Cations Stiffen Actin Filaments by Adhering a Key Structural Element to Adjacent Subunits

PubMed Central

2016-01-01

Ions regulate the assembly and mechanical properties of actin filaments. Recent work using structural bioinformatics and site-specific mutagenesis favors the existence of two discrete and specific divalent cation binding sites on actin filaments, positioned in the long axis between actin subunits. Cation binding at one site drives polymerization, while the other modulates filament stiffness and plays a role in filament severing by the regulatory protein, cofilin. Existing structural methods have not been able to resolve filament-associated cations, and so in this work we turn to molecular dynamics simulations to suggest a candidate binding pocket geometry for each site and to elucidate the mechanism by which occupancy of the “stiffness site” affects filament mechanical properties. Incorporating a magnesium ion in the “polymerization site” does not seem to require any large-scale change to an actin subunit’s conformation. Binding of a magnesium ion in the “stiffness site” adheres the actin DNase-binding loop (D-loop) to its long-axis neighbor, which increases the filament torsional stiffness and bending persistence length. Our analysis shows that bound D-loops occupy a smaller region of accessible conformational space. Cation occupancy buries key conserved residues of the D-loop, restricting accessibility to regulatory proteins and enzymes that target these amino acids. PMID:27146246

Clathrin- and AP-2-binding sites in HIP1 uncover a general assembly role for endocytic accessory proteins.

PubMed

Mishra, S K; Agostinelli, N R; Brett, T J; Mizukami, I; Ross, T S; Traub, L M

2001-12-07

Clathrin-mediated endocytosis is a major pathway for the internalization of macromolecules into the cytoplasm of eukaryotic cells. The principle coat components, clathrin and the AP-2 adaptor complex, assemble a polyhedral lattice at plasma membrane bud sites with the aid of several endocytic accessory proteins. Here, we show that huntingtin-interacting protein 1 (HIP1), a binding partner of huntingtin, copurifies with brain clathrin-coated vesicles and associates directly with both AP-2 and clathrin. The discrete interaction sequences within HIP1 that facilitate binding are analogous to motifs present in other accessory proteins, including AP180, amphiphysin, and epsin. Bound to a phosphoinositide-containing membrane surface via an epsin N-terminal homology (ENTH) domain, HIP1 associates with AP-2 to provide coincident clathrin-binding sites that together efficiently recruit clathrin to the bilayer. Our data implicate HIP1 in endocytosis, and the similar modular architecture and function of HIP1, epsin, and AP180 suggest a common role in lipid-regulated clathrin lattice biogenesis.

[3H]aniracetam binds to specific recognition sites in brain membranes.

PubMed

Fallarino, F; Genazzani, A A; Silla, S; L'Episcopo, M R; Camici, O; Corazzi, L; Nicoletti, F; Fioretti, M C

1995-08-01

[3H]Aniracetam bound to specific and saturable recognition sites in membranes prepared from discrete regions of rat brain. In crude membrane preparation from rat cerebral cortex, specific binding was Na+ independent, was still largely detectable at low temperature (4 degrees C), and underwent rapid dissociation. Scatchard analysis of [3H]aniracetam binding revealed a single population of sites with an apparent KD value of approximately 70 nM and a maximal density of 3.5 pmol/mg of protein. Specifically bound [3H]aniracetam was not displaced by various metabolites of aniracetam, nor by other pyrrolidinone-containing nootropic drugs such as piracetam or oxiracetam. Subcellular distribution studies showed that a high percentage of specific [3H]aniracetam binding was present in purified synaptosomes or mitochondria, whereas specific binding was low in the myelin fraction. The possibility that at least some [3H]aniracetam binding sites are associated with glutamate receptors is supported by the evidence that specific binding was abolished when membranes were preincubated at 37 degrees C under fast shaking (a procedure that substantially reduced the amount of glutamate trapped in the membranes) and could be restored after addition of either glutamate or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) but not kainate. The action of AMPA was antagonized by DNQX, which also reduced specific [3H]aniracetam binding in unwashed membranes. High levels of [3H]aniracetam binding were detected in hippocampal, cortical, or cerebellar membranes, which contain a high density of excitatory amino acid receptors.(ABSTRACT TRUNCATED AT 250 WORDS)

Igs expressed by chronic lymphocytic leukemia B cells show limited binding-site structure variability.

PubMed

Marcatili, Paolo; Ghiotto, Fabio; Tenca, Claudya; Chailyan, Anna; Mazzarello, Andrea N; Yan, Xiao-Jie; Colombo, Monica; Albesiano, Emilia; Bagnara, Davide; Cutrona, Giovanna; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Chiorazzi, Nicholas; Tramontano, Anna; Fais, Franco

2013-06-01

Ag selection has been suggested to play a role in chronic lymphocytic leukemia (CLL) pathogenesis, but no large-scale analysis has been performed so far on the structure of the Ag-binding sites (ABSs) of leukemic cell Igs. We sequenced both H and L chain V(D)J rearrangements from 366 CLL patients and modeled their three-dimensional structures. The resulting ABS structures were clustered into a small number of discrete sets, each containing ABSs with similar shapes and physicochemical properties. This structural classification correlates well with other known prognostic factors such as Ig mutation status and recurrent (stereotyped) receptors, but it shows a better prognostic value, at least in the case of one structural cluster for which clinical data were available. These findings suggest, for the first time, to our knowledge, on the basis of a structural analysis of the Ab-binding sites, that selection by a finite quota of antigenic structures operates on most CLL cases, whether mutated or unmutated.

Cd and proton adsorption onto bacterial consortia grown from industrial wastes and contaminated geologic settings.

PubMed

Borrok, David M; Fein, Jeremy B; Kulpa, Charles F

2004-11-01

To model the effects of bacterial metal adsorption in contaminated environments, results from metal adsorption experiments involving individual pure stains of bacteria must be extrapolated to systems in which potentially dozens of bacterial species are present. This extrapolation may be made easier because bacterial consortia from natural environments appear to exhibit similar metal binding properties. However, bacteria that thrive in highly perturbed contaminated environments may exhibit significantly different adsorptive behavior. Here we measure proton and Cd adsorption onto a range of bacterial consortia grown from heavily contaminated industrial wastes, groundwater, and soils. We model the results using a discrete site surface complexation approach to determine binding constants and site densities for each consortium. The results demonstrate that bacterial consortia from different contaminated environments exhibit a range of total site densities (approximately a 3-fold difference) and Cd-binding constants (approximately a 10-fold difference). These ranges for Cd binding constants may be small enough to suggest that bacteria-metal adsorption in contaminated environments can be described using relatively few "averaged" bacteria-metal binding constants (in conjunction with the necessary binding constants for competing surfaces and ligands). However, if additional precision is necessary, modeling parameters must be developed separately for each contaminated environment of interest.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Identification of discrete sites in Yip1A necessary for regulation of endoplasmic reticulum structure.

PubMed

Dykstra, Kaitlyn M; Ulengin, Idil; Delrose, Nicholas; Lee, Tina H

2013-01-01

The endoplasmic reticulum (ER) of specialized cells can undergo dramatic changes in structural organization, including formation of concentric whorls. We previously reported that depletion of Yip1A, an integral membrane protein conserved between yeast and mammals, caused ER whorl formation reminiscent of that seen in specialized cells. Yip1A and its yeast homologue Yip1p cycle between the ER and early Golgi, have been implicated in a number of distinct trafficking steps, and interact with a conserved set of binding partners including Yif1p/Yif1A and the Ypt1/Ypt31 Rab GTPases. Here, we carried out a mutational analysis of Yip1A to obtain insight into how it regulates ER whorl formation. Most of the Yip1A cytoplasmic domain was dispensable, whereas the transmembrane (TM) domain, especially residues within predicted TM helices 3 and 4, were sensitive to mutagenesis. Comprehensive analysis revealed two discrete functionally required determinants. One was E95 and flanking residues L92 and L96 within the cytoplasmic domain; the other was K146 and nearby residue V152 within the TM domain. Notably, the identified determinants correspond closely to two sites previously found to be essential for yeast viability (E76 and K130 in Yip1p corresponding to E95 and K146 in Yip1A, respectively). In contrast, a third site (E89) also essential for yeast viability (E70 in Yip1p) was dispensable for regulation of whorl formation. Earlier work showed that E76 (E95) was dispensable for binding Yif1p or Ypt1p/Ypt31p, whereas E70 (E89) was required. Collectively, these findings suggest that the ability of Yip1A to bind its established binding partners may be uncoupled from its ability to control ER whorl formation. In support, Yif1A knockdown did not cause ER whorl formation. Thus Yip1A may use the sites identified herein to interact with a novel binding partner to regulate ER membrane organization.

External Barium Affects the Gating of KCNQ1 Potassium Channels and Produces a Pore Block via Two Discrete Sites

PubMed Central

Gibor, Gilad; Yakubovich, Daniel; Peretz, Asher; Attali, Bernard

2004-01-01

The pore properties and the reciprocal interactions between permeant ions and the gating of KCNQ channels are poorly understood. Here we used external barium to investigate the permeation characteristics of homomeric KCNQ1 channels. We assessed the Ba2+ binding kinetics and the concentration and voltage dependence of Ba2+ steady-state block. Our results indicate that extracellular Ba2+ exerts a series of complex effects, including a voltage-dependent pore blockade as well as unique gating alterations. External barium interacts with the permeation pathway of KCNQ1 at two discrete and nonsequential sites. (a) A slow deep Ba2+ site that occludes the channel pore and could be simulated by a model of voltage-dependent block. (b) A fast superficial Ba2+ site that barely contributes to channel block and mostly affects channel gating by shifting rightward the voltage dependence of activation, slowing activation, speeding up deactivation kinetics, and inhibiting channel inactivation. A model of voltage-dependent block cannot predict the complex impact of Ba2+ on channel gating in low external K+ solutions. Ba2+ binding to this superficial site likely modifies the gating transitions states of KCNQ1. Both sites appear to reside in the permeation pathway as high external K+ attenuates Ba2+ inhibition of channel conductance and abolishes its impact on channel gating. Our data suggest that despite the high degree of homology of the pore region among the various K+ channels, KCNQ1 channels display significant structural and functional uniqueness. PMID:15226366

Alcohol-Binding Sites in Distinct Brain Proteins: The Quest for Atomic Level Resolution

PubMed Central

Howard, Rebecca J.; Slesinger, Paul A.; Davies, Daryl L.; Das, Joydip; Trudell, James R.; Harris, R. Adron

2011-01-01

Defining the sites of action of ethanol on brain proteins is a major prerequisite to understanding the molecular pharmacology of this drug. The main barrier to reaching an atomic-level understanding of alcohol action is the low potency of alcohols, ethanol in particular, which is a reflection of transient, low-affinity interactions with their targets. These mechanisms are difficult or impossible to study with traditional techniques such as radioligand binding or spectroscopy. However, there has been considerable recent progress in combining X-ray crystallography, structural modeling, and site-directed mutagenesis to define the sites and mechanisms of action of ethanol and related alcohols on key brain proteins. We review such insights for several diverse classes of proteins including inwardly rectifying potassium, transient receptor potential, and neurotransmit-ter-gated ion channels, as well as protein kinase C epsilon. Some common themes are beginning to emerge from these proteins, including hydrogen bonding of the hydroxyl group and van der Waals interactions of the methylene groups of ethanol with specific amino acid residues. The resulting binding energy is proposed to facilitate or stabilize low-energy state transitions in the bound proteins, allowing ethanol to act as a “molecular lubricant” for protein function. We discuss evidence for characteristic, discrete alcohol-binding sites on protein targets, as well as evidence that binding to some proteins is better characterized by an interaction region that can accommodate multiple molecules of ethanol. PMID:21676006

Localization and characterization of an alpha-thrombin-binding site on platelet glycoprotein Ib alpha.

PubMed

De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M

1994-03-04

Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.

Structure of the Mycobacterium tuberculosis D-Alanine:D-Alanine Ligase, a Target of the Antituberculosis Drug D-Cycloserine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruning, John B.; Murillo, Ana C.; Chacon, Ofelia

D-Alanine:D-alanine ligase (EC 6.3.2.4; Ddl) catalyzes the ATP-driven ligation of two D-alanine (D-Ala) molecules to form the D-alanyl:D-alanine dipeptide. This molecule is a key building block in peptidoglycan biosynthesis, making Ddl an attractive target for drug development. D-Cycloserine (DCS), an analog of D-Ala and a prototype Ddl inhibitor, has shown promise for the treatment of tuberculosis. Here, we report the crystal structure of Mycobacterium tuberculosis Ddl at a resolution of 2.1 {angstrom}. This structure indicates that Ddl is a dimer and consists of three discrete domains; the ligand binding cavity is at the intersection of all three domains and conjoinedmore » by several loop regions. The M. tuberculosis apo Ddl structure shows a novel conformation that has not yet been observed in Ddl enzymes from other species. The nucleotide and D-alanine binding pockets are flexible, requiring significant structural rearrangement of the bordering regions for entry and binding of both ATP and D-Ala molecules. Solution affinity and kinetic studies showed that DCS interacts with Ddl in a manner similar to that observed for D-Ala. Each ligand binds to two binding sites that have significant differences in affinity, with the first binding site exhibiting high affinity. DCS inhibits the enzyme, with a 50% inhibitory concentration (IC{sub 50}) of 0.37 mM under standard assay conditions, implicating a preferential and weak inhibition at the second, lower-affinity binding site. Moreover, DCS binding is tighter at higher ATP concentrations. The crystal structure illustrates potential drugable sites that may result in the development of more-effective Ddl inhibitors.« less

Homologous ligands accommodated by discrete conformations of a buried cavity

PubMed Central

Merski, Matthew; Fischer, Marcus; Balius, Trent E.; Eidam, Oliv; Shoichet, Brian K.

2015-01-01

Conformational change in protein–ligand complexes is widely modeled, but the protein accommodation expected on binding a congeneric series of ligands has received less attention. Given their use in medicinal chemistry, there are surprisingly few substantial series of congeneric ligand complexes in the Protein Data Bank (PDB). Here we determine the structures of eight alkyl benzenes, in single-methylene increases from benzene to n-hexylbenzene, bound to an enclosed cavity in T4 lysozyme. The volume of the apo cavity suffices to accommodate benzene but, even with toluene, larger cavity conformations become observable in the electron density, and over the series two other major conformations are observed. These involve discrete changes in main-chain conformation, expanding the site; few continuous changes in the site are observed. In most structures, two discrete protein conformations are observed simultaneously, and energetic considerations suggest that these conformations are low in energy relative to the ground state. An analysis of 121 lysozyme cavity structures in the PDB finds that these three conformations dominate the previously determined structures, largely modeled in a single conformation. An investigation of the few congeneric series in the PDB suggests that discrete changes are common adaptations to a series of growing ligands. The discrete, but relatively few, conformational states observed here, and their energetic accessibility, may have implications for anticipating protein conformational change in ligand design. PMID:25847998

Homologous ligands accommodated by discrete conformations of a buried cavity.

PubMed

Merski, Matthew; Fischer, Marcus; Balius, Trent E; Eidam, Oliv; Shoichet, Brian K

2015-04-21

Conformational change in protein-ligand complexes is widely modeled, but the protein accommodation expected on binding a congeneric series of ligands has received less attention. Given their use in medicinal chemistry, there are surprisingly few substantial series of congeneric ligand complexes in the Protein Data Bank (PDB). Here we determine the structures of eight alkyl benzenes, in single-methylene increases from benzene to n-hexylbenzene, bound to an enclosed cavity in T4 lysozyme. The volume of the apo cavity suffices to accommodate benzene but, even with toluene, larger cavity conformations become observable in the electron density, and over the series two other major conformations are observed. These involve discrete changes in main-chain conformation, expanding the site; few continuous changes in the site are observed. In most structures, two discrete protein conformations are observed simultaneously, and energetic considerations suggest that these conformations are low in energy relative to the ground state. An analysis of 121 lysozyme cavity structures in the PDB finds that these three conformations dominate the previously determined structures, largely modeled in a single conformation. An investigation of the few congeneric series in the PDB suggests that discrete changes are common adaptations to a series of growing ligands. The discrete, but relatively few, conformational states observed here, and their energetic accessibility, may have implications for anticipating protein conformational change in ligand design.

Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions

PubMed Central

Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa

2007-01-01

Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological insight. The demonstration of the efficacy of this approach in endo16 is a promising step for further application of the proposed method. PMID:17712424

An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors.

PubMed

Jadey, Snehal; Auerbach, Anthony

2012-07-01

In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes ("catch" and "hold") that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement ("capping"). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation.

An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors

PubMed Central

Jadey, Snehal

2012-01-01

In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes (“catch” and “hold”) that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement (“capping”). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation. PMID:22732309

Microsomal receptor for steroid hormones: functional implications for nuclear activity.

PubMed

Muldoon, T G; Watson, G H; Evans, A C; Steinsapir, J

1988-01-01

Target tissues for steroid hormones are responsive by virtue of and to the extent of their content of functional intracellular receptors. Recent years have seen a shift in considerations of the cellular dynamics and distribution of these receptors, with current views favoring predominant intranuclear localization in the intact cell. This paper summarizes our analyses of the microsomal estrogen and androgen binding capability of rat uterine and ventral prostate tissue, respectively; these studies have revealed a set of high affinity sites that may act as a conduit for estrogen traversing the cell en route to the nucleus. These sites have many properties in common with cytosolic receptors, with the salient difference of a failure to activate to a more avid DNA-binding form under conditions which permit such activation of cytosolic receptors. The microsomal estrogen-binding proteins also have appreciable affinity for progesterone, another distinction from other known cellular estrogen receptor species. Various experimental approaches were employed to demonstrate that the microsomal receptors were not simply cytosol contaminants; the most convincing evidence is the recent successful separation of the cytosolic and microsomal forms by differential ammonium sulfate precipitation. Discrete subfractionation of subcellular components on successive sucrose gradients, with simultaneous assessments of binding capability and marker enzyme concentrations, indicates that the major portion of the binding is localized within the vesicles of the endoplasmic reticulum free of significant plasma membrane contamination. The microsomal receptors are readily solubilized by extraction with high- or low-salt-containing buffers or with steroid. The residual microsomes following such extraction have the characteristics of saturable acceptor sites for cytosolic estrogen-receptor complexes. The extent to which these sites will accept the cytosolic complexes is equal to the concentration of microsomal binding sites extracted. These observations suggest three possible roles for the microsomal receptor-like proteins: (a) modulation of estrogen access to nuclear binding sites; (b) formation of functional complexes which diffuse to other extranuclear sites to alter non-genomic cellular processes; (c) regulation of nuclear concentration of estrogen-receptor complexes by virtue of producing microsomal acceptor sites for uptake of free or loosely associated nuclear complexes, previously thought to exist in the cytoplasm.

Channel architecture in maltoporin: dominance studies with lamB mutations influencing maltodextrin binding provide evidence for independent selectivity filters in each subunit.

PubMed Central

Ferenci, T; Lee, K S

1989-01-01

Maltoporin trimers constitute maltodextrin-selective channels in the outer membrane of Escherichia coli. To study the organization of the maltodextrin-binding site within trimers, dominance studies were undertaken with maltoporin variants of altered binding affinity. It has been established that amino acid substitutions at three dispersed regions of the maltoporin sequence (at residues 8, 82, and 360) resulted specifically in maltodextrin-binding defects and loss of maltodextrin channel selectivity; a substitution at residue 118 increased both binding affinity and maltodextrin transport. Strains heterodiploid for lamB were constructed in which these substitutions were encoded by chromosomal and plasmid-borne genes, and the relative level of maltoporin expression from these genes was estimated. Binding assays with bacteria forming maltoporin heterotrimers were performed in order to test for complementation between binding-negative alleles, negative dominance of negative over wild-type alleles, and possible dominance of negatives over the high-affinity allele. Double mutants with mutations affecting residues 8 and 118, 82 and 118, and 118 and 360 were constructed in vitro, and the dominance properties of the mutations in cis were also tested. There was no complementation between negatives and no negative dominance in heterotrimers. The high-affinity mutation was dominant over negatives in trans but not in cis. The affinity of binding sites in heterotrimer populations was characteristic of the high-affinity allele present and uninfluenced by the negative allele. These results are consistent with the presence of three discrete binding sites in a maltoporin trimer and suggest that the selectivity filter for maltodextrins is not at the interface between the three subunits. PMID:2521623

High density array fabrication and readout method for a fiber optic biosensor

DOEpatents

Pinkel, Daniel; Gray, Joe

1997-01-01

The invention relates to the fabrication and use of biosensors comprising a plurality of optical fibers each fiber having attached to its "sensor end" biological "binding partners" (molecules that specifically bind other molecules to form a binding complex such as antibody-antigen, lectin-carbohydrate, nucleic acid-nucleic acid, biotin-avidin, etc.). The biosensor preferably bears two or more different species of biological binding partner. The sensor is fabricated by providing a plurality of groups of optical fibers. Each group is treated as a batch to attach a different species of biological binding partner to the sensor ends of the fibers comprising that bundle. Each fiber, or group of fibers within a bundle, may be uniquely identified so that the fibers, or group of fibers, when later combined in an array of different fibers, can be discretely addressed. Fibers or groups of fibers are then selected and discretely separated from different bundles. The discretely separated fibers are then combined at their sensor ends to produce a high density sensor array of fibers capable of assaying simultaneously the binding of components of a test sample to the various binding partners on the different fibers of the sensor array. The transmission ends of the optical fibers are then discretely addressed to detectors--such as a multiplicity of optical sensors. An optical signal, produced by binding of the binding partner to its substrate to form a binding complex, is conducted through the optical fiber or group of fibers to a detector for each discrete test. By examining the addressed transmission ends of fibers, or groups of fibers, the addressed transmission ends can transmit unique patterns assisting in rapid sample identification by the sensor.

High density array fabrication and readout method for a fiber optic biosensor

DOEpatents

Pinkel, Daniel; Gray, Joe; Albertson, Donna G.

2000-01-01

The invention relates to the fabrication and use of biosensors comprising a plurality of optical fibers each fiber having attached to its "sensor end" biological "binding partners" (molecules that specifically bind other molecules to form a binding complex such as antibody-antigen, lectin-carbohydrate, nucleic acid-nucleic acid, biotin-avidin, etc.). The biosensor preferably bears two or more different species of biological binding partner. The sensor is fabricated by providing a plurality of groups of optical fibers. Each group is treated as a batch to attach a different species of biological binding partner to the sensor ends of the fibers comprising that bundle. Each fiber, or group of fibers within a bundle, may be uniquely identified so that the fibers, or group of fibers, when later combined in an array of different fibers, can be discretely addressed. Fibers or groups of fibers are then selected and discretely separated from different bundles. The discretely separated fibers are then combined at their sensor ends to produce a high density sensor array of fibers capable of assaying simultaneously the binding of components of a test sample to the various binding partners on the different fibers of the sensor array. The transmission ends of the optical fibers are then discretely addressed to detectors--such as a multiplicity of optical sensors. An optical signal, produced by binding of the binding partner to its substrate to form a binding complex, is conducted through the optical fiber or group of fibers to a detector for each discrete test. By examining the addressed transmission ends of fibers, or groups of fibers, the addressed transmission ends can transmit unique patterns assisting in rapid sample identification by the sensor.

High density array fabrication and readout method for a fiber optic biosensor

DOEpatents

Pinkel, Daniel; Gray, Joe; Albertson, Donna G.

2002-01-01

The invention relates to the fabrication and use of biosensors comprising a plurality of optical fibers each fiber having attached to its "sensor end" biological "binding partners" (molecules that specifically bind other molecules to form a binding complex such as antibody-antigen, lectin-carbohydrate, nucleic acid-nucleic acid, biotin-avidin, etc.). The biosensor preferably bears two or more different species of biological binding partner. The sensor is fabricated by providing a plurality of groups of optical fibers. Each group is treated as a batch to attach a different species of biological binding partner to the sensor ends of the fibers comprising that bundle. Each fiber, or group of fibers within a bundle, may be uniquely identified so that the fibers, or group of fibers, when later combined in an array of different fibers, can be discretely addressed. Fibers or groups of fibers are then selected and discretely separated from different bundles. The discretely separated fibers are then combined at their sensor ends to produce a high density sensor array of fibers capable of assaying simultaneously the binding of components of a test sample to the various binding partners on the different fibers of the sensor array. The transmission ends of the optical fibers are then discretely addressed to detectors--such as a multiplicity of optical sensors. An optical signal, produced by binding of the binding partner to its substrate to form a binding complex, is conducted through the optical fiber or group of fibers to a detector for each discrete test. By examining the addressed transmission ends of fibers, or groups of fibers, the addressed transmission ends can transmit unique patterns assisting in rapid sample identification by the sensor.

