[Alcohol-related cognitive impairment and the DSM-5].

PubMed

Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

2016-01-01

It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

Energetic-particle abundances in impulsive solar flares

NASA Technical Reports Server (NTRS)

Reames, D. V.; Cane, H. V.; Von Rosenvinge, T. T.

1990-01-01

The abundances of elements and of He-3 in 90 solar electron events have been examined. It is found that the events fall into two distinct groups based upon their F/C ratio. Events in the F-rich group frequently have high He-3/He-4 ratios and are associated with type III and type V radio bursts in the parent flare. The F-poor events are associated with type IV bursts. These results on individual events support the conclusions of earlier work done with daily-averaged abundances.

Ultraviolet spectral morphology of the O stars. IV - The OB supergiant sequence

NASA Technical Reports Server (NTRS)

Walborn, Nolan R.; Nichols-Bohlin, Joy

1987-01-01

An atlas of 25 O3-B8 supergiant spectra in the wavelength ranges 1320-1580 A and 1620-1880 A is presented, based on high-resolution data from the IUE archives. The remarkably detailed relationship between the stellar-wind profiles and the optical spectral classifications throughout this sequence is emphasized. For instance, the (Si IV)/(C IV) ratio reverses between O4 and O6.5; and the B0, B0.5, and B0.7 Ia wind characteristics are each qualitatively unique and distinct from one another. The systematic behavior of nine stellar-wind features with ionization potentials ranging from 114 to 19 eV is summarized as a function of advancing spectral type.

Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

PubMed

Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

2006-12-01

Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

Molecular epidemiology of methicillin-resistant Staphylococcus aureus isolated in serial cultures from the respiratory tract of children with cystic fibrosis.

PubMed

Al-Zubeidi, Duha; Hogan, Patrick G; Boyle, Mary; Burnham, Carey-Ann D; Fritz, Stephanie A

2014-06-01

Little is known about strain relatedness of methicillin-resistant Staphyloccocus aureus (MRSA) isolated at serial time points from the respiratory tract of patients with cystic fibrosis (CF). The objectives are to interrogate the genetic diversity of MRSA recovered in serial cultures from children with CF and to correlate strain relatedness with clinical characteristics. We performed a retrospective analysis of children with CF from whom MRSA was isolated from serial respiratory cultures from 2005 to 2011. Within individual patients, relatedness of isolated strains was determined by repetitive-sequence polymerase chain reaction, and the staphylococcal cassette chromosome mec type of each isolate was characterized. Medical records corresponding to the MRSA cultures were reviewed. We identified 54 CF patients with serial MRSA cultures (145 distinct cultures). Over time, 45 (83%) patients maintained the same strain type and 9 (17%) possessed at least 2 distinct strain types. A total of 91 pairs of isolates were analyzed for strain relatedness. Of these, 81 (89%) were identical and 10 (11%) were distinct strain types. About 117 (83%) isolates were staphylococcal cassette chromosome mec type II, 24 (17%) were staphylococcal cassette chromosome mec type IV and 4 were other types not resolvable with our assay. Clinical factors, including time interval and prescription of antibiotics effective against MRSA between positive cultures, did not correlate with acquisition of a distinct MRSA strain by individual patients. Our data suggest that sustained presence of MRSA in CF patients is most commonly attributable to identical strain types. Acquisition of distinct MRSA strains in the airway is infrequent.

Double-trap model for hysteretic current-voltage characteristics of a polystyrene/ZnO nanorods stacked layer

NASA Astrophysics Data System (ADS)

Wu, You-Lin; Lin, Jing-Jenn; Lin, Shih-Hung; Sung, Yi-Hsing

2017-11-01

Hysteretic current-voltage (I-V) characteristics are quite common in metal-insulator-metal (MIM) devices used for resistive switching random access memory (RRAM). Two types of hysteretic I-V curves are usually observed, figure eight and counter figure eight (counter-clockwise and clockwise in the positive voltage sweep direction, respectively). In this work, a clockwise hysteretic I-V curve was found for an MIM device with polystyrene (PS)/ZnO nanorods stack as an insulator layer. Three distinct regions I ∼ V, I ∼ V2, and I ∼ V0.6 are observed in the double logarithmic plot of the I-V curves, which cannot be explained completely with the conventional trap-controlled space-charge-limited-current (SCLC) model. A model based on the energy band with two separate traps plus local energy variation and trap-controlled SCLC has been developed, which can successfully describe the behavior of the clockwise hysteretic I-V characteristics obtained in this work.

Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

PubMed

Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

1970-12-01

Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Crystal structure of langbeinite-related Rb0.743K0.845Co0.293Ti1.707(PO4)3.

PubMed

Strutynska, Nataliia Yu; Bondarenko, Marina A; Ogorodnyk, Ivan V; Baumer, Vyacheslav N; Slobodyanik, Nikolay S

2015-03-01

Potassium rubidium cobalt(II)/titanium(IV) tris-(orthophosphate), Rb0.743K0.845Co0.293Ti1.707(PO4)3, has been obtained using a high-temperature crystallization method. The obtained compound has a langbeinite-type structure. The three-dimensional framework is built up from mixed-occupied (Co/Ti(IV))O6 octa-hedra (point group symmetry .3.) and PO4 tetra-hedra. The K(+) and Rb(+) cations are statistically distributed over two distinct sites (both with site symmetry .3.) in the large cavities of the framework. They are surrounded by 12 O atoms.

Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

PubMed Central

Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

2012-01-01

The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Ultraviolet light sensitivity and prolonged UVR-erythema

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, P.D.; Kaidbey, K.H.; Kligman, A.M.

The erythema and tanning responses in skin type I (n . 15) and skin type IV (n . 17) have been compared in caucasoids following a single exposure to solar simulated radiation. The former sunburn easily and do not tan while the latter do not burn and tan readily. The dose of radiation was 5 times the Minimal Erythema Dose (MED). The test sites were the extensor aspect of the forearm (exposed site) and flexor aspect of the upper arm (nonexposed site). The responses were monitored at 24 and 48 hr and then twice weekly for 8 weeks. The groupmore » of skin type I individuals had a lower MED and a much more prolonged erythema on both the exposed and nonexposed sites than the group of type IV individuals. All differences were highly significant (p less than 0.005). After 4 weeks erythema remained present in all of the type I subjects but had disappeared in 16 of the 17 type IV subjects. Within the groups there was no difference between erythema duration on exposed vs. nonexposed sites, but there was a highly significant difference (p less than 0.005) between the lower MED on the upper arm and higher MED on the forearm. These results contrast with those of other reports in which prolonged erythema could not be correlated with fair complexion, sunburn sensitivity, ethnic background, or skin type but was instead found to be a distinct feature of persons who had developed nonmelanoma skin cancer. Since prolonged erythema is related to skin type it is therefore not solely a feature of patients with skin cancer.« less

Crystal structure of langbeinite-related Rb0.743K0.845Co0.293Ti1.707(PO4)3

PubMed Central

Strutynska, Nataliia Yu.; Bondarenko, Marina A.; Ogorodnyk, Ivan V.; Baumer, Vyacheslav N.; Slobodyanik, Nikolay S.

