 9 (AAV9) expressing Hexb cDNA to correct the neurological phenotype. Neonatal or adult SD and normal mice were intravenously injected with AAV9-HexB or –LacZ and monitored for serum β-hexosaminidase activity, motor function, and survival. Brain GM2 ganglioside, β-hexosaminidase activity, and inflammation were assessed at experimental week 43, or an earlier humane end point. SD mice injected with AAV9-LacZ died by 17 weeks of age, whereas all neonatal AAV9-HexB–treated SD mice survived until 43 weeks (P < 0.0001) with only three exhibiting neurological dysfunction. SD mice treated as adults with AAV9-HexB died between 17 and 35 weeks. Neonatal SD-HexB–treated mice had a significant increase in brain β-hexosaminidase activity, and a reduction in GM2 ganglioside storage and neuroinflammation compared to adult SD-HexB– and SD-LacZ–treated groups. However, at 43 weeks, 8 of 10 neonatal-HexB injected control and SD mice exhibited liver or lung tumors. This study demonstrates the potential for long-term correction of SD and other GM2 gangliosidoses through early rAAV9 based systemic gene therapy. PMID:25515709

The APSES protein Sok2 is a positive regulator of sporulation in Ashbya gossypii.

PubMed

Wasserstrom, Lisa; Dünkler, Alexander; Walther, Andrea; Wendland, Jürgen

2017-12-01

Ashbya gossypii is a homothallic, flavinogenic, filamentous ascomycete that starts overproduction of riboflavin and fragments its mycelium quantitatively into spore producing sporangia at the end of a growth phase. Mating is not required for sporulation and the standard homothallic laboratory strain is a MATa strain. Here we show that ectopic expression of Saccharomyces cerevisiae MATα2 in A. gossypii completely suppresses sporulation, inhibits riboflavin overproduction and downregulates among others AgSOK2. AgSok2 belongs to a fungal-specific group of (APSES) transcription factors. Deletion of AgSOK2 strongly reduces riboflavin production and blocks sporulation. The initiator of meiosis, AgIME1, is a transcription factor essential for sporulation. We characterized the AgIME1 promoter region required for complementation of the Agime1 mutant. Reporter assays with AgIME1 promoter fragments fused to lacZ showed that AgSok2 does not control AgIME1 transcription. However, global transcriptome analysis identified two other essential regulators of sporulation, AgIME2 and AgNDT80, as potential targets of AgSok2. Our data suggest that sporulation and riboflavin production in A. gossypii are under mating type locus and nutritional control. Sok2, a target of the cAMP/protein kinase A pathway, serves as a central positive regulator to promote sporulation. This contrasts Saccharomyces cerevisiae where Sok2 is a repressor of IME1 transcription. © 2017 John Wiley & Sons Ltd.

Mutation of Gtf2ird1 from the Williams-Beuren syndrome critical region results in facial dysplasia, motor dysfunction, and altered vocalisations.

PubMed

Howard, Monique L; Palmer, Stephen J; Taylor, Kylie M; Arthurson, Geoffrey J; Spitzer, Matthew W; Du, Xin; Pang, Terence Y C; Renoir, Thibault; Hardeman, Edna C; Hannan, Anthony J

2012-03-01

Insufficiency of the transcriptional regulator GTF2IRD1 has become a strong potential explanation for some of the major characteristic features of the neurodevelopmental disorder Williams-Beuren syndrome (WBS). Genotype/phenotype correlations in humans indicate that the hemizygous loss of the GTF2IRD1 gene and an adjacent paralogue, GTF2I, play crucial roles in the neurocognitive and craniofacial aspects of the disease. In order to explore this genetic relationship in greater detail, we have generated a targeted Gtf2ird1 mutation in mice that blocks normal GTF2IRD1 protein production. Detailed analyses of homozygous null Gtf2ird1 mice have revealed a series of phenotypes that share some intriguing parallels with WBS. These include reduced body weight, a facial deformity resulting from localised epidermal hyperplasia, a motor coordination deficit, alterations in exploratory activity and, in response to specific stress-inducing stimuli; a novel audible vocalisation and increased serum corticosterone. Analysis of Gtf2ird1 expression patterns in the brain using a knock-in LacZ reporter and c-fos activity mapping illustrates the regions where these neurological abnormalities may originate. These data provide new mechanistic insight into the clinical genetic findings in WBS patients and indicate that insufficiency of GTF2IRD1 protein contributes to abnormalities of facial development, motor function and specific behavioural disorders that accompany this disease. Copyright © 2011 Elsevier Inc. All rights reserved.

Synthetic Promoters Functional in Francisella novicida and Escherichia coli

PubMed Central

McWhinnie, Ralph L.

2014-01-01

In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126

Sleeping Beauty Transposon Vectors in Liver-directed Gene Delivery of LDLR and VLDLR for Gene Therapy of Familial Hypercholesterolemia

PubMed Central

Turunen, Tytteli A K; Kurkipuro, Jere; Heikura, Tommi; Vuorio, Taina; Hytönen, Elisa; Izsvák, Zsuzsanna; Ylä-Herttuala, Seppo

2016-01-01

Plasmid-based Sleeping Beauty (SB) transposon vectors were developed and used to deliver genes for low-density lipoprotein and very-low-density lipoprotein receptors (LDLR and VLDLR, respectively) or lacZ reporter into liver of an LDLR-deficient mouse model of familial hypercholesterolemia (FH). SB transposase, SB100x, was used to integrate the therapeutic transposons into mice livers for evaluating the feasibility of the vectors in reducing high blood cholesterol and the progression of atherosclerosis. Hydrodynamic gene delivery of transposon-VLDLR into the livers of the mice resulted in initial 17–19% reductions in plasma cholesterol, and at the later time points, in a significant stabilization of the cholesterol level for the 6.5-month duration of the study compared to the control mice. Transposon-LDLR-treated animals also demonstrated a trend of stabilization in the cholesterol levels in the long term. Vector-treated mice had slightly less lipid accumulation in the liver and reduced aortic atherosclerosis. Clinical chemistry and histological analyses revealed normal liver function and morphology comparable to that of the controls during the follow-up with no safety issues regarding the vector type, transgenes, or the gene transfer method. The study demonstrates the safety and potential benefits of the SB transposon vectors in the treatment of FH. PMID:26670130

The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans.

PubMed

Qiu, Bin; Luczak, Susan E; Wall, Tamara L; Kirchhoff, Aaron M; Xu, Yuxue; Eng, Mimy Y; Stewart, Robert B; Shou, Weinian; Boehm, Stephen L; Chester, Julia A; Yong, Weidong; Liang, Tiebing

2016-08-05

FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21-26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans.

Interallelic complementation of mutations in propionic acidemia by microinjection of mutant cDNAs into fibroblasts of affected patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loyer, M.; Leclerc, D.; Gravel, R.A.

1994-09-01

Propionic acidemia is a rare autosomal recessive disorder resulting from defects of the {alpha} or {beta} subunit of biotin-dependent propionyl-CoA carboxylase (PCC). Mutations are assigned to defects of the PCCA ({alpha} subunit) or PCCB ({beta} subunit) gene through complementation studies after somatic fusion of patient cell lines. About two-thirds of patients with {beta} subunit defects (complementation group pccBC) show interallelic complementation in cell fusion experiments (subgroups pccB and pccC), monitored by the PCC-dependent metabolisms of {sup 14}C-propionate. Most patient cell lines are heteroallelic for two different mutations, leaving ambiguous the identity of the mutation participating in interallelic complementation. To identifymore » the complementing mutations, we have expressed {beta}-subunit cDNAs containing individual mutations by microinjection of the cDNAs in recipient cells from patients with {beta} subunit defects. Correction of the PCC defect was monitored by autoradiography of {sup 14}C-propionate incorporation. In some experiments, cDNAs were co-injected with a plasmid expressing the E. coli lacZ gene as a positive control for successful injection. Two mutations from the pccB subgroup showed complementation when injected into pccC cells; dupKICK140-143 and Pro228Leu. Similarly, two mutations from the pccC subgroup complemented after injection into pccB cells; {Delta}Ile408 and Arg410Trp. No mutation complemented with mutation of the pccBC group which are classified as non-complementing in cell fusion experiments. The results show that the complementing pccB mutations are found in the N-terminal half of the {beta} subunit, while the complementing pccC mutations cluxter at a site in the C-terminal half. The latter site is a candidate for the propionyl-CoA binding site based on sequence identity with a region of transcarboxylase from Propionibacterium shermanii.« less

Molecular Characterization and Regulation of the aguBA Operon, Responsible for Agmatine Utilization in Pseudomonas aeruginosa PAO1

PubMed Central

Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar

2001-01-01

Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419

Identification and characterization of a locus which regulates multiple functions in Pseudomonas tolaasii, the cause of brown blotch disease of Agaricus bisporus.

PubMed Central

Grewal, S I; Han, B; Johnstone, K

1995-01-01

Pseudomonas tolaasii, the causal agent of brown blotch disease of Agaricus bisporus, spontaneously gives rise to morphologically distinct stable sectors, referred to as the phenotypic variant form, at the margins of the wild-type colonies. The phenotypic variant form is nonpathogenic and differs from the wild type in a range of biochemical and physiological characteristics. A genomic cosmid clone (pSISG29) from a wild-type P. tolaasii library was shown to be capable of restoring a range of characteristics of the phenotypic variant to those of the wild-type form, when present in trans. Subcloning and saturation mutagenesis analysis with Tn5lacZ localized a 3.0-kb region from pSISG29, designated the pheN locus, required for complementation of the phenotypic variant to the wild-type form. Marker exchange of the Tn5lacZ-mutagenized copy of the pheN locus into the wild-type strain demonstrated that a functional copy of the pheN gene is required to maintain the wild-type pathogenic phenotype and that loss of the pheN gene or its function results in conversion of the wild-type form to the phenotypic variant form. The pheN locus contained a 2,727-bp open reading frame encoding an 83-kDa protein. The predicted amino acid sequence of the PheN protein showed homology to the sensor and regulator domains of the conserved family of two component bacterial sensor regulator proteins. Southern hybridization analysis of pheN genes from the wild type and the phenotypic variant form revealed that DNA rearrangement occurs within the pheN locus during phenotypic variation. Analysis of pheN expression with a pheN::lacZ fusion demonstrated that expression is regulated by environmental factors. These results are related to a model for control for phenotypic variation in P. tolaasii. PMID:7642492

A source of artifact in the lacZ reversion assay in Escherichia coli.

PubMed

Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I

2015-06-01

The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its utility for discerning effects of weak mutagens may be compromised by the artifact. Copyright © 2015 Elsevier B.V. All rights reserved.

The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)

PubMed Central

Maisnier-Patin, Sophie; Roth, John R.

2015-01-01

Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316

[Comparison of expression of transforming growth factor-β1 in rat dental pulp during direct pulp capping with 2 capping agents].

PubMed

Zhang, Xiao-fang; Yao, Ya-peng; Kang, Hong-ying; Dong, Pei

2014-04-01

To examine and compare the expression of transforming growth factor-β1(TGF-β1) in rat dental pulp after direct pulp capping with calcium hydroxide (CH) and mineral trioxide aggregate (MTA). The model of direct dental pulp capping after first molars was established in 28 female Wistar rats with CH and MTA. The rats were sacrificed 1, 3, 5, 7, 14,21 and 28 days after direct pulp capping. TGF-β1 expression in pulp tissues were measured with immunohistochemical staining. The data was analyzed by Dunnett t test and paired t test with SPSS 13.0 software package. The results showed that no TGF-β1 expression was detected in the control group. After direct pulp capping with MTA, TGF-β1 expression gradually increased and reached peak expression on 5 day. TGF-β1 expression gradually decreased afterwards and reached normal on 21 day after direct pulp. TGF-β1 was mainly expressed in neutrophils, odontoblasts cells, vascular endothelial cells and fibroblasts. The expression of TGF-β1 was significantly different between 2 capping agents 1, 3, 5, 7, 14 days after direct pulp capping (P<0.05). The results suggest that TGF-β1 expression increases at first and then decreases after direct pulp capping. The type of capping agents has an impact on the expression of TGF-β1 after direct pulp capping. MTA enhances more TGFβ-1 expression than CH 1, 3, 5, 7 and 14 days after direct pulp capping. Supported by Science and Technology Plan Project of Liaoning Province (2009225001-2).

Recognition of Emotion from Facial Expressions with Direct or Averted Eye Gaze and Varying Expression Intensities in Children with Autism Disorder and Typically Developing Children

PubMed Central

Tell, Dina; Davidson, Denise; Camras, Linda A.

2014-01-01

Eye gaze direction and expression intensity effects on emotion recognition in children with autism disorder and typically developing children were investigated. Children with autism disorder and typically developing children identified happy and angry expressions equally well. Children with autism disorder, however, were less accurate in identifying fear expressions across intensities and eye gaze directions. Children with autism disorder rated expressions with direct eyes, and 50% expressions, as more intense than typically developing children. A trend was also found for sad expressions, as children with autism disorder were less accurate in recognizing sadness at 100% intensity with direct eyes than typically developing children. Although the present research showed that children with autism disorder are sensitive to eye gaze direction, impairments in the recognition of fear, and possibly sadness, exist. Furthermore, children with autism disorder and typically developing children perceive the intensity of emotional expressions differently. PMID:24804098

The micro-Petri dish, a million-well growth chip for the culture and high-throughput screening of microorganisms.