High density array fabrication and readout method for a fiber optic biosensor

DOEpatents

Pinkel, D.; Gray, J.

1997-11-25

The invention relates to the fabrication and use of biosensors comprising a plurality of optical fibers each fiber having attached to its ``sensor end`` biological ``binding partners`` (molecules that specifically bind other molecules to form a binding complex such as antibody-antigen, lectin-carbohydrate, nucleic acid-nucleic acid, biotin-avidin, etc.). The biosensor preferably bears two or more different species of biological binding partner. The sensor is fabricated by providing a plurality of groups of optical fibers. Each group is treated as a batch to attach a different species of biological binding partner to the sensor ends of the fibers comprising that bundle. Each fiber, or group of fibers within a bundle, may be uniquely identified so that the fibers, or group of fibers, when later combined in an array of different fibers, can be discretely addressed. Fibers or groups of fibers are then selected and discretely separated from different bundles. The discretely separated fibers are then combined at their sensor ends to produce a high density sensor array of fibers capable of assaying simultaneously the binding of components of a test sample to the various binding partners on the different fibers of the sensor array. The transmission ends of the optical fibers are then discretely addressed to detectors--such as a multiplicity of optical sensors. An optical signal, produced by binding of the binding partner to its substrate to form a binding complex, is conducted through the optical fiber or group of fibers to a detector for each discrete test. By examining the addressed transmission ends of fibers, or groups of fibers, the addressed transmission ends can transmit unique patterns assisting in rapid sample identification by the sensor. 9 figs.

Fulvic acid-sulfide ion competition for mercury ion binding in the Florida everglades

USGS Publications Warehouse

Reddy, M.M.; Aiken, G.R.

2001-01-01

Negatively charged functional groups of fulvic acid compete with inorganic sulfide ion for mercury ion binding. This competition is evaluated here by using a discrete site-electrostatic model to calculate mercury solution speciation in the presence of fulvic acid. Model calculated species distributions are used to estimate a mercury-fulvic acid apparent binding constant to quantify fulvic acid and sulfide ion competition for dissolved inorganic mercury (Hg(II)) ion binding. Speciation calculations done with PHREEQC, modified to use the estimated mercury-fulvic acid apparent binding constant, suggest that mercury-fulvic acid and mercury-sulfide complex concentrations are equivalent for very low sulfide ion concentrations (about 10-11 M) in Everglades' surface water. Where measurable total sulfide concentration (about 10-7 M or greater) is present in Everglades' surface water, mercury-sulfide complexes should dominate dissolved inorganic mercury solution speciation. In the absence of sulfide ion (for example, in oxygenated Everglades' surface water), fulvic acid binding should dominate Everglades' dissolved inorganic mercury speciation.

Increased Insulin-like Growth Factor Binding Protein-1 Phosphorylation in Decidualized Stromal Mesenchymal Cells in Human Intrauterine Growth Restriction Placentas.

PubMed

Singal, Sahil S; Nygard, Karen; Gratton, Robert; Jansson, Thomas; Gupta, Madhulika B

2018-05-01

Intrauterine growth restriction (IUGR) is often caused by placental insufficiency, which is believed to be associated with decreased delivery of oxygen and nutrients to the placental barrier. We recently reported that hypoxia and/or leucine deprivation triggered hyperphosphorylation of insulin-like growth factor binding protein-1 (IGFBP-1) in decidualized human immortalized endometrial stromal cells (HIESCs), resulting in decreased insulin-like growth factor-1 (IGF-1) bioactivity. To test the hypothesis that human IUGR is associated with increased decidual IGFBP-1 phosphorylation at discrete sites, we used IUGR and gestational age matched appropriate for gestational age (AGA) placentas ( n=5 each). We performed dual immunofluorescence immunohistochemistry (IHC) using IGFBP-1 and vimentin as decidual and mesenchymal markers, respectively. Employing a unique strategy with imaging software, we extracted signal intensity of IGFBP-1 expressed specifically from truly decidualized cells of the placenta. Relative IGFBP-1 was increased (85%; p=0.0001) and using custom phospho-site-specific antibodies, we found that IGFBP-1 phosphorylation (pSer101; +40%, p=0.0677/pSer119; +60%, p=0.0064/pSer169; +100%, p=0.0021) was markedly enhanced in IUGR. Together, our data links for the first time, increased decidual IGFBP-1 phosphorylation at discrete sites with human IUGR. These novel findings suggest that hyperphosphorylation of IGFBP-1 in decidualized stromal mesenchymal decidua basalis contributes to potentially elevated levels of phosphorylated IGFBP-1 in maternal circulation in IUGR pregnancies.

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

PubMed Central

Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

1977-01-01

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

a Migration Well Model for the Binding of Ligands to Heme Proteins.

NASA Astrophysics Data System (ADS)

Beece, Daniel Kenneth

The binding of carbon monoxide and dioxygen to heme proteins can be viewed as occurring in distinct stages: diffusion in the solvent, migration through the matrix, and occupation of the pocket before the final binding step. A model is presented which can explain the dominant kinetic behavior of several different heme protein-ligand systems. The model assumes that a ligand molecule in the solvent sequentially encounters discrete energy barriers on the way to the binding site. The rate to surmount each barrier is distributed, except for the pseudofirst order rate corresponding to the step into the protein from the solvent. The migration through the matrix is equivalent to a small number of distinct jumps. Quantitative analysis of the data permit estimates of the barrier heights, preexponentials and solvent coupling factors for each rate. A migration coefficient and a matrix occupation factor are defined.

Immobilization of concanavalin A receptors during differentiation of neuroblastoma cells.

PubMed

Fishman, M C; Dragsten, P R; Spector, I

1981-04-30

Neuroblastoma cells serve as a useful model of neuronal development because compounds such as dimethyl sulphoxide (DMSO) and dibutyryl cyclic AMP cause them to undergo a process of controlled differentiation in tissue culture, during which they can extend long processes, develop characteristic excitability mechanisms, synthesize neurotransmitters and form synapses. We have used the technique of fluorescence photobleaching recovery to study the lateral mobility of cell-surface constituents during the differentiation of neuroblastoma clone N1E-115 cells. The concanavalin A (Con A) binding sites appear as discrete patches distributed over the entire cell surface and exhibit lateral mobility in undifferentiated cells comparable with that of surface glycoproteins of other cells. After induction of differentiation, however, the vast majority of Con A binding sites become immobilized, and we present data which suggest that the mechanism of this immobilization may involve linkage to the internal actin network.

Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

PubMed

Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

2018-06-15

The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Bivalent phenethylamines as novel dopamine transporter inhibitors: evidence for multiple substrate-binding sites in a single transporter.

PubMed

Schmitt, Kyle C; Mamidyala, Sreeman; Biswas, Swati; Dutta, Aloke K; Reith, Maarten E A

2010-03-01

Bivalent ligands--compounds incorporating two receptor-interacting moieties linked by a flexible chain--often exhibit profoundly enhanced binding affinity compared with their monovalent components, implying concurrent binding to multiple sites on the target protein. It is generally assumed that neurotransmitter sodium symporter (NSS) proteins, such as the dopamine transporter (DAT), contain a single domain responsible for recognition of substrate molecules. In this report, we show that molecules possessing two substrate-like phenylalkylamine moieties linked by a progressively longer aliphatic spacer act as progressively more potent DAT inhibitors (rather than substrates). One compound bearing two dopamine (DA)-like pharmacophoric 'heads' separated by an 8-carbon linker achieved an 82-fold gain in inhibition of [(3)H] 2beta-carbomethoxy-3beta-(4-fluorophenyl)-tropane (CFT) binding compared with DA itself; bivalent compounds with a 6-carbon linker and heterologous combinations of DA-, amphetamine- and beta-phenethylamine-like heads all resulted in considerable and comparable gains in DAT affinity. A series of short-chain bivalent-like compounds with a single N-linkage was also identified, the most potent of which displayed a 74-fold gain in binding affinity. Computational modelling of the DAT protein and docking of the two most potent bivalent (-like) ligands suggested simultaneous occupancy of two discrete substrate-binding domains. Assays with the DAT mutants W84L and D313N--previously employed by our laboratory to probe conformation-specific binding of different structural classes of DAT inhibitors--indicated a bias of the bivalent ligands for inward-facing transporters. Our results strongly indicate the existence of multiple DAT substrate-interaction sites, implying that it is possible to design novel types of DAT inhibitors based upon the 'multivalent ligand' strategy.

Estimation of distribution overlap of urn models.

PubMed

Hampton, Jerrad; Lladser, Manuel E

2012-01-01

A classical problem in statistics is estimating the expected coverage of a sample, which has had applications in gene expression, microbial ecology, optimization, and even numismatics. Here we consider a related extension of this problem to random samples of two discrete distributions. Specifically, we estimate what we call the dissimilarity probability of a sample, i.e., the probability of a draw from one distribution not being observed in [Formula: see text] draws from another distribution. We show our estimator of dissimilarity to be a [Formula: see text]-statistic and a uniformly minimum variance unbiased estimator of dissimilarity over the largest appropriate range of [Formula: see text]. Furthermore, despite the non-Markovian nature of our estimator when applied sequentially over [Formula: see text], we show it converges uniformly in probability to the dissimilarity parameter, and we present criteria when it is approximately normally distributed and admits a consistent jackknife estimator of its variance. As proof of concept, we analyze V35 16S rRNA data to discern between various microbial environments. Other potential applications concern any situation where dissimilarity of two discrete distributions may be of interest. For instance, in SELEX experiments, each urn could represent a random RNA pool and each draw a possible solution to a particular binding site problem over that pool. The dissimilarity of these pools is then related to the probability of finding binding site solutions in one pool that are absent in the other.

Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel

PubMed Central

Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel

2010-01-01

Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839

Identification of Conserved Water Sites in Protein Structures for Drug Design.

PubMed

Jukič, Marko; Konc, Janez; Gobec, Stanislav; Janežič, Dušanka

2017-12-26

Identification of conserved waters in protein structures is a challenging task with applications in molecular docking and protein stability prediction. As an alternative to computationally demanding simulations of proteins in water, experimental cocrystallized waters in the Protein Data Bank (PDB) in combination with a local structure alignment algorithm can be used for reliable prediction of conserved water sites. We developed the ProBiS H2O approach based on the previously developed ProBiS algorithm, which enables identification of conserved water sites in proteins using experimental protein structures from the PDB or a set of custom protein structures available to the user. With a protein structure, a binding site, or an individual water molecule as a query, ProBiS H2O collects similar proteins from the PDB and performs local or binding site-specific superimpositions of the query structure with similar proteins using the ProBiS algorithm. It collects the experimental water molecules from the similar proteins and transposes them to the query protein. Transposed waters are clustered by their mutual proximity, which enables identification of discrete sites in the query protein with high water conservation. ProBiS H2O is a robust and fast new approach that uses existing experimental structural data to identify conserved water sites on the interfaces of protein complexes, for example protein-small molecule interfaces, and elsewhere on the protein structures. It has been successfully validated in several reported proteins in which conserved water molecules were found to play an important role in ligand binding with applications in drug design.

Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

PubMed

Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

2003-10-01

Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential.

Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

PubMed Central

Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

2003-01-01

Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential. PMID:12812520

Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

PubMed

Srikant, C B; Dahan, A; Craig, C

1990-02-04

The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2+, Mn2+, Ca2+ and Co2+ augmented the binding of both T* SS-14 and LTT* SS-28, while higher than 4 mM Co2+ inhibited binding of both ligands. LTT* SS-28 binding was reduced in the presence of high concentrations of Ba2+ and Mn2+ also. Interestingly Ca2+ at higher than 10 mM preferentially inhibited LTT* SS-28 binding and increased the affinity of SS-14 but not SS-28 for LTT* SS-28 binding sites.(ABSTRACT TRUNCATED AT 400 WORDS)

Structural basis of transport function in major facilitator superfamily protein from Trichoderma harzianum.

PubMed

Chaudhary, Nitika; Sandhu, Padmani; Ahmed, Mushtaq; Akhter, Yusuf

2017-02-01

Trichothecenes are the sesquiterpenes secreted by Trichoderma spp. residing in the rhizosphere. These compounds have been reported to act as plant growth promoters and bio-control agents. The structural knowledge for the transporter proteins of their efflux remained limited. In this study, three-dimensional structure of Thmfs1 protein, a trichothecene transporter from Trichoderma harzianum, was homology modelled and further Molecular Dynamics (MD) simulations were used to decipher its mechanism. Fourteen transmembrane helices of Thmfs1 protein are observed contributing to an inward-open conformation. The transport channel and ligand binding sites in Thmfs1 are identified based on heuristic, iterative algorithm and structural alignment with homologous proteins. MD simulations were performed to reveal the differential structural behaviour occurring in the ligand free and ligand bound forms. We found that two discrete trichothecene binding sites are located on either side of the central transport tunnel running from the cytoplasmic side to the extracellular side across the Thmfs1 protein. Detailed analysis of the MD trajectories showed an alternative access mechanism between N and C-terminal domains contributing to its function. These results also demonstrate that the transport of trichodermin occurs via hopping mechanism in which the substrate molecule jumps from one binding site to another lining the transport tunnel. Copyright © 2016 Elsevier B.V. All rights reserved.

Glycosaminoglycans are interactants of Langerin: comparison with gp120 highlights an unexpected calcium-independent binding mode.

PubMed

Chabrol, Eric; Nurisso, Alessandra; Daina, Antoine; Vassal-Stermann, Emilie; Thepaut, Michel; Girard, Eric; Vivès, Romain R; Fieschi, Franck

2012-01-01

Langerin is a C-type lectin specifically expressed in Langerhans cells. As recently shown for HIV, Langerin is thought to capture pathogens and mediate their internalisation into Birbeck Granules for elimination. However, the precise functions of Langerin remain elusive, mostly because of the lack of information on its binding properties and physiological ligands. Based on recent reports that Langerin binds to sulfated sugars, we conducted here a comparative analysis of Langerin interaction with mannose-rich HIV glycoprotein gp120 and glycosaminoglycan (GAGs), a family of sulfated polysaccharides expressed at the surface of most mammalian cells. Our results first revealed that Langerin bound to these different glycans through very distinct mechanisms and led to the identification of a novel, GAG-specific binding mode within Langerin. In contrast to the canonical lectin domain, this new binding site showed no Ca(2+)-dependency, and could only be detected in entire, trimeric extracellular domains of Langerin. Interestingly binding to GAGs, did not simply rely on a net charge effect, but rather on more discrete saccharide features, such as 6-O-sulfation, or iduronic acid content. Using molecular modelling simulations, we proposed a model of Langerin/heparin complex, which located the GAG binding site at the interface of two of the three Carbohydrate-recognition domains of the protein, at the edge of the a-helix coiled-coil. To our knowledge, the binding properties that we have highlighted here for Langerin, have never been reported for C-type lectins before. These findings provide new insights towards the understanding of Langerin biological functions.

Permeability and kinetic coefficients for mesoscale BCF surface step dynamics: Discrete two-dimensional deposition-diffusion equation analysis

DOE PAGES

Zhao, Renjie; Evans, James W.; Oliveira, Tiago J.

2016-04-08

Here, a discrete version of deposition-diffusion equations appropriate for description of step flow on a vicinal surface is analyzed for a two-dimensional grid of adsorption sites representing the stepped surface and explicitly incorporating kinks along the step edges. Model energetics and kinetics appropriately account for binding of adatoms at steps and kinks, distinct terrace and edge diffusion rates, and possible additional barriers for attachment to steps. Analysis of adatom attachment fluxes as well as limiting values of adatom densities at step edges for nonuniform deposition scenarios allows determination of both permeability and kinetic coefficients. Behavior of these quantities is assessedmore » as a function of key system parameters including kink density, step attachment barriers, and the step edge diffusion rate.« less

Permeability and kinetic coefficients for mesoscale BCF surface step dynamics: Discrete two-dimensional deposition-diffusion equation analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Renjie; Evans, James W.; Oliveira, Tiago J.

Here, a discrete version of deposition-diffusion equations appropriate for description of step flow on a vicinal surface is analyzed for a two-dimensional grid of adsorption sites representing the stepped surface and explicitly incorporating kinks along the step edges. Model energetics and kinetics appropriately account for binding of adatoms at steps and kinks, distinct terrace and edge diffusion rates, and possible additional barriers for attachment to steps. Analysis of adatom attachment fluxes as well as limiting values of adatom densities at step edges for nonuniform deposition scenarios allows determination of both permeability and kinetic coefficients. Behavior of these quantities is assessedmore » as a function of key system parameters including kink density, step attachment barriers, and the step edge diffusion rate.« less

A stepwise mechanism for the permeation of phloretin through a lipid bilayer

PubMed Central

1982-01-01

The thermodynamics of interactions between phloretin and a phosphatidylcholine (PC) vesicle membrane are characterized using equilibrium spectrophotometric titration, stopped-flow, and temperature- jump techniques. Binding of phloretin to a PC vesicle membrane is diffusion limited, with an association rate constant greater than 10(8) M-1s-1, and an interfacial activation free energy of less than 2 kcal/mol. Equilibrium binding of phloretin to a vesicle membrane is characterized by a single class of high-affinity (8 micro M), noninteracting sites. Binding is enthalpy driven (delta H = -4.9 kcal/mol) at 23 degrees C. Analysis of amplitudes of kinetic processes shows that 66 +/- 3% of total phloretin binding sites are exposed at the external vesicle surface. The rate of phloretin movement between binding sites located near the external and internal interfaces is proportional to the concentration of un-ionized phloretin, with a rate constant of 5.7 X 10(4) M-1s-1 at 23 degrees C. The rate of this process is limited by a large enthalpic (9 kcal/mol) and entropic (-31 entropy units) barrier. An analysis of the concentration dependence of the rate of transmembrane movement suggests the presence of multiple intramembrane potential barriers. Permeation of phloretin through a lipid bilayer is modeled quantitatively in terms of discrete steps: binding to a membrane surface, translocation across a series of intramembrane barriers, and dissociation from the opposite membrane surface. The permeability coefficient for phloretin is calculated as 1.9 X 10(-3) cm/s on the basis of the model presented. Structure- function relationships are examined for a number of phloretin analogues. PMID:7142954

Structural and theoretical basis for ligand exchange on thiolate monolayer protected gold nanoclusters.

PubMed

Heinecke, Christine L; Ni, Thomas W; Malola, Sami; Mäkinen, Ville; Wong, O Andrea; Häkkinen, Hannu; Ackerson, Christopher J

2012-08-15

Ligand exchange reactions are widely used for imparting new functionality on or integrating nanoparticles into devices. Thiolate-for-thiolate ligand exchange in monolayer protected gold nanoclusters has been used for over a decade; however, a firm structural basis of this reaction has been lacking. Herein, we present the first single-crystal X-ray structure of a partially exchanged Au(102)(p-MBA)(40)(p-BBT)(4) (p-MBA = para-mercaptobenzoic acid, p-BBT = para-bromobenzene thiol) with p-BBT as the incoming ligand. The crystal structure shows that 2 of the 22 symmetry-unique p-MBA ligand sites are partially exchanged to p-BBT under the initial fast kinetics in a 5 min timescale exchange reaction. Each of these ligand-binding sites is bonded to a different solvent-exposed Au atom, suggesting an associative mechanism for the initial ligand exchange. Density functional theory calculations modeling both thiol and thiolate incoming ligands postulate a mechanistic pathway for thiol-based ligand exchange. The discrete modification of a small set of ligand binding sites suggests Au(102)(p-MBA)(44) as a powerful platform for surface chemical engineering.

Discrete breathers for a discrete nonlinear Schrödinger ring coupled to a central site.

PubMed

Jason, Peter; Johansson, Magnus

2016-01-01

We examine the existence and properties of certain discrete breathers for a discrete nonlinear Schrödinger model where all but one site are placed in a ring and coupled to the additional central site. The discrete breathers we focus on are stationary solutions mainly localized on one or a few of the ring sites and possibly also the central site. By numerical methods, we trace out and study the continuous families the discrete breathers belong to. Our main result is the discovery of a split bifurcation at a critical value of the coupling between neighboring ring sites. Below this critical value, families form closed loops in a certain parameter space, implying that discrete breathers with and without central-site occupation belong to the same family. Above the split bifurcation the families split up into several separate ones, which bifurcate with solutions with constant ring amplitudes. For symmetry reasons, the families have different properties below the split bifurcation for even and odd numbers of sites. It is also determined under which conditions the discrete breathers are linearly stable. The dynamics of some simpler initial conditions that approximate the discrete breathers are also studied and the parameter regimes where the dynamics remain localized close to the initially excited ring site are related to the linear stability of the exact discrete breathers.

Structure and Orientation of T4 Lysozyme Bound to the Small Heat Shock Protein α-Crystallin

PubMed Central

Claxton, Derek P.; Zou, Ping; Mchaourab, Hassane S.

2008-01-01

Summary We have determined the structural changes that accompany the formation of a stable complex between a destabilized mutant of T4 lysozyme (T4L) and the small heat-shock protein α-crystallin. Using pairs of fluorescence or spin label probes to fingerprint the T4L tertiary fold, we demonstrate that binding disrupts tertiary packing in the two domains as well as across the active site cleft. Furthermore, increased distances between i and i+4 residues of helices support a model in which the bound structure is not native-like but significantly unfolded. In the confines of the oligomer, T4L has a preferential orientation with residues in the more hydrophobic C-terminal domain sequestered in a buried environment while residues in the N-terminal domain are exposed to the aqueous solvent. Furthermore, EPR spectral lineshapes of sites in the N-terminal domain are narrower than in the folded, unbound T4L reflecting an unstructured backbone and an asymmetric pattern of contacts between T4L and α-crystallin. The net orientation is not affected by the location of the destabilizing mutation consistent with the notion that binding is not triggered by recognition of localized unfolding. Together, the structural and thermodynamic data indicate that the stably bound conformation of T4L is unfolded and support a model in which the two-modes of substrate binding originate from two discrete binding sites on the chaperone. PMID:18062989

Thermodynamic aspects of dicarboxylate recognition by simple artificial receptors.

PubMed

Linton, B R; Goodman, M S; Fan, E; van Arman, S A; Hamilton, A D

2001-11-02

Recognition of dicarboxylates by bis-functional hydrogen-bonding receptors displays divergent thermodynamics in different solvent systems. NMR titration and isothermal titration calorimetry indicated that neutral bis-urea and bis-thiourea receptors form exothermic complexes with dicarboxylates in DMSO, with a near zero entropic contribution to binding. The increased binding strength of bis-guanidinium receptors precluded quantitative measurement of binding constants in DMSO, but titration calorimetry offered a qualitative picture of the association. Formation of these 1:1 complexes was also exothermic, but additional endothermic events occurred at both lower and higher host-guest ratios. These events indicated multiple binding equilibria but did not always occur at a discrete 2:1 or 1:2 host-guest molar ratio, suggesting higher aggregates. With increasing amounts of methanol as solvent, bis-guanidinium receptors form more endothermic complexes with dicarboxylates, with a favorable entropy of association. This switch from association driven by enthalpy to one driven by entropy may reflect a change from complexation involving the formation of hydrogen bonds to that promoted by solvent liberation from binding sites.

Role of Microbial Exopolymeric Substances (EPS) on Chromium Sorption and Transport in Heterogeneous Subsurface Soils: I. Cr(III) Complexation with EPS in Aqueous Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Kantar; H Demiray; N Dogan

2011-12-31

Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less

Role of microbial exopolymeric substances (EPS) on chromium sorption and transport in heterogeneous subsurface soils: I. Cr(III) complexation with EPS in aqueous solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kantar, C.; Dodge, C.; Demiray, H.