2015-01-01

Potassium rubidium cobalt(II)/titanium(IV) tris­(orthophosphate), Rb0.743K0.845Co0.293Ti1.707(PO4)3, has been obtained using a high-temperature crystallization method. The obtained compound has a langbeinite-type structure. The three-dimensional framework is built up from mixed-occupied (Co/TiIV)O6 octa­hedra (point group symmetry .3.) and PO4 tetra­hedra. The K+ and Rb+ cations are statistically distributed over two distinct sites (both with site symmetry .3.) in the large cavities of the framework. They are surrounded by 12 O atoms. PMID:25844179

 Intrahepatic, perihilar and distal cholangiocarcinoma: Management and outcomes.

PubMed

Waseem, David; Tushar, Patel

 Introduction and aims. Cholangiocarcinomas are a heterogeneous group of tumors that can be classified into three clinically distinct types of cancers, intrahepatic, perihilar and distal cholangiocarcinoma. The inconsistent use of nomenclature for these cancers has obscured a true knowledge of the epidemiology, natural history and response to therapy of these cancers. Our aims were to define demographic characteristics, management and outcomes of these three distinct cancer types. A retrospective study of patients enrolled in an institutional cancer registry from 1992 to 2010. Median survival was compared between different treatment modalities over three time periods for the three types of cholangiocarcinoma at different stages of the disease using Kaplan Meyer analysis. 242 patients were identified. All cases were reviewed and classified into intrahepatic (90 patients), distal (48 patients) or perihilar (104 patients) cholangiocarcinomas. These cancers differed in median age of onset, gender distribution, median survival and stage. 13.8% of patients presented with stage I, 5.8% with stage II, 9.6% with stage III, 28% with stage IV, with 41.8% having unknown stage. The overall median survival was 15.8 months, and was 23, 25, 14, and 4.5 months for stages I, II, III, and IV respectively. Surgery improved survival in both early and advanced stages. Multimodality therapies further improved outcomes, particularly for perihilar cholangiocarcinoma. Perihilar, distal and intrahepatic cholangiocarcinoma vary in their presentation, natural history and therapeutic approach to management. A consistently applied classification is essential for meaningful interpretation of studies of these cancers.

The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

PubMed Central

Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

2012-01-01

In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

WIPI1 Coordinates Melanogenic Gene Transcription and Melanosome Formation via TORC1 Inhibition*

PubMed Central

Ho, Hsiang; Kapadia, Rubina; Al-Tahan, Sejad; Ahmad, Safoora; Ganesan, Anand K.

2011-01-01

Recent studies implicate a role for WD repeat domain, phosphoinositide-interacting 1 (WIPI1) in the biogenesis of melanosomes, cell type-specific lysosome-related organelles. In this study, we determined that WIPI1, an ATG18 homologue that is shown to localize to both autophagosomes and early endosomes, inhibited mammalian target of rapamycin (MTOR) signaling, leading to increased transcription of melanogenic enzymes and the formation of mature melanosomes. WIPI1 suppressed the target of rapamycin complex 1 (TORC1) activity, resulting in glycogen synthase kinase 3β inhibition, β-Catenin stabilization, and increased transcription of microphthalmia transcription factor and its target genes. WIPI1-depleted cells accumulated stage I melanosomes but lacked stage III-IV melanosomes. Inhibition of TORC1 by rapamycin treatment resulted in the accumulation of stage IV melanosomes but not autophagosomes, whereas starvation resulted in the formation of autophagosomes but not melanin accumulation. Taken together, our studies define a distinct role for WIPI1 and TORC1 signaling in controlling the transcription of melanogenic enzymes and melanosome maturation, a process that is distinct from starvation-induced autophagy. PMID:21317285

Ataques de nervios: culturally bound and distinct from panic attacks?

PubMed

Keough, Meghan E; Timpano, Kiara R; Schmidt, Norman B

2009-01-01

The Diagnostic and Statistical Manual of Mental Disorders [DSM-IV-TR; American Psychiatric Association [APA], 2000) has emphasized the importance of understanding psychopathology within a cultural framework by including culture-bound syndromes within its appendices. These syndromes are proposed to be bound to certain cultures and distinct from other psychological disorders. Included among the syndromes are ataques de nervios (ADN), which are reported to be bound to the Hispanic culture and closely resemble panic attacks. However, the cultural distinctiveness and phenomenology of ADN has not been adequately investigated. The current study employed an ethnically diverse study sample (N=342) of undergraduates. Participants completed a number of measures that assessed acculturation, syndrome and anxiety risk factors. In contrast to the DSM-IV's conceptualization of ADN, the rate of ADN did not significantly vary across the three main groups (African American, Caucasian, and Hispanic participants) nor did it vary based on acculturation. More consistent with the DSM-IV, the symptom comparisons indicated some differentiation between ADN and panic attacks. The present report provides data indicating that ADNs, as described by the DSM-IV, are not unique to the Hispanic culture and are experienced by non-Hispanic individuals at similar rates to Hispanic-endorsement. The findings are consistent with the DSM-IV assertion that ADNs and PAs are distinct syndromes. (c) 2008 Wiley-Liss, Inc.

Crystal Structure of a Type IV Pilus Assembly ATPase: Insights into the Molecular Mechanism of PilB from Thermus thermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard

Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less

Distinct docking and stabilization steps of the Pseudopilus conformational transition path suggest rotational assembly of type IV pilus-like fibers.

PubMed

Nivaskumar, Mangayarkarasi; Bouvier, Guillaume; Campos, Manuel; Nadeau, Nathalie; Yu, Xiong; Egelman, Edward H; Nilges, Michael; Francetic, Olivera

2014-05-06

The closely related bacterial type II secretion (T2S) and type IV pilus (T4P) systems are sophisticated machines that assemble dynamic fibers promoting protein transport, motility, or adhesion. Despite their essential role in virulence, the molecular mechanisms underlying helical fiber assembly remain unknown. Here, we use electron microscopy and flexible modeling to study conformational changes of PulG pili assembled by the Klebsiella oxytoca T2SS. Neural network analysis of 3,900 pilus models suggested a transition path toward low-energy conformations driven by progressive increase in fiber helical twist. Detailed predictions of interprotomer contacts along this path were tested by site-directed mutagenesis, pilus assembly, and protein secretion analyses. We demonstrate that electrostatic interactions between adjacent protomers (P-P+1) in the membrane drive pseudopilin docking, while P-P+3 and P-P+4 contacts determine downstream fiber stabilization steps. These results support a model of a spool-like assembly mechanism for fibers of the T2SS-T4P superfamily. Copyright © 2014 Elsevier Ltd. All rights reserved.