PubMed

Ingham, Colin J; Sprenkels, Ad; Bomer, Johan; Molenaar, Douwe; van den Berg, Albert; van Hylckama Vlieg, Johan E T; de Vos, Willem M

2007-11-13

A miniaturized, disposable microbial culture chip has been fabricated by microengineering a highly porous ceramic sheet with up to one million growth compartments. This versatile culture format, with discrete compartments as small as 7 x 7 mum, allowed the growth of segregated microbial samples at an unprecedented density. The chip has been used for four complementary applications in microbiology. (i) As a fast viable counting system that showed a dynamic range of over 10,000, a low degree of bias, and a high culturing efficiency. (ii) In high-throughput screening, with the recovery of 1 fluorescent microcolony in 10,000. (iii) In screening for an enzyme-based, nondominant phenotype by the targeted recovery of Escherichia coli transformed with the plasmid pUC18, based on expression of the lacZ reporter gene without antibiotic-resistance selection. The ease of rapid, successive changes in the environment of the organisms on the chip, needed for detection of beta-galactosidase activity, highlights an advantageous feature that was also used to screen a metagenomic library for the same activity. (iv) In high-throughput screening of >200,000 isolates from Rhine water based on metabolism of a fluorogenic organophosphate compound, resulting in the recovery of 22 microcolonies with the desired phenotype. These isolates were predicted, on the basis of rRNA sequence, to include six new species. These four applications suggest that the potential for such simple, readily manufactured chips to impact microbial culture is extensive and may facilitate the full automation and multiplexing of microbial culturing, screening, counting, and selection.

Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography

PubMed Central

Shaw, Paul D.; Ping, Gao; Daly, Sean L.; Cha, Chung; Cronan, John E.; Rinehart, Kenneth L.; Farrand, Stephen K.

1997-01-01

Many Gram-negative bacteria regulate gene expression in response to their population size by sensing the level of acyl-homoserine lactone signal molecules which they produce and liberate to the environment. We have developed an assay for these signals that couples separation by thin-layer chromatography with detection using Agrobacterium tumefaciens harboring lacZ fused to a gene that is regulated by autoinduction. With the exception of N-butanoyl-l-homoserine lactone, the reporter detected acyl-homoserine lactones with 3-oxo-, 3-hydroxy-, and 3-unsubstituted side chains of all lengths tested. The intensity of the response was proportional to the amount of the signal molecule chromatographed. Each of the 3-oxo- and the 3-unsubstituted derivatives migrated with a unique mobility. Using the assay, we showed that some bacteria produce as many as five detectable signal molecules. Structures could be assigned tentatively on the basis of mobility and spot shape. The dominant species produced by Pseudomonas syringae pv. tabaci chromatographed with the properties of N-(3-oxohexanoyl)-l-homoserine lactone, a structure that was confirmed by mass spectrometry. An isolate of Pseudomonas fluorescens produced five detectable species, three of which had novel chromatographic properties. These were identified as the 3-hydroxy- forms of N-hexanoyl-, N-octanoyl-, and N-decanoyl-l-homoserine lactone. The assay can be used to screen cultures of bacteria for acyl-homoserine lactones, for quantifying the amounts of these molecules produced, and as an analytical and preparative aid in determining the structures of these signal molecules. PMID:9177164

Genetic analysis of the dsz promoter and associated regulatory regions of Rhodococcus erythropolis IGTS8.

PubMed Central

Li, M Z; Squires, C H; Monticello, D J; Childs, J D

1996-01-01

The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295

Co-overexpression of TGF-β and SOX9 via rAAV gene transfer modulates the metabolic and chondrogenic activities of human bone marrow-derived mesenchymal stem cells.

PubMed

Tao, Ke; Frisch, Janina; Rey-Rico, Ana; Venkatesan, Jagadeesh K; Schmitt, Gertrud; Madry, Henning; Lin, Jianhao; Cucchiarini, Magali

2016-02-01

Articular cartilage has a limited potential for self-healing. Transplantation of genetically modified progenitor cells like bone marrow-derived mesenchymal stem cells (MSCs) is an attractive strategy to improve the intrinsic repair capacities of damaged articular cartilage. In this study, we examined the potential benefits of co-overexpressing the pleiotropic transformation growth factor beta (TGF-β) with the cartilage-specific transcription factor SOX9 via gene transfer with recombinant adeno-associated virus (rAAV) vectors upon the biological activities of human MSCs (hMSCs). Freshly isolated hMSCs were transduced over time with separate rAAV vectors carrying either TGF-β or sox9 in chondrogenically-induced aggregate cultures to evaluate the efficacy and duration of transgene expression and to monitor the effects of rAAV-mediated genetic modification upon the cellular activities (proliferation, matrix synthesis) and chondrogenic differentiation potency compared with control conditions (lacZ treatment, sequential transductions). Significant, prolonged TGF-β/sox9 co-overexpression was achieved in chondrogenically-induced hMSCs upon co-transduction via rAAV for up to 21 days, leading to enhanced proliferative, biosynthetic, and chondrogenic activities relative to control treatments, especially when co-applying the candidate vectors at the highest vector doses tested. Optimal co-administration of TGF-β with sox9 also advantageously reduced hypertrophic differentiation of the cells in the conditions applied here. The present findings demonstrate the possibility of modifying MSCs by combined therapeutic gene transfer as potent future strategies for implantation in clinically relevant animal models of cartilage defects in vivo.

Volumetric muscle loss injury repair using in situ fibrin gel cast seeded with muscle-derived stem cells (MDSCs)

PubMed Central

Matthias, Nadine; Hunt, Samuel D.; Wu, Jianbo; Lo, Jonathan; Smith Callahan, Laura A.; Li, Yong; Huard, Johnny; Darabi, Radbod

2018-01-01

Volumetric muscle defect, caused by trauma or combat injuries, is a major health concern leading to severe morbidity. It is characterized by partial or full thickness loss of muscle and its bio-scaffold, resulting in extensive fibrosis and scar formation. Therefore, the ideal therapeutic option is to use stem cells combined with bio-scaffolds to restore muscle. For this purpose, muscle-derived stem cells (MDSCs) are a great candidate due to their unique multi-lineage differentiation potential. In this study, we evaluated the regeneration potential of MDSCs for muscle loss repair using a novel in situ fibrin gel casting. Muscle defect was created by a partial thickness wedge resection in the tibialis anterior (TA)muscles of NSG mice which created an average of 25% mass loss. If untreated, this defect leads to severe muscle fibrosis. Next, MDSCs were delivered using a novel in situ fibrin gel casting method. Our results demonstrated MDSCs are able to engraft and form new myofibers in the defect when casted along with fibrin gel. LacZ labeled MDSCs were able to differentiate efficiently into new myofibers and significantly increase muscle mass. This was also accompanied by significant reduction of fibrotic tissue in the engrafted muscles. Furthermore, transplanted cells also contributed to new vessel formation and satellite cell seeding. These results confirmed the therapeutic potential of MDSCs and feasibility of direct in situ casting of fibrin/MDSC mixture to repair muscle mass defects. PMID:29331939

Fate-mapping the mammalian hindbrain: segmental origins of vestibular projection neurons assessed using rhombomere-specific Hoxa2 enhancer elements in the mouse embryo.

PubMed

Pasqualetti, Massimo; Díaz, Carmen; Renaud, Jean-Sébastien; Rijli, Filippo M; Glover, Joel C

2007-09-05

As a step toward generating a fate map of identified neuron populations in the mammalian hindbrain, we assessed the contributions of individual rhombomeres to the vestibular nuclear complex, a major sensorimotor area that spans the entire rhombencephalon. Transgenic mice harboring either the lacZ or the enhanced green fluorescent protein reporter genes under the transcriptional control of rhombomere-specific Hoxa2 enhancer elements were used to visualize rhombomere-derived domains. We labeled functionally identifiable vestibular projection neuron groups retrogradely with conjugated dextran-amines at successive embryonic stages and obtained developmental fate maps through direct comparison with the rhombomere-derived domains in the same embryos. The fate maps show that each vestibular neuron group derives from a unique rostrocaudal domain that is relatively stable developmentally, suggesting that anteroposterior migration is not a major contributor to the rostrocaudal patterning of the vestibular system. Most of the groups are multisegmental in origin, and each rhombomere is fated to give rise to two or more vestibular projection neuron types, in a complex pattern that is not segmentally iterated. Comparison with studies in the chicken embryo shows that the rostrocaudal patterning of identified vestibular projection neuron groups is generally well conserved between avians and mammalians but that significant species-specific differences exist in the rostrocaudal limits of particular groups. This mammalian hindbrain fate map can be used as the basis for targeting genetic manipulation to specific subpopulations of vestibular projection neurons.

78 FR 19024 - Submission for Review: It's Time to Sign Up for Direct Deposit or Direct Express, RI 38-128

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-28

... OFFICE OF PERSONNEL MANAGEMENT Submission for Review: It's Time to Sign Up for Direct Deposit or Direct Express, RI 38-128 AGENCY: U.S. Office of Personnel Management. ACTION: 30-Day Notice and request... request (ICR) 3206-0226, It's Time to Sign Up for Direct Deposit or Direct Express. As required by the...

A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut+/pAOX1-lacZ strain

PubMed Central

2013-01-01

Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities under given oxygen supply. According to our results, β-galactosidase productivity could be improved about 40% using the optimally mixed feed. PMID:23565774

A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut⁺/pAOX1-lacZ strain.

PubMed

Niu, Hongxing; Jost, Laurent; Pirlot, Nathalie; Sassi, Hosni; Daukandt, Marc; Rodriguez, Christian; Fickers, Patrick

2013-04-08

One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Transient continuous cultures with a dilution rate of 0.023 h(-1) at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities under given oxygen supply. According to our results, β-galactosidase productivity could be improved about 40% using the optimally mixed feed.

In Your Face: Startle to Emotional Facial Expressions Depends on Face Direction.

PubMed

Åsli, Ole; Michalsen, Henriette; Øvervoll, Morten

2017-01-01

Although faces are often included in the broad category of emotional visual stimuli, the affective impact of different facial expressions is not well documented. The present experiment investigated startle electromyographic responses to pictures of neutral, happy, angry, and fearful facial expressions, with a frontal face direction (directed) and at a 45° angle to the left (averted). Results showed that emotional facial expressions interact with face direction to produce startle potentiation: Greater responses were found for angry expressions, compared with fear and neutrality, with directed faces. When faces were averted, fear and neutrality produced larger responses compared with anger and happiness. These results are in line with the notion that startle is potentiated to stimuli signaling threat. That is, a forward directed angry face may signal a threat toward the observer, and a fearful face directed to the side may signal a possible threat in the environment.

78 FR 32533 - Proposed Collection of Information: Direct Deposit, Go Direct, and Direct Express Sign-Up Forms

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-30

... Deposit, Go Direct, and Direct Express Sign-Up Forms AGENCY: Bureau of the Fiscal Service, Fiscal Service... ``Direct Deposit Sign-Up Form'', Form 1200 ``Go Direct Sign-Up Form for Direct Deposit of Federal Benefit... information described below: Title: Direct Deposit Sign-Up Form, and Go Direct Sign-Up Form, and Direct...

Activation of aminoimidazole carcinogens by nitrosation: mutagenicity and nucleotide adducts

PubMed Central

Zenser, Terry V.; Lakshmi, Vijaya M.; Schut, Herman A. J.; Zhou, Hui-jia; Josephy, P. David

2009-01-01

2-Amino-3-methylimidazo[4,5-f]quinoline (IQ) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are heterocyclic amines (HCA) derived from high temperature cooking of meat and thought to cause colon cancer in humans. Reactive nitrogen oxygen species, which are mediators of the inflammatory response, can convert these amines to the corresponding N-nitrosamines, N-NO-IQ and N-NO-MeIQx. This study was designed to evaluate whether these N-nitrosamines are genotoxic and could be responsible, in part, for the high incidence of colon cancer in individuals with colitis. Such an association would counsel reduced intake of well-done red meat by colitis patients. Mutagenicity was evaluated by reversion of a lacZ frameshift allele in three different E. coli strains. Strains DJ701 and DJ702 express recombinant (S. typhimurium) aromatic amine N-acetyltransferase; DJ702 also expresses recombinant human cytochrome P450 1A2 and NADPH-P450 reductase; and DJ2002 served as an N-acetyltransferase-negative control. In strain DJ701, N-NO-IQ and N-NO-MeIQx elicited dose-dependent mutagenicity, which was not further increased in DJ702. Neither nitrosamine was mutagenic in strain DJ2002. While both N-nitrosamines are stable for >4 hours (pH 7.4, 37°C), they react with DNA or 2′-deoxyguanosine 3′-monophosphate at lower pH (5.5) to form adducts. HOCl, a component of the inflammatory response, increased adduct formation, as measured by 32P-postlabeling. Following treatment with nuclease P1 and separation by two-dimensional thin-layer chromatography and then HPLC, N-NO-IQ and N-NO-MeIQx were shown to form the same adducts as those formed by N-OH-MeIQx or N-OH-IQ, namely N-(deoxyguanosin-8-yl) adducts. In summary, these N-nitrosamines are genotoxic and might be alternatives to their hydroxylamine analogues as activated intermediates leading to initiation of colon cancer in individuals with colitis. PMID:19449459

A minimal model of epithelial tissue dynamics and its application to the corneal epithelium

NASA Astrophysics Data System (ADS)

Henkes, Silke; Matoz-Fernandez, Daniel; Kostanjevec, Kaja; Coburn, Luke; Sknepnek, Rastko; Collinson, J. Martin; Martens, Kirsten

Epithelial cell sheets are characterized by a complex interplay of active drivers, including cell motility, cell division and extrusion. Here we construct a particle-based minimal model tissue with only division/death dynamics and show that it always corresponds to a liquid state with a single dynamic time scale set by the division rate, and that no glassy phase is possible. Building on this, we construct an in-silico model of the mammalian corneal epithelium as such a tissue confined to a hemisphere bordered by the limbal stem cell zone. With added cell motility dynamics we are able to explain the steady-state spiral migration on the cornea, including the central vortex defect, and quantitatively compare it to eyes obtained from mice that are X-inactivation mosaic for LacZ.

PAH1-encoded Phosphatidate Phosphatase Plays a Role in the Growth Phase- and Inositol-mediated Regulation of Lipid Synthesis in Saccharomyces cerevisiae*

PubMed Central

Pascual, Florencia; Soto-Cardalda, Aníbal; Carman, George M.