2011-01-26

Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less

Structure of a Premicellar Complex of Alkyl Sulfates with the Interfacial Binding Surfaces of 4 Subunits of Phospholipase A2✰

PubMed Central

Pan, Ying H.; Bahnson, Brian J.

2010-01-01

The properties of three discrete premicellar complexes (E1#, E2#, E3#) of pig pancreatic group-IB secreted phospholipase A2 (sPLA2) with monodisperse alkyl sulfates has been characterized [Berg, O. G., et al., Biochemistry 43, 7999–8013, 2004]. Here we have solved the 2.7 Å crystal structure of group-IB sPLA2 complexed with 12 molecules of octyl sulfate (C8S) in a form consistent with a tetrameric oligomeric that exists during the E1# phase of premicellar complexes. The alkyl tails of the C8S molecules are centered in the middle of the tetrameric cluster of sPLA2 subunits. Three of the four sPLA2 subunits also contain a C8S molecule in the active site pocket. The sulfate oxygen of a C8S ligand is complexed to the active site calcium in 3 of the 4 protein active sites. The interactions of the alkyl sulfate head group with Arg-6 and Lys-10, as well as the backbone amide of Met-20, are analogous to those observed in the previously solved sPLA2 crystal structures with bound phosphate and sulfate anions. The cluster of three anions found in the present structure is postulated to be the site for nucleating the binding of anionic amphiphiles to the interfacial surface of the protein, and therefore this binding interaction has implications for interfacial activation of the enzyme. PMID:20302975

Lipid A binding proteins in macrophages detected by ligand blotting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.H.

1987-05-01

Endotoxin (LPS) stimulates a variety of eukaryotic cells. These actions are involved in the pathogenesis of Gram-negative septicemia. The site of action of the LPS toxic moiety, lipid A (LA), is unclear. Their laboratory has previously identified a bioactive LA precursor lipid IV/sub A/, which can be enzymatically labeled with /sup 32/P/sub i/ (10/sup 9/ dpm/nmole) and purified (99%). They now show that this ligand binds to specific proteins immobilized on nitrocellulose (NC) from LPS-sensitive RAW 264.7 cultured macrophages. NC blots were incubated with (/sup 32/P)-IV/sub A/ in a buffer containing BSA, NaCl, polyethylene glycol, and azide. Binding was assessedmore » using autoradiography or scintillation counting. Dot blot binding of the radioligand was inhibited by excess cold IV/sub A/, LA, or ReLPS but not by phosphatidylcholine, cardiolipin, phosphatidylinositol, or phosphatidic acid. Binding was trypsin-sensitive and dependent on protein concentration. Particulate macrophage proteins were subjected to SDS-PAGE and then electroblotted onto NC. Several discrete binding proteins were observed. Identical treatment of fetal bovine serum or molecular weight standards revealed no detectable binding. By avoiding high nonspecific binding of intact membranes, this ligand blotting assay may be useful in elucidating the molecular actions of LPS.« less

Directing stem cell trafficking via GPS.

PubMed

Sackstein, Robert

2010-01-01

The success of stem-cell-based regenerative therapeutics critically hinges on delivering relevant stem/progenitor cells to sites of tissue injury. To achieve adequate parenchymal infiltration following intravascular administration, it is first necessary that circulating cells bind to target tissue endothelium with sufficient strength to overcome the prevailing forces of hemodynamic shear. The principal mediators of these shear-resistant binding interactions consist of a family of C-type lectins known as "selectins" that bind discrete sialofucosylated glycans on their respective ligands. One member of this family, E-selectin, is an endothelial molecule that is inducibly expressed on postcapillary venules at all sites of tissue injury, but is also constitutively expressed on the luminal surface of bone marrow and dermal microvascular endothelium. Most stem/progenitor cells express high levels of CD44, and, in particular, human hematopoietic stem cells express a specialized sialofucosylated glycoform of CD44 known as "hematopoietic cell E-/L-selectin ligand" (HCELL) that functions as a potent E-selectin ligand. This chapter describes a method called "glycosyltransferase-programmed stereosubstitution" (GPS) for custom-modifying CD44 glycans to create HCELL on the surface of living cells that natively lack HCELL. Ex vivo glycan engineering of HCELL via GPS licenses trafficking of infused cells to endothelial beds that express E-selectin, thereby enabling efficient vascular delivery of stem/progenitor cells to sites where they are needed. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

PubMed Central

2018-01-01

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the properties of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Last, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site. PMID:29386401

Solutions of burnt-bridge models for molecular motor transport.

PubMed

Morozov, Alexander Yu; Pronina, Ekaterina; Kolomeisky, Anatoly B; Artyomov, Maxim N

2007-03-01

Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called "bridges"), is investigated theoretically by analyzing discrete-state stochastic "burnt-bridge" models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed ("burned") with a probability p , creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into a one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For the general case of p<1 a theoretical method is developed and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics for periodic distribution of bridges and different burning dynamics are analyzed and compared. Analytical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.

Exact Solutions of Burnt-Bridge Models for Molecular Motor Transport

NASA Astrophysics Data System (ADS)

Morozov, Alexander; Pronina, Ekaterina; Kolomeisky, Anatoly; Artyomov, Maxim

2007-03-01

Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called ``bridges''), is investigated theoretically by analyzing discrete-state stochastic ``burnt-bridge'' models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed (``burned'') with a probability p, creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For general case of p<1 a new theoretical method is developed, and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics, periodic and random distribution of bridges and different burning dynamics are analyzed and compared. Theoretical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.

Solutions of burnt-bridge models for molecular motor transport

NASA Astrophysics Data System (ADS)

Morozov, Alexander Yu.; Pronina, Ekaterina; Kolomeisky, Anatoly B.; Artyomov, Maxim N.

2007-03-01

Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called “bridges”), is investigated theoretically by analyzing discrete-state stochastic “burnt-bridge” models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed (“burned”) with a probability p , creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into a one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For the general case of p<1 a theoretical method is developed and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics for periodic distribution of bridges and different burning dynamics are analyzed and compared. Analytical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.

Prenatal hypoxia promotes atherosclerosis via vascular inflammation in the offspring rats.

PubMed

Zhang, Pengjie; Zhu, Di; Chen, Xionghui; Li, Yongmei; Li, Na; Gao, Qinqin; Li, Lingjun; Zhou, Xiuwen; Lv, Juanxiu; Sun, Miao; Mao, Caiping; Xu, Zhice

2016-02-01

Hypoxia is a critical contributor to increased risks of cardiovascular diseases, including atherosclerosis, but the detailed mechanism that hypoxia leads to atherosclerosis remains unknown. Pregnant rats were treated with hypoxia (10.5% oxygen) during pregnancy, and HUVEC cells treated with 1% of oxygen. Blood lipids were tested at fetal stage and adult stage of offspring rats; the level of pro-inflammatory cytokines of HUVEC and offspring rats were investigated, and HIF-1α and NFκB mRNA level were also measured by Q-PCR and Elisa. We found that TC, LDL-C, ox-LDL-C, and the receptors of ox-LDL-C (lox-1) of the adult offspring were significantly higher than that of the control, while HDL-C was significantly reduced in hypoxia group. The internal elastic lamina was blocked by smooth muscle cells; and the migration of smooth muscle cells into the intima were observed in hypoxia offspring. Luciferase reporter gene experiment showed that HIF-1α activated NFκB transcription at four discrete binding sites of NFκBp65 promoter, although there was no obvious difference among the four discrete binding sites. Using transfection of pCDNA3.1-HIF-1α on HUVEC cells, HIF-1α significantly activated NFκB transcription at hypoxic conditions (1% O2), and concurrent with increased expression of IL-1β and TNF-α. Hypoxia during pregnancy activated NFκB transcription to induce pro-inflammatory cytokines, leading to the early stage of atherosclerosis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Structure of a premicellar complex of alkyl sulfates with the interfacial binding surfaces of four subunits of phospholipase A2.

PubMed

Pan, Ying H; Bahnson, Brian J

2010-07-01

The properties of three discrete premicellar complexes (E1#, E2#, E3#) of pig pancreatic group-IB secreted phospholipase A2 (sPLA2) with monodisperse alkyl sulfates have been characterized [Berg, O. G. et al., Biochemistry 43, 7999-8013, 2004]. Here we have solved the 2.7 A crystal structure of group-IB sPLA2 complexed with 12 molecules of octyl sulfate (C8S) in a form consistent with a tetrameric oligomeric that exists during the E1# phase of premicellar complexes. The alkyl tails of the C8S molecules are centered in the middle of the tetrameric cluster of sPLA2 subunits. Three of the four sPLA2 subunits also contain a C8S molecule in the active site pocket. The sulfate oxygen of a C8S ligand is complexed to the active site calcium in three of the four protein active sites. The interactions of the alkyl sulfate head group with Arg-6 and Lys-10, as well as the backbone amide of Met-20, are analogous to those observed in the previously solved sPLA2 crystal structures with bound phosphate and sulfate anions. The cluster of three anions found in the present structure is postulated to be the site for nucleating the binding of anionic amphiphiles to the interfacial surface of the protein, and therefore this binding interaction has implications for interfacial activation of the enzyme. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Glomerular anionic site distribution in nonproteinuric rats. A computer-assisted morphometric analysis.

PubMed

Pilia, P A; Swain, R P; Williams, A V; Loadholt, C B; Ainsworth, S K

1985-12-01

The cationic ultrastructural tracer polyethyleneimine (PEI: pI approximately equal to 11.0), binds electrophysically to uniformly spaced discrete electron-dense anionic sites present in the laminae rarae of the rat glomerular basement membrane (GBM), mesangial reflections of the GBM, Bowman's capsule, and tubular basement membranes when administered intravenously. Computer-assisted morphometric analysis of glomerular anionic sites reveals that the maximum concentration of stainable lamina rara externa (lre) sites (21/10,000 A GBM) occurs 60 minutes after PEI injection with a site-site interspacing of 460 A. Lamina rara interna (lri) sites similarly demonstrate a maximum concentration (20/10,000 A GBM) at 60 minutes with a periodicity of 497 A. The concentration and distribution of anionic sites within the lri was irregular in pattern and markedly decreased in number, while the lre possesses an electrical field that is highly regular at all time intervals analyzed (15, 30, 60, 120, 180, 240, and 300 minutes). Immersion and perfusion of renal tissue with PEI reveals additional heavy staining of the epithelial and endothelial cell sialoprotein coatings. PEI appears to bind to glomerular anionic sites reversibly: ie, between 60 and 180 minutes the concentration of stained sites decreases. At 300 minutes, the interspacing once again approaches the 60-minute concentration. This suggests a dynamic turnover or dissociation followed by a reassociation of glomerular negatively charged PEI binding sites. In contrast, morphometric analysis of anionic sites stained with lysozyme and protamine sulfate reveals interspacings of 642 A and 585 A, respectively; in addition, these tracers produce major glomerular ultrastructural alterations and induce transient proteinuria. PEI does not induce proteinuria in rats, nor does it produce glomerular morphologic alterations when ten times the tracer dosage is administered intravenously. These findings indicate that the choice of ultrastructural charge tracer, the method of administering the tracer, and the time selected for analysis of tissue after administration of tracer significantly influences results. Morphometric analysis of the distribution of glomerular anionic sites in nonproteinuric rats provides a method of evaluating quantitative alterations of the glomerular charge barrier in renal disease models.

Concealed Accessory Pathways with a Single Ventricular and Two Discrete Atrial Insertion Sites.

PubMed

Kipp, Ryan T; Abu Sham'a, Raed; Hiroyuki, Ito; Han, Frederick T; Refaat, Marwan; Hsu, Jonathan C; Field, Michael E; Kopp, Douglas E; Marcus, Gregory M; Scheinman, Melvin M; Hoffmayer, Kurt S

2017-03-01

Atrioventricular reciprocating tachycardia (AVRT) utilizing a concealed accessory pathway is common. It is well appreciated that some patients may have multiple accessory pathways with separate atrial and ventricular insertion sites. We present three cases of AVRT utilizing concealed pathways with evidence that each utilizing a single ventricular insertion and two discrete atrial insertion sites. In case one, two discrete atrial insertion sites were mapped in two separate procedures, and only during the second ablation was the Kent potential identified. Ablation of the Kent potential at this site remote from the two atrial insertion sites resulted in the termination of the retrograde conduction in both pathways. Case two presented with supraventricular tachycardia (SVT) with alternating eccentric atrial activation patterns without alteration in the tachycardia cycle length. The two distinct atrial insertion sites during orthodromic AVRT and ventricular pacing were targeted and each of the two atrial insertion sites were successfully mapped and ablated. In case three, retrograde decremental conduction utilizing both atrial insertion sites was identified prior to ablation. After mapping and ablation of the first discrete atrial insertion site, tachycardia persisted utilizing the second atrial insertion site. Only after ablation of the second atrial insertion site was SVT noninducible, and VA conduction was no longer present. Concealed retrograde accessory pathways with discrete atrial insertion sites may have a common ventricular insertion site. Identification and ablation of the ventricular insertion site or the separate discrete atrial insertion sites result in successful treatment. © 2017 Wiley Periodicals, Inc.

Understanding transporter specificity and the discrete appearance of channel-like gating domains in transporters

PubMed Central

Diallinas, George

2014-01-01

Transporters are ubiquitous proteins mediating the translocation of solutes across cell membranes, a biological process involved in nutrition, signaling, neurotransmission, cell communication and drug uptake or efflux. Similarly to enzymes, most transporters have a single substrate binding-site and thus their activity follows Michaelis-Menten kinetics. Substrate binding elicits a series of structural changes, which produce a transporter conformer open toward the side opposite to the one from where the substrate was originally bound. This mechanism, involving alternate outward- and inward-facing transporter conformers, has gained significant support from structural, genetic, biochemical and biophysical approaches. Most transporters are specific for a given substrate or a group of substrates with similar chemical structure, but substrate specificity and/or affinity can vary dramatically, even among members of a transporter family that show high overall amino acid sequence and structural similarity. The current view is that transporter substrate affinity or specificity is determined by a small number of interactions a given solute can make within a specific binding site. However, genetic, biochemical and in silico modeling studies with the purine transporter UapA of the filamentous ascomycete Aspergillus nidulans have challenged this dogma. This review highlights results leading to a novel concept, stating that substrate specificity, but also transport kinetics and transporter turnover, are determined by subtle intramolecular interactions between a major substrate binding site and independent outward- or cytoplasmically-facing gating domains, analogous to those present in channels. This concept is supported by recent structural evidence from several, phylogenetically and functionally distinct transporter families. The significance of this concept is discussed in relationship to the role and potential exploitation of transporters in drug action. PMID:25309439

Mechanistic insights into c-di-GMP–dependent control of the biofilm regulator FleQ from Pseudomonas aeruginosa

DOE PAGES

Matsuyama, Bruno Y.; Krasteva, Petya V.; Baraquet, Claudine; ...

2015-12-28

Bacterial biofilm formation during chronic infections confers increased fitness, antibiotic tolerance, and cytotoxicity. In many pathogens, the transition from a planktonic lifestyle to collaborative, sessile biofilms represents a regulated process orchestrated by the intracellular second-messenger c-di-GMP. A main effector for c-di-GMP signaling in the opportunistic pathogen Pseudomonas aeruginosa is the transcription regulator FleQ. FleQ is a bacterial enhancer-binding protein (bEBP) with a central AAA+ ATPase σ 54-interaction domain, flanked by a C-terminal helix-turn-helix DNA-binding motif and a divergent N-terminal receiver domain. Together with a second ATPase, FleN, FleQ regulates the expression of flagellar and exopolysaccharide biosynthesis genes in response tomore » cellular c-di-GMP. Here we report structural and functional data that reveal an unexpected mode of c-di-GMP recognition that is associated with major conformational rearrangements in FleQ. Crystal structures of FleQ’s AAA+ ATPase domain in its apo-state or bound to ADP or ATP-γ-S show conformations reminiscent of the activated ring-shaped assemblies of other bEBPs. As revealed by the structure of c-di-GMP–complexed FleQ, the second messenger interacts with the AAA+ ATPase domain at a site distinct from the ATP binding pocket. c-di-GMP interaction leads to active site obstruction, hexameric ring destabilization, and discrete quaternary structure transitions. Solution and cell-based studies confirm coupling of the ATPase active site and c-di-GMP binding, as well as the functional significance of crystallographic interprotomer interfaces. Taken together, our data offer unprecedented insight into conserved regulatory mechanisms of gene expression under direct c-di-GMP control via FleQ and FleQ-like bEBPs.« less

Mechanistic insights into c-di-GMP–dependent control of the biofilm regulator FleQ from Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuyama, Bruno Y.; Krasteva, Petya V.; Baraquet, Claudine

Bacterial biofilm formation during chronic infections confers increased fitness, antibiotic tolerance, and cytotoxicity. In many pathogens, the transition from a planktonic lifestyle to collaborative, sessile biofilms represents a regulated process orchestrated by the intracellular second-messenger c-di-GMP. A main effector for c-di-GMP signaling in the opportunistic pathogen Pseudomonas aeruginosa is the transcription regulator FleQ. FleQ is a bacterial enhancer-binding protein (bEBP) with a central AAA+ ATPase σ 54-interaction domain, flanked by a C-terminal helix-turn-helix DNA-binding motif and a divergent N-terminal receiver domain. Together with a second ATPase, FleN, FleQ regulates the expression of flagellar and exopolysaccharide biosynthesis genes in response tomore » cellular c-di-GMP. Here we report structural and functional data that reveal an unexpected mode of c-di-GMP recognition that is associated with major conformational rearrangements in FleQ. Crystal structures of FleQ’s AAA+ ATPase domain in its apo-state or bound to ADP or ATP-γ-S show conformations reminiscent of the activated ring-shaped assemblies of other bEBPs. As revealed by the structure of c-di-GMP–complexed FleQ, the second messenger interacts with the AAA+ ATPase domain at a site distinct from the ATP binding pocket. c-di-GMP interaction leads to active site obstruction, hexameric ring destabilization, and discrete quaternary structure transitions. Solution and cell-based studies confirm coupling of the ATPase active site and c-di-GMP binding, as well as the functional significance of crystallographic interprotomer interfaces. Taken together, our data offer unprecedented insight into conserved regulatory mechanisms of gene expression under direct c-di-GMP control via FleQ and FleQ-like bEBPs.« less

Mechanistic insights into c-di-GMP–dependent control of the biofilm regulator FleQ from Pseudomonas aeruginosa

PubMed Central

Matsuyama, Bruno Y.; Krasteva, Petya V.; Baraquet, Claudine; Harwood, Caroline S.; Sondermann, Holger; Navarro, Marcos V. A. S.

2016-01-01

Bacterial biofilm formation during chronic infections confers increased fitness, antibiotic tolerance, and cytotoxicity. In many pathogens, the transition from a planktonic lifestyle to collaborative, sessile biofilms represents a regulated process orchestrated by the intracellular second-messenger c-di-GMP. A main effector for c-di-GMP signaling in the opportunistic pathogen Pseudomonas aeruginosa is the transcription regulator FleQ. FleQ is a bacterial enhancer-binding protein (bEBP) with a central AAA+ ATPase σ54-interaction domain, flanked by a C-terminal helix-turn-helix DNA-binding motif and a divergent N-terminal receiver domain. Together with a second ATPase, FleN, FleQ regulates the expression of flagellar and exopolysaccharide biosynthesis genes in response to cellular c-di-GMP. Here we report structural and functional data that reveal an unexpected mode of c-di-GMP recognition that is associated with major conformational rearrangements in FleQ. Crystal structures of FleQ’s AAA+ ATPase domain in its apo-state or bound to ADP or ATP-γ-S show conformations reminiscent of the activated ring-shaped assemblies of other bEBPs. As revealed by the structure of c-di-GMP–complexed FleQ, the second messenger interacts with the AAA+ ATPase domain at a site distinct from the ATP binding pocket. c-di-GMP interaction leads to active site obstruction, hexameric ring destabilization, and discrete quaternary structure transitions. Solution and cell-based studies confirm coupling of the ATPase active site and c-di-GMP binding, as well as the functional significance of crystallographic interprotomer interfaces. Taken together, our data offer unprecedented insight into conserved regulatory mechanisms of gene expression under direct c-di-GMP control via FleQ and FleQ-like bEBPs. PMID:26712005

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yen Ting; Buchler, Nicolas E.

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the propertiesmore » of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Finally, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site.« less

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

DOE PAGES

Lin, Yen Ting; Buchler, Nicolas E.

2018-01-31

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the propertiesmore » of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Finally, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site.« less

Antigenic mapping of an H9N2 avian influenza virus reveals two discrete antigenic sites and a novel mechanism of immune escape.

PubMed

Peacock, Thomas; Reddy, Kolli; James, Joe; Adamiak, Beata; Barclay, Wendy; Shelton, Holly; Iqbal, Munir

2016-01-07

H9N2 avian influenza virus is a major cause of poultry production loss across Asia leading to the wide use of vaccines. Efficacy of vaccines is often compromised due to the rapid emergence of antigenic variants. To improve the effectiveness of vaccines in the field, a better understanding of the antigenic epitopes of the major antigen, hemagglutinin, is required. To address this, a panel of nine monoclonal antibodies were generated against a contemporary Pakistani H9N2 isolate, which represents a major Asian H9N2 viral lineage. Antibodies were characterized in detail and used to select a total of 26 unique 'escape' mutants with substitutions across nine different amino acid residues in hemagglutinin including seven that have not been described as antigenic determinants for H9N2 viruses before. Competition assays and structural mapping revealed two novel, discrete antigenic sites "H9-A" and "H9-B". Additionally, a second subset of escape mutants contained amino acid deletions within the hemagglutinin receptor binding site. This constitutes a novel method of escape for group 1 hemagglutinins and could represent an alternative means for H9N2 viruses to overcome vaccine induced immunity. These results will guide surveillance efforts for arising antigenic variants as well as evidence based vaccine seed selection and vaccine design.

Antigenic mapping of an H9N2 avian influenza virus reveals two discrete antigenic sites and a novel mechanism of immune escape

PubMed Central

Peacock, Thomas; Reddy, Kolli; James, Joe; Adamiak, Beata; Barclay, Wendy; Shelton, Holly; Iqbal, Munir

2016-01-01

H9N2 avian influenza virus is a major cause of poultry production loss across Asia leading to the wide use of vaccines. Efficacy of vaccines is often compromised due to the rapid emergence of antigenic variants. To improve the effectiveness of vaccines in the field, a better understanding of the antigenic epitopes of the major antigen, hemagglutinin, is required. To address this, a panel of nine monoclonal antibodies were generated against a contemporary Pakistani H9N2 isolate, which represents a major Asian H9N2 viral lineage. Antibodies were characterized in detail and used to select a total of 26 unique ‘escape’ mutants with substitutions across nine different amino acid residues in hemagglutinin including seven that have not been described as antigenic determinants for H9N2 viruses before. Competition assays and structural mapping revealed two novel, discrete antigenic sites “H9-A” and “H9-B”. Additionally, a second subset of escape mutants contained amino acid deletions within the hemagglutinin receptor binding site. This constitutes a novel method of escape for group 1 hemagglutinins and could represent an alternative means for H9N2 viruses to overcome vaccine induced immunity. These results will guide surveillance efforts for arising antigenic variants as well as evidence based vaccine seed selection and vaccine design. PMID:26738561

Ligand-Assisted Protein Structure (LAPS): An Experimental Paradigm for Characterizing Cannabinoid-Receptor Ligand-Binding Domains.

PubMed

Janero, David R; Korde, Anisha; Makriyannis, Alexandros

2017-01-01

Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such as X-ray crystallography. © 2017 Elsevier Inc. All rights reserved.

Discrete prepotential as an indicator of successful ablation in patients with coronary cusp ventricular arrhythmia.