Distinct docking and stabilization steps of the pseudopilus conformational transition path suggest rotational assembly of type IV pilus-like fibers

PubMed Central

Nivaskumar, Mangayarkarasi; Bouvier, Guillaume; Campos, Manuel; Nadeau, Nathalie; Yu, Xiong; Egelman, Edward H.; Nilges, Michael; Francetic, Olivera

2014-01-01

SUMMARY The closely related bacterial type II secretion (T2S) and type IV pilus (T4P) systems are sophisticated machines that assemble dynamic fibers promoting protein transport, motility or adhesion. Despite their essential role in virulence, the molecular mechanisms underlying helical fiber assembly remain unknown. Here we use electron microscopy and flexible modeling to study conformational changes of PulG pili assembled by the Klebsiella oxytoca T2SS. Neural network analysis of 3900 pilus models suggested a transition path towards low-energy conformations driven by progressive increase in fiber helical twist. Detailed predictions of inter-protomer contacts along this path were tested by site-directed mutagenesis, pilus assembly and protein secretion analyses. We demonstrate that electrostatic interactions between adjacent protomers (P-P+1) in the membrane drive pseudopilin docking, while P-P+3 and P-P+4 contacts determine downstream fiber stabilization steps. These results support a new model of a spool-like assembly mechanism for fibers of the T2SS-T4P superfamily. PMID:24685147

Crystal Structure of a Type IV Pilus Assembly ATPase: Insights into the Molecular Mechanism of PilB from Thermus thermophilus

DOE PAGES

Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard; ...

2016-09-22

Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less

Localization of type IV collagen a 1 to a 6 chains in basement membrane during mouse molar germ development.

PubMed

Nagai, N; Nakano, K; Sado, Y; Naito, I; Gunduz, M; Tsujigiwa, H; Nagatsuka, H; Ninomiya, Y; Siar, C H

2001-10-01

The dental basement membrane (BM) putatively mediates epithelial-mesenchymal interactions during tooth morphogenesis and cytodifferentiation. Type IV collagen alpha chains, a major network-forming protein of the dental BM, was studied and results disclosed distinct expression patterns at different stages of mouse molar germ development. At the dental placode and bud stage, the BM of the oral epithelium expressed alpha 1, alpha 2, alpha 5 and alpha 6 chains while the gubernaculum dentis, in addition to the above four chains, also expressed a 4 chain. An asymmetrical expression for alpha 4, alpha 5 and alpha 6 chains was observed at the bud stage. At the early bell stage, the BM associated with the inner enamel epithelium (IEE) of molar germ expressed alpha 1, alpha 2 and alpha 4 chains while the BM of the outer enamel epithelium (OEE) expressed only alpha 1 and a 2 chains. With the onset of dentinogenesis, the collagen a chain profile of the IEE BM gradually disappeared. Howeverfrom the early to late bell stage, the gubernaculum dentis consistently expressed alpha 1, alpha 2, alpha 5 and a 6 chains resembling fetal oral mucosa. These findings suggest that stage- and position-specific distribution of type IV collagen alpha subunits occur during molar germ development and that these changes are essential for molar morphogenesis and cytodifferentiation.

Neutralization Serotyping of BK Polyomavirus Infection in Kidney Transplant Recipients

PubMed Central

Pastrana, Diana V.; Brennan, Daniel C.; Çuburu, Nicolas; Storch, Gregory A.; Viscidi, Raphael P.; Randhawa, Parmjeet S.; Buck, Christopher B.

2012-01-01

BK polyomavirus (BKV or BKPyV) associated nephropathy affects up to 10% of kidney transplant recipients (KTRs). BKV isolates are categorized into four genotypes. It is currently unclear whether the four genotypes are also serotypes. To address this issue, we developed high-throughput serological assays based on antibody-mediated neutralization of BKV genotype I and IV reporter vectors (pseudoviruses). Neutralization-based testing of sera from mice immunized with BKV-I or BKV-IV virus-like particles (VLPs) or sera from naturally infected human subjects revealed that BKV-I specific serum antibodies are poorly neutralizing against BKV-IV and vice versa. The fact that BKV-I and BKV-IV are distinct serotypes was less evident in traditional VLP-based ELISAs. BKV-I and BKV-IV neutralization assays were used to examine BKV type-specific neutralizing antibody responses in KTRs at various time points after transplantation. At study entry, sera from 5% and 49% of KTRs showed no detectable neutralizing activity for BKV-I or BKV-IV neutralization, respectively. By one year after transplantation, all KTRs were neutralization seropositive for BKV-I, and 43% of the initially BKV-IV seronegative subjects showed evidence of acute seroconversion for BKV-IV neutralization. The results suggest a model in which BKV-IV-specific seroconversion reflects a de novo BKV-IV infection in KTRs who initially lack protective antibody responses capable of neutralizing genotype IV BKVs. If this model is correct, it suggests that pre-vaccinating prospective KTRs with a multivalent VLP-based vaccine against all BKV serotypes, or administration of BKV-neutralizing antibodies, might offer protection against graft loss or dysfunction due to BKV associated nephropathy. PMID:22511874

PML clastosomes prevent nuclear accumulation of mutant ataxin-7 and other polyglutamine proteins

PubMed Central

Janer, Alexandre; Martin, Elodie; Muriel, Marie-Paule; Latouche, Morwena; Fujigasaki, Hiroto; Ruberg, Merle; Brice, Alexis; Trottier, Yvon; Sittler, Annie

2006-01-01

The pathogenesis of spinocerebellar ataxia type 7 and other neurodegenerative polyglutamine (polyQ) disorders correlates with the aberrant accumulation of toxic polyQ-expanded proteins in the nucleus. Promyelocytic leukemia protein (PML) nuclear bodies are often present in polyQ aggregates, but their relation to pathogenesis is unclear. We show that expression of PML isoform IV leads to the formation of distinct nuclear bodies enriched in components of the ubiquitin-proteasome system. These bodies recruit soluble mutant ataxin-7 and promote its degradation by proteasome-dependent proteolysis, thus preventing the aggregate formation. Inversely, disruption of the endogenous nuclear bodies with cadmium increases the nuclear accumulation and aggregation of mutant ataxin-7, demonstrating their role in ataxin-7 turnover. Interestingly, β-interferon treatment, which induces the expression of endogenous PML IV, prevents the accumulation of transiently expressed mutant ataxin-7 without affecting the level of the endogenous wild-type protein. Therefore, clastosomes represent a potential therapeutic target for preventing polyQ disorders. PMID:16818720

Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

2009-01-30

In addition to RNA polymerases I, II, and III, the essential RNA polymerases present in all eukaryotes, plants have two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V, that play nonredundant roles in siRNA-directed DNA methylation and gene silencing. We show that Arabidopsis Pol IV and Pol V are composed of subunits that are paralogous or identical to the 12 subunits of Pol II. Four subunits of Pol IV are distinct from their Pol II paralogs, six subunits of Pol V are distinct from their Pol II paralogs, and four subunits differ between Pol IV and Polmore » V. Importantly, the subunit differences occur in key positions relative to the template entry and RNA exit paths. Our findings support the hypothesis that Pol IV and Pol V are Pol II-like enzymes that evolved specialized roles in the production of noncoding transcripts for RNA silencing and genome defense.« less

Effective prediction of bacterial type IV secreted effectors by combined features of both C-termini and N-termini.