2013-01-01

In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids in the exponential phase of growth occurs at the expense of the storage lipid triacylglycerol. As exponential phase cells progress into the stationary phase, the synthesis of triacylglycerol occurs at the expense of phospholipids. Early work indicates a role of the phosphatidate phosphatase (PAP) in this metabolism; the enzyme produces the diacylglycerol needed for the synthesis of triacylglycerol and simultaneously controls the level of phosphatidate for the synthesis of phospholipids. Four genes (APP1, DPP1, LPP1, and PAH1) encode PAP activity in yeast, and it has been unclear which gene is responsible for the synthesis of triacylglycerol throughout growth. An analysis of lipid synthesis and composition, as well as PAP activity in various PAP mutant strains, showed the essential role of PAH1 in triacylglycerol synthesis throughout growth. Pah1p is a phosphorylated enzyme whose in vivo function is dependent on its dephosphorylation by the Nem1p-Spo7p protein phosphatase complex. nem1Δ mutant cells exhibited defects in triacylglycerol synthesis and lipid metabolism that mirrored those imparted by the pah1Δ mutation, substantiating the importance of Pah1p dephosphorylation throughout growth. An analysis of cells bearing PPAH1-lacZ and PPAH1-DPP1 reporter genes showed that PAH1 expression was induced throughout growth and that the induction in the stationary phase was stimulated by inositol supplementation. A mutant analysis indicated that the Ino2p/Ino4p/Opi1p regulatory circuit and transcription factors Gis1p and Rph1p mediated this regulation. PMID:24196957

BAPJ69-4A: a yeast two-hybrid strain for both positive and negative genetic selection.

PubMed

Shaffer, Hally Anne; Rood, Michael Kenneth; Kashlan, Badar; Chang, Eileen I-ling; Doyle, Donald Francis; Azizi, Bahareh

2012-10-01

Genetic selection systems, such as the yeast two-hybrid system, are efficient methods to detect protein-protein and protein-ligand interactions. These systems have been further developed to assess negative interactions, such as inhibition, using the URA3 genetic selection marker. Previously, chemical complementation was used to assess positive selection in Saccharomyces cerevisiae. In this work, a new S. cerevisiae strain, called BAPJ69-4A, containing three selective markers ADE2, HIS3, and URA3 as well as the lacZ gene controlled by Gal4 response elements, was developed and characterized using the retinoid X receptor (RXR) and its ligand 9-cis retinoic acid (9cRA). Further characterization was performed using RXR variants and the synthetic ligand LG335. To assess the functionality of the strain, RXR was compared to the parent strain PJ69-4A in adenine, histidine, and uracil selective media. In positive selection, associating partners that lead to cell growth were observed in all media in the presence of ligand, whereas partners that did not associate due to the absence of ligand displayed no growth. Conversely, in negative selection, partners that did not associate in 5-FOA medium did not display cell death due to the lack of expression of the URA3 gene. The creation of the BAPJ69-4A yeast strain provides a high-throughput selection system, called negative chemical complementation, which can be used for both positive and negative selection, providing a fast, powerful tool for discovering novel ligand receptor pairs for applications in drug discovery and protein engineering. Copyright © 2012 Elsevier B.V. All rights reserved.

Genetic analysis of the Rhizobium meliloti bacA gene: functional interchangeability with the Escherichia coli sbmA gene and phenotypes of mutants.

PubMed Central

Ichige, A; Walker, G C

1997-01-01

The Rhizobium meliloti bacA gene encodes a function that is essential for bacterial differentiation into bacteroids within plant cells in the symbiosis between R. meliloti and alfalfa. An Escherichia coli homolog of BacA, SbmA, is implicated in the uptake of microcin B17, microcin J25 (formerly microcin 25), and bleomycin. When expressed in E. coli with the lacZ promoter, the R. meliloti bacA gene was found to suppress all the known defects of E. coli sbmA mutants, namely, increased resistance to microcin B17, microcin J25, and bleomycin, demonstrating the functional similarity between the two proteins. The R. meliloti bacA386::Tn(pho)A mutant, as well as a newly constructed bacA deletion mutant, was found to show increased resistance to bleomycin. However, it also showed increased resistance to certain aminoglycosides and increased sensitivity to ethanol and detergents, suggesting that the loss of bacA function causes some defect in membrane integrity. The E. coli sbmA gene suppressed all these bacA mutant phenotypes as well as the Fix- phenotype when placed under control of the bacA promoter. Taken together, these results strongly suggest that the BacA and SbmA proteins are functionally similar and thus provide support for our previous hypothesis that BacA may be required for uptake of some compound that plays an important role in bacteroid development. However, the additional phenotypes of bacA mutants identified in this study suggest the alternative possibility that BacA may be needed for membrane integrity, which is likely to be critically important during the early stages of bacterial differentiation within plant cells. PMID:8982000

Construction and application of a Xanthomonas campestris CGMCC15155 strain that produces white xanthan gum.

PubMed

Dai, Xiaohui; Gao, Ge; Wu, Mengmeng; Wei, Weiying; Qu, Jianmei; Li, Guoqiang; Ma, Ting

2018-04-15

In the industrial production of xanthan gum using Xanthomonas campestris CGMCC15155, large amounts of ethanol are required to extract xanthan gum from the fermentation broth and remove xanthomonadin impurities. To reduce the amount of ethanol and the overall production cost of xanthan gum, a xanthomonadin-deficient strain of CGMCC15155 was constructed by inserting the Vitreoscilla globin (vgb) gene, under the control of the LacZ promoter, into the region of the pigA gene, which is involved in xanthomonadin synthesis. The insertion of vgb inactivated pigA, resulting in the production of white xanthan gum. The lack of xanthomonadins resulted in a decreased yield of xanthan gum. However, the expression product of vgb gene, VHb, could increase the metabolism of X. campestris, which allowed the production of xanthan gum to reach wild-type levels in the engineered strain. The yield, molecular weight, and rheological properties of the xanthan gum synthesized by the engineered and wild-type bacteria were essentially the same. When the same volume of ethanol was used, the whiteness values of the xanthan gum extracted from engineered and wild-type bacteria were 65.20 and 38.17, respectively. To extract xanthan gum with the same whiteness, three and seven times the fermentation volume of ethanol was required for the engineered and wild-type strains, respectively. Thus, the engineered train reduced the requirement for ethanol in xanthan gum production by 133.3%. The results demonstrated that the engineered bacteria used less ethanol, thus reducing the downstream processing cost in xanthan gum production. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Rosuvastatin reduces atherosclerotic lesions and promotes progenitor cell mobilisation and recruitment in apolipoprotein E knockout mice.

PubMed

Schroeter, Marco R; Humboldt, Tim; Schäfer, Katrin; Konstantinides, Stavros

2009-07-01

Statins enhance incorporation of bone marrow-derived cells into experimental neointimal lesions. However, the contribution of progenitor cells to progression of spontaneous atherosclerotic plaques, and the possible modulatory role of statins in this process, remain poorly understood. We compared the effects of rosuvastatin (1 and 10mg/kg BW) and pravastatin (10mg/kg) on progenitor cell mobilisation, recruitment into atherosclerotic plaques, and lesion growth. Statins were administered over 8 weeks to apolipoprotein E knockout mice on atherogenic diet. In addition, mice were lethally irradiated, followed by transplantation of bone marrow from LacZ transgenic mice. Rosuvastatin reduced lesion area and intima-to-media ratio at the brachiocephalic artery compared to vehicle, while both parameters were not significantly altered by pravastatin. Rosuvastatin also augmented endothelialisation (P<0.05) and reduced the smooth muscle cells (SMC) content (P=0.042) of lesions. Numbers of c-kit, sca-1 and flk-1, sca-1 double-positive progenitor cells were significantly increased in rosuvastatin compared to control-treated mice, both in the bone marrow and the peripheral blood. Similarly, the number of spleen-derived acLDL, lectin double-positive progenitor cells (P=0.001) and colony-forming units (P=0.0104) was significantly increased in mice treated with rosuvastatin compared to vehicle alone. In the bone marrow, increased Akt and p42/44 MAP kinase phosphorylation and upregulated SDF1alpha mRNA expression were observed. Importantly, rosuvastatin treatment also increased the plasma levels of c-kit ligand (P=0.003), and the number of c-kit-positive cells within atherosclerotic lesions (P=0.041). Our findings suggest that rosuvastatin reduces the size of atherosclerotic plaques, and this effect appears to involve progenitor cell mobilisation and recruitment into vascular lesions.

Magnetic nanoparticles as a new approach to improve the efficacy of gene therapy against differentiated human uterine fibroid cells and tumor-initiating stem cells

PubMed Central

Shalaby, Shahinaz Mahmood; Khater, Mostafa K; Mas Perucho, Aymara; Mohamed, Sara A; Helwa, Inas; Laknaur, Archana; Lebedyeva, Iryna; Liu, Yutao; Diamond, Michael P; Al-Hendy, Ayman A

2016-01-01

Uterine fibroid(s) (UF/UFs) are benign tumors commonly found in women of reproductive age. The long-term outcomes of myomectomies are often hampered by high rates of recurrence (up to 60%). Objective To study whether efficient transduction and subsequent elimination of fibroid tumor initiating stem cells during debulking of tumor cells will aid in completely eradicating the tumor as well as decreasing the likelihood of recurrence. Design We have developed a localized non-surgical adenovirus-based alternative for the treatment of UFs. Combining viral based gene delivery with nanotechnology provides an opportunity to develop more efficient targeted viral gene therapy. Magnetic nanoparticles (MNPs) complexed to adenovirus, in the presence of an external magnetic field, accelerate adenovirus transduction. Setting Research laboratory located in Georgia Regents University, an academic research institution. Patients N/A Interventions MNPs complexed to adenovirus (AD GFP) or (AD LacZ) were used to transfect differentiated human fibroid cells in vitro. Main Outcome Measures rate of transduction and tumor growth inhibition. Results We observed a significant increase in transduction efficiency among differentiated human fibroid cells at 2 different multiplicities of infection (MOI); 1 and 10 respectively, with MNPs as compared to adenovirus-alone. Human fibroid stem cells transfected with AD-LacZ expressed β-Galactosidaze at (MOI) of 1, 10, and 50 at percentages of 19%, 62%, and 90%, respectively, which were significantly enhanced with MNPs. Conclusion When applied with adenovirus herpes simplex thymidine kinase, magnetofection significantly suppressed proliferation and induced apoptosis in both cell types. Through the use of magnetofection, we will prove that a lower viral dose will effectively increase the overall safety profile of suicide gene therapy against fibroid tumors. PMID:27020169

Cytotoxicity and gene induction by some essential oils in the yeast Saccharomyces cerevisiae.

PubMed

Bakkali, F; Averbeck, S; Averbeck, D; Zhiri, A; Idaomar, M

2005-08-01

In order to get an insight into the possible genotoxicity of essential oils (EOs) used in traditional pharmacological applications we tested five different oils extracted from the medicinal plants Origanum compactum, Coriandrum sativum, Artemisia herba alba, Cinnamomum camphora (Ravintsara aromatica) and Helichrysum italicum (Calendula officinalis) for genotoxic effects using the yeast Saccharomyces cerevisiae. Clear cytotoxic effects were observed in the diploid yeast strain D7, with the cells being more sensitive to EOs in exponential than in stationary growth phase. The cytotoxicity decreased in the following order: Origanum compactum>Coriandrum sativum>Artemisia herba alba>Cinnamomum camphora>Helichrysum italicum. In the same order, all EOs, except that derived from Helichrysum italicum, clearly induced cytoplasmic petite mutations indicating damage to mitochondrial DNA. However, no nuclear genetic events such as point mutations or mitotic intragenic or intergenic recombination were induced. The capacity of EOs to induce nuclear DNA damage-responsive genes was tested using suitable Lac-Z fusion strains for RNR3 and RAD51, which are genes involved in DNA metabolism and DNA repair, respectively. At equitoxic doses, all EOs demonstrated significant gene induction, approximately the same as that caused by hydrogen peroxide, but much lower than that caused by methyl methanesulfonate (MMS). EOs affect mitochondrial structure and function and can stimulate the transcriptional expression of DNA damage-responsive genes. The induction of mitochondrial damage by EOs appears to be closely linked to overall cellular cytotoxicity and appears to mask the occurrence of nuclear genetic events. EO-induced cytotoxicity involves oxidative stress, as is evident from the protection observed in the presence of ROS inhibitors such as glutathione, catalase or the iron-chelating agent deferoxamine.

Magel2 knockout mice manifest altered social phenotypes and a deficit in preference for social novelty.

PubMed

Fountain, M D; Tao, H; Chen, C-A; Yin, J; Schaaf, C P

2017-07-01

MAGEL2 is one of five protein-coding, maternally imprinted, paternally expressed genes in the Prader-Willi syndrome (PWS)-critical domain on chromosome 15q11-q13. Truncating pathogenic variants of MAGEL2 cause Schaaf-Yang syndrome (SHFYNG) (OMIM #615547), a neurodevelopmental disorder related to PWS. Affected individuals manifest a spectrum of neurocognitive and behavioral phenotypes, including intellectual disability and autism spectrum disorder (ASD). Magel2 knockout mice carrying a maternally inherited, imprinted wild-type (WT) allele and a paternally inherited Magel2-lacZ knock-in allele, which abolishes endogenous Magel2 gene function, exhibit several features reminiscent of the human Prader-Willi phenotypes, including neonatal growth retardation, excessive weight gain after weaning and increased adiposity in adulthood. They were shown to have altered circadian rhythm, reduced motor activity and reduced fertility. An extensive assessment for autism-like behaviors in this mouse model was warranted, because of the high prevalence of ASD in human patients. The behavior of Magel2 knockout mice and their WT littermates were assayed via open field, elevated plus maze, tube, three-chamber and partition tests. Our studies confirm decreased horizontal activity of male and female mice and increased vertical activity of females, in the open field. Both sexes spent more time in the open arm of the elevated plus maze, suggestive of reductions in anxiety. Both sexes displayed a lack of preference for social novelty, via a lack of discrimination between known and novel partners in the partition test. The in-depth investigation of behavioral profiles caused by Magel2 loss-of-function helps to elucidate the etiology of behavioral phenotypes both for SHFYNG and PWS in general. © 2017 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Estimating P-coverage of biosynthetic pathways in DNA libraries and screening by genetic selection: biotin biosynthesis in the marine microorganism Chromohalobacter.