PubMed

Hachiya, Hitoshi; Yamauchi, Yasuteru; Iesaka, Yoshito; Yagishita, Atsuhiko; Sasaki, Takeshi; Higuchi, Koji; Kawabata, Mihoko; Sugiyama, Koji; Tanaka, Yasuaki; Kusa, Shigeki; Nakamura, Hiroaki; Miyazaki, Shinsuke; Taniguchi, Hiroshi; Isobe, Mitsuaki; Hirao, Kenzo

2013-10-01

Although coronary cusp (CC) ventricular arrhythmia (VA) can be treated by catheter ablation, reliable indicators of successful ablation sites have not been fully identified. This study comprised 392 patients undergoing radiofrequency catheter ablation for outflow tract-VA at 3 institutions from January 2007 to August 2012. The successful ablation site was on the left CC or right CC in 35 (8.9%) of the 392 patients. In 9 (26%) of these 35 patients, a discrete prepotential was recognized, 5 of whom had left CC-VAs and 4 of whom had right CC-VAs. Radiofrequency catheter ablation was successful at the site of the prepotential in all 9 of these patients. The duration of the isoelectric line between the end of the discrete prepotential and the onset of the ventricular electrogram was 27±13 ms. The time from onset of the discrete prepotential at the successful ablation site on the CC to the QRS onset (activation time) was 69±20 ms (range, 50-98 ms). Pace mapping was graded as excellent at the successful ablation site in only 1 patient. No discrete prepotential was recorded in any successful right outflow tract-VA ablation case in this study. A discrete prepotential was seen in 9 (26%) of 35 patients with CC-VA. In left and right CC-VA, the site of a discrete prepotential with ≥50 ms activation time may indicate a successful ablation site.

Hexameric supramolecular scaffold orients carbohydrates to sense bacteria.

PubMed

Grünstein, Dan; Maglinao, Maha; Kikkeri, Raghavendra; Collot, Mayeul; Barylyuk, Konstantin; Lepenies, Bernd; Kamena, Faustin; Zenobi, Renato; Seeberger, Peter H

2011-09-07

Carbohydrates are integral to biological signaling networks and cell-cell interactions, yet the detection of discrete carbohydrate-lectin interactions remains difficult since binding is generally weak. A strategy to overcome this problem is to create multivalent sensors, where the avidity rather than the affinity of the interaction is important. Here we describe the development of a series of multivalent sensors that self-assemble via hydrophobic supramolecular interactions. The multivalent sensors are comprised of a fluorescent ruthenium(II) core surrounded by a heptamannosylated β-cyclodextrin scaffold. Two additional series of complexes were synthesized as proof-of-principle for supramolecular self-assembly, the fluorescent core alone and the core plus β-cyclodextrin. Spectroscopic analyses confirmed that the three mannosylated sensors displayed 14, 28, and 42 sugar units, respectively. Each complex adopted original and unique spatial arrangements. The sensors were used to investigate the influence of carbohydrate spatial arrangement and clustering on the mechanistic and qualitative properties of lectin binding. Simple visualization of binding between a fluorescent, multivalent mannose complex and the Escherichia coli strain ORN178 that possesses mannose-specific receptor sites illustrates the potential for these complexes as biosensors.

Modifications of Glycans: Biological Significance and Therapeutic Opportunities

PubMed Central

Muthana, Saddam M.; Campbell, Christopher; Gildersleeve, Jeffrey C.

2012-01-01

Carbohydrates play a central role in a wide range of biological processes. As with nucleic acids and proteins, modifications of specific sites within the glycan chain can modulate a carbohydrate’s overall biological function. For example, acylation, methylation, sulfation, epimerization, and phosphorylation can occur at various positions within a carbohydrate to modulate bioactivity. Therefore, there is significant interest in identifying discrete carbohydrate modifications and understanding their biological effects. Additionally, enzymes that catalyze those modifications and proteins that bind modified glycans provide numerous targets for therapeutic intervention. This review will focus on modifications of glycans that occur after the oligomer/polymer has been assembled, generally referred to as postglycosylational modifications. PMID:22195988

Discovery of Novel MDR-Mycobacterium tuberculosis Inhibitor by New FRIGATE Computational Screen

PubMed Central

Vértessy, Beáta; Pütter, Vera; Grolmusz, Vince; Schade, Markus

2011-01-01

With 1.6 million casualties annually and 2 billion people being infected, tuberculosis is still one of the most pressing healthcare challenges. Here we report on the new computational docking algorithm FRIGATE which unites continuous local optimization techniques (conjugate gradient method) with an inherently discrete computational approach in forcefield computation, resulting in equal or better scoring accuracies than several benchmark docking programs. By utilizing FRIGATE for a virtual screen of the ZINC library against the Mycobacterium tuberculosis (Mtb) enzyme antigen 85C, we identified novel small molecule inhibitors of multiple drug-resistant Mtb, which bind in vitro to the catalytic site of antigen 85C. PMID:22164290

RNA-protein binding motifs mining with a new hybrid deep learning based cross-domain knowledge integration approach.

PubMed

Pan, Xiaoyong; Shen, Hong-Bin

2017-02-28

RNAs play key roles in cells through the interactions with proteins known as the RNA-binding proteins (RBP) and their binding motifs enable crucial understanding of the post-transcriptional regulation of RNAs. How the RBPs correctly recognize the target RNAs and why they bind specific positions is still far from clear. Machine learning-based algorithms are widely acknowledged to be capable of speeding up this process. Although many automatic tools have been developed to predict the RNA-protein binding sites from the rapidly growing multi-resource data, e.g. sequence, structure, their domain specific features and formats have posed significant computational challenges. One of current difficulties is that the cross-source shared common knowledge is at a higher abstraction level beyond the observed data, resulting in a low efficiency of direct integration of observed data across domains. The other difficulty is how to interpret the prediction results. Existing approaches tend to terminate after outputting the potential discrete binding sites on the sequences, but how to assemble them into the meaningful binding motifs is a topic worth of further investigation. In viewing of these challenges, we propose a deep learning-based framework (iDeep) by using a novel hybrid convolutional neural network and deep belief network to predict the RBP interaction sites and motifs on RNAs. This new protocol is featured by transforming the original observed data into a high-level abstraction feature space using multiple layers of learning blocks, where the shared representations across different domains are integrated. To validate our iDeep method, we performed experiments on 31 large-scale CLIP-seq datasets, and our results show that by integrating multiple sources of data, the average AUC can be improved by 8% compared to the best single-source-based predictor; and through cross-domain knowledge integration at an abstraction level, it outperforms the state-of-the-art predictors by 6%. Besides the overall enhanced prediction performance, the convolutional neural network module embedded in iDeep is also able to automatically capture the interpretable binding motifs for RBPs. Large-scale experiments demonstrate that these mined binding motifs agree well with the experimentally verified results, suggesting iDeep is a promising approach in the real-world applications. The iDeep framework not only can achieve promising performance than the state-of-the-art predictors, but also easily capture interpretable binding motifs. iDeep is available at http://www.csbio.sjtu.edu.cn/bioinf/iDeep.

Construction of Discrete Pentanuclear Platinum(II) Stacks with Extended Metal-Metal Interactions by Using Phosphorescent Platinum(II) Tweezers.

PubMed

Kong, Fred Ka-Wai; Chan, Alan Kwun-Wa; Ng, Maggie; Low, Kam-Hung; Yam, Vivian Wing-Wah

2017-11-20

Discrete pentanuclear Pt II stacks were prepared by the host-guest adduct formation between multinuclear tweezer-type Pt II complexes. The formation of the Pt II stacks in solution was accompanied by color changes and the turning on of near-infrared emission resulting from Pt⋅⋅⋅Pt and π-π interactions. The X-ray crystal structure revealed the formation of a discrete 1:1 adduct, in which a linear stack of five Pt II centers with extended Pt⋅⋅⋅Pt interactions was observed. Additional binding affinity and stability have been achieved through a multinuclear host-guest system. The binding behaviors can be fine-tuned by varying the spacer between the two Pt II moieties in the guests. This work provides important insights for the construction of discrete higher-order supramolecular metal-ligand aggregates using a tweezer-directed approach. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Interaction of ( sup 3 H)MK-801 with multiple states of the N-methyl-D-aspartate receptor complex of rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Javitt, D.C.; Zukin, S.R.

1989-01-01

N-Methyl-D-aspartate (N-Me-D-Asp) and phencyclidine receptors interactively mediate central nervous system processes including psychotomimetic effects of drugs as well as neurodegenerative, cognitive, and developmental events. To elucidate the mechanism of this interaction, effects of N-Me-D-Asp agonists and antagonists and of glycine-like agents upon binding of the radiolabeled phencyclidine receptor ligand ({sup 3}H)MK-801 were determined in rat brain. Scatchard analysis revealed two discrete components of ({sup 3}H)MK-801 binding after 4 hr of incubation. Incubation in the presence of L-glutamate led to an increase in apparent densities but not in affinities of both components of ({sup 3}H)MK-801 binding as well as conversion ofmore » sites from apparent low to high affinity. Incubation in the presence of combined D-serine and L-glutamate led to an increase in the apparent density of high-affinity ({sup 3}H)MK-801 binding compared with incubation in the presence of either L-glutamate or D-serine alone. These data support a model in which phencyclidine receptor ligands bind differentially to closed as well as open conformations of the N-Me-D-Asp receptor complex and in which glycine-like agents permit or facilitate agonist-induced conversion of N-Me-D-Asp receptors from closed to open conformations.« less

Copper removal by algal biomass: biosorbents characterization and equilibrium modelling.

PubMed

Vilar, Vítor J P; Botelho, Cidália M S; Pinheiro, José P S; Domingos, Rute F; Boaventura, Rui A R

2009-04-30

The general principles of Cu(II) binding to algal waste from agar extraction, composite material and algae Gelidium, and different modelling approaches, are discussed. FTIR analyses provided a detailed description of the possible binding groups present in the biosorbents, as carboxylic groups (D-glucuronic and pyruvic acids), hydroxyl groups (cellulose, agar and floridean starch) and sulfonate groups (sulphated galactans). Potentiometric acid-base titrations showed a heterogeneous distribution of two major binding groups, carboxyl and hydroxyl, following the quasi-Gaussian affinity constant distribution suggested by Sips, which permitted to estimate the maximum amount of acid functional groups (0.36, 0.25 and 0.1 mmol g(-1)) and proton binding parameters (pK(H)=5.0, 5.3 and 4.4; m(H)=0.43, 0.37, 0.33), respectively for algae Gelidium, algal waste and composite material. A non-ideal, semi-empirical, thermodynamically consistent (NICCA) isotherm fitted better the experimental ion binding data for different pH values and copper concentrations, considering only the acid functional groups, than the discrete model. Values of pK(M) (3.2; 3.6 and 3.3), n(M) (0.98, 0.91, 1.0) and p (0.67, 0.53 and 0.43) were obtained, respectively for algae Gelidium, algal waste and composite material. NICCA model reflects the complex macromolecular systems that take part in biosorption considering the heterogeneity of the biosorbent, the competition between protons and metals ions to the binding sites and the stoichiometry for different ions.

Controlling allosteric networks in proteins

NASA Astrophysics Data System (ADS)

Dokholyan, Nikolay

2013-03-01

We present a novel methodology based on graph theory and discrete molecular dynamics simulations for delineating allosteric pathways in proteins. We use this methodology to uncover the structural mechanisms responsible for coupling of distal sites on proteins and utilize it for allosteric modulation of proteins. We will present examples where inference of allosteric networks and its rewiring allows us to ``rescue'' cystic fibrosis transmembrane conductance regulator (CFTR), a protein associated with fatal genetic disease cystic fibrosis. We also use our methodology to control protein function allosterically. We design a novel protein domain that can be inserted into identified allosteric site of target protein. Using a drug that binds to our domain, we alter the function of the target protein. We successfully tested this methodology in vitro, in living cells and in zebrafish. We further demonstrate transferability of our allosteric modulation methodology to other systems and extend it to become ligh-activatable.

LRP-mediated clearance of Abeta is inhibited by KPI-containing isoforms of APP.

PubMed

Moir, Robert D; Tanzi, Rudolph E

2005-04-01

The pathogenesis of Alzheimer's disease (AD) involves the abnormal accumulation and deposition of beta-amyloid in cerebral blood vessels and in the brain parenchyma. Critical in modulating beta-amyloid deposition in brain is the flux of Abeta across the blood brain barrier. The low-density lipoprotein receptor-related protein (LRP), is a large endocytic receptor that mediates the efflux of Abeta out of brain and into the periphery. The first step in the LRP-mediated clearance of Abeta involves the formation of a complex between Abeta and the LRP ligands apolipoprotein E (apoE) or alpha(2)-macroglobulin (alpha(2)M). The Abeta/chaperone complexes then bind to LRP via binding sites on apoE or alpha(2)M. The efflux of Abeta/chaperone complexes out of the neuropil and into the periphery may be attenuated by LRP-ligands that compete with apoE or alpha(2)M for LRP binding. LRP is also the cell surface receptor for Kunitz Protease Inhibitor (KPI) containing isoforms of Abeta's parent protein, the amyloid protein precursor (APP). Protein and mRNA levels of KPI-containing APP isoforms (APP-KPI) are elevated in AD brain and are associated with increased Abeta production. In this study we show that soluble non-amyloidogenic APP-KPI can also inhibit the uptake of Abeta/alpha(2)M in a cell culture model of LRP mediated Abeta clearance. Clearance of Abeta/apoE complexes was not inhibited by APP-KPI. Our findings are consistent with studies showing that apoE and alpha(2)M have discrete binding sites on LRP. Most significantly, our data suggests that the elevated levels of APP-KPI in AD brain may attenuate the clearance of Abeta, the proteins own amyloidogenic catabolic product.

Central sympathoexcitatory actions of angiotensin II: role of type 1 angiotensin II receptors.

PubMed

DiBona, G F

1999-01-01

The role of the renin-angiotensin system in the control of sympathetic nerve activity is reviewed. Two general mechanisms are considered, one that involves the effects of circulating angiotensin II (AngII) on the central nervous system and a second that involves the central nervous system effects of AngII that originates within the central nervous system. The role of type 1 AngII receptors in discrete brain sites that mediate the sympathoexcitatory actions of AngII of either circulating or central nervous system origin is examined. AngII of circulating origin has ready access to the subfornical organ and area postrema, where it can bind to type 1 AngII receptors on neurons whose connections to the nucleus tractus solitarius and rostral ventrolateral medulla result in sympathoexcitation. In the rostral ventrolateral medulla, angiotensin peptides of central nervous system origin, likely involving angiotensin species in addition to AngII and binding to receptors other than type 1 or 2 AngII receptors, tonically support sympathetic nerve activity.

The Groucho Co-repressor Is Primarily Recruited to Local Target Sites in Active Chromatin to Attenuate Transcription

PubMed Central

Jennings, Barbara H.

2014-01-01

Gene expression is regulated by the complex interaction between transcriptional activators and repressors, which function in part by recruiting histone-modifying enzymes to control accessibility of DNA to RNA polymerase. The evolutionarily conserved family of Groucho/Transducin-Like Enhancer of split (Gro/TLE) proteins act as co-repressors for numerous transcription factors. Gro/TLE proteins act in several key pathways during development (including Notch and Wnt signaling), and are implicated in the pathogenesis of several human cancers. Gro/TLE proteins form oligomers and it has been proposed that their ability to exert long-range repression on target genes involves oligomerization over broad regions of chromatin. However, analysis of an endogenous gro mutation in Drosophila revealed that oligomerization of Gro is not always obligatory for repression in vivo. We have used chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) to profile Gro recruitment in two Drosophila cell lines. We find that Gro predominantly binds at discrete peaks (<1 kilobase). We also demonstrate that blocking Gro oligomerization does not reduce peak width as would be expected if Gro oligomerization induced spreading along the chromatin from the site of recruitment. Gro recruitment is enriched in “active” chromatin containing developmentally regulated genes. However, Gro binding is associated with local regions containing hypoacetylated histones H3 and H4, which is indicative of chromatin that is not fully open for efficient transcription. We also find that peaks of Gro binding frequently overlap the transcription start sites of expressed genes that exhibit strong RNA polymerase pausing and that depletion of Gro leads to release of polymerase pausing and increased transcription at a bona fide target gene. Our results demonstrate that Gro is recruited to local sites by transcription factors to attenuate rather than silence gene expression by promoting histone deacetylation and polymerase pausing. PMID:25165826

Evidence for discrete landmark use by pigeons during homing.

PubMed

Mora, Cordula V; Ross, Jeremy D; Gorsevski, Peter V; Chowdhury, Budhaditya; Bingman, Verner P

2012-10-01

Considerable efforts have been made to investigate how homing pigeons (Columba livia f. domestica) are able to return to their loft from distant, unfamiliar sites while the mechanisms underlying navigation in familiar territory have received less attention. With the recent advent of global positioning system (GPS) data loggers small enough to be carried by pigeons, the role of visual environmental features in guiding navigation over familiar areas is beginning to be understood, yet, surprisingly, we still know very little about whether homing pigeons can rely on discrete, visual landmarks to guide navigation. To assess a possible role of discrete, visual landmarks in navigation, homing pigeons were first trained to home from a site with four wind turbines as salient landmarks as well as from a control site without any distinctive, discrete landmark features. The GPS-recorded flight paths of the pigeons on the last training release were straighter and more similar among birds from the turbine site compared with those from the control site. The pigeons were then released from both sites following a clock-shift manipulation. Vanishing bearings from the turbine site continued to be homeward oriented as 13 of 14 pigeons returned home. By contrast, at the control site the vanishing bearings were deflected in the expected clock-shift direction and only 5 of 13 pigeons returned home. Taken together, our results offer the first strong evidence that discrete, visual landmarks are one source of spatial information homing pigeons can utilize to navigate when flying over a familiar area.

Revisiting the mechanism of coagulation factor XIII activation and regulation from a structure/functional perspective

PubMed Central

Gupta, Sneha; Biswas, Arijit; Akhter, Mohammad Suhail; Krettler, Christoph; Reinhart, Christoph; Dodt, Johannes; Reuter, Andreas; Philippou, Helen; Ivaskevicius, Vytautas; Oldenburg, Johannes

2016-01-01

The activation and regulation of coagulation Factor XIII (FXIII) protein has been the subject of active research for the past three decades. Although discrete evidence exists on various aspects of FXIII activation and regulation a combinatorial structure/functional view in this regard is lacking. In this study, we present results of a structure/function study of the functional chain of events for FXIII. Our study shows how subtle chronological submolecular changes within calcium binding sites can bring about the detailed transformation of the zymogenic FXIII to its activated form especially in the context of FXIIIA and FXIIIB subunit interactions. We demonstrate what aspects of FXIII are important for the stabilization (first calcium binding site) of its zymogenic form and the possible modes of deactivation (thrombin mediated secondary cleavage) of the activated form. Our study for the first time provides a structural outlook of the FXIIIA2B2 heterotetramer assembly, its association and dissociation. The FXIIIB subunits regulatory role in the overall process has also been elaborated upon. In summary, this study provides detailed structural insight into the mechanisms of FXIII activation and regulation that can be used as a template for the development of future highly specific therapeutic inhibitors targeting FXIII in pathological conditions like thrombosis. PMID:27453290

Repelling, binding, and oscillating of two-particle discrete-time quantum walks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qinghao; Li, Zhi-Jian, E-mail: zjli@sxu.edu.cn

In this paper, we investigate the effects of particle–particle interaction and static force on the propagation of probability distribution in two-particle discrete-time quantum walk, where the interaction and static force are expressed as a collision phase and a linear position-dependent phase, respectively. It is found that the interaction can lead to boson repelling and fermion binding. The static force also induces Bloch oscillation and results in a continuous transition from boson bunching to fermion anti-bunching. The interplays of particle–particle interaction, quantum interference, and Bloch oscillation provide a versatile framework to study and simulate many-particle physics via quantum walks.

Site Specific Discrete PEGylation of 124I-Labeled mCC49 Fab′ Fragments Improves Tumor MicroPET/CT Imaging in Mice

PubMed Central

Ding, Haiming; Carlton, Michelle M.; Povoski, Stephen P.; Milum, Keisha; Kumar, Krishan; Kothandaraman, Shankaran; Hinkle, George H.; Colcher, David; Brody, Rich; Davis, Paul D.; Pokora, Alex; Phelps, Mitchell; Martin, Edward W.; Tweedle, Michael F.

2014-01-01

The tumor-associated glycoprotein-72 (TAG-72) antigen is highly overexpressed in various human adenocarcinomas and anti-TAG-72 monoclonal antibodies, and fragments are therefore useful as pharmaceutical targeting vectors. In this study, we investigated the effects of site-specific PEGylation with MW 2–4 kDa discrete, branched PEGylation reagents on mCC49 Fab′ (MW 50 kDa) via in vitro TAG72 binding, and in vivo blood clearance kinetics, biodistribution, and mouse tumor microPET/CT imaging. mCC49Fab′ (Fab′-NEM) was conjugated at a hinge region cysteine with maleimide-dPEG12-(dPEG24COOH)3 acid (Mal-dPEG-A), maleimide-dPEG12-(dPEG12COOH)3 acid (Mal-dPEG-B), or maleimide-dPEG12-(m-dPEG24)3 (Mal-dPEG-C), and then radiolabeled with iodine-124 (124I) in vitro radioligand binding assays and in vivo studies used TAG-72 expressing LS174T human colon carcinoma cells and xenograft mouse tumors. Conjugation of mCC49Fab′ with Mal-dPEG-A (Fab′-A) reduced the binding affinity of the non PEGylated Fab′ by 30%; however, in vivo, Fab′-A significantly lengthened the blood retention vs Fab′-NEM (47.5 vs 28.1%/ID at 1 h, 25.1 vs 8.4%/ID at 5 h, p < 0.01), showed excellent tumor to background, better microPET/CT images due to higher tumor accumulation, and increased tumor concentration in excised tissues at 72 h by 130% (5.09 ± 0.83 vs 3.83 ± 1.50%ID/g, p < 0.05). Despite the strong similarity of the three PEGylation reagents, PEGylation with Mal-dPEG-B or -C reduced the in vitro binding affinity of Fab′-NEM by 70%, blood retention, microPET/CT imaging tumor signal intensity, and residual 72 h tumor concentration by 49% (3.83 ± 1.50 vs 1.97 ± 0.29%ID/g, p < 0.05) and 63% (3.83 ± 1.50 vs 1.42 ± 0.35%ID/g, p < 0.05), respectively. We conclude that remarkably subtle changes in the structure of the PEGylation reagent can create significantly altered biologic behavior. Further study is warranted of conjugates of the triple branched, negatively charged Mal-dPEG-A. PMID:24175669

Metallomics investigations on potential binding partners of methylmercury in tuna fish muscle tissue using complementary mass spectrometric techniques.

PubMed

Kutscher, Daniel J; Sanz-Medel, Alfredo; Bettmer, Jörg

2012-08-01

In this study, the binding behaviour of methylmercury (MeHg(+)) towards proteins is investigated. Free sulfhydryl groups in cysteine residues are known to be the most likely binding partners, due to the high affinity of mercury to sulphur. However, detailed knowledge about discrete binding sites in living organisms has been so far scarce. A metallomics approach using different methods like size-exclusion chromatography (SEC) and liquid chromatography (LC) coupled to inductively coupled plasma-mass spectrometry (ICP-MS) as well as complementary mass spectrometric techniques (electrospray ionisation-tandem mass spectrometry, ESI-MS/MS) are combined to sequence and identify possible target proteins or peptides after enzymatic digestion. Potential targets for MeHg(+) in tuna fish muscle tissue are investigated using the certified reference material CRM464 as a model tissue. Different extraction procedures appropriate for the extraction of proteins are evaluated for their efficiency using isotope dilution analysis for the determination of total Hg in the extracts. Due to the high chemical stability of the mercury-sulphur bond, the bioconjugate can be quantitatively extracted with a combination of tris(hydroxymethyl)aminomethane (TRIS) and sodium dodecyl sulphate (SDS). Using different separation techniques such as SEC and SDS-polyacrylamide gel electrophoresis (SDS-PAGE) it can be shown that major binding occurs to a high-molecular weight protein (M(w) > 200 kDa). A potential target protein, skeletal muscle myosin heavy chain, could be identified after tryptic digestion and capillary LC-ESI-MS/MS.