PubMed

Wang, Yu; Guo, Yanzhi; Pu, Xuemei; Li, Menglong

2017-11-01

Various bacterial pathogens can deliver their secreted substrates also called as effectors through type IV secretion systems (T4SSs) into host cells and cause diseases. Since T4SS secreted effectors (T4SEs) play important roles in pathogen-host interactions, identifying them is crucial to our understanding of the pathogenic mechanisms of T4SSs. A few computational methods using machine learning algorithms for T4SEs prediction have been developed by using features of C-terminal residues. However, recent studies have shown that targeting information can also be encoded in the N-terminal region of at least some T4SEs. In this study, we present an effective method for T4SEs prediction by novelly integrating both N-terminal and C-terminal sequence information. First, we collected a comprehensive dataset across multiple bacterial species of known T4SEs and non-T4SEs from literatures. Then, three types of distinctive features, namely amino acid composition, composition, transition and distribution and position-specific scoring matrices were calculated for 50 N-terminal and 100 C-terminal residues. After that, we employed information gain represent to rank the importance score of the 150 different position residues for T4SE secretion signaling. At last, 125 distinctive position residues were singled out for the prediction model to classify T4SEs and non-T4SEs. The support vector machine model yields a high receiver operating curve of 0.916 in the fivefold cross-validation and an accuracy of 85.29% for the independent test set.

Effective prediction of bacterial type IV secreted effectors by combined features of both C-termini and N-termini

NASA Astrophysics Data System (ADS)

Wang, Yu; Guo, Yanzhi; Pu, Xuemei; Li, Menglong

2017-11-01

Various bacterial pathogens can deliver their secreted substrates also called as effectors through type IV secretion systems (T4SSs) into host cells and cause diseases. Since T4SS secreted effectors (T4SEs) play important roles in pathogen-host interactions, identifying them is crucial to our understanding of the pathogenic mechanisms of T4SSs. A few computational methods using machine learning algorithms for T4SEs prediction have been developed by using features of C-terminal residues. However, recent studies have shown that targeting information can also be encoded in the N-terminal region of at least some T4SEs. In this study, we present an effective method for T4SEs prediction by novelly integrating both N-terminal and C-terminal sequence information. First, we collected a comprehensive dataset across multiple bacterial species of known T4SEs and non-T4SEs from literatures. Then, three types of distinctive features, namely amino acid composition, composition, transition and distribution and position-specific scoring matrices were calculated for 50 N-terminal and 100 C-terminal residues. After that, we employed information gain represent to rank the importance score of the 150 different position residues for T4SE secretion signaling. At last, 125 distinctive position residues were singled out for the prediction model to classify T4SEs and non-T4SEs. The support vector machine model yields a high receiver operating curve of 0.916 in the fivefold cross-validation and an accuracy of 85.29% for the independent test set.

The nebular spectra of the transitional Type Ia Supernovae 2007on and 2011iv: broad, multiple components indicate aspherical explosion cores

NASA Astrophysics Data System (ADS)

Mazzali, P. A.; Ashall, C.; Pian, E.; Stritzinger, M. D.; Gall, C.; Phillips, M. M.; Höflich, P.; Hsiao, E.

2018-05-01

The nebular-epoch spectrum of the rapidly declining, `transitional' Type Ia supernova (SN) 2007on showed double emission peaks, which have been interpreted as indicating that the SN was the result of the direct collision of two white dwarfs. The spectrum can be reproduced using two distinct emission components, one redshifted and one blueshifted. These components are similar in mass but have slightly different degrees of ionization. They recede from one another at a line-of-sight speed larger than the sum of the combined expansion velocities of their emitting cores, thereby acting as two independent nebulae. While this configuration appears to be consistent with the scenario of two white dwarfs colliding, it may also indicate an off-centre delayed detonation explosion of a near-Chandrasekhar-mass white dwarf. In either case, broad emission line widths and a rapidly evolving light curve can be expected for the bolometric luminosity of the SN. This is the case for both SNe 2007on and 2011iv, also a transitional SN Ia that exploded in the same elliptical galaxy, NGC 1404. Although SN 2011iv does not show double-peaked emission line profiles, the width of its emission lines is such that a two-component model yields somewhat better results than a single-component model. Most of the mass ejected is in one component, however, which suggests that SN 2011iv was the result of the off-centre ignition of a Chandrasekhar-mass white dwarf.

Hypermineralization and High Osteocyte Lacunar Density in Osteogenesis Imperfecta Type V Bone Indicate Exuberant Primary Bone Formation.

PubMed

Blouin, Stéphane; Fratzl-Zelman, Nadja; Glorieux, Francis H; Roschger, Paul; Klaushofer, Klaus; Marini, Joan C; Rauch, Frank

2017-09-01

In contrast to "classical" forms of osteogenesis imperfecta (OI) types I to IV, caused by a mutation in COL1A1/A2, OI type V is due to a gain-of-function mutation in the IFITM5 gene, encoding the interferon-induced transmembrane protein 5, or bone-restricted interferon-inducible transmembrane (IFITM)-like protein (BRIL). Its phenotype distinctly differs from OI types I to IV by absence of blue sclerae and dentinogenesis imperfecta, by the occurrence of ossification disorders such as hyperplastic callus and forearm interosseous membrane ossification. Little is known about the impact of the mutation on bone tissue/material level in untreated and bisphosphonate-treated patients. Therefore, investigations of transiliac bone biopsy samples from a cohort of OI type V children (n = 15, 8.7 ± 4 years old) untreated at baseline and a subset (n = 8) after pamidronate treatment (2.6 years in average) were performed. Quantitative backscattered electron imaging (qBEI) was used to determine bone mineralization density distribution (BMDD) as well as osteocyte lacunar density. The BMDD of type V OI bone was distinctly shifted toward a higher degree of mineralization. The most frequently occurring calcium concentration (CaPeak) in cortical (Ct) and cancellous (Cn) bone was markedly increased (+11.5%, +10.4%, respectively, p < 0.0001) compared to healthy reference values. Treatment with pamidronate resulted in only a slight enhancement of mineralization. The osteocyte lacunar density derived from sectioned bone area was elevated in OI type V Ct and Cn bone (+171%, p < 0.0001; +183.3%, p < 0.01; respectively) versus controls. The high osteocyte density was associated with an overall immature primary bone structure ("mesh-like") as visualized by polarized light microscopy. In summary, the bone material from OI type V patients is hypermineralized, similar to other forms of OI. The elevated osteocyte lacunar density in connection with lack of regular bone lamellation points to an exuberant primary bone formation and an alteration of the bone remodeling process in OI type V. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

The Staphylococcus aureus Two-Component System AgrAC Displays Four Distinct Genomic Arrangements That Delineate Genomic Virulence Factor Signatures

PubMed Central

Choudhary, Kumari S.; Mih, Nathan; Monk, Jonathan; Kavvas, Erol; Yurkovich, James T.; Sakoulas, George; Palsson, Bernhard O.