PubMed

Kim, Eun Jin; Angell, Scott; Janes, Jeff; Watanabe, Coran M H

2008-06-01

Traditional approaches to natural product discovery involve cell-based screening of natural product extracts followed by compound isolation and characterization. Their importance notwithstanding, continued mining leads to depletion of natural resources and the reisolation of previously identified metabolites. Metagenomic strategies aimed at localizing the biosynthetic cluster genes and expressing them in surrogate hosts offers one possible alternative. A fundamental question that naturally arises when pursuing such a strategy is, how large must the genomic library be to effectively represent the genome of an organism(s) and the biosynthetic gene clusters they harbor? Such an issue is certainly augmented in the absence of expensive robotics to expedite colony picking and/or screening of clones. We have developed an algorism, named BPC (biosynthetic pathway coverage), supported by molecular simulations to deduce the number of BAC clones required to achieve proper coverage of the genome and their respective biosynthetic pathways. The strategy has been applied to the construction of a large-insert BAC library from a marine microorganism, Hon6 (isolated from Honokohau, Maui) thought to represent a new species. The genomic library is constructed with a BAC yeast shuttle vector pClasper lacZ paving the way for the culturing of libraries in both prokaryotic and eukaryotic hosts. Flow cytometric methods are utilized to estimate the genome size of the organism and BPC implemented to assess P-coverage or percent coverage. A genetic selection strategy is illustrated, applications of which could expedite screening efforts in the identification and localization of biosynthetic pathways from marine microbial consortia, offering a powerful complement to genome sequencing and degenerate probe strategies. Implementing this approach, we report on the biotin biosynthetic pathway from the marine microorganism Hon6.

Volumetric muscle loss injury repair using in situ fibrin gel cast seeded with muscle-derived stem cells (MDSCs).

PubMed

Matthias, Nadine; Hunt, Samuel D; Wu, Jianbo; Lo, Jonathan; Smith Callahan, Laura A; Li, Yong; Huard, Johnny; Darabi, Radbod

2018-03-01

Volumetric muscle defect, caused by trauma or combat injuries, is a major health concern leading to severe morbidity. It is characterized by partial or full thickness loss of muscle and its bio-scaffold, resulting in extensive fibrosis and scar formation. Therefore, the ideal therapeutic option is to use stem cells combined with bio-scaffolds to restore muscle. For this purpose, muscle-derived stem cells (MDSCs) are a great candidate due to their unique multi-lineage differentiation potential. In this study, we evaluated the regeneration potential of MDSCs for muscle loss repair using a novel in situ fibrin gel casting. Muscle defect was created by a partial thickness wedge resection in the tibialis anterior (TA) muscles of NSG mice which created an average of 25% mass loss. If untreated, this defect leads to severe muscle fibrosis. Next, MDSCs were delivered using a novel in situ fibrin gel casting method. Our results demonstrated MDSCs are able to engraft and form new myofibers in the defect when casted along with fibrin gel. LacZ labeled MDSCs were able to differentiate efficiently into new myofibers and significantly increase muscle mass. This was also accompanied by significant reduction of fibrotic tissue in the engrafted muscles. Furthermore, transplanted cells also contributed to new vessel formation and satellite cell seeding. These results confirmed the therapeutic potential of MDSCs and feasibility of direct in situ casting of fibrin/MDSC mixture to repair muscle mass defects. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Does Gaze Direction Modulate Facial Expression Processing in Children with Autism Spectrum Disorder?

ERIC Educational Resources Information Center

Akechi, Hironori; Senju, Atsushi; Kikuchi, Yukiko; Tojo, Yoshikuni; Osanai, Hiroo; Hasegawa, Toshikazu

2009-01-01

Two experiments investigated whether children with autism spectrum disorder (ASD) integrate relevant communicative signals, such as gaze direction, when decoding a facial expression. In Experiment 1, typically developing children (9-14 years old; n = 14) were faster at detecting a facial expression accompanying a gaze direction with a congruent…

77 FR 66190 - Submission for Review: It's Time To Sign Up for Direct Deposit or Direct Express, RI 38-128

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-02

... OFFICE OF PERSONNEL MANAGEMENT Submission for Review: It's Time To Sign Up for Direct Deposit or... request (ICR) 3206-0226, It's Time To Sign up for Direct Deposit or Direct Express. As required by the..., Retirement Services, Office of Personnel Management. Title: It's Time To Sign Up for Direct Deposit or Direct...

Abstract knowledge versus direct experience in processing of binomial expressions

PubMed Central

Morgan, Emily; Levy, Roger

2016-01-01

We ask whether word order preferences for binomial expressions of the form A and B (e.g. bread and butter) are driven by abstract linguistic knowledge of ordering constraints referencing the semantic, phonological, and lexical properties of the constituent words, or by prior direct experience with the specific items in questions. Using forced-choice and self-paced reading tasks, we demonstrate that online processing of never-before-seen binomials is influenced by abstract knowledge of ordering constraints, which we estimate with a probabilistic model. In contrast, online processing of highly frequent binomials is primarily driven by direct experience, which we estimate from corpus frequency counts. We propose a trade-off wherein processing of novel expressions relies upon abstract knowledge, while reliance upon direct experience increases with increased exposure to an expression. Our findings support theories of language processing in which both compositional generation and direct, holistic reuse of multi-word expressions play crucial roles. PMID:27776281

Novel Fe3+-Based 1H MRI β-Galactosidase Reporter Molecules**

PubMed Central

Yu, Jian-Xin; Gulaka, Praveen K.; Liu, Li; Kodibagkar, Vikram D.; Mason, Ralph P.

2012-01-01

There is increasing interest in the development of reporter agents to reveal enzyme activity in vivo using small animal imaging. We have previously demonstrated the feasibility of detecting lacZ gene activity using the commercially available 3,4-cyclohexenoesculetin-β-D-galactopyranoside (S-Gal™) as a 1H MRI reporter. Specifically, β-galactosidase (β-gal) releases the aglycone, which forms an MR contrast-inducing paramagnetic precipitate in the presence of Fe3+. Contrast was primarily T2-weighted signal loss, but T1 effects were also observed. Since T1-contrast generally provides signal enhancement as opposed to loss, it appeared attractive to explore whether analogues could be generated with enhanced characteristics. We now report the design and successful synthesis of novel analogues together with characterization of 1H MRI contrast based on both T1 and T2 response to β-gal activity in vitro for the lead agent. PMID:23807909

Synergic in vitro combinations of artemisinin, pyrimethamine and methylene blue against Neospora caninum.

PubMed

Pereira, Luiz Miguel; de Luca, Gabriela; Abichabki, Nathália de Lima Martins; Bronzon da Costa, Cássia Mariana; Yatsuda, Ana Patrícia

2018-01-15

Neospora caninum is a member of Apicomplexa phylum, the causative agent of neosporosis. The neosporosis combat is not well established and several strategies related to vaccine, chemotherapy and immune modulation are under development. In this work, we evaluated the effects of artemisinin (Art), methylene blue (MB) and pyrimethamine (Pyr) alone or associated, on N. caninum proliferation and elimination using LacZ tagged tachyzoites. The reactive oxygen species (ROS) production after incubation with Art were also performed. Our results indicate that combinations of classical antimalarial drugs improve the parasite control, allowing the use of three drugs in a single dose. Additionally, artemisinin demonstrated distinct ROS production patterns in intra and extracellular N. caninum forms. The drug repurposing appears as a suitable approach, allowing a fast and safe method to evaluate old drugs but novel candidates against neosporosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Bus Service Planning for Orlando's Southwest Direct Express Demonstration

DOT National Transportation Integrated Search

1985-04-01

This report describes a set of service planning activities undertaken in the

Anxiety and sensitivity to gaze direction in emotionally expressive faces.

PubMed

Fox, Elaine; Mathews, Andrew; Calder, Andrew J; Yiend, Jenny

2007-08-01

This study investigated the role of neutral, happy, fearful, and angry facial expressions in enhancing orienting to the direction of eye gaze. Photographs of faces with either direct or averted gaze were presented. A target letter (T or L) appeared unpredictably to the left or the right of the face, either 300 ms or 700 ms after gaze direction changed. Response times were faster in congruent conditions (i.e., when the eyes gazed toward the target) relative to incongruent conditions (when the eyes gazed away from the target letter). Facial expression did influence reaction times, but these effects were qualified by individual differences in self-reported anxiety. High trait-anxious participants showed an enhanced orienting to the eye gaze of faces with fearful expressions relative to all other expressions. In contrast, when the eyes stared straight ahead, trait anxiety was associated with slower responding when the facial expressions depicted anger. Thus, in anxiety-prone people attention is more likely to be held by an expression of anger, whereas attention is guided more potently by fearful facial expressions. ((c) 2007 APA, all rights reserved).

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment.

PubMed

Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A

2013-03-22

Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations.

Reconstructing directed gene regulatory network by only gene expression data.

PubMed

Zhang, Lu; Feng, Xi Kang; Ng, Yen Kaow; Li, Shuai Cheng

2016-08-18

Accurately identifying gene regulatory network is an important task in understanding in vivo biological activities. The inference of such networks is often accomplished through the use of gene expression data. Many methods have been developed to evaluate gene expression dependencies between transcription factor and its target genes, and some methods also eliminate transitive interactions. The regulatory (or edge) direction is undetermined if the target gene is also a transcription factor. Some methods predict the regulatory directions in the gene regulatory networks by locating the eQTL single nucleotide polymorphism, or by observing the gene expression changes when knocking out/down the candidate transcript factors; regrettably, these additional data are usually unavailable, especially for the samples deriving from human tissues. In this study, we propose the Context Based Dependency Network (CBDN), a method that is able to infer gene regulatory networks with the regulatory directions from gene expression data only. To determine the regulatory direction, CBDN computes the influence of source to target by evaluating the magnitude changes of expression dependencies between the target gene and the others with conditioning on the source gene. CBDN extends the data processing inequality by involving the dependency direction to distinguish between direct and transitive relationship between genes. We also define two types of important regulators which can influence a majority of the genes in the network directly or indirectly. CBDN can detect both of these two types of important regulators by averaging the influence functions of candidate regulator to the other genes. In our experiments with simulated and real data, even with the regulatory direction taken into account, CBDN outperforms the state-of-the-art approaches for inferring gene regulatory network. CBDN identifies the important regulators in the predicted network: 1. TYROBP influences a batch of genes that are related to Alzheimer's disease; 2. ZNF329 and RB1 significantly regulate those 'mesenchymal' gene expression signature genes for brain tumors. By merely leveraging gene expression data, CBDN can efficiently infer the existence of gene-gene interactions as well as their regulatory directions. The constructed networks are helpful in the identification of important regulators for complex diseases.

IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis

PubMed Central

Fan, Di; Dai, Yan; Wang, Xuncheng; Wang, Zhenjie; He, Hang; Yang, Hongchun; Cao, Ying; Deng, Xing Wang; Ma, Ligeng

2012-01-01

Small RNA-directed DNA methylation (RdDM) is an important epigenetic pathway in Arabidopsis that controls the expression of multiple genes and several developmental processes. RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3) are necessary factors in 24-nt small interfering RNA (siRNA) biogenesis, which is part of the RdDM pathway. Here, we found that Increase in BONSAI Methylation 1 (IBM1), a conserved JmjC family histone demethylase, is directly associated with RDR2 and DCL3 chromatin. The mutation of IBM1 induced the hypermethylation of H3K9 and DNA non-CG sites within RDR2 and DCL3, which repressed their expression. A genome-wide analysis suggested that the reduction in RDR2 and DCL3 expression affected siRNA biogenesis in a locus-specific manner and disrupted RdDM-directed gene repression. Together, our results suggest that IBM1 regulates gene expression through two distinct pathways: direct association to protect genes from silencing by preventing the coupling of histone and DNA methylation, and indirect silencing of gene expression through RdDM-directed repression. PMID:22772985

Synergetic effect of yeast cell-surface expression of cellulase and expansin-like protein on direct ethanol production from cellulose

PubMed Central

2013-01-01

Background Numerous studies have examined the direct fermentation of cellulosic materials by cellulase-expressing yeast; however, ethanol productivity in these systems has not yet reached an industrial level. Certain microorganisms, such as the cellulolytic fungus Trichoderma reesei, produce expansin-like proteins, which have a cellulose-loosening effect that may increase the breakdown of cellulose. Here, to improve the direct conversion of cellulose to ethanol, yeast Saccharomyces cerevisiae co-displaying cellulase and expansin-like protein on the cell surface were constructed and examined for direct ethanol fermentation performance. Results The cellulase and expansin-like protein co-expressing strain showed 246 mU/g-wet cell of phosphoric acid swollen cellulose (PASC) degradation activity, which corresponded to 2.9-fold higher activity than that of a cellulase-expressing strain. This result clearly demonstrated that yeast cell-surface expressed cellulase and expansin-like protein act synergistically to breakdown cellulose. In fermentation experiments examining direct ethanol production from PASC, the cellulase and expansin-like protein co-expressing strain produced 3.4 g/L ethanol after 96 h of fermentation, a concentration that was 1.4-fold higher than that achieved by the cellulase-expressing strain (2.5 g/L). Conclusions The PASC degradation and fermentation ability of an engineered yeast strain was markedly improved by co-expressing cellulase and expansin-like protein on the cell surface. To our knowledge, this is the first report to demonstrate the synergetic effect of co-expressing cellulase and expansin-like protein on a yeast cell surface, which may be a promising strategy for constructing direct ethanol fermenting yeast from cellulose. PMID:23835302

Revisiting the Relationship between the Processing of Gaze Direction and the Processing of Facial Expression

ERIC Educational Resources Information Center

Ganel, Tzvi

2011-01-01

There is mixed evidence on the nature of the relationship between the perception of gaze direction and the perception of facial expressions. Major support for shared processing of gaze and expression comes from behavioral studies that showed that observers cannot process expression or gaze and ignore irrelevant variations in the other dimension.…

Influence of methanol/sorbitol co-feeding rate on pAOX1 induction in a Pichia pastoris Mut+ strain in bioreactor with limited oxygen transfer rate.