Structures of the APC–ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners

PubMed Central

Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

2015-01-01

The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC–Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC–ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC–ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC–ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC–ARM binding partners. PMID:27462415

Structures of the APC-ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners.

PubMed

Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

2015-01-01

The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC-Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC-ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC-ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC-ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC-ARM binding partners.

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

Interaction study on bovine serum albumin physically binding to silver nanoparticles: Evolution from discrete conjugates to protein coronas

NASA Astrophysics Data System (ADS)

Guo, Jun; Zhong, Ruibo; Li, Wanrong; Liu, Yushuang; Bai, Zhijun; Yin, Jun; Liu, Jingran; Gong, Pei; Zhao, Xinmin; Zhang, Feng

2015-12-01

The nanostructures formed by inorganic nanoparticles together with organic molecules especially biomolecules have attracted increasing attention from both industries and researching fields due to their unique hybrid properties. In this paper, we systemically studied the interactions between amphiphilic polymer coated silver nanoparticles and bovine serum albumins by employing the fluorescence quenching approach in combination with the Stern-Volmer and Hill equations. The binding affinity was determined to 1.30 × 107 M-1 and the interaction was spontaneously driven by mainly the van der Waals force and hydrogen-bond mediated interactions, and negatively cooperative from the point of view of thermodynamics. With the non-uniform coating of amphiphilic polymer, the silver nanoparticles can form protein coronas which can become discrete protein-nanoparticle conjugates when controlling their molar ratios of mixing. The protein's conformational changes upon binding nanoparticles was also studied by using the three-dimensional fluorescence spectroscopy.

Relative binding and biochemical effects of heterodimeric and homodimeric isoforms of platelet-derived growth factor in osteoblast-enriched cultures from fetal rat bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Centrella, M.; McCarthy, T.L.; Kusmik, W.F.

1991-06-01

Platelet-derived growth factor (PDGF) exists as a homodimer or a heterodimer comprising either PDGF-A or PDGF-B subunits, and each isoform occurs in various tissues, including bone. Although the stimulatory effects of PDGF-BB have been studied in cultures of bone cells and intact bone fragments, the influence of other isoforms that may arise locally or systematically in vivo, has not been reported. Therefore recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were evaluated in osteoblast-enriched cultures from fetal rat bone. Within 24 hours these factors produced a graded response in bone cell DNA and protein synthesis, with half-maximal effects at approximately 0.6, 2.1,more » and 4.8 nM PDGF-BB, PDGF-AB, and PDGF-AA, respectively. Increases in collagen and noncollagen protein synthesis were abrogated when DNA synthesis was blocked with hydroxyurea. Furthermore, each factor reduced alkaline phosphatase activity, PDGF-BB being the most inhibitory. Binding studies with 125I-PDGF-BB or 125I-PDGF-AA and each unlabeled PDGF isoform produced discrete ligand binding and displacement patterns: 125I-PDGF-BB binding was preferentially displaced by PDGF-BB (Ki approximately 0.7 nM), less by PDGF-AB (Ki approximately 2.3 nM) and poorly by PDGF-AA. In contrast, 125I-PDGF-AA binding was measurably reduced by PDGF-AA (Ki approximately 4.0 nM), but was more effectively displaced by PDGF-BB or PDGF-AB (each with Ki approximately 0.7 nM). These studies indicate that each PDGF isoform produces biochemical effects proportional to binding site occupancy and suggest that receptors that favor PDGF-B subunit binding preferentially mediate these results in osteoblast-enriched bone cell cultures.« less

Monte Carlo modeling of single-molecule cytoplasmic dynein.

PubMed

Singh, Manoranjan P; Mallik, Roop; Gross, Steven P; Yu, Clare C

2005-08-23

Molecular motors are responsible for active transport and organization in the cell, underlying an enormous number of crucial biological processes. Dynein is more complicated in its structure and function than other motors. Recent experiments have found that, unlike other motors, dynein can take different size steps along microtubules depending on load and ATP concentration. We use Monte Carlo simulations to model the molecular motor function of cytoplasmic dynein at the single-molecule level. The theory relates dynein's enzymatic properties to its mechanical force production. Our simulations reproduce the main features of recent single-molecule experiments that found a discrete distribution of dynein step sizes, depending on load and ATP concentration. The model reproduces the large steps found experimentally under high ATP and no load by assuming that the ATP binding affinities at the secondary sites decrease as the number of ATP bound to these sites increases. Additionally, to capture the essential features of the step-size distribution at very low ATP concentration and no load, the ATP hydrolysis of the primary site must be dramatically reduced when none of the secondary sites have ATP bound to them. We make testable predictions that should guide future experiments related to dynein function.

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.

2014-10-02

GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1)more » an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.« less

CYP2C9 Amino Acid Residues Influencing Phenytoin Turnover and Metabolite Regio- and Stereochemistry

PubMed Central

Mosher, Carrie M.; Tai, Guoying; Rettie, Allan E.

2009-01-01

Phenytoin has been an effective anticonvulsant agent for over 60 years, although its clinical use is complicated by nonlinear pharmacokinetics, a narrow therapeutic index, and metabolically based drug-drug interactions. Although it is well established that CYP2C9 is the major cytochrome P450 enzyme controlling metabolic elimination of phenytoin through its oxidative conversion to (S)-5-(4-hydroxyphenyl)-5-phenylhydantoin (p-HPPH), nothing is known about the amino acid binding determinants within the CYP2C9 active site that promote metabolism and maintain the tight stereocontrol of hydroxy metabolite formation. This knowledge gap was addressed here through the construction of nine active site mutants at amino acid positions Phe100, Arg108, Phe114, Leu208, and Phe476 and in vitro analysis of the steady-state kinetics and stereochemistry of p-HPPH formation. The F100L and F114W mutants exhibited 4- to 5-fold increases in catalytic efficiency, whereas the F100W, F114L, F476L, and F476W mutants lost >90% of their phenytoin hydroxylation capacity. This pattern of effects differs substantially from that found previously for (S)-warfarin and (S)-flurbiprofen metabolism, suggesting that these three ligands bind within discrete locations in the CYP2C9 active site. Only the F114L, F476L, and L208V mutants altered phenytoin's orientation during catalytic turnover. The L208V mutant also uniquely demonstrated enhanced 6-hydroxylation of (S)-warfarin. These latter data provide the first experimental evidence for a role of the F-G loop region in dictating the catalytic orientation of substrates within the CYP2C9 active site. PMID:19258521

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Genome-wide Analysis Reveals Extensive Functional Interaction between DNA Replication Initiation and Transcription in the Genome of Trypanosoma brucei

PubMed Central

Tiengwe, Calvin; Marcello, Lucio; Farr, Helen; Dickens, Nicholas; Kelly, Steven; Swiderski, Michal; Vaughan, Diane; Gull, Keith; Barry, J. David; Bell, Stephen D.; McCulloch, Richard

2012-01-01

Summary Identification of replication initiation sites, termed origins, is a crucial step in understanding genome transmission in any organism. Transcription of the Trypanosoma brucei genome is highly unusual, with each chromosome comprising a few discrete transcription units. To understand how DNA replication occurs in the context of such organization, we have performed genome-wide mapping of the binding sites of the replication initiator ORC1/CDC6 and have identified replication origins, revealing that both localize to the boundaries of the transcription units. A remarkably small number of active origins is seen, whose spacing is greater than in any other eukaryote. We show that replication and transcription in T. brucei have a profound functional overlap, as reducing ORC1/CDC6 levels leads to genome-wide increases in mRNA levels arising from the boundaries of the transcription units. In addition, ORC1/CDC6 loss causes derepression of silent Variant Surface Glycoprotein genes, which are critical for host immune evasion. PMID:22840408

Discrete Functions of Nuclear Receptor Rev-erbα Couple Metabolism to the Clock

PubMed Central

Zhang, Yuxiang; Fang, Bin; Emmett, Matthew J.; Damle, Manashree; Sun, Zheng; Feng, Dan; Armour, Sean M.; Remsberg, Jarrett R.; Jager, Jennifer; Soccio, Raymond E.; Steger, David J.; Lazar, Mitchell A.

2015-01-01

SUMMARY Circadian and metabolic physiology are intricately intertwined, as illustrated by Rev-erbα, a transcription factor (TF) that functions both as a core repressive component of the cell autonomous clock and as a regulator of metabolic genes. Here we show that Rev-erbα modulates the clock and metabolism by different genomic mechanisms. Clock control requires Rev-erbα to bind directly to the genome at its cognate sites, where it competes with activating ROR TFs. By contrast, Rev-erbα regulates metabolic genes primarily by recruiting the HDAC3 corepressor to sites to which it is tethered by cell type-specific transcription factors. Thus, direct competition between Rev-erbα and ROR TFs provides a universal mechanism for self-sustained control of molecular clock across all tissues, whereas Rev-erbα utilizes lineage-determining factors to convey a tissue-specific epigenomic rhythm that regulates metabolism tailored to the specific need of that tissue. PMID:26044300

GENE REGULATION. Discrete functions of nuclear receptor Rev-erbα couple metabolism to the clock.

PubMed

Zhang, Yuxiang; Fang, Bin; Emmett, Matthew J; Damle, Manashree; Sun, Zheng; Feng, Dan; Armour, Sean M; Remsberg, Jarrett R; Jager, Jennifer; Soccio, Raymond E; Steger, David J; Lazar, Mitchell A

2015-06-26

Circadian and metabolic physiology are intricately intertwined, as illustrated by Rev-erbα, a transcription factor (TF) that functions both as a core repressive component of the cell-autonomous clock and as a regulator of metabolic genes. Here, we show that Rev-erbα modulates the clock and metabolism by different genomic mechanisms. Clock control requires Rev-erbα to bind directly to the genome at its cognate sites, where it competes with activating ROR TFs. By contrast, Rev-erbα regulates metabolic genes primarily by recruiting the HDAC3 co-repressor to sites to which it is tethered by cell type-specific transcription factors. Thus, direct competition between Rev-erbα and ROR TFs provides a universal mechanism for self-sustained control of the molecular clock across all tissues, whereas Rev-erbα uses lineage-determining factors to convey a tissue-specific epigenomic rhythm that regulates metabolism tailored to the specific need of that tissue. Copyright © 2015, American Association for the Advancement of Science.

Transfer of dipolar gas through the discrete localized mode.

PubMed

Bai, Xiao-Dong; Zhang, Ai-Xia; Xue, Ju-Kui

2013-12-01

By considering the discrete nonlinear Schrödinger model with dipole-dipole interactions for dipolar condensate, the existence, the types, the stability, and the dynamics of the localized modes in a nonlinear lattice are discussed. It is found that the contact interaction and the dipole-dipole interactions play important roles in determining the existence, the type, and the stability of the localized modes. Because of the coupled effects of the contact interaction and the dipole-dipole interactions, rich localized modes and their stability nature can exist: when the contact interaction is larger and the dipole-dipole interactions is smaller, a discrete bright breather occurs. In this case, while the on-site interaction can stabilize the discrete breather, the dipole-dipole interactions will destabilize the discrete breather; when both the contact interaction and the dipole-dipole interactions are larger, a discrete kink appears. In this case, both the on-site interaction and the dipole-dipole interactions can stabilize the discrete kink, but the discrete kink is more unstable than the ordinary discrete breather. The predicted results provide a deep insight into the dynamics of blocking, filtering, and transfer of the norm in nonlinear lattices for dipolar condensates.

Multiple coupled landscapes and non-adiabatic dynamics with applications to self-activating genes.

PubMed

Chen, Cong; Zhang, Kun; Feng, Haidong; Sasai, Masaki; Wang, Jin

2015-11-21

Many physical, chemical and biochemical systems (e.g. electronic dynamics and gene regulatory networks) are governed by continuous stochastic processes (e.g. electron dynamics on a particular electronic energy surface and protein (gene product) synthesis) coupled with discrete processes (e.g. hopping among different electronic energy surfaces and on and off switching of genes). One can also think of the underlying dynamics as the continuous motion on a particular landscape and discrete hoppings among different landscapes. The main difference of such systems from the intra-landscape dynamics alone is the emergence of the timescale involved in transitions among different landscapes in addition to the timescale involved in a particular landscape. The adiabatic limit when inter-landscape hoppings are fast compared to continuous intra-landscape dynamics has been studied both analytically and numerically, but the analytical treatment of the non-adiabatic regime where the inter-landscape hoppings are slow or comparable to continuous intra-landscape dynamics remains challenging. In this study, we show that there exists mathematical mapping of the dynamics on 2(N) discretely coupled N continuous dimensional landscapes onto one single landscape in 2N dimensional extended continuous space. On this 2N dimensional landscape, eddy current emerges as a sign of non-equilibrium non-adiabatic dynamics and plays an important role in system evolution. Many interesting physical effects such as the enhancement of fluctuations, irreversibility, dissipation and optimal kinetics emerge due to non-adiabaticity manifested by the eddy current illustrated for an N = 1 self-activator. We further generalize our theory to the N-gene network with multiple binding sites and multiple synthesis rates for discretely coupled non-equilibrium stochastic physical and biological systems.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Preliminary Work in Obtaining Site-Directed Mutants of Hen Egg White Lysozyme

NASA Technical Reports Server (NTRS)

Holmes, Leonard D.

1996-01-01

Protein crystal growth studies are recognized as a critical endeavor in the field of molecular biotechnology. The scientific applications of this field include the understanding of how enzymes function and the accumulation of accurate information of atomic structures, a key factor in the process of rational drug design. NASA has committed substantial investment and resources to the field of protein crystal growth and has conducted many microgravity protein crystal growth experiments aboard shuttle flights. Crystals grown in space tend to be larger, denser and have a more perfect habit and geometry. These improved properties gained in the microgravity environment of space result largely from the reduction of solutal convection, and the elimination of sedimentation at the growing crystal surface. Shuttle experiments have yielded many large, high quality crystals that are suitable for high resolution X-ray diffraction analysis. Examples of biologically important macromolecules which have been successfully crystallized during shuttle missions include: lysozyme, isocitrate lyase, gamma-interferon, insulin, human serum albumin and canavalin. Numerous other examples are also available. In addition to obtaining high quality crystals, investigators are also interested in learning the mechanisms by which the growth events take place. Crystallization experiments indicate that for the enzyme HEWL, measured growth rates do not follow mathematical models for 2D nucleation and dislocation-led growth of tetragonal protein crystals. As has been suggested by the laboratory of Marc L. Pusey, a possible explanation for the disagreement between observation and data is that HEWL tetraconal crystals form by aggregated units of lysozyme in supersaturated solutions. Surface measurement data was shown to fit very well with a model using an octamer unit cell as the growth unit. According to this model, the aggregation pathway and subsequent crystal growth is described by: monomer < ------ > dimer < ------- > tetramer < ------ > octamer < ------ > higher order. It is believed that multimer aggregation of lysozyme occurs by interaction at specific binding sites on the surface of the protein crystals. If the presence of discrete binding sites and the aggregation hypothesis is true, then it follows that the alteration of the binding site(s) should have significant effect on the measurements obtained during growth experiments. Site-directed mutagenesis allows the specific alteration of proteins by replacement, deletion or addition of specific amino acid residues. This report outlines the approach for this strategy and the progress made thus far toward that end.

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

Glycosyltransferase-programmed stereosubstitution (GPS) to create HCELL: engineering a roadmap for cell migration.

PubMed

Sackstein, Robert

2009-07-01

During evolution of the vertebrate cardiovascular system, the vast endothelial surface area associated with branching vascular networks mandated the development of molecular processes to efficiently and specifically recruit circulating sentinel host defense cells and tissue repair cells at localized sites of inflammation/tissue injury. The forces engendered by high-velocity blood flow commensurately required the evolution of specialized cell surface molecules capable of mediating shear-resistant endothelial adhesive interactions, thus literally capturing relevant cells from the blood stream onto the target endothelial surface and permitting subsequent extravasation. The principal effectors of these shear-resistant binding interactions comprise a family of C-type lectins known as 'selectins' that bind discrete sialofucosylated glycans on their respective ligands. This review explains the 'intelligent design' of requisite reagents to convert native CD44 into the sialofucosylated glycoform known as hematopoietic cell E-/L-selectin ligand (HCELL), the most potent E-selectin counter-receptor expressed on human cells, and will describe how ex vivo glycan engineering of HCELL expression may open the 'avenues' for the efficient vascular delivery of cells for a variety of cell therapies.

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Estimation of rates-across-sites distributions in phylogenetic substitution models.

PubMed

Susko, Edward; Field, Chris; Blouin, Christian; Roger, Andrew J

2003-10-01

Previous work has shown that it is often essential to account for the variation in rates at different sites in phylogenetic models in order to avoid phylogenetic artifacts such as long branch attraction. In most current models, the gamma distribution is used for the rates-across-sites distributions and is implemented as an equal-probability discrete gamma. In this article, we introduce discrete distribution estimates with large numbers of equally spaced rate categories allowing us to investigate the appropriateness of the gamma model. With large numbers of rate categories, these discrete estimates are flexible enough to approximate the shape of almost any distribution. Likelihood ratio statistical tests and a nonparametric bootstrap confidence-bound estimation procedure based on the discrete estimates are presented that can be used to test the fit of a parametric family. We applied the methodology to several different protein data sets, and found that although the gamma model often provides a good parametric model for this type of data, rate estimates from an equal-probability discrete gamma model with a small number of categories will tend to underestimate the largest rates. In cases when the gamma model assumption is in doubt, rate estimates coming from the discrete rate distribution estimate with a large number of rate categories provide a robust alternative to gamma estimates. An alternative implementation of the gamma distribution is proposed that, for equal numbers of rate categories, is computationally more efficient during optimization than the standard gamma implementation and can provide more accurate estimates of site rates.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Cross-talk between the ligand- and DNA-binding domains of estrogen receptor.

PubMed

Huang, Wei; Greene, Geoffrey L; Ravikumar, Krishnakumar M; Yang, Sichun

2013-11-01

Estrogen receptor alpha (ERα) is a hormone-responsive transcription factor that contains several discrete functional domains, including a ligand-binding domain (LBD) and a DNA-binding domain (DBD). Despite a wealth of knowledge about the behaviors of individual domains, the molecular mechanisms of cross-talk between LBD and DBD during signal transduction from hormone to DNA-binding of ERα remain elusive. Here, we apply a multiscale approach combining coarse-grained (CG) and atomistically detailed simulations to characterize this cross-talk mechanism via an investigation of the ERα conformational landscape. First, a CG model of ERα is built based on crystal structures of individual LBDs and DBDs, with more emphasis on their interdomain interactions. Second, molecular dynamics simulations are implemented and enhanced sampling is achieved via the "push-pull-release" strategy in the search for different LBD-DBD orientations. Third, multiple energetically stable ERα conformations are identified on the landscape. A key finding is that estradiol-bound LBDs utilize the well-described activation helix H12 to pack and stabilize LBD-DBD interactions. Our results suggest that the estradiol-bound LBDs can serve as a scaffold to position and stabilize the DBD-DNA complex, consistent with experimental observations of enhanced DNA binding with the LBD. Final assessment using atomic-level simulations shows that these CG-predicted models are significantly stable within a 15-ns simulation window and that specific pairs of lysine residues in close proximity at the domain interfaces could serve as candidate sites for chemical cross-linking studies. Together, these simulation results provide a molecular view of the role of ERα domain interactions in response to hormone binding. Copyright © 2013 Wiley Periodicals, Inc.

Analysis of Cytochrome P450 CYP119 Ligand-dependent Conformational Dynamics by Two-dimensional NMR and X-ray Crystallography*

PubMed Central

Basudhar, Debashree; Madrona, Yarrow; Kandel, Sylvie; Lampe, Jed N.; Nishida, Clinton R.; de Montellano, Paul R. Ortiz

2015-01-01

Defining the conformational states of cytochrome P450 active sites is critical for the design of agents that minimize drug-drug interactions, the development of isoform-specific P450 inhibitors, and the engineering of novel oxidative catalysts. We used two-dimensional 1H,15N HSQC chemical shift perturbation mapping of 15N-labeled Phe residues and x-ray crystallography to examine the ligand-dependent conformational dynamics of CYP119. Active site Phe residues were most affected by the binding of azole inhibitors and fatty acid substrates, in agreement with active site localization of the conformational changes. This was supported by crystallography, which revealed movement of the F-G loop with various azoles. Nevertheless, the NMR chemical shift perturbations caused by azoles and substrates were distinguishable. The absence of significant chemical shift perturbations with several azoles revealed binding of ligands to an open conformation similar to that of the ligand-free state. In contrast, 4-phenylimidazole caused pronounced NMR changes involving Phe-87, Phe-144, and Phe-153 that support the closed conformation found in the crystal structure. The same closed conformation is observed by NMR and crystallography with a para-fluoro substituent on the 4-phenylimidazole, but a para-chloro or bromo substituent engendered a second closed conformation. An open conformation is thus favored in solution with many azole ligands, but para-substituted phenylimidazoles give rise to two closed conformations that depend on the size of the para-substituent. The results suggest that ligands selectively stabilize discrete cytochrome P450 conformational states. PMID:25670859

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Complement activation by ligand-driven juxtaposition of discrete pattern recognition complexes

PubMed Central

Degn, Søren E.; Kjaer, Troels R.; Kidmose, Rune T.; Jensen, Lisbeth; Hansen, Annette G.; Tekin, Mustafa; Jensenius, Jens C.; Andersen, Gregers R.; Thiel, Steffen

2014-01-01

Defining mechanisms governing translation of molecular binding events into immune activation is central to understanding immune function. In the lectin pathway of complement, the pattern recognition molecules (PRMs) mannan-binding lectin (MBL) and ficolins complexed with the MBL-associated serine proteases (MASP)-1 and MASP-2 cleave C4 and C2 to generate C3 convertase. MASP-1 was recently found to be the exclusive activator of MASP-2 under physiological conditions, yet the predominant oligomeric forms of MBL carry only a single MASP homodimer. This prompted us to investigate whether activation of MASP-2 by MASP-1 occurs through PRM-driven juxtaposition on ligand surfaces. We demonstrate that intercomplex activation occurs between discrete PRM/MASP complexes. PRM ligand binding does not directly escort the transition of MASP from zymogen to active enzyme in the PRM/MASP complex; rather, clustering of PRM/MASP complexes directly causes activation. Our results support a clustering-based mechanism of activation, fundamentally different from the conformational model suggested for the classical pathway of complement. PMID:25197071

A Novel MHC-I Surface Targeted for Binding by the MCMV m06 Immunoevasin Revealed by Solution NMR.

PubMed

Sgourakis, Nikolaos G; May, Nathan A; Boyd, Lisa F; Ying, Jinfa; Bax, Ad; Margulies, David H

2015-11-27

As part of its strategy to evade detection by the host immune system, murine cytomegalovirus (MCMV) encodes three proteins that modulate cell surface expression of major histocompatibility complex class I (MHC-I) molecules: the MHC-I homolog m152/gp40 as well as the m02-m16 family members m04/gp34 and m06/gp48. Previous studies of the m04 protein revealed a divergent Ig-like fold that is unique to immunoevasins of the m02-m16 family. Here, we engineer and characterize recombinant m06 and investigate its interactions with full-length and truncated forms of the MHC-I molecule H2-L(d) by several techniques. Furthermore, we employ solution NMR to map the interaction footprint of the m06 protein on MHC-I, taking advantage of a truncated H2-L(d), "mini-H2-L(d)," consisting of only the α1α2 platform domain. Mini-H2-L(d) refolded in vitro with a high affinity peptide yields a molecule that shows outstanding NMR spectral features, permitting complete backbone assignments. These NMR-based studies reveal that m06 binds tightly to a discrete site located under the peptide-binding platform that partially overlaps with the β2-microglobulin interface on the MHC-I heavy chain, consistent with in vitro binding experiments showing significantly reduced complex formation between m06 and β2-microglobulin-associated MHC-I. Moreover, we carry out NMR relaxation experiments to characterize the picosecond-nanosecond dynamics of the free mini-H2-L(d) MHC-I molecule, revealing that the site of interaction is highly ordered. This study provides insight into the mechanism of the interaction of m06 with MHC-I, suggesting a structural manipulation of the target MHC-I molecule at an early stage of the peptide-loading pathway. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of endoplasmic reticulum proteins involved in glycan assembly: synthesis and characterization of P3-(4-azidoanilido)uridine 5'-triphosphate, a membrane-topological photoaffinity probe for uridine diphosphate-sugar binding proteins.