2018-01-01

Two-component systems (TCSs) consist of a histidine kinase and a response regulator. Here, we evaluated the conservation of the AgrAC TCS among 149 completely sequenced Staphylococcus aureus strains. It is composed of four genes: agrBDCA. We found that: (i) AgrAC system (agr) was found in all but one of the 149 strains, (ii) the agr positive strains were further classified into four agr types based on AgrD protein sequences, (iii) the four agr types not only specified the chromosomal arrangement of the agr genes but also the sequence divergence of AgrC histidine kinase protein, which confers signal specificity, (iv) the sequence divergence was reflected in distinct structural properties especially in the transmembrane region and second extracellular binding domain, and (v) there was a strong correlation between the agr type and the virulence genomic profile of the organism. Taken together, these results demonstrate that bioinformatic analysis of the agr locus leads to a classification system that correlates with the presence of virulence factors and protein structural properties. PMID:29887846

The craving withdrawal model for alcoholism: towards the DSM-V. Improving the discriminant validity of alcohol use disorder diagnosis.

PubMed

de Bruijn, Carla; van den Brink, Wim; de Graaf, Ron; Vollebergh, Wilma A M

2005-01-01

To compare the discriminant validity of the DSM-IV and the ICD-10 classification of alcohol use disorders (AUD) with an alternative classification, the craving withdrawal model (CWM). CWM requires craving and withdrawal for the diagnosis of alcohol dependence and raises the alcohol abuse threshold to two DSM-IV AUD criteria. Data were derived from The Netherlands Mental Health Survey and Incidence Study, a large representative sample of the general Dutch population. In the present study, only non-abstinent subjects were included (n=6041). Three diagnostic systems (DSM-IV, ICD-10, and CWM) were compared using the following discriminant variables: alcohol intake, psychiatric comorbidity, functional status, familial alcohol problems, and treatment sought. The year prevalence of CWM alcohol dependence was lower than the prevalence of ICD-10 and DSM-IV dependence (0.3% vs 1.4% and 1.4%). The year prevalence of abuse was similar for CWM and DSM-IV (4.7 and 4.9%), but lower for ICD-10 harmful use (1.7%). DSM-IV resulted in a poor distinction between normality and abuse and ICD-10 resulted in a poor distinction between harmful use and dependence. In contrast, the CWM distinctions between normality and abuse, and between abuse, and dependence were significant for most of the discriminant variables. This study indicates that CWM improves the discriminant validity of AUD diagnoses. The predictive validity of the CWM for alcohol and other substance use disorders remain to be studied.

Diversity of methicillin-resistant Staphylococcus aureus CC22-MRSA-IV from Saudi Arabia and the Gulf region.

PubMed

Senok, Abiola; Somily, Ali; Raji, Adeola; Gawlik, Darius; Al-Shahrani, Fatimah; Baqi, Shehla; Boswihi, Samar; Skakni, Leila; Udo, Edet E; Weber, Stefan; Ehricht, Ralf; Monecke, Stefan

2016-10-01

CC22-MRSA-IV, UK-EMRSA-15/Barnim EMRSA, is a common and pandemic strain of methicillin-resistant Staphylococcus aureus (MRSA) that has been found mainly in Western Europe, but also in other parts of the world including some Gulf countries. One suspected case of an infection with this strain in a patient who was admitted to the surgical unit in Riyadh, Kingdom of Saudi Arabia (KSA) was investigated in order to check whether this strain has reached KSA. Besides the index isolate, 46 additional isolates of CC22-MRSA-IV from patients from KSA, Abu Dhabi, Kuwait, and Germany (patients with a history of travel in the Middle East), were characterized by microarray hybridization. The study revealed a regional presence of as many as six distinct 'strains' of CC22-MRSA-IV that could be distinguished based on carriage of SCCmec IV subtypes and virulence factors. No true UK-EMRSA-15/Barnim EMRSA was identified in Riyadh; all suspected isolates from Riyadh were assigned to other, albeit related strains. However, this strain was identified in Abu Dhabi and Kuwait. CC22-MRSA-IV from KSA could be linked to other epidemic strains from the Middle East and possibly India, rather than to the Western European UK-EMRSA-15/Barnim EMRSA. High-resolution typing methods, including SCCmec subtyping, might help to differentiate related epidemic strains and to monitor routes of transmission. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

The Joint Structure of DSM–IV Axis I and Axis II Disorders

PubMed Central

Røysamb, Espen; Tambs, Kristian; Ørstavik, Ragnhild E.; Torgersen, Svenn; Kendler, Kenneth S.; Neale, Michael C.; Aggen, Steven H.; Reichborn-Kjennerud, Ted

2011-01-01

The Diagnostic and Statistical Manual (4th ed. [DSM–IV]; American Psychiatric Association, 1994) distinction between clinical disorders on Axis I and personality disorders on Axis II has become increasingly controversial. Although substantial comorbidity between axes has been demonstrated, the structure of the liability factors underlying these two groups of disorders is poorly understood. The aim of this study was to determine the latent factor structure of a broad set of common Axis I disorders and all Axis II personality disorders and thereby to identify clusters of disorders and account for comorbidity within and between axes. Data were collected in Norway, through a population-based interview study (N = 2,794 young adult twins). Axis I and Axis II disorders were assessed with the Composite International Diagnostic Interview (CIDI) and the Structured Interview for DSM–IV Personality (SIDP–IV), respectively. Exploratory and confirmatory factor analyses were used to investigate the underlying structure of 25 disorders. A four-factor model fit the data well, suggesting a distinction between clinical and personality disorders as well as a distinction between broad groups of internalizing and externalizing disorders. The location of some disorders was not consistent with the DSM–IV classification; antisocial personality disorder belonged primarily to the Axis I externalizing spectrum, dysthymia appeared as a personality disorder, and borderline personality disorder appeared in an interspectral position. The findings have implications for a meta-structure for the DSM. PMID:21319931

Twitching motility of bacteria with type-IV pili: Fractal walks, first passage time, and their consequences on microcolonies

NASA Astrophysics Data System (ADS)

Bisht, Konark; Klumpp, Stefan; Banerjee, Varsha; Marathe, Rahul

2017-11-01

A human pathogen, Neisseria gonorrhoeae (NG), moves on surfaces by attaching and retracting polymeric structures called Type IV pili. The tug-of-war between the pili results in a two-dimensional stochastic motion called twitching motility. In this paper, with the help of real-time NG trajectories, we develop coarse-grained models for their description. The fractal properties of these trajectories are determined and their influence on first passage time and formation of bacterial microcolonies is studied. Our main observations are as follows: (i) NG performs a fast ballistic walk on small time scales and a slow diffusive walk over long time scales with a long crossover region; (ii) there exists a characteristic persistent length lp*, which yields the fastest growth of bacterial aggregates or biofilms. Our simulations reveal that lp*˜L0.6 , where L ×L is the surface on which the bacteria move; (iii) the morphologies have distinct fractal characteristics as a consequence of the ballistic and diffusive motion of the constituting bacteria.