PubMed

Carly, F; Niu, H; Delvigne, F; Fickers, P

2016-04-01

High Pichia pastoris biomass density could be obtained using high co-feeding rate of methanol and sorbitol in a fed-batch or continuous culture, while further higher feeding rate finally leads to oxygen limitation in bioreactor. In the literature, there is lack of report about AOX1 promoter regulation with regard to dissolved oxygen level (DO). Therefore, in this work, chemostat cultures were performed to investigate the cell growth, metabolism and regulation of the AOX1 promoter (pAOX1) regarding co-feeding rate of optimized methanol/sorbitol mixture (methanol fraction 0.60 C-mol/C-mol) using a P. pastoris Mut+/pAOX1-lacZ strain. The oxygen transfer rates (OTR) in bioreactor were kept in the range of typical values of large bioreactor, i.e., 4-8 g/(L h) if DO equals 30 % saturation or 5-10 g/(L h) if DO nears zero. For DO >0, an increase of the carbon fed led to an increase of pAOX1 induction. By contrast, when dissolved oxygen was completely depleted, methanol accumulated, causing a 30 % decrease of pAOX1 induction. However, this decrease is more likely to be lined to methanol accumulation than to low level of dissolved oxygen (<4 % DO). Methanol/sorbitol co-feeding allowed cells to adapt to oxygen transient limitations that often occur at industrial scale with reduced effect on pAOX1 induction. The optimal feeding rate tested here was 6.6 mmol C (DCW h)(-1) at an OTR of 8.28 g O2(L h)(-1) with over fivefold pAOX1 induction (probably directly associated with target protein productivity) compared with previous work.

Self-Relevance Appraisal Influences Facial Reactions to Emotional Body Expressions

PubMed Central

Grèzes, Julie; Philip, Léonor; Chadwick, Michèle; Dezecache, Guillaume; Soussignan, Robert; Conty, Laurence

2013-01-01

People display facial reactions when exposed to others' emotional expressions, but exactly what mechanism mediates these facial reactions remains a debated issue. In this study, we manipulated two critical perceptual features that contribute to determining the significance of others' emotional expressions: the direction of attention (toward or away from the observer) and the intensity of the emotional display. Electromyographic activity over the corrugator muscle was recorded while participants observed videos of neutral to angry body expressions. Self-directed bodies induced greater corrugator activity than other-directed bodies; additionally corrugator activity was only influenced by the intensity of anger expresssed by self-directed bodies. These data support the hypothesis that rapid facial reactions are the outcome of self-relevant emotional processing. PMID:23405230

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

Biological impact of low dose-rate simulated solar particle event radiation in vivo.

PubMed

Chang, P Y; Doppalapudi, R; Bakke, J; Wang, A; Menda, S; Davis, Z

2010-08-01

C57Bl6-lacZ animals were exposed to a range of low dose-rate simulated solar particle event (sSPE) radiation at the NASA-sponsored Research Laboratory (NSRL) at Brookhaven National Laboratory (BNL). Peripheral blood was harvested from animals from 1 to 12 days after total body irradiation (TBI) to quantify the level of circulating reticulocytes (RET) and micronucleated reticulocytes (MN-RET) as an early indicator of radiation-induced genotoxicity. Bone marrow lymphocytes and hippocampal tissues from each animal were collected at 12 days and up to two months, to evaluate dose-dependent late effects after sSPE exposure. Early hematopoietic changes show that the % RET was reduced up to 3 days in response to radiation exposure but recovered at 12 days postirradiation. The % MN-RET in peripheral blood was temporally regulated and dependant on the total accumulated dose. Total chromosome aberrations in lymphocytes increased linearly with dose within a week after radiation and remained significantly higher than the control values at 4 weeks after exposure. The level of aberrations in the irradiated animals returned to control levels by 8 weeks postirradiation. Measurements of chromosome 2 and 8 specific aberrations indicate that, consistent with conventional giemsa-staining methods, the level of aberrations is also not significantly higher than in control animals at 8 weeks postirradiation. The hippocampus was surveyed for differential transcriptional regulation of genes known to be associated with neurogenesis. Our results showed differential expression of neurotrophin and their associated receptor genes within 1 week after sSPE exposure. Progressive changes in the profile of expressed genes known to be involved in neurogenic signaling pathways were dependent on the sSPE dose. Our results to date suggest that radiation-induced changes in the hematopoietic system, i.e., chromosome aberrations in lymphocytes, are transient and do not persist past 4 weeks after radiation. On the other hand, alteration in the profile of genes known to be involved in neurotrophic functions in the hippocampal tissue appears to persist for up to 8 weeks after radiation exposure. Such temporal changes confirm that, although cytogenetic changes after a single dose of low-dose and low-dose-rate protons appear to be transient, the impact of this exposure is sufficient to lead to persistent dynamic changes in neuronal tissues long after the initial radiation exposure.

Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

PubMed

Fukuzawa, M; Williams, J G

2000-06-01

The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

Affective Evaluations of Objects Are Influenced by Observed Gaze Direction and Emotional Expression

ERIC Educational Resources Information Center

Bayliss, Andrew P.; Frischen, Alexandra; Fenske, Mark J.; Tipper, Steven P.

2007-01-01

Gaze direction signals another person's focus of interest. Facial expressions convey information about their mental state. Appropriate responses to these signals should reflect their combined influence, yet current evidence suggests that gaze-cueing effects for objects near an observed face are not modulated by its emotional expression. Here, we…

Expressive/Exploratory Technical Writing (XTW) in Engineering: Shifting the Technical Writing Curriculum

ERIC Educational Resources Information Center

Warnock, Scott; Kahn, Michael

2007-01-01

While the importance of "expressive writing," or informal, self-directed writing, has been well established, teachers underutilize it, particularly in technical writing courses. We introduce the term expressive/exploratory technical writing (XTW), which is the use of informal, self-directed writing to problem-solve in technical fields. We describe…

Social communication with virtual agents: The effects of body and gaze direction on attention and emotional responding in human observers.

PubMed

Marschner, Linda; Pannasch, Sebastian; Schulz, Johannes; Graupner, Sven-Thomas

2015-08-01

In social communication, the gaze direction of other persons provides important information to perceive and interpret their emotional response. Previous research investigated the influence of gaze by manipulating mutual eye contact. Therefore, gaze and body direction have been changed as a whole, resulting in only congruent gaze and body directions (averted or directed) of another person. Here, we aimed to disentangle these effects by using short animated sequences of virtual agents posing with either direct or averted body or gaze. Attention allocation by means of eye movements, facial muscle response, and emotional experience to agents of different gender and facial expressions were investigated. Eye movement data revealed longer fixation durations, i.e., a stronger allocation of attention, when gaze and body direction were not congruent with each other or when both were directed towards the observer. This suggests that direct interaction as well as incongruous signals increase the demands of attentional resources in the observer. For the facial muscle response, only the reaction of muscle zygomaticus major revealed an effect of body direction, expressed by stronger activity in response to happy expressions for direct compared to averted gaze when the virtual character's body was directed towards the observer. Finally, body direction also influenced the emotional experience ratings towards happy expressions. While earlier findings suggested that mutual eye contact is the main source for increased emotional responding and attentional allocation, the present results indicate that direction of the virtual agent's body and head also plays a minor but significant role. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of Primary Transcriptional Regulation of Cell Cycle-Regulated Genes upon DNA Damage

PubMed Central

Zhou, Tong; Chou, Jeff; Mullen, Thomas E.; Elkon, Rani; Zhou, Yingchun; Simpson, Dennis A.; Bushel, Pierre R.; Paules, Richard S.; Lobenhofer, Edward K.; Hurban, Patrick; Kaufmann, William K.

2007-01-01

The changes in global gene expression in response to DNA damage may derive from either direct induction or repression by transcriptional regulation or indirectly by synchronization of cells to specific cell cycle phases, such as G1 or G2. We developed a model that successfully estimated the expression levels of >400 cell cycle-regulated genes in normal human fibroblasts based on the proportions of cells in each phase of the cell cycle. By isolating effects on the gene expression associated with the cell cycle phase redistribution after genotoxin treatment, the direct transcriptional target genes were distinguished from genes for which expression changed secondary to cell synchronization. Application of this model to ionizing radiation (IR)-treated normal human fibroblasts identified 150 of 406 cycle-regulated genes as putative direct transcriptional targets of IR-induced DNA damage. Changes in expression of these genes after IR treatment derived from both direct transcriptional regulation and cell cycle synchronization. PMID:17404513

Single-round selection yields a unique retroviral envelope utilizing GPR172A as its host receptor.

PubMed

Mazari, Peter M; Linder-Basso, Daniela; Sarangi, Anindita; Chang, Yehchung; Roth, Monica J

2009-04-07

The recognition by a viral envelope of its cognate host-cell receptor is the initial critical step in defining the viral host-range and tissue specificity. This study combines a single-round of selection of a random envelope library with a parallel cDNA screen for receptor function to identify a distinct retroviral envelope/receptor pair. The 11-aa targeting domain of the modified feline leukemia virus envelope consists of a constrained peptide. Critical to the binding of the constrained peptide envelope to its cellular receptor are a pair of internal cysteines and an essential Trp required for maintenance of titers >10(5) lacZ staining units per milliliter. The receptor used for viral entry is the human GPR172A protein, a G-protein-coupled receptor isolated from osteosarcoma cells. The ability to generate unique envelopes capable of using tissue- or disease-specific receptors marks an advance in the development of efficient gene-therapy vectors.

Adenovirus-mediated suppression of HMGI(Y) protein synthesis as potential therapy of human malignant neoplasias

PubMed Central

Scala, Stefania; Portella, Giuseppe; Fedele, Monica; Chiappetta, Gennaro; Fusco, Alfredo

2000-01-01

High mobility group I (HMGI) proteins are overexpressed in several human malignant tumors. We previously demonstrated that inhibition of HMGI synthesis prevents thyroid cell transformation. Here, we report that an adenovirus carrying the HMGI(Y) gene in an antisense orientation (Ad-Yas) induced programmed cell death of two human thyroid anaplastic carcinoma cell lines (ARO and FB-1), but not normal thyroid cells. The Ad-Yas virus led to death of lung, colon, and breast carcinoma cells. A control adenovirus carrying the lacZ gene did not inhibit the growth of either normal or neoplastic cells. Ad-Yas treatment of tumors induced in athymic mice by ARO cells caused a drastic reduction in tumor size. Therefore, suppression of HMGI(Y) protein synthesis by an HMGI(Y) antisense adenoviral vector may be a useful treatment strategy in a variety of human malignant neoplasias, in which HMGI(Y) gene overexpression is a general event. PMID:10759549

Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

PubMed

Wolter, R; Siede, W; Brendel, M

1996-02-05

The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

miR-25 modulates NSCLC cell radio-sensitivity through directly inhibiting BTG2 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Zhiwei, E-mail: carlhe@126.com; Liu, Yi, E-mail: cassieliu@126.com; Xiao, Bing, E-mail: rockg714@aliyun.com

2015-02-13

A large proportion of the NSCLC patients were insensitive to radiotherapy, but the exact mechanism is still unclear. This study explored the role of miR-25 in regulating sensitivity of NSCLC cells to ionizing radiation (IR) and its downstream targets. Based on measurement in tumor samples from NSCLC patients, this study found that miR-25 expression is upregulated in both NSCLC and radio-resistant NSCLC patients compared the healthy and radio-sensitive controls. In addition, BTG expression was found negatively correlated with miR-25a expression in the both tissues and cells. By applying luciferase reporter assay, we verified two putative binding sites between miR-25 andmore » BTG2. Therefore, BTG2 is a directly target of miR-25 in NSCLC cancer. By applying loss-and-gain function analysis in NSCLC cell lines, we demonstrated that miR-25-BTG2 axis could directly regulated BTG2 expression and affect radiotherapy sensitivity of NSCLC cells. - Highlights: • miR-25 is upregulated, while BTG2 is downregulated in radioresistant NSCLC patients. • miR-25 modulates sensitivity to radiation induced apoptosis. • miR-25 directly targets BTG2 and suppresses its expression. • miR-25 modulates sensitivity to radiotherapy through inhibiting BTG2 expression.« less

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Mutation at Tyrosine in AMLRY (GILRY Like) Motif of Yeast eRF1 on Nonsense Codons Suppression and Binding Affinity to eRF3

PubMed Central

Akhmaloka; Susilowati, Prima Endang; Subandi; Madayanti, Fida

2008-01-01

Termination translation in Saccharomyces cerevisiae is controlled by two interacting polypeptide chain release factors, eRF1 and eRF3. Two regions in human eRF1, position at 281-305 and position at 411-415, were proposed to be involved on the interaction to eRF3. In this study we have constructed and characterized yeast eRF1 mutant at position 410 (correspond to 415 human eRF1) from tyrosine to serine residue resulting eRF1(Y410S). The mutations did not affect the viability and temperature sensitivity of the cell. The stop codons suppression of the mutant was analyzed in vivo using PGK-stop codon-LACZ gene fusion and showed that the suppression of the mutant was significantly increased in all of codon terminations. The suppression on UAG codon was the highest increased among the stop codons by comparing the suppression of the wild type respectively. In vitro interaction between eRF1 (mutant and wild type) to eRF3 were carried out using eRF1-(His)6 and eRF1(Y410S)-(His)6 expressed in Escherichia coli and indigenous Saccharomyces cerevisiae eRF3. The results showed that the binding affinity of eRF1(Y410S) to eRF3 was decreased up to 20% of the wild type binding affinity. Computer modeling analysis using Swiss-Prot and Amber version 9.0 programs revealed that the overall structure of eRF1(Y410S) has no significant different with the wild type. However, substitution of tyrosine to serine triggered the structural change on the other motif of C-terminal domain of eRF1. The data suggested that increasing stop codon suppression and decreasing of the binding affinity of eRF1(Y410S) were probably due to the slight modification on the structure of the C-terminal domain. PMID:18463713

Endothelial cell repopulation after stenting determines in-stent neointima formation: effects of bare-metal vs. drug-eluting stents and genetic endothelial cell modification.