PubMed Central

Rancour, D M; Menon, A K

1998-01-01

Much of the enzymic machinery required for the assembly of cell surface carbohydrates is located in the endoplasmic reticulum (ER) of eukaryotic cells. Structural information on these proteins is limited and the identity of the active polypeptide(s) is generally unknown. This paper describes the synthesis and characteristics of a photoaffinity reagent that can be used to identify and analyse members of the ER glycan assembly apparatus, specifically those glycosyltransferases, nucleotide phosphatases and nucleotide-sugar transporters that recognize uridine nucleotides or UDP-sugars. The photoaffinity reagent, P3-(4-azidoanilido)uridine 5'-triphosphate (AAUTP), was synthesized easily from commercially available precursors. AAUTP inhibited the activity of ER glycosyltransferases that utilize UDP-GlcNAc and UDP-Glc, indicating that it is recognized by UDP-sugar-binding proteins. In preliminary tests AAUTP[alpha-32P] labelled bovine milk galactosyltransferase, a model UDP-sugar-utilizing enzyme, in a UV-light-dependent, competitive and saturable manner. When incubated with rat liver ER vesicles, AAUTP[alpha-32P] labelled a discrete subset of ER proteins; labelling was light-dependent and metal ion-specific. Photolabelling of intact ER vesicles with AAUTP[alpha-32P] caused selective incorporation of radioactivity into proteins with cytoplasmically disposed binding sites; UDP-Glc:glycoprotein glucosyltransferase, a lumenal protein, was labelled only when the vesicle membrane was disrupted. These data indicate that AAUTP is a membrane topological probe of catalytic sites in target proteins. Strategies for using AAUTP to identify and study novel ER proteins involved in glycan assembly are discussed. PMID:9677326

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Cone penetrometer testing and discrete-depth ground water sampling techniques: A cost-effective method of site characterization in a multiple-aquifer setting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zemo, D.A.; Pierce, Y.G.; Gallinatti, J.D.

Cone penetrometer testing (CPT), combined with discrete-depth ground water sampling methods, can significantly reduce the time and expense required to characterize large sites that have multiple aquifers. Results from the screening site characterization can then be used to design and install a cost-effective monitoring well network. At a site in northern California, it was necessary to characterize the stratigraphy and the distribution of volatile organic compounds (VOCs). To expedite characterization, a five-week field screening program was implemented that consisted of a shallow ground water survey, CPT soundings and pore-pressure measurements, and discrete-depth ground water sampling. Based on continuous lithologic informationmore » provided by the CPT soundings, four predominantly coarse-grained, water yielding stratigraphic packages were identified. Seventy-nine discrete-depth ground water samples were collected using either shallow ground water survey techniques, the BAT Enviroprobe, or the QED HydroPunch I, depending on subsurface conditions. Using results from these efforts, a 20-well monitoring network was designed and installed to monitor critical points within each stratigraphic package. Good correlation was found for hydraulic head and chemical results between discrete-depth screening data and monitoring well data. Understanding the vertical VOC distribution and concentrations produced substantial time and cost savings by minimizing the number of permanent monitoring wells and reducing the number of costly conductor casings that had to be installed. Additionally, significant long-term cost savings will result from reduced sampling costs, because fewer wells comprise the monitoring network. The authors estimate these savings to be 50% for site characterization costs, 65% for site characterization time, and 60% for long-term monitoring costs.« less

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

1987-11-01

Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

A Neural Dynamic Model Generates Descriptions of Object-Oriented Actions.

PubMed

Richter, Mathis; Lins, Jonas; Schöner, Gregor

2017-01-01

Describing actions entails that relations between objects are discovered. A pervasively neural account of this process requires that fundamental problems are solved: the neural pointer problem, the binding problem, and the problem of generating discrete processing steps from time-continuous neural processes. We present a prototypical solution to these problems in a neural dynamic model that comprises dynamic neural fields holding representations close to sensorimotor surfaces as well as dynamic neural nodes holding discrete, language-like representations. Making the connection between these two types of representations enables the model to describe actions as well as to perceptually ground movement phrases-all based on real visual input. We demonstrate how the dynamic neural processes autonomously generate the processing steps required to describe or ground object-oriented actions. By solving the fundamental problems of neural pointing, binding, and emergent discrete processing, the model may be a first but critical step toward a systematic neural processing account of higher cognition. Copyright © 2017 The Authors. Topics in Cognitive Science published by Wiley Periodicals, Inc. on behalf of Cognitive Science Society.

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Activity and subcellular compartmentalization of peroxisome proliferator-activated receptor alpha are altered by the centrosome-associated protein CAP350.

PubMed

Patel, Hansa; Truant, Ray; Rachubinski, Richard A; Capone, John P

2005-01-01

Peroxisome proliferator-activated nuclear hormone receptors (PPAR) are ligand-activated transcription factors that play pivotal roles in governing metabolic homeostasis and cell growth. PPARs are primarily in the nucleus but, under certain circumstances, can be found in the cytoplasm. We show here that PPAR(alpha) interacts with the centrosome-associated protein CAP350. CAP350 also interacts with PPAR(delta), PPAR(gamma) and liver-X-receptor alpha, but not with the 9-cis retinoic acid receptor, RXR(alpha). Immunofluorescence analysis indicated that PPAR(alpha) is diffusely distributed in the nucleus and excluded from the cytoplasm. However, in the presence of coexpressed CAP350, PPAR(alpha) colocalizes with CAP350 to discrete nuclear foci and to the centrosome, perinuclear region and intermediate filaments. In contrast, the subcellular distribution of RXR(alpha) or of thyroid hormone receptor alpha was not altered by coexpression of CAP350. An amino-terminal fragment of CAP350 was localized exclusively to nuclear foci and was sufficient to recruit PPAR(alpha) to these sites. Mutation of the single putative nuclear hormone receptor interacting signature motif LXXLL present in this fragment had no effect on its subnuclear localization but abrogated recruitment of PPAR(alpha) to nuclear foci. Surprisingly, mutation of the LXXLL motif in this CAP350 subfragment did not prevent its binding to PPAR(alpha) in vitro, suggesting that this motif serves some function other than PPAR(alpha) binding in recruiting PPAR(alpha) to nuclear spots. CAP350 inhibited PPAR(alpha)-mediated transactivation in an LXXLL-dependent manner, suggesting that CAP350 represses PPAR(alpha) function. Our findings implicate CAP350 in a dynamic process that recruits PPAR(alpha) to discrete nuclear and cytoplasmic compartments and suggest that altered intracellular compartmentalization represents a regulatory process that modulates PPAR function.

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

NASA Astrophysics Data System (ADS)

Schwartz, Rochelle D.; Kellar, Kenneth J.

1983-04-01

Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

Substance P binding sites in the nucleus tractus solitarius of the cat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, B.E.; Sasek, C.A.; Seybold, V.S.

1988-11-01

Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

PubMed

Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

2018-06-16

Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

PubMed Central

Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

2008-01-01

Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

[The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

PubMed

Kawasaki, Kazuyoshi; Ogawa, Seturou

2003-01-01

NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

PubMed

Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

2014-02-03

The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

Binding of Amphipathic Cell Penetrating Peptide p28 to Wild Type and Mutated p53 as studied by Raman, Atomic Force and Surface Plasmon Resonance spectroscopies.

PubMed

Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

2017-04-01

Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.

Protein-Protein Interactions within Late Pre-40S Ribosomes

PubMed Central

Campbell, Melody G.; Karbstein, Katrin

2011-01-01

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762

Protein-protein interactions within late pre-40S ribosomes.

PubMed

Campbell, Melody G; Karbstein, Katrin

2011-01-20

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

Family 46 Carbohydrate-binding Modules Contribute to the Enzymatic Hydrolysis of Xyloglucan and β-1,3-1,4-Glucans through Distinct Mechanisms.

PubMed

Venditto, Immacolata; Najmudin, Shabir; Luís, Ana S; Ferreira, Luís M A; Sakka, Kazuo; Knox, J Paul; Gilbert, Harry J; Fontes, Carlos M G A

2015-04-24

Structural carbohydrates comprise an extraordinary source of energy that remains poorly utilized by the biofuel sector as enzymes have restricted access to their substrates within the intricacy of plant cell walls. Carbohydrate active enzymes (CAZYmes) that target recalcitrant polysaccharides are modular enzymes containing noncatalytic carbohydrate-binding modules (CBMs) that direct enzymes to their cognate substrate, thus potentiating catalysis. In general, CBMs are functionally and structurally autonomous from their associated catalytic domains from which they are separated through flexible linker sequences. Here, we show that a C-terminal CBM46 derived from BhCel5B, a Bacillus halodurans endoglucanase, does not interact with β-glucans independently but, uniquely, acts cooperatively with the catalytic domain of the enzyme in substrate recognition. The structure of BhCBM46 revealed a β-sandwich fold that abuts onto the region of the substrate binding cleft upstream of the active site. BhCBM46 as a discrete entity is unable to bind to β-glucans. Removal of BhCBM46 from BhCel5B, however, abrogates binding to β-1,3-1,4-glucans while substantially decreasing the affinity for decorated β-1,4-glucan homopolymers such as xyloglucan. The CBM46 was shown to contribute to xyloglucan hydrolysis only in the context of intact plant cell walls, but it potentiates enzymatic activity against purified β-1,3-1,4-glucans in solution or within the cell wall. This report reveals the mechanism by which a CBM can promote enzyme activity through direct interaction with the substrate or by targeting regions of the plant cell wall where the target glucan is abundant. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

A ruler protein in a complex for antiviral defense determines the length of small interfering CRISPR RNAs.

PubMed

Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A

2013-09-27

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.

Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCann, D.J.; Su, T.P.

1991-05-01

The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

PubMed

Suzuki, N; Mihashi, K

1991-01-01

The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

Analysis of cytochrome P450 CYP119 ligand-dependent conformational dynamics by two-dimensional NMR and X-ray crystallography.

PubMed

Basudhar, Debashree; Madrona, Yarrow; Kandel, Sylvie; Lampe, Jed N; Nishida, Clinton R; de Montellano, Paul R Ortiz

2015-04-17

Defining the conformational states of cytochrome P450 active sites is critical for the design of agents that minimize drug-drug interactions, the development of isoform-specific P450 inhibitors, and the engineering of novel oxidative catalysts. We used two-dimensional (1)H,(15)N HSQC chemical shift perturbation mapping of (15)N-labeled Phe residues and x-ray crystallography to examine the ligand-dependent conformational dynamics of CYP119. Active site Phe residues were most affected by the binding of azole inhibitors and fatty acid substrates, in agreement with active site localization of the conformational changes. This was supported by crystallography, which revealed movement of the F-G loop with various azoles. Nevertheless, the NMR chemical shift perturbations caused by azoles and substrates were distinguishable. The absence of significant chemical shift perturbations with several azoles revealed binding of ligands to an open conformation similar to that of the ligand-free state. In contrast, 4-phenylimidazole caused pronounced NMR changes involving Phe-87, Phe-144, and Phe-153 that support the closed conformation found in the crystal structure. The same closed conformation is observed by NMR and crystallography with a para-fluoro substituent on the 4-phenylimidazole, but a para-chloro or bromo substituent engendered a second closed conformation. An open conformation is thus favored in solution with many azole ligands, but para-substituted phenylimidazoles give rise to two closed conformations that depend on the size of the para-substituent. The results suggest that ligands selectively stabilize discrete cytochrome P450 conformational states. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Analysis of Cytochrome P450 CYP119 Ligand-dependent Conformational Dynamics by Two-dimensional NMR and X-ray Crystallography

DOE PAGES

Basudhar, Debashree; Madrona, Yarrow; Kandel, Sylvie; ...

2015-02-10

Defining the conformational states of cytochrome P450 active sites is critical for the design of agents that minimize drug-drug interactions, the development of isoform-specific P450 inhibitors, and the engineering of novel oxidative catalysts. In this paper, we used two-dimensional 1H,15N HSQC chemical shift perturbation mapping of 15N-labeled Phe residues and x-ray crystallography to examine the ligand-dependent conformational dynamics of CYP119. Active site Phe residues were most affected by the binding of azole inhibitors and fatty acid substrates, in agreement with active site localization of the conformational changes. This was supported by crystallography, which revealed movement of the F-G loop withmore » various azoles. Nevertheless, the NMR chemical shift perturbations caused by azoles and substrates were distinguishable. The absence of significant chemical shift perturbations with several azoles revealed binding of ligands to an open conformation similar to that of the ligand-free state. In contrast, 4-phenylimidazole caused pronounced NMR changes involving Phe-87, Phe-144, and Phe-153 that support the closed conformation found in the crystal structure. The same closed conformation is observed by NMR and crystallography with a para-fluoro substituent on the 4-phenylimidazole, but a para-chloro or bromo substituent engendered a second closed conformation. An open conformation is thus favored in solution with many azole ligands, but para-substituted phenylimidazoles give rise to two closed conformations that depend on the size of the para-substituent. Finally, the results suggest that ligands selectively stabilize discrete cytochrome P450 conformational states.« less

Analysis of Cytochrome P450 CYP119 Ligand-dependent Conformational Dynamics by Two-dimensional NMR and X-ray Crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basudhar, Debashree; Madrona, Yarrow; Kandel, Sylvie

Defining the conformational states of cytochrome P450 active sites is critical for the design of agents that minimize drug-drug interactions, the development of isoform-specific P450 inhibitors, and the engineering of novel oxidative catalysts. In this paper, we used two-dimensional 1H,15N HSQC chemical shift perturbation mapping of 15N-labeled Phe residues and x-ray crystallography to examine the ligand-dependent conformational dynamics of CYP119. Active site Phe residues were most affected by the binding of azole inhibitors and fatty acid substrates, in agreement with active site localization of the conformational changes. This was supported by crystallography, which revealed movement of the F-G loop withmore » various azoles. Nevertheless, the NMR chemical shift perturbations caused by azoles and substrates were distinguishable. The absence of significant chemical shift perturbations with several azoles revealed binding of ligands to an open conformation similar to that of the ligand-free state. In contrast, 4-phenylimidazole caused pronounced NMR changes involving Phe-87, Phe-144, and Phe-153 that support the closed conformation found in the crystal structure. The same closed conformation is observed by NMR and crystallography with a para-fluoro substituent on the 4-phenylimidazole, but a para-chloro or bromo substituent engendered a second closed conformation. An open conformation is thus favored in solution with many azole ligands, but para-substituted phenylimidazoles give rise to two closed conformations that depend on the size of the para-substituent. Finally, the results suggest that ligands selectively stabilize discrete cytochrome P450 conformational states.« less

Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luthin, G.R.; Wolfe, B.B.

The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Hidden Markov models for evolution and comparative genomics analysis.

PubMed

Bykova, Nadezda A; Favorov, Alexander V; Mironov, Andrey A

2013-01-01

The problem of reconstruction of ancestral states given a phylogeny and data from extant species arises in a wide range of biological studies. The continuous-time Markov model for the discrete states evolution is generally used for the reconstruction of ancestral states. We modify this model to account for a case when the states of the extant species are uncertain. This situation appears, for example, if the states for extant species are predicted by some program and thus are known only with some level of reliability; it is common for bioinformatics field. The main idea is formulation of the problem as a hidden Markov model on a tree (tree HMM, tHMM), where the basic continuous-time Markov model is expanded with the introduction of emission probabilities of observed data (e.g. prediction scores) for each underlying discrete state. Our tHMM decoding algorithm allows us to predict states at the ancestral nodes as well as to refine states at the leaves on the basis of quantitative comparative genomics. The test on the simulated data shows that the tHMM approach applied to the continuous variable reflecting the probabilities of the states (i.e. prediction score) appears to be more accurate then the reconstruction from the discrete states assignment defined by the best score threshold. We provide examples of applying our model to the evolutionary analysis of N-terminal signal peptides and transcription factor binding sites in bacteria. The program is freely available at http://bioinf.fbb.msu.ru/~nadya/tHMM and via web-service at http://bioinf.fbb.msu.ru/treehmmweb.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

A Versatile Class of Cell Surface Directional Motors Gives Rise to Gliding Motility and Sporulation in Myxococcus xanthus

PubMed Central

Wartel, Morgane; Czerwinski, Fabian; Le Gall, Anne-Valérie; Mauriello, Emilia M. F.; Bergam, Ptissam; Brun, Yves V.; Shaevitz, Joshua; Mignot, Tâm

2013-01-01

Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex) to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories. PMID:24339744

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structure-Activity Relationships of Small Molecule Autotaxin Inhibitors with a Discrete Binding Mode.

PubMed

Miller, Lisa M; Keune, Willem-Jan; Castagna, Diana; Young, Louise C; Duffy, Emma L; Potjewyd, Frances; Salgado-Polo, Fernando; Engel García, Paloma; Semaan, Dima; Pritchard, John M; Perrakis, Anastassis; Macdonald, Simon J F; Jamieson, Craig; Watson, Allan J B

2017-01-26

Autotaxin (ATX) is a secreted enzyme responsible for the hydrolysis of lysophosphatidylcholine (LPC) to the bioactive lysophosphatidic acid (LPA) and choline. The ATX-LPA signaling pathway is implicated in cell survival, migration, and proliferation; thus, the inhibition of ATX is a recognized therapeutic target for a number of diseases including fibrotic diseases, cancer, and inflammation, among others. Many of the developed synthetic inhibitors for ATX have resembled the lipid chemotype of the native ligand; however, a small number of inhibitors have been described that deviate from this common scaffold. Herein, we report the structure-activity relationships (SAR) of a previously reported small molecule ATX inhibitor. We show through enzyme kinetics studies that analogues of this chemotype are noncompetitive inhibitors, and by using a crystal structure with ATX we confirm the discrete binding mode.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Ethylene binding site affinity in ripening apples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, S.M.; Sisler, E.C.

1993-09-01

Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

Grid inhomogeneous solvation theory: hydration structure and thermodynamics of the miniature receptor cucurbit[7]uril.

PubMed

Nguyen, Crystal N; Young, Tom Kurtzman; Gilson, Michael K

2012-07-28

The displacement of perturbed water upon binding is believed to play a critical role in the thermodynamics of biomolecular recognition, but it is nontrivial to unambiguously define and answer questions about this process. We address this issue by introducing grid inhomogeneous solvation theory (GIST), which discretizes the equations of inhomogeneous solvation theory (IST) onto a three-dimensional grid situated in the region of interest around a solute molecule or complex. Snapshots from explicit solvent simulations are used to estimate localized solvation entropies, energies, and free energies associated with the grid boxes, or voxels, and properly summing these thermodynamic quantities over voxels yields information about hydration thermodynamics. GIST thus provides a smoothly varying representation of water properties as a function of position, rather than focusing on hydration sites where solvent is present at high density. It therefore accounts for full or partial displacement of water from sites that are highly occupied by water, as well as for partly occupied and water-depleted regions around the solute. GIST can also provide a well-defined estimate of the solvation free energy and therefore enables a rigorous end-states analysis of binding. For example, one may not only use a first GIST calculation to project the thermodynamic consequences of displacing water from the surface of a receptor by a ligand, but also account, in a second GIST calculation, for the thermodynamics of subsequent solvent reorganization around the bound complex. In the present study, a first GIST analysis of the molecular host cucurbit[7]uril is found to yield a rich picture of hydration structure and thermodynamics in and around this miniature receptor. One of the most striking results is the observation of a toroidal region of high water density at the center of the host's nonpolar cavity. Despite its high density, the water in this toroidal region is disfavored energetically and entropically, and hence may contribute to the known ability of this small receptor to bind guest molecules with unusually high affinities. Interestingly, the toroidal region of high water density persists even when all partial charges of the receptor are set to zero. Thus, localized regions of high solvent density can be generated in a binding site without strong, attractive solute-solvent interactions.

Grid inhomogeneous solvation theory: Hydration structure and thermodynamics of the miniature receptor cucurbit[7]uril

PubMed Central

Nguyen, Crystal N.; Kurtzman Young, Tom; Gilson, Michael K.

2012-01-01

The displacement of perturbed water upon binding is believed to play a critical role in the thermodynamics of biomolecular recognition, but it is nontrivial to unambiguously define and answer questions about this process. We address this issue by introducing grid inhomogeneous solvation theory (GIST), which discretizes the equations of inhomogeneous solvation theory (IST) onto a three-dimensional grid situated in the region of interest around a solute molecule or complex. Snapshots from explicit solvent simulations are used to estimate localized solvation entropies, energies, and free energies associated with the grid boxes, or voxels, and properly summing these thermodynamic quantities over voxels yields information about hydration thermodynamics. GIST thus provides a smoothly varying representation of water properties as a function of position, rather than focusing on hydration sites where solvent is present at high density. It therefore accounts for full or partial displacement of water from sites that are highly occupied by water, as well as for partly occupied and water-depleted regions around the solute. GIST can also provide a well-defined estimate of the solvation free energy and therefore enables a rigorous end-states analysis of binding. For example, one may not only use a first GIST calculation to project the thermodynamic consequences of displacing water from the surface of a receptor by a ligand, but also account, in a second GIST calculation, for the thermodynamics of subsequent solvent reorganization around the bound complex. In the present study, a first GIST analysis of the molecular host cucurbit[7]uril is found to yield a rich picture of hydration structure and thermodynamics in and around this miniature receptor. One of the most striking results is the observation of a toroidal region of high water density at the center of the host's nonpolar cavity. Despite its high density, the water in this toroidal region is disfavored energetically and entropically, and hence may contribute to the known ability of this small receptor to bind guest molecules with unusually high affinities. Interestingly, the toroidal region of high water density persists even when all partial charges of the receptor are set to zero. Thus, localized regions of high solvent density can be generated in a binding site without strong, attractive solute-solvent interactions. PMID:22852591

76 FR 70170 - Proposed Alternative Soils Standards for the Uravan, Colorado Uranium Mill

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-10

... identified four discrete areas that are not in full compliance with the soil remediation standards. The... State of Colorado and the EPA to proceed with delisting the Uravan site from the NPL. Four discrete... four discrete areas are referred to as: the Mill Hillside Area; A-Plant North Area; River Ponds Area...

Dynamic measurements of flowing cells labeled by gold nanoparticles using full-field photothermal interferometric imaging

NASA Astrophysics Data System (ADS)

Turko, Nir A.; Roitshtain, Darina; Blum, Omry; Kemper, Björn; Shaked, Natan T.

2017-06-01

We present highly dynamic photothermal interferometric phase microscopy for quantitative, selective contrast imaging of live cells during flow. Gold nanoparticles can be biofunctionalized to bind to specific cells, and stimulated for local temperature increase due to plasmon resonance, causing a rapid change of the optical phase. These phase changes can be recorded by interferometric phase microscopy and analyzed to form an image of the binding sites of the nanoparticles in the cells, gaining molecular specificity. Since the nanoparticle excitation frequency might overlap with the sample dynamics frequencies, photothermal phase imaging was performed on stationary or slowly dynamic samples. Furthermore, the computational analysis of the photothermal signals is time consuming. This makes photothermal imaging unsuitable for applications requiring dynamic imaging or real-time analysis, such as analyzing and sorting cells during fast flow. To overcome these drawbacks, we utilized an external interferometric module and developed new algorithms, based on discrete Fourier transform variants, enabling fast analysis of photothermal signals in highly dynamic live cells. Due to the self-interference module, the cells are imaged with and without excitation in video-rate, effectively increasing signal-to-noise ratio. Our approach holds potential for using photothermal cell imaging and depletion in flow cytometry.

Architecture of the ParF*ParG protein complex involved in prokaryotic DNA segregation.