C IV λ1549 as an Eigenvector 1 Parameter for Active Galactic Nuclei

NASA Astrophysics Data System (ADS)

Sulentic, Jack W.; Bachev, Rumen; Marziani, Paola; Negrete, C. Alenka; Dultzin, Deborah

2007-09-01

We are exploring a spectroscopic unification for all types of broad-line emitting AGNs. The four-dimensional Eigenvector 1 (4DE1) parameter space organizes quasar diversity in a sequence primarily governed by Eddington ratio. This paper considers the role of C IV λ1549 measures as 4DE1 diagnostics. We use HST archival spectra for 130 sources with S/N high enough to permit reliable C IV λ1549 broad-component measures. We find a C IV λ1549BC profile blueshift that is strongly concentrated among (largely radio-quiet [RQ]) sources with FWHM(HβBC)<~4000 km s-1 (which we call Population A). Narrow-line Seyfert 1 (NLSy1; with FWHM Hβ<=2000 km s-1) sources belong to this population but do not emerge as a distinct class. The systematic blueshift, widely interpreted as arising in a disk wind/outflow, is not observed in broader line AGNs (including most radio-loud [RL] sources), which we call Population B. We find new correlations involving FWHM(C IV λ1549BC), C IV λ1549 line shift, and equivalent width only among Population A sources. Sulentic et al. suggested C IV λ1549 measures enhance an apparent dichotomy between sources with FWHM(HβBC) less and greater than 4000 km s-1, suggesting that it has more significance in the context of broad-line region structure than the more commonly discussed RL versus RQ dichotomy. Black hole masses computed from FWHM C IV λ1549BC for about 80 AGNs indicate that the C IV λ1549 width is a poor virial estimator. Comparison of mass estimates derived from HβBC and C IV λ1549 reveals that the latter show different and nonlinear offsets for Population A and B sources. A significant number of sources also show narrow-line C IV λ1549 emission that must be removed before C IV λ1549BC measures can be made and interpreted effectively. We present a recipe for C IV λ1549 narrow-component extraction.

Chromosomal structures and repetitive sequences divergence in Cucumis species revealed by comparative cytogenetic mapping.

PubMed

Zhang, Yunxia; Cheng, Chunyan; Li, Ji; Yang, Shuqiong; Wang, Yunzhu; Li, Ziang; Chen, Jinfeng; Lou, Qunfeng

2015-09-25

Differentiation and copy number of repetitive sequences affect directly chromosome structure which contributes to reproductive isolation and speciation. Comparative cytogenetic mapping has been verified an efficient tool to elucidate the differentiation and distribution of repetitive sequences in genome. In present study, the distinct chromosomal structures of five Cucumis species were revealed through genomic in situ hybridization (GISH) technique and comparative cytogenetic mapping of major satellite repeats. Chromosome structures of five Cucumis species were investigated using GISH and comparative mapping of specific satellites. Southern hybridization was employed to study the proliferation of satellites, whose structural characteristics were helpful for analyzing chromosome evolution. Preferential distribution of repetitive DNAs at the subtelomeric regions was found in C. sativus, C hystrix and C. metuliferus, while majority was positioned at the pericentromeric heterochromatin regions in C. melo and C. anguria. Further, comparative GISH (cGISH) through using genomic DNA of other species as probes revealed high homology of repeats between C. sativus and C. hystrix. Specific satellites including 45S rDNA, Type I/II, Type III, Type IV, CentM and telomeric repeat were then comparatively mapped in these species. Type I/II and Type IV produced bright signals at the subtelomeric regions of C. sativus and C. hystrix simultaneously, which might explain the significance of their amplification in the divergence of Cucumis subgenus from the ancient ancestor. Unique positioning of Type III and CentM only at the centromeric domains of C. sativus and C. melo, respectively, combining with unique southern bands, revealed rapid evolutionary patterns of centromeric DNA in Cucumis. Obvious interstitial telomeric repeats were observed in chromosomes 1 and 2 of C. sativus, which might provide evidence of the fusion hypothesis of chromosome evolution from x = 12 to x = 7 in Cucumis species. Besides, the significant correlation was found between gene density along chromosome and GISH band intensity in C. sativus and C. melo. In summary, comparative cytogenetic mapping of major satellites and GISH revealed the distinct differentiation of chromosome structure during species formation. The evolution of repetitive sequences was the main force for the divergence of Cucumis species from common ancestor.

Determination of the minimal phototoxic dose and colorimetry in psoralen plus ultraviolet A radiation therapy.

PubMed

Kraemer, Cristine Kloeckner; Menegon, Dóris Baratz; Cestari, Tania Ferreira

2005-10-01

The use of an adequate initial dose of ultraviolet A (UVA) radiation for photochemotherapy is important to prevent burns secondary to overdosage, meanwhile avoiding a reduced clinical improvement and long-term risks secondary to underdosage. The ideal initial dose of UVA can be achieved based on the phototype and the minimal phototoxic dose (MPD). The objective measurement of constitutive skin color (colorimetry) is another method commonly used to quantify the erythematous skin reaction to ultraviolet radiation exposure. The aim of this study was to determine variations in MPD and constitutional skin color (coordinate L(*)) within different phototypes in order to establish the best initial dose of UVA radiation for photochemotherapy patients. Thirty-six patients with dermatological conditions and 13 healthy volunteers were divided into five groups according to phototype. Constitutional skin color of the infra-axillary area was assessed by colorimetry. The infra-axillary area was subsequently divided into twelve 1.5 cm(2) regions to determine the MPD; readings were performed 72 h after oral administration of 8-methoxypsoralen (MOP) followed by exposure of the demarcated regions to increasing doses of UVA. The majority of the participants were women (73.5%) and their mean age was 38.8 years. The MPD ranged from 4 to 12 J/cm(2) in phototypes II and III; from 10 to 18 J/cm(2) in type IV; from 12 to 24 J/cm(2) in type V and from 18 to 32 J/cm(2) in type VI. The analysis of colorimetric values (L(*) coordinate) and MPD values allowed the definition of three distinctive groups of individuals composed by phototypes II and III (group 1), types IV and V (group 2), and phototype VI (group 3). MPD and L(*) coordinate showed variation within the same phototype and superposition between adjacent phototypes. The values of the L(*) coordinate and the MPD lead to the definition of three distinct sensitivity groups: phototypes II and III, IV and V and type VI. Also, the MPD values bear a strong correlation to coordinate L(*) values. Mean MPD values described for each of the three major sensitivity groups were higher than the values commonly used in clinical settings for the different phototypes. Therefore, phototype alone is not a good parameter to define the initial UVA dose. MPD and colorimetry could be used in pre-treatment evaluation of patients who are to be submitted to photochemotherapy, in a non-invasive and more accurate way when compared with the classical phenotype clinical criteria.

Investigation of the Acoustics of Plucked String Tones Based on the Analysis of Their Time-Varying Spectra.