PubMed

Douglas, Gillian; Van Kampen, Erik; Hale, Ashley B; McNeill, Eileen; Patel, Jyoti; Crabtree, Mark J; Ali, Ziad; Hoerr, Robert A; Alp, Nicholas J; Channon, Keith M

2013-11-01

Understanding endothelial cell repopulation post-stenting and how this modulates in-stent restenosis is critical to improving arterial healing post-stenting. We used a novel murine stent model to investigate endothelial cell repopulation post-stenting, comparing the response of drug-eluting stents with a primary genetic modification to improve endothelial cell function. Endothelial cell repopulation was assessed en face in stented arteries in ApoE(-/-) mice with endothelial-specific LacZ expression. Stent deployment resulted in near-complete denudation of endothelium, but was followed by endothelial cell repopulation, by cells originating from both bone marrow-derived endothelial progenitor cells and from the adjacent vasculature. Paclitaxel-eluting stents reduced neointima formation (0.423 ± 0.065 vs. 0.240 ± 0.040 mm(2), P = 0.038), but decreased endothelial cell repopulation (238 ± 17 vs. 154 ± 22 nuclei/mm(2), P = 0.018), despite complete strut coverage. To test the effects of selectively improving endothelial cell function, we used transgenic mice with endothelial-specific overexpression of GTP-cyclohydrolase 1 (GCH-Tg) as a model of enhanced endothelial cell function and increased NO production. GCH-Tg ApoE(-/-) mice had less neointima formation compared with ApoE(-/-) littermates (0.52 ± 0.08 vs. 0.26 ± 0.09 mm(2), P = 0.039). In contrast to paclitaxel-eluting stents, reduced neointima formation in GCH-Tg mice was accompanied by increased endothelial cell coverage (156 ± 17 vs. 209 ± 23 nuclei/mm(2), P = 0.043). Drug-eluting stents reduce not only neointima formation but also endothelial cell repopulation, independent of strut coverage. In contrast, selective targeting of endothelial cell function is sufficient to improve endothelial cell repopulation and reduce neointima formation. Targeting endothelial cell function is a rational therapeutic strategy to improve vascular healing and decrease neointima formation after stenting.

An attenuated herpes simplex virus type 1 (HSV1) encoding the HIV-1 Tat protein protects mice from a deadly mucosal HSV1 challenge.

PubMed

Sicurella, Mariaconcetta; Nicoli, Francesco; Gallerani, Eleonora; Volpi, Ilaria; Berto, Elena; Finessi, Valentina; Destro, Federica; Manservigi, Roberto; Cafaro, Aurelio; Ensoli, Barbara; Caputo, Antonella; Gavioli, Riccardo; Marconi, Peggy C

2014-01-01

Herpes simplex virus types 1 and 2 (HSV1 and HSV2) are common infectious agents in both industrialized and developing countries. They cause recurrent asymptomatic and/or symptomatic infections, and life-threatening diseases and death in newborns and immunocompromised patients. Current treatment for HSV relies on antiviral medications, which can halt the symptomatic diseases but cannot prevent the shedding that occurs in asymptomatic patients or, consequently, the spread of the viruses. Therefore, prevention rather than treatment of HSV infections has long been an area of intense research, but thus far effective anti-HSV vaccines still remain elusive. One of the key hurdles to overcome in anti-HSV vaccine development is the identification and effective use of strategies that promote the emergence of Th1-type immune responses against a wide range of epitopes involved in the control of viral replication. Since the HIV1 Tat protein has several immunomodulatory activities and increases CTL recognition of dominant and subdominant epitopes of heterologous antigens, we generated and assayed a recombinant attenuated replication-competent HSV1 vector containing the tat gene (HSV1-Tat). In this proof-of-concept study we show that immunization with this vector conferred protection in 100% of mice challenged intravaginally with a lethal dose of wild-type HSV1. We demonstrate that the presence of Tat within the recombinant virus increased and broadened Th1-like and CTL responses against HSV-derived T-cell epitopes and elicited in most immunized mice detectable IgG responses. In sharp contrast, a similarly attenuated HSV1 recombinant vector without Tat (HSV1-LacZ), induced low and different T cell responses, no measurable antibody responses and did not protect mice against the wild-type HSV1 challenge. These findings strongly suggest that recombinant HSV1 vectors expressing Tat merit further investigation for their potential to prevent and/or contain HSV1 infection and dissemination.

An Attenuated Herpes Simplex Virus Type 1 (HSV1) Encoding the HIV-1 Tat Protein Protects Mice from a Deadly Mucosal HSV1 Challenge

PubMed Central

Sicurella, Mariaconcetta; Nicoli, Francesco; Gallerani, Eleonora; Volpi, Ilaria; Berto, Elena; Finessi, Valentina; Destro, Federica; Manservigi, Roberto; Cafaro, Aurelio; Ensoli, Barbara; Caputo, Antonella; Gavioli, Riccardo; Marconi, Peggy C.

2014-01-01

Herpes simplex virus types 1 and 2 (HSV1 and HSV2) are common infectious agents in both industrialized and developing countries. They cause recurrent asymptomatic and/or symptomatic infections, and life-threatening diseases and death in newborns and immunocompromised patients. Current treatment for HSV relies on antiviral medications, which can halt the symptomatic diseases but cannot prevent the shedding that occurs in asymptomatic patients or, consequently, the spread of the viruses. Therefore, prevention rather than treatment of HSV infections has long been an area of intense research, but thus far effective anti-HSV vaccines still remain elusive. One of the key hurdles to overcome in anti-HSV vaccine development is the identification and effective use of strategies that promote the emergence of Th1-type immune responses against a wide range of epitopes involved in the control of viral replication. Since the HIV1 Tat protein has several immunomodulatory activities and increases CTL recognition of dominant and subdominant epitopes of heterologous antigens, we generated and assayed a recombinant attenuated replication-competent HSV1 vector containing the tat gene (HSV1-Tat). In this proof-of-concept study we show that immunization with this vector conferred protection in 100% of mice challenged intravaginally with a lethal dose of wild-type HSV1. We demonstrate that the presence of Tat within the recombinant virus increased and broadened Th1-like and CTL responses against HSV-derived T-cell epitopes and elicited in most immunized mice detectable IgG responses. In sharp contrast, a similarly attenuated HSV1 recombinant vector without Tat (HSV1-LacZ), induced low and different T cell responses, no measurable antibody responses and did not protect mice against the wild-type HSV1 challenge. These findings strongly suggest that recombinant HSV1 vectors expressing Tat merit further investigation for their potential to prevent and/or contain HSV1 infection and dissemination. PMID:25033084

Identification of a lineage specific zinc responsive genomic island in Mycobacterium avium ssp. paratuberculosis.

PubMed

Eckelt, Elke; Jarek, Michael; Frömke, Cornelia; Meens, Jochen; Goethe, Ralph

2014-12-06

Maintenance of metal homeostasis is crucial in bacterial pathogenicity as metal starvation is the most important mechanism in the nutritional immunity strategy of host cells. Thus, pathogenic bacteria have evolved sensitive metal scavenging systems to overcome this particular host defence mechanism. The ruminant pathogen Mycobacterium avium ssp. paratuberculosis (MAP) displays a unique gut tropism and causes a chronic progressive intestinal inflammation. MAP possesses eight conserved lineage specific large sequence polymorphisms (LSP), which distinguish MAP from its ancestral M. avium ssp. hominissuis or other M. avium subspecies. LSP14 and LSP15 harbour many genes proposed to be involved in metal homeostasis and have been suggested to substitute for a MAP specific, impaired mycobactin synthesis. In the present study, we found that a LSP14 located putative IrtAB-like iron transporter encoded by mptABC was induced by zinc but not by iron starvation. Heterologous reporter gene assays with the lacZ gene under control of the mptABC promoter in M. smegmatis (MSMEG) and in a MSMEG∆furB deletion mutant revealed a zinc dependent, metalloregulator FurB mediated expression of mptABC via a conserved mycobacterial FurB recognition site. Deep sequencing of RNA from MAP cultures treated with the zinc chelator TPEN revealed that 70 genes responded to zinc limitation. Remarkably, 45 of these genes were located on a large genomic island of approximately 90 kb which harboured LSP14 and LSP15. Thirty-five of these genes were predicted to be controlled by FurB, due to the presence of putative binding sites. This clustering of zinc responsive genes was exclusively found in MAP and not in other mycobacteria. Our data revealed a particular genomic signature for MAP given by a unique zinc specific locus, thereby suggesting an exceptional relevance of zinc for the metabolism of MAP. MAP seems to be well adapted to maintain zinc homeostasis which might contribute to the peculiarity of MAP pathogenicity.

PDZ affinity chromatography: a general method for affinity purification of proteins based on PDZ domains and their ligands.

PubMed

Walkup, Ward G; Kennedy, Mary B

2014-06-01

PDZ (PSD-95, DiscsLarge, ZO1) domains function in nature as protein binding domains within scaffold and membrane-associated proteins. They comprise ∼90 residues and make specific, high affinity interactions with complementary C-terminal peptide sequences, with other PDZ domains, and with phospholipids. We hypothesized that the specific, strong interactions of PDZ domains with their ligands would make them well suited for use in affinity chromatography. Here we describe a novel affinity chromatography method applicable for the purification of proteins that contain PDZ domain-binding ligands, either naturally or introduced by genetic engineering. We created a series of affinity resins comprised of PDZ domains from the scaffold protein PSD-95, or from neuronal nitric oxide synthase (nNOS), coupled to solid supports. We used them to purify heterologously expressed neuronal proteins or protein domains containing endogenous PDZ domain ligands, eluting the proteins with free PDZ domain peptide ligands. We show that Proteins of Interest (POIs) lacking endogenous PDZ domain ligands can be engineered as fusion products containing C-terminal PDZ domain ligand peptides or internal, N- or C-terminal PDZ domains and then can be purified by the same method. Using this method, we recovered recombinant GFP fused to a PDZ domain ligand in active form as verified by fluorescence yield. Similarly, chloramphenicol acetyltransferase (CAT) and β-Galactosidase (LacZ) fused to a C-terminal PDZ domain ligand or an N-terminal PDZ domain were purified in active form as assessed by enzymatic assay. In general, PDZ domains and ligands derived from PSD-95 were superior to those from nNOS for this method. PDZ Domain Affinity Chromatography promises to be a versatile and effective method for purification of a wide variety of natural and recombinant proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

The mitochondrial cytochrome c peroxidase Ccp1 of Saccharomyces cerevisiae is involved in conveying an oxidative stress signal to the transcription factor Pos9 (Skn7).

PubMed

Charizanis, C; Juhnke, H; Krems, B; Entian, K D

1999-10-01

In Saccharomyces cerevisiae two transcription factors, Pos9 (Skn7) and Yap1, are involved in the response to oxidative stress. Fusion of the Pos9 response-regulator domain to the Gal4 DNA-binding domain results in a transcription factor which renders the expression of a GAL1-lacZ reporter gene dependent on oxidative stress. To identify genes which are involved in the oxygen-dependent activation of the Gal4-Pos9 hybrid protein we screened for mutants that failed to induce the heterologous test system upon oxidative stress (fap mutants for factors activating Pos9). We isolated several respiration-deficient and some respiration-competent mutants by this means. We selected for further characterization only those mutants which also displayed an oxidative-stress-sensitive phenotype. One of the respiration-deficient mutants (complementation groupfap6) could be complemented by the ISM1 gene, which encodes mitochondrial isoleucyl tRNA synthetase, suggesting that respiration competence was important for signalling of oxidative stress. In accordance with this notion a rho0 strain and a wild-type strain in which respiration had been blocked (by treatment with antimycin A or with cyanide) also failed to activate Gal4-Pos9 upon imposition of oxidative stress. Another mutant, fap24, which was respiration-competent, could be complemented by CCP1, which encodes the mitochondrial cytochrome c peroxidase. Mitochondrial cytochrome c peroxidase degrades reactive oxygen species within the mitochondria. This suggested a possible sensor function for the enzyme in the oxidative stress response. To test this we used the previously described point mutant ccp1 W191F, which is characterized by a 10(4)-fold decrease in electron flux between cytochrome c and cytochrome c peroxidase. The Ccp1W191F mutant was still capable of activating the Pos9 transcriptional activation domain, suggesting that the signalling function of Ccp1 is independent of electron flux rates.

SIRT1 overexpression decreases cisplatin-induced acetylation of NF-{kappa}B p65 subunit and cytotoxicity in renal proximal tubule cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jung, Yu Jin; Lee, Jung Eun; Lee, Ae Sin

2012-03-09

Highlights: Black-Right-Pointing-Pointer Cisplatin increases acetylation of NF-{kappa}B p65 subunit in HK2 cells. Black-Right-Pointing-Pointer SIRT1 overexpression decreases cisplatin-induced p65 acetylation and -cytotoxicity. Black-Right-Pointing-Pointer Resveratrol decreased cisplatin-induced cell viability through deacetylation of p65. -- Abstract: As the increased acetylation of p65 is linked to nuclear factor-{kappa}B (NF-{kappa}B) activation, the regulation of p65 acetylation can be a potential target for the treatment of inflammatory injury. Cisplatin-induced nephrotoxicity is an important issue in chemotherapy of cancer patients. SIRT1, nicotinamide adenine dinucleotide (NAD{sup +})-dependent protein deacetylase, has been implicated in a variety of cellular processes such as inflammatory injury and the control of multidrug resistancemore » in cancer. However, there is no report on the effect of SIRT1 overexpression on cisplatin-induced acetylation of p65 subunit of NF-{kappa}B and cell injury. To investigate the effect of SIRT1 in on cisplatin-induced acetylation of p65 subunit of NF-{kappa}B and cell injury, HK2 cells were exposed with SIRT1 overexpression, LacZ adenovirus or dominant negative adenovirus after treatment with cisplatin. While protein expression of SIRT1 was decreased by cisplatin treatment compared with control buffer treatment, acetylation of NF-{kappa}B p65 subunit was significantly increased after treatment with cisplatin. Overexpression of SIRT1 ameliorated the increased acetylation of p65 of NF-{kappa}B during cisplatin treatment and cisplatin-induced cytotoxicity. Further, treatment of cisplatin-treated HK2 cells with resveratrol, a SIRT1 activator, also decreased acetylation of NF-{kappa}B p65 subunit and cisplatin-induced increase of the cell viability in HK2 cells. Our findings suggests that the regulation of acetylation of p65 of NF-{kappa}B through SIRT1 can be a possible target to attenuate cisplatin-induced renal cell damage.« less

Variable directionality of gene expression changes across generations does not constitute negative evidence of epigenetic inheritance.