PubMed

Barillà, Daniela; Hayes, Finbarr

2003-07-01

The mechanism by which low copy number plasmids are segregated at cell division involves the concerted action of two plasmid-encoded proteins that assemble on a centromere-like site. This study explores the topology of the DNA segregation machinery specified by the parFG locus of TP228, a partition system which is phylogenetically distinct from more well-characterized archetypes. A variety of genetic, biochemical and biophysical strategies revealed that the ParG protein is dimeric. ParF, which is more closely related to the cell division regulator MinD than to the prototypical ParA partition protein of plasmid P1, is instead multimeric and its polymeric state appears to be modulated by ATP which correlates with the proposed ATP-binding activity of ParF. ParG interacts in a sequence-specific manner with the DNA region upstream of the parFG locus and this binding is modulated by ParF. Intriguingly, the ParF and ParG proteins form at least two types of discrete complex in the absence of this region suggesting that the assembly dynamics of these proteins onto DNA is intricate.

Functional Roles of Acetylated Histone Marks at Mouse Meiotic Recombination Hot Spots

PubMed Central

Wu, Zhen; Fallahi, Mohammad; Ouizem, Souad; Liu, Qin; Li, Weimin; Costi, Roberta; Roush, William R.; Bois, Philippe R. J.

2016-01-01

ABSTRACT Meiotic recombination initiates following the formation of DNA double-strand breaks (DSBs) by the Spo11 endonuclease early in prophase I, at discrete regions in the genome coined “hot spots.” In mammals, meiotic DSB site selection is directed in part by sequence-specific binding of PRDM9, a polymorphic histone H3 (H3K4Me3) methyltransferase. However, other chromatin features needed for meiotic hot spot specification are largely unknown. Here we show that the recombinogenic cores of active hot spots in mice harbor several histone H3 and H4 acetylation and methylation marks that are typical of open, active chromatin. Further, deposition of these open chromatin-associated histone marks is dynamic and is manifest at spermatogonia and/or pre-leptotene-stage cells, which facilitates PRDM9 binding and access for Spo11 to direct the formation of DSBs, which are initiated at the leptotene stage. Importantly, manipulating histone acetylase and deacetylase activities established that histone acetylation marks are necessary for both hot spot activity and crossover resolution. We conclude that there are functional roles for histone acetylation marks at mammalian meiotic recombination hot spots. PMID:27821479

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

Autoradiographic localization of endothelin-1 binding sites in porcine skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Y.D.; Springall, D.R.; Wharton, J.

Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Higher order scaffoldin assembly in Ruminococcus flavefaciens cellulosome is coordinated by a discrete cohesin-dockerin interaction.

PubMed

Bule, Pedro; Pires, Virgínia M R; Alves, Victor D; Carvalho, Ana Luísa; Prates, José A M; Ferreira, Luís M A; Smith, Steven P; Gilbert, Harry J; Noach, Ilit; Bayer, Edward A; Najmudin, Shabir; Fontes, Carlos M G A

2018-05-03

Cellulosomes are highly sophisticated molecular nanomachines that participate in the deconstruction of complex polysaccharides, notably cellulose and hemicellulose. Cellulosomal assembly is orchestrated by the interaction of enzyme-borne dockerin (Doc) modules to tandem cohesin (Coh) modules of a non-catalytic primary scaffoldin. In some cases, as exemplified by the cellulosome of the major cellulolytic ruminal bacterium Ruminococcus flavefaciens, primary scaffoldins bind to adaptor scaffoldins that further interact with the cell surface via anchoring scaffoldins, thereby increasing cellulosome complexity. Here we elucidate the structure of the unique Doc of R. flavefaciens FD-1 primary scaffoldin ScaA, bound to Coh 5 of the adaptor scaffoldin ScaB. The RfCohScaB5-DocScaA complex has an elliptical architecture similar to previously described complexes from a variety of ecological niches. ScaA Doc presents a single-binding mode, analogous to that described for the other two Coh-Doc specificities required for cellulosome assembly in R. flavefaciens. The exclusive reliance on a single-mode of Coh recognition contrasts with the majority of cellulosomes from other bacterial species described to date, where Docs contain two similar Coh-binding interfaces promoting a dual-binding mode. The discrete Coh-Doc interactions observed in ruminal cellulosomes suggest an adaptation to the exquisite properties of the rumen environment.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

PubMed

Jiang, Peng; Singh, Mona; Coller, Hilary A

2013-01-01

Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Location of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

Locations of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

Discovering amino acid patterns on binding sites in protein complexes

PubMed Central

Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

2011-01-01

Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegon, A.; Rainbow, T.C.

1983-05-01

The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palacios, J.M.; Chinaglia, G.; Rigo, M.

1991-02-01

Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

PubMed

Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

2014-01-01

We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

PubMed

Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

1996-10-11

In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

PubMed Central

2011-01-01

Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

PubMed

Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

2016-11-01

Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

PubMed

Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

1986-08-15

The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

Improved detection of DNA-binding proteins via compression technology on PSSM information.

PubMed

Wang, Yubo; Ding, Yijie; Guo, Fei; Wei, Leyi; Tang, Jijun

2017-01-01

Since the importance of DNA-binding proteins in multiple biomolecular functions has been recognized, an increasing number of researchers are attempting to identify DNA-binding proteins. In recent years, the machine learning methods have become more and more compelling in the case of protein sequence data soaring, because of their favorable speed and accuracy. In this paper, we extract three features from the protein sequence, namely NMBAC (Normalized Moreau-Broto Autocorrelation), PSSM-DWT (Position-specific scoring matrix-Discrete Wavelet Transform), and PSSM-DCT (Position-specific scoring matrix-Discrete Cosine Transform). We also employ feature selection algorithm on these feature vectors. Then, these features are fed into the training SVM (support vector machine) model as classifier to predict DNA-binding proteins. Our method applys three datasets, namely PDB1075, PDB594 and PDB186, to evaluate the performance of our approach. The PDB1075 and PDB594 datasets are employed for Jackknife test and the PDB186 dataset is used for the independent test. Our method achieves the best accuracy in the Jacknife test, from 79.20% to 86.23% and 80.5% to 86.20% on PDB1075 and PDB594 datasets, respectively. In the independent test, the accuracy of our method comes to 76.3%. The performance of independent test also shows that our method has a certain ability to be effectively used for DNA-binding protein prediction. The data and source code are at https://doi.org/10.6084/m9.figshare.5104084.

Solid-State Gas Adsorption Studies with Discrete Palladium(II) [Pd2 (L)4 ]4+ Cages.

PubMed

Preston, Dan; White, Keith F; Lewis, James E M; Vasdev, Roan A S; Abrahams, Brendan F; Crowley, James D

2017-08-04

The need for effective CO 2 capture systems remains high, and due to their tunability, metallosupramolecular architectures are an attractive option for gas sorption. While the use of extended metal organic frameworks for gas adsorption has been extensively explored, the exploitation of discrete metallocage architectures to bind gases remains in its infancy. Herein the solid state gas adsorption properties of a series of [Pd 2 (L) 4 ] 4+ lantern shaped coordination cages (L = variants of 2,6-bis(pyridin-3-ylethynyl)pyridine), which had solvent accessible internal cavities suitable for gas binding, have been investigated. The cages showed little interaction with dinitrogen gas but were able to take up CO 2 . The best performing cage reversibly sorbed 1.4 mol CO 2 per mol cage at 298 K, and 2.3 mol CO 2 per mol cage at 258 K (1 bar). The enthalpy of binding was calculated to be 25-35 kJ mol -1 , across the number of equivalents bound, while DFT calculations on the CO 2 binding in the cage gave ΔE for the cage-CO 2 interaction of 23-28 kJ mol -1 , across the same range. DFT modelling suggested that the binding mode is a hydrogen bond between the carbonyl oxygen of CO 2 and the internally directed hydrogen atoms of the cage. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

PubMed

Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

2017-04-01

BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

PubMed

Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

1996-01-04

In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, K.A.; LaBarbera, A.R.

1988-11-01

The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

PubMed Central

Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

2013-01-01

Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Computational Optimization and Characterization of Molecularly Imprinted Polymers

NASA Astrophysics Data System (ADS)

Terracina, Jacob J.

Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

PubMed

Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

2011-05-01

The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

High Productivity Computing Systems Analysis and Performance

DTIC Science & Technology

2005-07-01

cubic grid Discrete Math Global Updates per second (GUP/S) RandomAccess Paper & Pencil Contact Bob Lucas (ISI) Multiple Precision none...can be found at the web site. One of the HPCchallenge codes, RandomAccess, is derived from the HPCS discrete math benchmarks that we released, and...Kernels Discrete Math … Graph Analysis … Linear Solvers … Signal Processi ng Execution Bounds Execution Indicators 6 Scalable Compact

Acceleration of Binding Site Comparisons by Graph Partitioning.

PubMed

Krotzky, Timo; Klebe, Gerhard

2015-08-01

The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A chimera encoding the fusion of an acetylcholine-binding protein to an ion channel is stabilized in a state close to the desensitized form of ligand-gated ion channels.

PubMed

Grutter, Thomas; Prado de Carvalho, Lia; Virginie, Dufresne; Taly, Antoine; Fischer, Markus; Changeux, Jean-Pierre

2005-03-01

To understand the mechanism of allosteric coupling between the ligand-binding domain and the ion channel of the Cys-loop ligand-gated ion channels (LGICs), we fused the soluble acetylcholine-binding protein (AChBP), which lacks an ion channel, to either the cationic serotonin type-3A ion channel (5HT(3A)) or the anionic glycine ion channel. Both linear chimeras expressed in HEK-293 cells display high affinity for the nicotinic agonist epibatidine (K(D) = 0.2-0.5 nM), but are not targeted to the cell surface. Only after substituting a ring of three loops located at the putative membrane side of the AChBP three-dimensional structure by the homologous residues of 5HT(3A), the resulting chimera AChBP(ring)/5HT(3A) (i) still displayed on intact cells an apparent high affinity for epibatidine, yet with a fourfold decrease (K(D) = 2.1 nM), (ii) displayed a high proportion of low affinity sites (11 +/- 7 microM) for the resting state stabilizing competitive antagonist alpha-bungarotoxin and (iii) was successfully targeted to the cell surface, as seen by immunofluorescence labelling. The AChBP(ring)/5HT(3A) chimera forms a pentameric structure, as revealed by sucrose gradient sedimentation. However, no whole-cell patch-clamp currents were detectable. Interestingly, binding assays with membrane fragments prepared from cells expressing AChBP(ring)/5HT(3A) showed a decrease in the apparent affinity for the agonists nicotine and epibatidine (5-fold), concomitant with an increase in the proportion of high-affinity sites (48 +/- 1 nM) for alpha-bungarotoxin. These results indicate that fusion of AChBP to an ion channel forms a pentameric receptor exposed to the cell surface and able to convert between discrete allosteric states, but stabilized in a high affinity state for epibatidine that likely corresponds to a desensitized form of LGICs. These artificial chimeras might offer a useful system to investigate signal transduction in LGICs.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

sc-PDB: a 3D-database of ligandable binding sites--10 years on.

PubMed

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

PubMed

Ahmed, Ahmed H; Oswald, Robert E

2010-03-11

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

PubMed Central

Ahmed, Ahmed H.; Oswald, Robert E.

2010-01-01

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

PubMed

Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

2013-07-01

Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

PubMed

Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

2017-09-14

U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauch, Eva-Maria; Bernard, Steffen M.; La, David

Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

PubMed

Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

2015-11-01

Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

Oligomycin frames a common drug-binding site in the ATP synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

PubMed

Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

2013-01-01

Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

[3H]MK-801 binding sites in post-mortem human frontal cortex.

PubMed

Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

1989-03-29

The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

A Ruler Protein in a Complex for Antiviral Defense Determines the Length of Small Interfering CRISPR RNAs

PubMed Central

Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.

2013-01-01

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Systematic Testing of Belief-Propagation Estimates for Absolute Free Energies in Atomistic Peptides and Proteins.

PubMed

Donovan-Maiye, Rory M; Langmead, Christopher J; Zuckerman, Daniel M

2018-01-09

Motivated by the extremely high computing costs associated with estimates of free energies for biological systems using molecular simulations, we further the exploration of existing "belief propagation" (BP) algorithms for fixed-backbone peptide and protein systems. The precalculation of pairwise interactions among discretized libraries of side-chain conformations, along with representation of protein side chains as nodes in a graphical model, enables direct application of the BP approach, which requires only ∼1 s of single-processor run time after the precalculation stage. We use a "loopy BP" algorithm, which can be seen as an approximate generalization of the transfer-matrix approach to highly connected (i.e., loopy) graphs, and it has previously been applied to protein calculations. We examine the application of loopy BP to several peptides as well as the binding site of the T4 lysozyme L99A mutant. The present study reports on (i) the comparison of the approximate BP results with estimates from unbiased estimators based on the Amber99SB force field; (ii) investigation of the effects of varying library size on BP predictions; and (iii) a theoretical discussion of the discretization effects that can arise in BP calculations. The data suggest that, despite their approximate nature, BP free-energy estimates are highly accurate-indeed, they never fall outside confidence intervals from unbiased estimators for the systems where independent results could be obtained. Furthermore, we find that libraries of sufficiently fine discretization (which diminish library-size sensitivity) can be obtained with standard computing resources in most cases. Altogether, the extremely low computing times and accurate results suggest the BP approach warrants further study.

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

Superposition and alignment of labeled point clouds.

PubMed

Fober, Thomas; Glinca, Serghei; Klebe, Gerhard; Hüllermeier, Eyke

2011-01-01

Geometric objects are often represented approximately in terms of a finite set of points in three-dimensional euclidean space. In this paper, we extend this representation to what we call labeled point clouds. A labeled point cloud is a finite set of points, where each point is not only associated with a position in three-dimensional space, but also with a discrete class label that represents a specific property. This type of model is especially suitable for modeling biomolecules such as proteins and protein binding sites, where a label may represent an atom type or a physico-chemical property. Proceeding from this representation, we address the question of how to compare two labeled points clouds in terms of their similarity. Using fuzzy modeling techniques, we develop a suitable similarity measure as well as an efficient evolutionary algorithm to compute it. Moreover, we consider the problem of establishing an alignment of the structures in the sense of a one-to-one correspondence between their basic constituents. From a biological point of view, alignments of this kind are of great interest, since mutually corresponding molecular constituents offer important information about evolution and heredity, and can also serve as a means to explain a degree of similarity. In this paper, we therefore develop a method for computing pairwise or multiple alignments of labeled point clouds. To this end, we proceed from an optimal superposition of the corresponding point clouds and construct an alignment which is as much as possible in agreement with the neighborhood structure established by this superposition. We apply our methods to the structural analysis of protein binding sites.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-03-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed Central

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-01-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

Discrete and structurally unique proteins (tāpirins) mediate attachment of extremely thermophilic Caldicellulosiruptor species to cellulose.

PubMed

Blumer-Schuette, Sara E; Alahuhta, Markus; Conway, Jonathan M; Lee, Laura L; Zurawski, Jeffrey V; Giannone, Richard J; Hettich, Robert L; Lunin, Vladimir V; Himmel, Michael E; Kelly, Robert M

2015-04-24

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins ("tāpirins," origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose*

PubMed Central

Blumer-Schuette, Sara E.; Alahuhta, Markus; Conway, Jonathan M.; Lee, Laura L.; Zurawski, Jeffrey V.; Giannone, Richard J.; Hettich, Robert L.; Lunin, Vladimir V.; Himmel, Michael E.; Kelly, Robert M.

2015-01-01

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tāpirins,” origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose. PMID:25720489

sc-PDB: a 3D-database of ligandable binding sites—10 years on

PubMed Central

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

PubMed

Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

2018-05-29

Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

PubMed Central

Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

2012-01-01

Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

PubMed

Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

2014-01-01

We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

PubMed

Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

2018-03-23

The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halavaty, Andrei S.; Northwestern University, Chicago, IL 60611; Kim, Youngchang

The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holomore » form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.« less

Single-molecule enzymology of steroid transforming enzymes: Transient kinetic studies and what they tell us.

PubMed

Penning, Trevor M

2016-07-01

Structure-function studies on steroid transforming enzymes often use site-directed mutagenesis to inform mechanisms of catalysis and effects on steroid binding, and data are reported in terms of changes in steady state kinetic parameters kcat, Km and kcat/Km. However, this dissection of function is limited since kcat is governed by the rate-determining step and Km is a complex macroscopic kinetic constant. Often site-directed mutagenesis can lead to a change in the rate-determining step which cannot be revealed by just reporting a decrease in kcat alone. These issues are made more complex when it is considered that many steroid transforming enzymes have more than one substrate and product. We present the case for using transient-kinetics performed with stopped-flow spectrometry to assign rate constants to discrete steps in these multi-substrate reactions and their use to interpret enzyme mechanism and the effects of disease and engineered mutations. We demonstrate that fluorescence kinetic transients can be used to measure ligand binding that may be accompanied by isomerization steps, revealing the existence of new enzyme intermediates. We also demonstrate that single-turnover reactions can provide a klim for the chemical step and Ks for steroid-substrate binding and that when coupled with kinetic isotope effect measurements can provide information on transition state intermediates. We also demonstrate how multiple turnover experiments can provide evidence for either "burst-phase" kinetics, which can reveal a slow product release step, or linear-phase kinetics, in which the chemical step can be rate-determining. With these assignments it becomes more straightforward to analyze the effects of mutations. We use examples from the hydroxysteroid dehydrogenases (AKR1Cs) and human steroid 5β-reductase (AKR1D1) to illustrate the utility of the approach, which are members of the aldo-keto reductase (AKR) superfamily. Copyright © 2015 Elsevier Ltd. All rights reserved.

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

PubMed

Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

2006-07-01

High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

PubMed Central

Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

2016-01-01

The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

Evaluation of the antagonism of nicotine by mecamylamine and pempidine in the brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, T.J.

1989-01-01

Antagonists have been crucial in the characterization of nicotine's pharmacology. Initial evidence for the existence of central nicotinic receptors was based on the fact that nicotine produced a number of behavioral effects that were antagonized by ganglionic blockers that crossed the blood-brain barrier, such as mecamylamine and pempidine. These compounds are thought to be noncompetitive antagonists due to the fact that they do not compete for agonist binding to brain homogenate in vitro. However, pharmacological evidence in support of noncompetitive antagonism is lacking. Dose-response curves for nicotine were determined in the presence of various doses of pempidine for depression ofmore » spontaneous activity and antinociception in mice. Pempidine was found to shift the dose response curves for these effects of nicotine in a manner consistent with noncompetitive antagonism. A number of mecamylamine analogs were investigated for antagonism of these central effects of nicotine as well. These studies revealed that the N-, 2-, and 3-methyls were crucial for optimal efficacy and potency and suggests that these compounds possess a specific mechanism of action, possibly involving a receptor. Furthermore, the structure-activity relationships for the mecamylamine analogs were found to be different than that previously reported for the agonists, suggesting that they do not act at the same site. The binding of ({sup 3} H)-L-nicotine and ({sup 3}H)-pempidine was studied in vitro to mouse brain homogentate and in situ to rat brain slices. The in situ binding of ({sup 3}H)-L-nicotine to rat brain slices was quantitated autoradiographically to discrete brain areas in the presence and absence of 1, 10 and 100 {mu}M nicotine and pempidine. Pempidine did not effectively displace ({sup 3}H)-L-nicotine binding.« less

Insight into the molecular basis of pathogen abundance: group A Streptococcus inhibitor of complement inhibits bacterial adherence and internalization into human cells.

PubMed

Hoe, Nancy P; Ireland, Robin M; DeLeo, Frank R; Gowen, Brian B; Dorward, David W; Voyich, Jovanka M; Liu, Mengyao; Burns, Eugene H; Culnan, Derek M; Bretscher, Anthony; Musser, James M

2002-05-28

Streptococcal inhibitor of complement (Sic) is a secreted protein made predominantly by serotype M1 Group A Streptococcus (GAS), which contributes to persistence in the mammalian upper respiratory tract and epidemics of human disease. Unexpectedly, an isogenic sic-negative mutant adhered to human epithelial cells significantly better than the wild-type parental strain. Purified Sic inhibited the adherence of a sic negative serotype M1 mutant and of non-Sic-producing GAS strains to human epithelial cells. Sic was rapidly internalized by human epithelial cells, inducing cell flattening and loss of microvilli. Ezrin and moesin, human proteins that functionally link the cytoskeleton to the plasma membrane, were identified as Sic-binding proteins by affinity chromatography and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis. Sic colocalized with ezrin inside epithelial cells and bound to the F-actin-binding site region located in the carboxyl terminus of ezrin and moesin. Synthetic peptides corresponding to two regions of Sic had GAS adherence-inhibitory activity equivalent to mature Sic and inhibited binding of Sic to ezrin. In addition, the sic mutant was phagocytosed and killed by human polymorphonuclear leukocytes significantly better than the wild-type strain, and Sic colocalized with ezrin in discrete regions of polymorphonuclear leukocytes. The data suggest that binding of Sic to ezrin alters cellular processes critical for efficient GAS contact, internalization, and killing. Sic enhances bacterial survival by enabling the pathogen to avoid the intracellular environment. This process contributes to the abundance of M1 GAS in human infections and their ability to cause epidemics.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannopoulos, G.; Jackson, K.; Kredentser, J.

The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

Competitive Binding of Natural Amphiphiles with Graphene Derivatives

NASA Astrophysics Data System (ADS)

Radic, Slaven; Geitner, Nicholas K.; Podila, Ramakrishna; Käkinen, Aleksandr; Chen, Pengyu; Ke, Pu Chun; Ding, Feng

2013-07-01

Understanding the transformation of graphene derivatives by natural amphiphiles is essential for elucidating the biological and environmental implications of this emerging class of engineered nanomaterials. Using rapid discrete-molecular-dynamics simulations, we examined the binding of graphene and graphene oxide with peptides, fatty acids, and cellulose, and complemented our simulations by experimental studies of Raman spectroscopy, FTIR, and UV-Vis spectrophotometry. Specifically, we established a connection between the differential binding and the conformational flexibility, molecular geometry, and hydrocarbon content of the amphiphiles. Importantly, our dynamics simulations revealed a Vroman-like competitive binding of the amphiphiles for the graphene oxide substrate. This study provides a mechanistic basis for addressing the transformation, evolution, transport, biocompatibility, and toxicity of graphene derivatives in living systems and the natural environment.

Competitive Binding of Natural Amphiphiles with Graphene Derivatives

PubMed Central

Radic, Slaven; Geitner, Nicholas K.; Podila, Ramakrishna; Käkinen, Aleksandr; Chen, Pengyu; Ke, Pu Chun; Ding, Feng

2013-01-01

Understanding the transformation of graphene derivatives by natural amphiphiles is essential for elucidating the biological and environmental implications of this emerging class of engineered nanomaterials. Using rapid discrete-molecular-dynamics simulations, we examined the binding of graphene and graphene oxide with peptides, fatty acids, and cellulose, and complemented our simulations by experimental studies of Raman spectroscopy, FTIR, and UV-Vis spectrophotometry. Specifically, we established a connection between the differential binding and the conformational flexibility, molecular geometry, and hydrocarbon content of the amphiphiles. Importantly, our dynamics simulations revealed a Vroman-like competitive binding of the amphiphiles for the graphene oxide substrate. This study provides a mechanistic basis for addressing the transformation, evolution, transport, biocompatibility, and toxicity of graphene derivatives in living systems and the natural environment. PMID:23881402

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

Discrete-State Stochastic Models of Calcium-Regulated Calcium Influx and Subspace Dynamics Are Not Well-Approximated by ODEs That Neglect Concentration Fluctuations

PubMed Central

Weinberg, Seth H.; Smith, Gregory D.