NASA Astrophysics Data System (ADS)

Chen, Kwok-Ping John

This research investigates two aspects of the time-varying vibration patterns of plucked string tones of classical guitar, Chinese pipa and Chinese ch'in. First, the assumption that horizontal and vertical frequencies and decay rates may be different is used as a basis for classifying the partial amplitude envelopes into four types. It is found that the partial envelopes of the tones produced by the three instruments, using the finger tip excitation method, on a single undamped string, can be described in terms of these four types. The results show that ch'in tones contain Type III, and IV, guitar tones contain Type I, II and III, and pipa tones contain all four types with a higher percentage of Type III and IV. Second, the theories of "missing modes" (Young, 1800), (Benade, 1976) and delayed generation of these modes (Fletcher, 1984), (Hall, 1987) are re-examined experimentally. The edge of a conventional guitar pick is used to excite a single undamped string on a classical guitar at nodal position N which is L/N from the bridge. As a result, it is a consistent feature that any mode whose index n is a multiple of N is attenuated during the attack phase but subsequently rises with a more gradual attack to reach a significant peak amplitude, except for the first multiple of locations L/3 to L/7. This amplitude envelope pattern, Type V, which is only applicable when the pick-edge excitation method is used, is distinct from the other four types mentioned above.

Oxabicyclooctane-Linked Novel Bacterial Topoisomerase Inhibitors as Broad Spectrum Antibacterial Agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Sheo B.; Kaelin, David E.; Wu, Jin

Bacterial resistance is eroding the clinical utility of existing antibiotics necessitating the discovery of new agents. Bacterial type II topoisomerase is a clinically validated, highly effective, and proven drug target. This target is amenable to inhibition by diverse classes of inhibitors with alternative and distinct binding sites to quinolone antibiotics, thus enabling the development of agents that lack cross-resistance to quinolones. Described here are novel bacterial topoisomerase inhibitors (NBTIs), which are a new class of gyrase and topo IV inhibitors and consist of three distinct structural moieties. The substitution of the linker moiety led to discovery of potent broad-spectrum NBTIsmore » with reduced off-target activity (hERG IC50 > 18 μM) and improved physical properties. AM8191 is bactericidal and selectively inhibits DNA synthesis and Staphylococcus aureus gyrase (IC50 = 1.02 μM) and topo IV (IC50 = 10.4 μM). AM8191 showed parenteral and oral efficacy (ED50) at less than 2.5 mg/kg doses in a S. aureus murine infection model. A cocrystal structure of AM8191 bound to S. aureus DNA-gyrase showed binding interactions similar to that reported for GSK299423, displaying a key contact of Asp83 with the basic amine at position-7 of the linker.« less

Strong enhancement of the luminescence decay time of isoelectronic centers in GaP:N at low temperatures

NASA Astrophysics Data System (ADS)

St-Jean, Philippe; Ethier-Majcher, Gabriel; Bergeron, Alaric; Francoeur, Sebastien

2013-03-01

We report (i)- results from ac impedance measurements obtained for intrinsic indium oxide films, grown under O2-rich conditions, (ii)- current-voltage (I-V) curves for p-n homojunctions fabricated by sequential growth of a 200 nm thick p-type In2O3 layer on a 400 nm thick n-type In2O3, and (iii)- capacitance-voltage (C-V) curves for these junctions. Impedance as well as I-V and C-V measurements were performed under UV irradiation and in darkness. We find two distinct contributions to the ac conductivity. One of them is brought about by grain boundaries, and the other one by inversion layers, which are on grain surfaces. In addition, we have found that photocurrents relax extremely slowly in these films. All of this fits consistently within a model in which mobile holes in inversion layers are responsible for p-type dc conductivity in intrinsic indium oxide films grown under O2-rich conditions. Such mechanism might be important in other polycrystalline thin films which have a large number of oxidizing defects at grain boundaries. We acknowledge support from grant MAT2012-38213-C02-01, from the Ministerio de Economia y Competividad, Spain.

New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

PubMed

Ramírez, Juan C; Torres, Carolina; Curto, María de Los A; Schijman, Alejandro G

2017-12-01

Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs), TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA), comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

What is a mental/psychiatric disorder? From DSM-IV to DSM-V.

PubMed

Stein, D J; Phillips, K A; Bolton, D; Fulford, K W M; Sadler, J Z; Kendler, K S

2010-11-01

The distinction between normality and psychopathology has long been subject to debate. DSM-III and DSM-IV provided a definition of mental disorder to help clinicians address this distinction. As part of the process of developing DSM-V, researchers have reviewed the concept of mental disorder and emphasized the need for additional work in this area. Here we review the DSM-IV definition of mental disorder and propose some changes. The approach taken here arguably takes a middle course through some of the relevant conceptual debates. We agree with the view that no definition perfectly specifies precise boundaries for the concept of mental/psychiatric disorder, but in line with a view that the nomenclature can improve over time, we aim here for a more scientifically valid and more clinically useful definition.

Defined types of cortical interneurone structure space and spike timing in the hippocampus

PubMed Central

Somogyi, Peter; Klausberger, Thomas

2005-01-01

The cerebral cortex encodes, stores and combines information about the internal and external environment in rhythmic activity of multiple frequency ranges. Neurones of the cortex can be defined, recognized and compared on the comprehensive application of the following measures: (i) brain area- and cell domain-specific distribution of input and output synapses, (ii) expression of molecules involved in cell signalling, (iii) membrane and synaptic properties reflecting the expression of membrane proteins, (iv) temporal structure of firing in vivo, resulting from (i)–(iii). Spatial and temporal measures of neurones in the network reflect an indivisible unity of evolutionary design, i.e. neurones do not have separate structure or function. The blueprint of this design is most easily accessible in the CA1 area of the hippocampus, where a relatively uniform population of pyramidal cells and their inputs follow an instantly recognizable laminated pattern and act within stereotyped network activity patterns. Reviewing the cell types and their spatio-temporal interactions, we suggest that CA1 pyramidal cells are supported by at least 16 distinct types of GABAergic neurone. During a given behaviour-contingent network oscillation, interneurones of a given type exhibit similar firing patterns. During different network oscillations representing two distinct brain states, interneurones of the same class show different firing patterns modulating their postsynaptic target-domain in a brain-state-dependent manner. These results suggest roles for specific interneurone types in structuring the activity of pyramidal cells via their respective target domains, and accurately timing and synchronizing pyramidal cell discharge, rather than providing generalized inhibition. Finally, interneurones belonging to different classes may fire preferentially at distinct time points during a given oscillation. As different interneurones innervate distinct domains of the pyramidal cells, the different compartments will receive GABAergic input differentiated in time. Such a dynamic, spatio-temporal, GABAergic control, which evolves distinct patterns during different brain states, is ideally suited to regulating the input integration of individual pyramidal cells contributing to the formation of cell assemblies and representations in the hippocampus and, probably, throughout the cerebral cortex. PMID:15539390

Subtypes of the Type II Pit Pattern Reflect Distinct Molecular Subclasses in the Serrated Neoplastic Pathway.