PubMed

Sharma, Abhay

2015-01-01

Transgenerational epigenetic inheritance in mammals has been controversial due to inherent difficulties in its experimental demonstration. A recent report has, however, opened a new front in the ongoing debate by claiming that endocrine disrupting chemicals, contrary to previous findings, do not cause effects across generations. This claim is based on the observation that gene expression changes induced by these chemicals in the exposed and unexposed generations are mainly in the opposite direction. This analysis shows that the pattern of gene expression reported in the two generations is not expected by chance and is suggestive of transmission across generations. A meta-analysis of diverse data sets related to endocrine disruptor-induced transgenerational gene expression alterations, including the data provided in the said report, further suggests that effects of endocrine disrupting chemicals persist in unexposed generations. Based on the prior evidence of phenotypic variability and gene expression alterations in opposite direction between generations, it is argued here that calling evidence of mismatched directionality in gene expression in experiments testing potential of environmental agents in inducing epigenetic inheritance of phenotypic traits as negative is untenable. This is expected to settle the newly raised doubts over epigenetic inheritance in mammals.

Interactions among the effects of head orientation, emotional expression, and physical attractiveness on face preferences.

PubMed

Main, Julie C; DeBruine, Lisa M; Little, Anthony C; Jones, Benedict C

2010-01-01

Previous studies have shown that preferences for direct versus averted gaze are modulated by emotional expressions and physical attractiveness. For example, preferences for direct gaze are stronger when judging happy or physically attractive faces than when judging disgusted or physically unattractive faces. Here we show that preferences for front versus three-quarter views of faces, in which gaze direction was always congruent with head orientation, are also modulated by emotional expressions and physical attractiveness; participants demonstrated preferences for front views of faces over three-quarter views of faces when judging the attractiveness of happy, physically attractive individuals, but not when judging the attractiveness of relatively unattractive individuals or those with disgusted expressions. Moreover, further analyses indicated that these interactions did not simply reflect differential perceptions of the intensity of the emotional expressions shown in each condition. Collectively, these findings present novel evidence that the effect of the direction of the attention of others on attractiveness judgments is modulated by cues to the physical attractiveness and emotional state of the depicted individual, potentially reflecting psychological adaptations for efficient allocation of social effort. These data also present the first behavioural evidence that the effect of the direction of the attention of others on attractiveness judgments reflects viewer-referenced, rather than face-referenced, coding and/or processing of gaze direction.

Southwest Direct Express Bus Demonstration in Orlando, FL

DOT National Transportation Integrated Search

1988-04-01

In August 1983, the Orange-Seminole-Osceola Transit Authority (OSOTA) initiated six express bus routes in the southwest corridor of Orlando (known collectively as the Southwest Direct) as an UMTA-funded demonstration project. While one objective of t...

Pax6 Exerts Regional Control of Cortical Progenitor Proliferation via Direct Repression of Cdk6 and Hypophosphorylation of pRb

PubMed Central

Mi, Da; Carr, Catherine B.; Georgala, Petrina A.; Huang, Yu-Ting; Manuel, Martine N.; Jeanes, Emily; Niisato, Emi; Sansom, Stephen N.; Livesey, Frederick J.; Theil, Thomas; Hasenpusch-Theil, Kerstin; Simpson, T. Ian; Mason, John O.; Price, David J.

2013-01-01

Summary The mechanisms by which early spatiotemporal expression patterns of transcription factors such as Pax6 regulate cortical progenitors in a region-specific manner are poorly understood. Pax6 is expressed in a gradient across the developing cortex and is essential for normal corticogenesis. We found that constitutive or conditional loss of Pax6 increases cortical progenitor proliferation by amounts that vary regionally with normal Pax6 levels. We compared the gene expression profiles of equivalent Pax6-expressing progenitors isolated from Pax6+/+ and Pax6−/− cortices and identified many negatively regulated cell-cycle genes, including Cyclins and Cdks. Biochemical assays indicated that Pax6 directly represses Cdk6 expression. Cyclin/Cdk repression inhibits retinoblastoma protein (pRb) phosphorylation, thereby limiting the transcription of genes that directly promote the mechanics of the cell cycle, and we found that Pax6 inhibits pRb phosphorylation and represses genes involved in DNA replication. Our results indicate that Pax6’s modulation of cortical progenitor cell cycles is regional and direct. PMID:23622063

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

Fibrin-Enhanced Canonical Wnt Signaling Directs Plasminogen Expression in Cementoblasts

PubMed Central

Rahman, Saeed Ur; Ryoo, Hyun-Mo

2017-01-01

Cementum is a mineralized layer on the tooth’s root surface and facilitates the biomechanical anchoring of fibrous connective tissues as a part of tooth-supportive complexes. Previously, we observed that OCCM30 cementoblasts cultured on fibrin matrices underwent apoptosis due to fibrin degradation through the expression of proteases. Here, we demonstrated that OCCM30 on fibrin matrices (OCCM30-fibrin) enhanced canonical Wnt signaling, which directed to plasminogen expression. The OCCM30-fibrin showed higher levels of Wnt3a expression, nuclear translocation of β-catenin, and T-cell factor (TCF) optimal motif (TOP) reporter activity than the cells on tissue culture dishes (OCCM30-TCD), indicating that the OCCM30-fibrin enhanced canonical Wnt/β-catenin signaling. Also, OCCM30-fibrin expressed biomineralization-associated markers at higher levels than OCCM30-TCD, of which levels were further increased with LiCl, a Wnt signaling activator. The OCCM30 cementoblasts simultaneously showed that high levels of plasminogen, a critical component of fibrinolysis, were expressed in the OCCM30-fibrin. Activation of canonical Wnt signaling with LiCl treatment or with forced lymphoid enhancer factor 1 (LEF1)-expression increased the expression of plasminogen. On the contrary, the inhibition of canonical Wnt signaling with siRNAs against Wnt3a or β-catenin abrogated fibrin-enhanced plasminogen expression. Furthermore, there are three conserved putative response elements for the LEF1/β-catenin complex in the plasminogen proximal promoter regions (−900 to +54). Site-directed mutations and chromatin immunoprecipitation indicated that canonical Wnt signaling directed plasminogen expression. Taken together, this study suggests that fibrin-based materials can modulate functional periodontal formations in controlling cementoblast differentiation and fibrin degradation. PMID:29120400

Arginine-vasopressin directly promotes a thermogenic and pro-inflammatory adipokine expression profile in brown adipocytes.

PubMed

Küchler, Sebastian; Perwitz, Nina; Schick, Rafael Reinhold; Klein, Johannes; Westphal, Sören

2010-09-24

Arginine-vasopressin (AVP) - via activation of the hypothalamic-pituitary-adrenal (HPA) axis - may play a role in the regulation of energy homeostasis and related cardiovascular complications. Brown adipose tissue (BAT) - via dissipation of energy in the form of heat - contributes to whole body energy balance. BAT expresses vasopressin receptors. We investigated direct effects of AVP on brown adipose endocrine and metabolic functions. UCP-1 protein expression in differentiated brown adipocytes was induced after acute exposure of adipocytes to AVP. This effect was time-dependent with a maximum increase after 8h. AVP also induced a time- and dose-dependent increase in p38 MAP kinase phosphorylation. Pharmacological inhibition of p38 MAP kinase with SB 202190 abolished the induction of UCP-1 protein expression. Furthermore, while acute AVP treatment enhanced mRNA expression of MCP-1 and IL-6, adiponectin mRNA expression was reduced. Yet, on the level of intracellular glucose uptake, there was no AVP-induced change of adipose insulin-induced glucose uptake. Finally, there was no difference in lipid accumulation between control and AVP-treated cells. Taken together, our data demonstrate direct effects of AVP on thermogenic, inflammatory, and glucoregulatory gene expression in brown adipocytes, thus expanding the hitherto known spectrum of this neuropeptides's biological effects and suggesting a direct adipotropic role as a stress-promoting factor. Copyright 2010 Elsevier B.V. All rights reserved.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

Widespread Over-Expression of the X Chromosome in Sterile F1 Hybrid Mice

PubMed Central

Good, Jeffrey M.; Giger, Thomas; Dean, Matthew D.; Nachman, Michael W.

2010-01-01

The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F1 males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F1 hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility. PMID:20941395

Widespread over-expression of the X chromosome in sterile F₁hybrid mice.

PubMed

Good, Jeffrey M; Giger, Thomas; Dean, Matthew D; Nachman, Michael W

2010-09-30

The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F₁ males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F₁ hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility.

Expressed emotion and its relationship to adolescent depression and antisocial behavior in northern Taiwan.

PubMed

Lue, Bee-Horng; Wu, Wen-Chi; Yen, Lee-Lan

2010-02-01

Despite widespread recognition of the occurrence of antisocial behavior and depression in adolescents, the specifics of the relationship between them have not been clarified. The purpose of this study was to investigate the role of expressed emotion as a proximal factor for depression and antisocial behavior among adolescents, by looking at direct and indirect relationships. Secondary data analysis using path analysis was carried out on 2004 data from the Child and Adolescent Behaviors in Long-term Evaluation project. The study sample consisted of 1599 seventh-grade students in Northern Taiwan. Variables included family factors, personal factors (sex and academic performance), expressed emotion [emotional involvement (EI) and perceived criticism (PC)], depression, and antisocial behavior. We found that one dimension of expressed emotion, PC, directly influenced student depression and related indirectly to antisocial behavior. Depression was an important mediator between PC and antisocial behavior. Another dimension, EI, did not influence either depression or antisocial behavior. Sex was related directly to expressed emotion, depression, and antisocial behavior, and also indirectly to antisocial behavior through PC and depression. Academic performance was related directly to expressed emotion and indirectly to antisocial behavior through PC and depression. Greater PC from parents directly contributed to higher levels of student depression and was related indirectly to more student antisocial behavior. It is suggested that parents should decrease overly critical parenting styles to promote adolescent mental health and avoid the development of antisocial behavior. (c) 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.

Treatment of malignant pleural mesothelioma by fibroblast activation protein-specific re-directed T cells

PubMed Central

2013-01-01

Introduction Malignant pleural mesothelioma (MPM) is an incurable malignant disease, which results from chronic exposition to asbestos in at least 70% of the cases. Fibroblast activation protein (FAP) is predominantly expressed on the surface of reactive tumor-associated fibroblasts as well as on particular cancer types. Because of its expression on the cell surface, FAP is an attractive target for adoptive T cell therapy. T cells can be re-directed by retroviral transfer of chimeric antigen receptors (CAR) against tumor-associated antigens (TAA) and therefore represent a therapeutic strategy of adoptive immunotherapy. Methods To evaluate FAP expression immunohistochemistry was performed in tumor tissue from MPM patients. CD8+ human T cells were retrovirally transduced with an anti-FAP-F19-∆CD28/CD3ζ-CAR. T cell function was evaluated in vitro by cytokine release and cytotoxicity assays. In vivo function was tested with an intraperitoneal xenograft tumor model in immunodeficient mice. Results FAP was found to be expressed in all subtypes of MPM. Additionally, FAP expression was evaluated in healthy adult tissue samples and was only detected in specific areas in the pancreas, the placenta and very weakly for cervix and uterus. Expression of the anti-FAP-F19-∆CD28/CD3ζ-CAR in CD8+ T cells resulted in antigen-specific IFNγ release. Additionally, FAP-specific re-directed T cells lysed FAP positive mesothelioma cells and inflammatory fibroblasts in an antigen-specific manner in vitro. Furthermore, FAP-specific re-directed T cells inhibited the growth of FAP positive human tumor cells in the peritoneal cavity of mice and significantly prolonged survival of mice. Conclusion FAP re-directed CD8+ T cells showed antigen-specific functionality in vitro and in vivo. Furthermore, FAP expression was verified in all MPM histotypes. Therefore, our data support performing a phase I clinical trial in which MPM patients are treated with adoptively transferred FAP-specific re-directed T cells. PMID:23937772

The PBX1 lupus susceptibility gene regulates CD44 expression

PubMed Central

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

2017-01-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

Ezetimibe inhibits platelet activation and uPAR expression on endothelial cells.

PubMed

Becher, Tobias; Schulze, Torsten J; Schmitt, Melanie; Trinkmann, Frederik; El-Battrawy, Ibrahim; Akin, Ibrahim; Kälsch, Thorsten; Borggrefe, Martin; Stach, Ksenija

2017-01-15

Lipid lowering therapy constitutes the basis of cardiovascular disease therapy. The purpose of this study was to investigate effects of ezetimibe, a selective inhibitor of intestinal cholesterol absorption, on platelets and endothelial cells in an in vitro endothelial cell model. After a 24h incubation period with ezetimibe (concentrations 1, 50, 100 and 1000ng/ml), human umbilical vein endothelial cells (HUVEC) were stimulated for 1h with lipopolysaccharide (LPS) and were then incubated in direct contact with activated platelets. Following this, the expression of CD40L and CD62P on platelets, and the expression of ICAM-1, VCAM-1, uPAR, and MT1-MMP on endothelial cells were measured by flow cytometry. Supernatants were analysed by enzyme linked immunosorbent assay for soluble MCP-1, IL-6 and MMP-1. The increased expression of uPAR on endothelial cells by proinflammatory stimulation with LPS and by direct endothelial contact with activated platelets was significantly reduced through pre-incubation with 100ng/ml and 1000ng/ml ezetimibe (p<0.05). Platelets directly incubated with ezetimibe but without endothelial cell contact showed significantly reduced CD62P and CD40L surface expression (p<0.05). Ezetimibe had no significant effects on HUVEC expression of MT1-MMP, ICAM-1 and VCAM-1 and on CD40L expression on platelets in direct contact with endothelial cells. Levels of soluble IL-6 in HUVEC supernatants were significantly lower after pre-incubation with ezetimibe. In this in vitro analysis, ezetimibe directly attenuates platelet activation and has significant endothelial cell mediated effects on selected markers of atherosclerosis. Copyright © 2016. Published by Elsevier Ireland Ltd.