2012-01-01

Cardiac myocyte calcium signaling is often modeled using deterministic ordinary differential equations (ODEs) and mass-action kinetics. However, spatially restricted “domains” associated with calcium influx are small enough (e.g., 10−17 liters) that local signaling may involve 1–100 calcium ions. Is it appropriate to model the dynamics of subspace calcium using deterministic ODEs or, alternatively, do we require stochastic descriptions that account for the fundamentally discrete nature of these local calcium signals? To address this question, we constructed a minimal Markov model of a calcium-regulated calcium channel and associated subspace. We compared the expected value of fluctuating subspace calcium concentration (a result that accounts for the small subspace volume) with the corresponding deterministic model (an approximation that assumes large system size). When subspace calcium did not regulate calcium influx, the deterministic and stochastic descriptions agreed. However, when calcium binding altered channel activity in the model, the continuous deterministic description often deviated significantly from the discrete stochastic model, unless the subspace volume is unrealistically large and/or the kinetics of the calcium binding are sufficiently fast. This principle was also demonstrated using a physiologically realistic model of calmodulin regulation of L-type calcium channels introduced by Yue and coworkers. PMID:23509597

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

PubMed

Konc, Janez; Janežič, Dušanka

2014-07-01

The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

PubMed

Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

1994-10-27

Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

NASA Astrophysics Data System (ADS)

Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

Peierls-Nabarro barrier and protein loop propagation

NASA Astrophysics Data System (ADS)

Sieradzan, Adam K.; Niemi, Antti; Peng, Xubiao

2014-12-01

When a self-localized quasiparticle excitation propagates along a discrete one-dimensional lattice, it becomes subject to a dissipation that converts the kinetic energy into lattice vibrations. Eventually the kinetic energy no longer enables the excitation to cross over the minimum energy barrier between neighboring sites, and the excitation becomes localized within a lattice cell. In the case of a protein, the lattice structure consists of the Cα backbone. The self-localized quasiparticle excitation is the elemental building block of loops. It can be modeled by a kink that solves a variant of the discrete nonlinear Schrödinger equation. We study the propagation of such a kink in the case of the protein G related albumin-binding domain, using the united residue coarse-grained molecular-dynamics force field. We estimate the height of the energy barriers that the kink needs to cross over in order to propagate along the backbone lattice. We analyze how these barriers give rise to both stresses and reliefs, which control the kink movement. For this, we deform a natively folded protein structure by parallel translating the kink along the backbone away from its native position. We release the transposed kink, and we follow how it propagates along the backbone toward the native location. We observe that the dissipative forces that are exerted on the kink by the various energy barriers have a pivotal role in determining how a protein folds toward its native state.

Electrostatic coupling of ion pumps.

PubMed

Nieto-Frausto, J; Lüger, P; Apell, H J

1992-01-01

In this paper the electrostatic interactions between membrane-embedded ion-pumps and their consequences for the kinetics of pump-mediated transport processes have been examined. We show that the time course of an intrinsically monomolecular transport reaction can become distinctly nonexponential, if the reaction is associated with charge translocation and takes place in an aggregate of pump molecules. First we consider the electrostatic coupling of a single dimer of ion-pumps embedded in the membrane. Then we apply the treatment to the kinetic analysis of light-driven proton transport by bacteriorhodopsin which forms two-dimensional hexagonal lattices. Finally, for the case of nonordered molecules, we also consider a model in which the pumps are randomly distributed over the nodes of a lattice. Here the average distance is equal to that deduced experimentally and the elemental size of the lattice is the effective diameter of one single pump. This latter model is applied to an aggregate of membrane-embedded Na, K- and Ca-pumps. In all these cases the electrostatic potential considered is the exact solution calculated from the method of electrical images for a plane membrane of finite thickness immersed in an infinite aqueous solution environment. The distributions of charges (ions or charged binding sites) are considered homogeneous or discrete in the membrane and/or in the external solution. In the case of discrete distributions we compare the results from a mean field approximation and a stochastic simulation.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

PubMed Central

Jalak, Jürgen; Väljamäe, Priit

2014-01-01

Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

PubMed Central

Gibbons, R. J.; Moreno, E. C.; Etherden, I.

1983-01-01

The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

1990-01-01

Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

The Structural Basis of ATP as an Allosteric Modulator

PubMed Central

Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

2014-01-01

Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

PubMed Central

Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

2014-01-01

A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

Structural Insights into the Degradation of Mcl-1 Induced by BH3 Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Czabotar,P.; Lee, E.; van Delft, M.

2007-01-01

Apoptosis is held in check by prosurvival proteins of the Bcl-2 family. The distantly related BH3-only proteins bind to and antagonize them, thereby promoting apoptosis. Whereas binding of the BH3-only protein Noxa to prosurvival Mcl-1 induces Mcl-1 degradation by the proteasome, binding of another BH3-only ligand, Bim, elevates Mcl-1 protein levels. We compared the three-dimensional structures of the complexes formed between BH3 peptides of both Bim and Noxa, and we show that a discrete C-terminal sequence of the Noxa BH3 is necessary to instigate Mcl-1 degradation.

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

PubMed Central

Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

1999-01-01

Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

ATP Synthase: A Molecular Therapeutic Drug Target for Antimicrobial and Antitumor Peptides

PubMed Central

Ahmad, Zulfiqar; Okafor, Florence; Azim, Sofiya; Laughlin, Thomas F.

2015-01-01

In this review we discuss the role of ATP synthase as a molecular drug target for natural and synthetic antimi-crobial/antitumor peptides. We start with an introduction of the universal nature of the ATP synthase enzyme and its role as a biological nanomotor. Significant structural features required for catalytic activity and motor functions of ATP synthase are described. Relevant details regarding the presence of ATP synthase on the surface of several animal cell types, where it is associated with multiple cellular processes making it a potential drug target with respect to antimicrobial peptides and other inhibitors such as dietary polyphenols, is also reviewed. ATP synthase is known to have about twelve discrete inhibitor binding sites including peptides and other inhibitors located at the interface of α/β subunits on the F1 sector of the enzyme. Molecular interaction of peptides at the β DEELSEED site on ATP synthase is discussed with specific examples. An inhibitory effect of other natural/synthetic inhibitors on ATP is highlighted to explore the therapeutic roles played by peptides and other inhibitors. Lastly, the effect of peptides on the inhibition of the Escherichia coli model system through their action on ATP synthase is presented. PMID:23432591

Feline Immunodeficiency Virus Vif N-Terminal Residues Selectively Counteract Feline APOBEC3s.

PubMed

Gu, Qinyong; Zhang, Zeli; Cano Ortiz, Lucía; Franco, Ana Cláudia; Häussinger, Dieter; Münk, Carsten

2016-12-01

Feline immunodeficiency virus (FIV) Vif protein counteracts feline APOBEC3s (FcaA3s) restriction factors by inducing their proteasomal degradation. The functional domains in FIV Vif for interaction with FcaA3s are poorly understood. Here, we have identified several motifs in FIV Vif that are important for selective degradation of different FcaA3s. Cats (Felis catus) express three types of A3s: single-domain A3Z2, single-domain A3Z3, and double-domain A3Z2Z3. We proposed that FIV Vif would selectively interact with the Z2 and the Z3 A3s. Indeed, we identified two N-terminal Vif motifs (12LF13 and 18GG19) that specifically interacted with the FcaA3Z2 protein but not with A3Z3. In contrast, the exclusive degradation of FcaA3Z3 was regulated by a region of three residues (M24, L25, and I27). Only a FIV Vif carrying a combination of mutations from both interaction sites lost the capacity to degrade and counteract FcaA3Z2Z3. However, alterations in the specific A3s interaction sites did not affect the cellular localization of the FIV Vif protein and binding to feline A3s. Pulldown experiments demonstrated that the A3 binding region localized to FIV Vif residues 50 to 80, outside the specific A3 interaction domain. Finally, we found that the Vif sites specific to individual A3s are conserved in several FIV lineages of domestic cat and nondomestic cats, while being absent in the FIV Vif of pumas. Our data support a complex model of multiple Vif-A3 interactions in which the specific region for selective A3 counteraction is discrete from a general A3 binding domain. Both human immunodeficiency virus (HIV) and feline immunodeficiency virus (FIV) Vif proteins counteract their host's APOBEC3 restriction factors. However, these two Vif proteins have limited sequence homology. The molecular interaction between FIV Vif and feline APOBEC3s are not well understood. Here, we identified N-terminal FIV Vif sites that regulate the selective interaction of Vif with either feline APOBEC3Z2 or APOBEC3Z3. These specific Vif sites are conserved in several FIV lineages of domestic cat and nondomestic cats, while being absent in FIV Vif from puma. Our findings provide important insights for future experiments describing the FIV Vif interaction with feline APOBEC3s and also indicate that the conserved feline APOBEC3s interaction sites of FIV Vif allow FIV transmissions in Felidae. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Feline Immunodeficiency Virus Vif N-Terminal Residues Selectively Counteract Feline APOBEC3s

PubMed Central

Gu, Qinyong; Zhang, Zeli; Cano Ortiz, Lucía; Franco, Ana Cláudia; Häussinger, Dieter

2016-01-01

ABSTRACT Feline immunodeficiency virus (FIV) Vif protein counteracts feline APOBEC3s (FcaA3s) restriction factors by inducing their proteasomal degradation. The functional domains in FIV Vif for interaction with FcaA3s are poorly understood. Here, we have identified several motifs in FIV Vif that are important for selective degradation of different FcaA3s. Cats (Felis catus) express three types of A3s: single-domain A3Z2, single-domain A3Z3, and double-domain A3Z2Z3. We proposed that FIV Vif would selectively interact with the Z2 and the Z3 A3s. Indeed, we identified two N-terminal Vif motifs (12LF13 and 18GG19) that specifically interacted with the FcaA3Z2 protein but not with A3Z3. In contrast, the exclusive degradation of FcaA3Z3 was regulated by a region of three residues (M24, L25, and I27). Only a FIV Vif carrying a combination of mutations from both interaction sites lost the capacity to degrade and counteract FcaA3Z2Z3. However, alterations in the specific A3s interaction sites did not affect the cellular localization of the FIV Vif protein and binding to feline A3s. Pulldown experiments demonstrated that the A3 binding region localized to FIV Vif residues 50 to 80, outside the specific A3 interaction domain. Finally, we found that the Vif sites specific to individual A3s are conserved in several FIV lineages of domestic cat and nondomestic cats, while being absent in the FIV Vif of pumas. Our data support a complex model of multiple Vif-A3 interactions in which the specific region for selective A3 counteraction is discrete from a general A3 binding domain. IMPORTANCE Both human immunodeficiency virus (HIV) and feline immunodeficiency virus (FIV) Vif proteins counteract their host's APOBEC3 restriction factors. However, these two Vif proteins have limited sequence homology. The molecular interaction between FIV Vif and feline APOBEC3s are not well understood. Here, we identified N-terminal FIV Vif sites that regulate the selective interaction of Vif with either feline APOBEC3Z2 or APOBEC3Z3. These specific Vif sites are conserved in several FIV lineages of domestic cat and nondomestic cats, while being absent in FIV Vif from puma. Our findings provide important insights for future experiments describing the FIV Vif interaction with feline APOBEC3s and also indicate that the conserved feline APOBEC3s interaction sites of FIV Vif allow FIV transmissions in Felidae. PMID:27630243

Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

PubMed

Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

2005-05-13

Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romm, E.; Marks, M.J.; Collins, A.C.

1990-01-01

Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

Nucleotide-dependent bisANS binding to tubulin.

PubMed

Chakraborty, S; Sarkar, N; Bhattacharyya, B

1999-07-13

Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

1988-01-01

(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

DTIC Science & Technology

positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

PubMed

Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

2017-03-16

Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

1986-06-01

(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Analysis of Heme Iron Coordination in DGCR8: The Heme-Binding Component of the Microprocessor Complex.

PubMed

Girvan, Hazel M; Bradley, Justin M; Cheesman, Myles R; Kincaid, James R; Liu, Yilin; Czarnecki, Kazimierz; Fisher, Karl; Leys, David; Rigby, Stephen E J; Munro, Andrew W

2016-09-13

DGCR8 is the RNA-binding partner of the nuclease Drosha. Their complex (the "Microprocessor") is essential for processing of long, primary microRNAs (pri-miRNAs) in the nucleus. Binding of heme to DGCR8 is essential for pri-miRNA processing. On the basis of the split Soret ultraviolet-visible (UV-vis) spectrum of ferric DGCR8, bis-thiolate sulfur (cysteinate, Cys(-)) heme iron coordination of DGCR8 heme iron was proposed. We have characterized DGCR8 heme ligation using the Δ276 DGCR8 variant and combined electron paramagnetic resonance (EPR), magnetic circular dichroism (MCD), electron nuclear double resonance, resonance Raman, and electronic absorption spectroscopy. These studies indicate DGCR8 bis-Cys heme iron ligation, with conversion from bis-thiolate (Cys(-)/Cys(-)) axial coordination in ferric DGCR8 to bis-thiol (CysH/CysH) coordination in ferrous DGCR8. Pri-miRNA binding does not perturb ferric DGCR8's optical spectrum, consistent with the axial ligand environment being separated from the substrate-binding site. UV-vis absorption spectra of the Fe(II) and Fe(II)-CO forms indicate discrete species exhibiting peaks with absorption coefficients substantially larger than those for ferric DGCR8 and that previously reported for a ferrous form of DGCR8. Electron-nuclear double resonance spectroscopy data exclude histidine or water as axial ligands for ferric DGCR8 and favor bis-thiolate coordination in this form. UV-vis MCD and near-infrared MCD provide data consistent with this conclusion. UV-vis MCD data for ferrous DGCR8 reveal features consistent with bis-thiol heme iron coordination, and resonance Raman data for the ferrous-CO form are consistent with a thiol ligand trans to the CO. These studies support retention of DGCR8 cysteine coordination upon reduction, a conclusion distinct from those of previous studies of a different ferrous DGCR8 isoform.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

PubMed Central

Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

1998-01-01

The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

Results from laboratory and field testing of nitrate measuring spectrophotometers

USGS Publications Warehouse

Snazelle, Teri T.

2015-01-01

In Phase II, the analyzers were deployed in field conditions at three diferent USGS sites. The measured nitrate concentrations were compared to discrete (reference) samples analyzed by the Direct UV method on a Shimadzu UV1800 bench top spectrophotometer, and by the National Environmental Methods Index (NEMI) method I-2548-11 at the USGS National Water Quality Laboratory. The first deployment at USGS site 0249620 on the East Pearl River in Hancock County, Mississippi, tested the ability of the TriOs ProPs (10-mm path length), Hach NITRATAX (5 mm), Satlantic SUNA (10 mm), and the S::CAN Spectro::lyser (5 mm) to accurately measure low-level (less than 2 mg-N/L) nitrate concentrations while observing the effect turbidity and colored dissolved organic matter (CDOM) would have on the analyzers' measurements. The second deployment at USGS site 01389005 Passaic River below Pompton River at Two Bridges, New Jersey, tested the analyzer's accuracy in mid-level (2-8 mg-N/L) nitrate concentrations. This site provided the means to test the analyzers' performance in two distinct matrices—the Passaic and the Pompton Rivers. In this deployment, three instruments tested in Phase I (TriOS, Hach, and SUNA) were deployed with the S::CAN Spectro::lyser (35 mm) already placed by the New Jersey Water Science Center (WSC). The third deployment at USGS site 05579610 Kickapoo Creek at 2100E Road near Bloomington, Illinois, tested the ability of the analyzers to measure high nitrate concentrations (greater than 8 mg-N/L) in turbid waters. For Kickapoo Creek, the HIF provided the TriOS (10 mm) and S::CAN (5 mm) from Phase I, and a SUNA V2 (5 mm) to be deployed adjacent to the Illinois WSC-owned Hach (2 mm). A total of 40 discrete samples were collected from the three deployment sites and analyzed. The nitrate concentration of the samples ranged from 0.3–22.2 mg-N/L. The average absolute difference between the TriOS measurements and discrete samples was 0.46 mg-N/L. For the combined data from the Hach 5-mm and 2-mm analyzers, the average absolute difference between the Hach samples and the discrete samples was 0.13 mg-N/L. For the SUNA and SUNA V2 combined data, the average absolute difference between the SUNA samples and the discrete samples was 0.66 mg-N/L. The average absolute difference between the S::CAN samples and the discrete samples was 0.63 mg-N/L.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

NASA Astrophysics Data System (ADS)

Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2018-03-01

To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

PubMed Central

Keck, P C; Huston, J S

1996-01-01

Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Catalytic site interactions in yeast OMP synthase.

PubMed

Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

2014-01-15

The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

PubMed

Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

2006-01-01

Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muccioli, G.; Guardabassi, A.; Pattono, P.

1990-03-01

The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

Study of DNA binding sites using the Rényi parametric entropy measure.

PubMed

Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

2004-04-07

Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

40 CFR 53.30 - General provisions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... more information about the site. Any such pre-test approval of a test site by the EPA shall indicate... Methods and Reference Methods § 53.30 General provisions. (a) Determination of comparability. The test... discretion of the Administrator. (b) Selection of test sites. (1) Each test site shall be in an area which...

40 CFR 53.30 - General provisions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... more information about the site. Any such pre-test approval of a test site by the EPA shall indicate... Methods and Reference Methods § 53.30 General provisions. (a) Determination of comparability. The test... discretion of the Administrator. (b) Selection of test sites. (1) Each test site shall be in an area which...

40 CFR 53.30 - General provisions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... more information about the site. Any such pre-test approval of a test site by the EPA shall indicate... Methods and Reference Methods § 53.30 General provisions. (a) Determination of comparability. The test... discretion of the Administrator. (b) Selection of test sites. (1) Each test site shall be in an area which...

40 CFR 53.30 - General provisions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... more information about the site. Any such pre-test approval of a test site by the EPA shall indicate... Methods and Reference Methods § 53.30 General provisions. (a) Determination of comparability. The test... discretion of the Administrator. (b) Selection of test sites. (1) Each test site shall be in an area which...

40 CFR 53.30 - General provisions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... more information about the site. Any such pre-test approval of a test site by the EPA shall indicate... Methods and Reference Methods § 53.30 General provisions. (a) Determination of comparability. The test... discretion of the Administrator. (b) Selection of test sites. (1) Each test site shall be in an area which...

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Binding site and affinity prediction of general anesthetics to protein targets using docking.

PubMed

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

2012-05-01

The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

PubMed Central

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

2012-01-01

Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

PubMed Central

Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

2008-01-01

Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

PubMed

Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

2006-04-15

We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

PubMed Central

Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

2015-01-01

Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

PubMed

Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

2013-02-21

Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

EVALUATION OF MEMBRANE TYPE FOR USE IN DIFFUSION SAMPLERS TO MONITOR GROUND WATER QUALITY

EPA Science Inventory

The Discrete Multi-Level Sampler (DMLS®) system has proven to be a useful tool for obtaining discrete interval contaminant concentrations at hazardous waste sites. The DMLS® utilizes dialysis cells, which consist of a polypropylene vial, covered on both ends by a permeable membr...

Discrete breathers dynamic in a model for DNA chain with a finite stacking enthalpy

NASA Astrophysics Data System (ADS)

Gninzanlong, Carlos Lawrence; Ndjomatchoua, Frank Thomas; Tchawoua, Clément

2018-04-01

The nonlinear dynamics of a homogeneous DNA chain based on site-dependent finite stacking and pairing enthalpies is studied. A new variant of extended discrete nonlinear Schrödinger equation describing the dynamics of modulated wave is derived. The regions of discrete modulational instability of plane carrier waves are studied, and it appears that these zones depend strongly on the phonon frequency of Fourier's mode. The staggered/unstaggered discrete breather (SDB/USDB) is obtained straightforwardly without the staggering transformation, and it is demonstrated that SDBs are less unstable than USDB. The instability of discrete multi-humped SDB/USDB solution does not depend on the number of peaks of the discrete breather (DB). By using the concept of Peierls-Nabarro energy barrier, it appears that the low-frequency DBs are more mobile.

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

PubMed

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

PubMed Central

Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-01-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

Diurnal variations in metal concentrations in the Alamosa River and Wightman Fork, southwestern Colorado, 1995-97

USGS Publications Warehouse

Ortiz, Roderick F.; Stogner, Sr., Robert W.

2001-01-01

A comprehensive sampling network was implemented in the Alamosa River Basin from 1995 to 1997 to address data gaps identified as part of the ecological risk assessment of the Summitville Superfund site. Aluminum, copper, iron, and zinc were identified as the constituents of concern for the risk assessment. Water-quality samples were collected at six sites on the Alamosa River and Wightman Fork by automatic samplers. Several discrete (instantaneous) samples were collected over 24 hours at each site during periods of high diurnal variations in streamflow (May through September). The discrete samples were analyzed individually and duplicate samples were composited to produce a single sample that represented the daily-mean concentration. The diurnal variations in concentration with respect to the theoretical daily-mean concentration (maximum minus minimum divided by daily mean) are presented. Diurnal metal concentrations were highly variable in the Alamosa River and Wightman Fork. The concentration of a metal at a single site could change by several hundred percent during one diurnal cycle. The largest percent change in metal concentrations was observed for aluminum and iron. Zinc concentrations varied the least of the four metals. No discernible or predictable pattern was indicated in the timing of the daily mean, maximum, or minimum concentrations. The percentage of discrete sample concentrations that varied from the daily-mean concentration by thresholds of plus or minus 10, 25, and 50 percent was evaluated. Between 50 and 75 percent of discrete-sample concentrations varied from the daily-mean concentration by more than plus or minus 10 percent. The percentage of samples exceeding given thresholds generally was smaller during the summer period than the snowmelt period. Sampling strategies are critical to accurately define variability in constituent concentration, and conversely, understanding constituent variability is important in determining appropriate sampling strategies. During nonsteady-state periods, considerable errors in estimates of daily-mean concentration are possible if based on one discrete sample. Flow-weighting multiple discrete samples collected over a diurnal cycle provides a better estimate of daily-mean concentrations during nonsteady-state periods.

Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Souza, E.B.; Kuyatt, B.L.

1987-01-01

Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

USGS Publications Warehouse

Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

2002-01-01

The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Effect of the surface charge discretization on electric double layers: a Monte Carlo simulation study.

PubMed

Madurga, Sergio; Martín-Molina, Alberto; Vilaseca, Eudald; Mas, Francesc; Quesada-Pérez, Manuel

2007-06-21

The structure of the electric double layer in contact with discrete and continuously charged planar surfaces is studied within the framework of the primitive model through Monte Carlo simulations. Three different discretization models are considered together with the case of uniform distribution. The effect of discreteness is analyzed in terms of charge density profiles. For point surface groups, a complete equivalence with the situation of uniformly distributed charge is found if profiles are exclusively analyzed as a function of the distance to the charged surface. However, some differences are observed moving parallel to the surface. Significant discrepancies with approaches that do not account for discreteness are reported if charge sites of finite size placed on the surface are considered.

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Selection of the simplest RNA that binds isoleucine

PubMed Central

LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

2003-01-01

We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shima, K.; Kitayama, S.; Nakano, R.

Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

NASA Astrophysics Data System (ADS)

Aalberts, Daniel P.; Garland, Jeffrey A.

2004-03-01

When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Reid, A.; Mahboubi, A.

1991-02-01

Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

PubMed

Brierley, I; Hoggett, J G

1992-07-01

The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

NASA Astrophysics Data System (ADS)

Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

2010-01-01

The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

Cooperative interplay of let-7 mimic and HuR with MYC RNA

PubMed Central

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

Two classes of binding sites for [3H]substance P in rat cerebral cortex.

PubMed

Geraghty, D P; Burcher, E

1993-01-22

The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

A web server for analysis, comparison and prediction of protein ligand binding sites.

PubMed

Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

2016-03-25

One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

PubMed Central

Meng, Xiangzhi; Leman, Michael; Xiang, Yan

2007-01-01

Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

PubMed

Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

2018-05-16

Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

NASA Astrophysics Data System (ADS)

Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

1986-07-01

The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

PubMed

Marsh, Lorraine

2015-01-01

Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

PubMed

Fehr, Marcus; Wolf, Antje; Stammler, Gerd

2016-03-01

Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

NASA Astrophysics Data System (ADS)

Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

1985-05-01

The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

PubMed

DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

2003-07-08

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

PubMed

Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

1997-10-28

Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

PubMed Central

Jayasena, S D; Johnston, B H

1992-01-01

tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

PubMed

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-04-01

Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

PubMed Central

Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

PubMed

Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

PubMed Central

Joiner, C H; Lauf, P K

1978-01-01

1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

PubMed Central

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-01-01

Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.

Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less