Myb14, a direct activator of STS, is associated with resveratrol content variation in berry skin in two grape cultivars.

PubMed

Fang, Linchuan; Hou, Yanlin; Wang, Lijun; Xin, Haiping; Wang, Nian; Li, Shaohua

2014-10-01

High and low resveratrol (Res) contents in two cultivars are correlated with the expression abundance of Myb14 , which could directly activate transcriptional expression of stilbene synthase gene ( STS ). Resveratrol (3,5,4'-trihydroxystilbene) is one of the natural polyphenols produced by secondary metabolism in some plants. Stilbene synthase (STS) is the key enzyme for the final step of precursor formation of resveratrol (Res) in grapevines. In this study, we found that Res contents in ripe berry skin were completely different in two grape cultivars, namely, 'Z168' (Vitis monticola × Vitis riparia) with high-Res and 'Jingzaojing' (Vitis vinifera) with low-Res. Moreover, the level of expression of STS gene was higher in the ripe berry skin of 'Z168' than in that of 'Jingzaojing'. To further investigate the underlying mechanisms, we conducted a co-expression analysis through transcriptomic data. We confirmed that Myb14, an R2R3 Myb transcription factor, is the direct regulator of STS by binding to Box-L5 motif. Moreover, the expression pattern of Myb14 is associated with the variation of Res content. To test this prediction, we conducted a number of experiments in vivo and in vitro. The expression patterns of Myb14 and STS in grapevine leaves were identical under a series of stimulus. Myb14 showed higher expression in the ripe berry skin of 'Z168' than in that of 'Jingzaojing'. Yeast one-hybrid assay indicated that grapevine Myb14 could interact with the promoter of STS in vitro, and the transient overexpression of Myb14 promoted the expression of STS. Furthermore, co-expressing 35S::Myb14 in transgenic Arabidopsis could activate GUS expression promoted by STS promoter. Thus, Myb14 is the direct activator of STS, and its expression pattern is associated with Res content variation in grapes.

Internal representations reveal cultural diversity in expectations of facial expressions of emotion.

PubMed

Jack, Rachael E; Caldara, Roberto; Schyns, Philippe G

2012-02-01

Facial expressions have long been considered the "universal language of emotion." Yet consistent cultural differences in the recognition of facial expressions contradict such notions (e.g., R. E. Jack, C. Blais, C. Scheepers, P. G. Schyns, & R. Caldara, 2009). Rather, culture--as an intricate system of social concepts and beliefs--could generate different expectations (i.e., internal representations) of facial expression signals. To investigate, they used a powerful psychophysical technique (reverse correlation) to estimate the observer-specific internal representations of the 6 basic facial expressions of emotion (i.e., happy, surprise, fear, disgust, anger, and sad) in two culturally distinct groups (i.e., Western Caucasian [WC] and East Asian [EA]). Using complementary statistical image analyses, cultural specificity was directly revealed in these representations. Specifically, whereas WC internal representations predominantly featured the eyebrows and mouth, EA internal representations showed a preference for expressive information in the eye region. Closer inspection of the EA observer preference revealed a surprising feature: changes of gaze direction, shown primarily among the EA group. For the first time, it is revealed directly that culture can finely shape the internal representations of common facial expressions of emotion, challenging notions of a biologically hardwired "universal language of emotion."

Positivity bias in judging ingroup members' emotional expressions.

PubMed

Lazerus, Talya; Ingbretsen, Zachary A; Stolier, Ryan M; Freeman, Jonathan B; Cikara, Mina

2016-12-01

We investigated how group membership impacts valence judgments of ingroup and outgroup members' emotional expressions. In Experiment 1, participants, randomized into 2 novel, competitive groups, rated the valence of in- and outgroup members' facial expressions (e.g., fearful, happy, neutral) using a circumplex affect grid. Across all emotions, participants judged ingroup members' expressions as more positive than outgroup members' expressions. In Experiment 2, participants categorized fearful and happy expressions as being either positive or negative using a mouse-tracking paradigm. Participants exhibited the most direct trajectories toward the "positive" label for ingroup happy expressions and an initial attraction toward positive for ingroup expressions of fear, with outgroup emotion trajectories falling in between. Experiment 3 replicated Experiment 2 and demonstrated that the effect could not be accounted for by targets' gaze direction. Overall, people judged ingroup faces as more positive, regardless of emotion, both in deliberate and implicit judgments. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Endothelial connexin 32 regulates tissue factor expression induced by inflammatory stimulation and direct cell-cell interaction with activated cells.

PubMed

Okamoto, Takayuki; Akita, Nobuyuki; Hayashi, Tatsuya; Shimaoka, Motomu; Suzuki, Koji

2014-10-01

Endothelial cell (EC) interacts with adjacent EC through gap junction, and abnormal expression or function of Cxs is associated with cardiovascular diseases. In patients with endothelial dysfunction, the up-regulation of tissue factor (TF) expression promotes the pathogenic activation of blood coagulation, however the relationship between gap junctions and TF expression in ECs remains uncharacterized. ECs express the gap junction (GJ) proteins connexin32 (Cx32), Cx37, Cx40 and Cx43. We investigated the role of endothelial gap junctions, particularly Cx32, in modulating TF expression during vascular inflammation. Human umbilical vein endothelial cells (HUVECs) were stimulated with tumor necrosis factor-α (TNF-α) and TF activity was assessed in the presence of GJ blockers and an inhibitory anti-Cx32 monoclonal antibody. Treatment with GJ blockers and anti-Cx32 monoclonal antibody enhanced the TNF-α-induced TF activity and mRNA expression in HUVECs. TNF-α-activated effector HUVECs or mouse MS-1 cells were co-cultured with non-stimulated acceptor HUVECs and TF expression in acceptor HUVECs was detected. Effector EC induced TF expression in adjacent acceptor HUVECs through direct cell-cell interaction. Cell-cell interaction induced TF expression was reduced by anti-intercellular adhesion molecule-1 (ICAM1) monoclonal antibody. Soluble ICAM1-Fc fusion protein promotes TF expression. GJ blockers and anti-Cx32 monoclonal antibody enhanced TF expression induced by cell-cell interaction and ICAM1-Fc treatment. Blockade of endothelial Cx32 increased TF expression induced by TNF-α stimulation and cell-cell interaction which was at least partly dependent upon ICAM1. These results suggest that direct Cx32-mediated interaction modulates TF expression in ECs during vascular inflammation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

NASA Astrophysics Data System (ADS)

Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S.; Qian, Pei-Yuan

2015-03-01

Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning ``plug-and-play'' approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis.

PubMed

Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S; Qian, Pei-Yuan

2015-03-24

Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning "plug-and-play" approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

A comparative cDNA microarray analysis reveals a spectrum of genes regulated by Pax6 in mouse lens

PubMed Central

Chauhan, Bharesh K.; Reed, Nathan A.; Yang, Ying; Čermák, Lukáš; Reneker, Lixing; Duncan, Melinda K.; Cvekl, Aleš

2007-01-01

Background Pax6 is a transcription factor that is required for induction, growth, and maintenance of the lens; however, few direct target genes of Pax6 are known. Results In this report, we describe the results of a cDNA microarray analysis of lens transcripts from transgenic mice over-expressing Pax6 in lens fibre cells in order to narrow the field of potential direct Pax6 target genes. This study revealed that the transcript levels were significantly altered for 508 of the 9700 genes analysed, including five genes encoding the cell adhesion molecules β1-integrin, JAM1, L1 CAM, NCAM-140 and neogenin. Notably, comparisons between the genes differentially expressed in Pax6 heterozygous and Pax6 over-expressing lenses identified 13 common genes, including paralemmin, GDIβ, ATF1, Hrp12 and Brg1. Immunohistochemistry and Western blotting demonstrated that Brg1 is expressed in the embryonic and neonatal (2-week-old) but not in 14-week adult lenses, and confirmed altered expression in transgenic lenses over-expressing Pax6. Furthermore, EMSA demonstrated that the BRG1 promoter contains Pax6 binding sites, further supporting the proposition that it is directly regulated by Pax6. Conclusions These results provide a list of genes with possible roles in lens biology and cataracts that are directly or indirectly regulated by Pax6. PMID:12485166

The synthetic gestagen levonorgestrel directly affects gene expression in thyroid and pituitary glands of Xenopus laevis tadpoles.

PubMed

Lorenz, Claudia; Opitz, Robert; Trubiroha, Achim; Lutz, Ilka; Zikova, Andrea; Kloas, Werner

2016-08-01

The synthetic gestagen levonorgestrel (LNG) was previously shown to perturb thyroid hormone-dependent metamorphosis in Xenopus laevis. However, so far the mechanisms underlying the anti-metamorphic effects of LNG remained unknown. Therefore, a series of in vivo and ex vivo experiments was performed to identify potential target sites of LNG action along the pituitary-thyroid axis of X. laevis tadpoles. Prometamorphic tadpoles were treated in vivo with LNG (0.01-10nM) for 72h and brain-pituitary and thyroid tissue was analyzed for marker gene expression. While no treatment-related changes were observed in brain-pituitary tissue, LNG treatment readily affected thyroidal gene expression in tadpoles including decreased slc5a5 and iyd mRNA expression and a strong induction of dio2 and dio3 expression. When using an ex vivo organ explant culture approach, direct effects of LNG on both pituitary and thyroid gland gene expression were detecTable Specifically, treatment of pituitary explants with 10nM LNG strongly stimulated dio2 expression and concurrently suppressed tshb expression. In thyroid glands, ex vivo LNG treatment induced dio2 and dio3 mRNA expression in a thyrotropin-independent manner. When thyroid explants were cultured in thyrotropin-containing media, LNG caused similar gene expression changes as seen after 72h in vivo treatment including a very strong repression of thyrotropin-induced slc5a5 expression. Concerning the anti-thyroidal activity of LNG as seen under in vivo conditions, our ex vivo data provide clear evidence that LNG directly affects expression of genes important for thyroidal iodide handling as well as genes involved in negative feedback regulation of pituitary tshb expression. Copyright © 2016 Elsevier B.V. All rights reserved.

DMirNet: Inferring direct microRNA-mRNA association networks.

PubMed

Lee, Minsu; Lee, HyungJune

2016-12-05

MicroRNAs (miRNAs) play important regulatory roles in the wide range of biological processes by inducing target mRNA degradation or translational repression. Based on the correlation between expression profiles of a miRNA and its target mRNA, various computational methods have previously been proposed to identify miRNA-mRNA association networks by incorporating the matched miRNA and mRNA expression profiles. However, there remain three major issues to be resolved in the conventional computation approaches for inferring miRNA-mRNA association networks from expression profiles. 1) Inferred correlations from the observed expression profiles using conventional correlation-based methods include numerous erroneous links or over-estimated edge weight due to the transitive information flow among direct associations. 2) Due to the high-dimension-low-sample-size problem on the microarray dataset, it is difficult to obtain an accurate and reliable estimate of the empirical correlations between all pairs of expression profiles. 3) Because the previously proposed computational methods usually suffer from varying performance across different datasets, a more reliable model that guarantees optimal or suboptimal performance across different datasets is highly needed. In this paper, we present DMirNet, a new framework for identifying direct miRNA-mRNA association networks. To tackle the aforementioned issues, DMirNet incorporates 1) three direct correlation estimation methods (namely Corpcor, SPACE, Network deconvolution) to infer direct miRNA-mRNA association networks, 2) the bootstrapping method to fully utilize insufficient training expression profiles, and 3) a rank-based Ensemble aggregation to build a reliable and robust model across different datasets. Our empirical experiments on three datasets demonstrate the combinatorial effects of necessary components in DMirNet. Additional performance comparison experiments show that DMirNet outperforms the state-of-the-art Ensemble-based model [1] which has shown the best performance across the same three datasets, with a factor of up to 1.29. Further, we identify 43 putative novel multi-cancer-related miRNA-mRNA association relationships from an inferred Top 1000 direct miRNA-mRNA association network. We believe that DMirNet is a promising method to identify novel direct miRNA-mRNA relations and to elucidate the direct miRNA-mRNA association networks. Since DMirNet infers direct relationships from the observed data, DMirNet can contribute to reconstructing various direct regulatory pathways, including, but not limited to, the direct miRNA-mRNA association networks.

High expression Zymomonas promoters

DOEpatents

Viitanen, Paul V [West Chester, PA; Tao, Luan [Havertown, PA; Zhang, Yuying [New Hope, PA; Caimi, Perry G [Kennett Square, PA; McCole, Laura : Zhang, Min; Chou, Yat-Chen [Lakewood, CO; McCutchen, Carol M [Wilmington, DE; Franden, Mary Ann [Centennial, CO

2011-08-02

Identified are mutants of the promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene, which direct improved expression levels of operably linked heterologous nucleic acids. These are high expression promoters useful for expression of chimeric genes in Zymomonas, Zymobacter, and other related bacteria.

Correlation of nonorthogonality of best hybrid bond orbitals with bond strength of orthogonal orbitals

PubMed Central

Pauling, Linus

1976-01-01

An expression is derived for the bond length of two spd orbitals with maximum values in two directions forming a given bond angle by consideration of the nonorthogonality integral of two best orbitals in these directions. This equation is equivalent to the expression derived by formulating the pair of orthogonal orbitals. Similar expressions are derived for spdf orbitals. Applications are made to icosahedral and cuboctahedral bonds and to the packing of nucleons in atomic nuclei. PMID:16578736

Correlation of nonorthogonality of best hybrid bond orbitals with bond strength of orthogonal orbitals.

PubMed

Pauling, L

1976-02-01

An expression is derived for the bond length of two spd orbitals with maximum values in two directions forming a given bond angle by consideration of the nonorthogonality integral of two best orbitals in these directions. This equation is equivalent to the expression derived by formulating the pair of orthogonal orbitals. Similar expressions are derived for spdf orbitals. Applications are made to icosahedral and cuboctahedral bonds and to the packing of nucleons in atomic nuclei.

31 CFR 208.6 - Availability of the Direct Express® Card.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Availability of the Direct Express® Card. 208.6 Section 208.6 Money and Finance: Treasury Regulations Relating to Money and Finance... within the meaning of Public Law 104-208. [75 FR 80335, Dec. 22, 2010] ...