PubMed

Aoki, Hironori; Yamamoto, Eiichiro; Yamano, Hiro-O; Sugai, Tamotsu; Kimura, Tomoaki; Tanaka, Yoshihito; Matsushita, Hiro-O; Yoshikawa, Kenjiro; Takagi, Ryo; Harada, Eiji; Nakaoka, Michiko; Yoshida, Yuko; Harada, Taku; Sudo, Gota; Eizuka, Makoto; Yorozu, Akira; Kitajima, Hiroshi; Niinuma, Takeshi; Kai, Masahiro; Nojima, Masanori; Suzuki, Hiromu; Nakase, Hiroshi

2018-03-15

Colorectal serrated lesions (SLs) are important premalignant lesions whose clinical and biological features are not fully understood. We aimed to establish accurate colonoscopic diagnosis and treatment of SLs through evaluation of associations among the morphological, pathological, and molecular characteristics of SLs. A total of 388 premalignant and 18 malignant colorectal lesions were studied. Using magnifying colonoscopy, microsurface structures were assessed based on Kudo's pit pattern classification system, and the Type II pit pattern was subcategorized into classical Type II, Type II-Open (Type II-O) and Type II-Long (Type II-L). BRAF/KRAS mutations and DNA methylation of CpG island methylator phenotype (CIMP) markers (MINT1, - 2, - 12, - 31, p16, and MLH1) were analyzed through pyrosequencing. Type II-O was tightly associated with sessile serrated adenoma/polyps (SSA/Ps) with BRAF mutation and CIMP-high. Most lesions with simple Type II or Type II-L were hyperplastic polyps, while mixtures of Type II or Type II-L plus more advanced pit patterns (III/IV) were characteristic of traditional serrated adenomas (TSAs). Type II-positive TSAs frequently exhibited BRAF mutation and CIMP-low, while Type II-L-positive TSAs were tightly associated with KRAS mutation and CIMP-low. Analysis of lesions containing both premalignant and cancerous components suggested Type II-L-positive TSAs may develop into KRAS-mutated/CIMP-low/microsatellite stable cancers, while Type II-O-positive SSA/Ps develop into BRAF-mutated/CIMP-high/microsatellite unstable cancers. These results suggest that Type II subtypes reflect distinct molecular subclasses in the serrated neoplasia pathway and that they could be useful hallmarks for identifying SLs at high risk of developing into CRC.

Extension of the classical classification of β-turns

PubMed Central

de Brevern, Alexandre G.

2016-01-01

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

Extension of the classical classification of β-turns.

PubMed

de Brevern, Alexandre G

2016-09-15

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

Proposal of a novel system for the staging of thymic epithelial tumors.

PubMed

Bedini, Amedeo Vittorio; Andreani, Stefano Michele; Tavecchio, Luca; Fabbri, Alessandra; Giardini, Roberto; Camerini, Tiziana; Bufalino, Rosaria; Morabito, Alberto; Rosai, Juan

2005-12-01

We designed and assessed a new TNM staging system (herein called the INT [Istituto Nazionale Tumori] system) for thymic epithelial tumors in order to overcome the perceived drawbacks of Masaoka's system, which represents the current standard. In all, 123 cases were evaluated. The histologic types according to the World Health Organization (WHO) classification were as follows: subtype A: 5 cases; AB: 40; B1: 16; B2: 29; B3: 16; and C: 17 cases. There were 45 Masaoka's stage I, 33 stage II, 26 stage III, and 19 stage IV cases. A total of 11 INT definitions were grouped into three stages: locally restricted disease (75 cases), which included Masaoka's stage I and selected stage II cases (no pleural invasion); locally advanced disease (37 cases), which included Masaoka's stage III cases plus those staged II owing to pleural invasion and those staged IV owing to intrathoracic nodal or limited pleuropericardial involvement; and systemic disease (11 cases), which included the remaining Masaoka's stage IV cases. Completeness of resection, WHO types, and both staging systems were significant prognostic factors (p < 0.0001) on univariate analysis. The 95-month progression-free survival rates according to Masaoka's system were stage I: 100%; II: 93.6%; III: 46.3%; and IV: 23.2%. The INT system corresponding figures were as follows: locally restricted disease: 98.6%; locally advanced disease: 46.9%; and systemic disease: 11.7%. The INT system was the prognostic factor with the greatest impact (p = 0.0218) on multivariate analysis (Masaoka's system: p = 0.2012; completeness of resection: p = 0.6855; histology: p = 0.9386). The INT system allows finer disease descriptions than Masaoka's system, resulting in a stage grouping with higher prognostic distinctiveness.

Impact of inhomogeneity on SH-type wave propagation in an initially stressed composite structure

NASA Astrophysics Data System (ADS)

Saha, S.; Chattopadhyay, A.; Singh, A. K.

2018-02-01

The present analysis has been made on the influence of distinct form of inhomogeneity in a composite structure comprised of double superficial layers lying over a half-space, on the phase velocity of SH-type wave propagating through it. Propagation of SH-type wave in the said structure has been examined in four distinct cases of inhomogeneity viz. when inhomogeneity in double superficial layer is due to exponential variation in density only (Case I); when inhomogeneity in double superficial layers is due to exponential variation in rigidity only (Case II); when inhomogeneity in double superficial layer is due to exponential variation in rigidity, density and initial stress (Case III) and when inhomogeneity in double superficial layer is due to linear variation in rigidity, density and initial stress (Case IV). Closed-form expression of dispersion relation has been accomplished for all four aforementioned cases through extensive application of Debye asymptotic analysis. Deduced dispersion relations for all the cases are found in well-agreement to the classical Love-wave equation. Numerical computation has been carried out to graphically demonstrate the effect of inhomogeneity parameters, initial stress parameters as well as width ratio associated with double superficial layers in the composite structure for each of the four aforesaid cases on dispersion curve. Meticulous examination of distinct cases of inhomogeneity and initial stress in context of considered problem has been carried out with detailed analysis in a comparative approach.

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

PubMed

Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

2007-08-01

Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

Extensive Genetic Diversity Identified among Sporadic Methicillin-Resistant Staphylococcus aureus Isolates Recovered in Irish Hospitals between 2000 and 2012

PubMed Central

Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan

2014-01-01

Clonal replacement of predominant nosocomial methicillin-resistant Staphylococcus aureus (MRSA) strains has occurred several times in Ireland during the last 4 decades. However, little is known about sporadically occurring MRSA in Irish hospitals or in other countries. Eighty-eight representative pvl-negative sporadic MRSA isolates recovered in Irish hospitals between 2000 and 2012 were investigated. These yielded unusual pulsed-field gel electrophoresis and antibiogram-resistogram typing patterns distinct from those of the predominant nosocomial MRSA clone, ST22-MRSA-IV, during the study period. Isolates were characterized by spa typing and DNA microarray profiling for multilocus sequence type (MLST) clonal complex (CC) and/or sequence type (ST) and SCCmec type assignment, as well as for detection of virulence and antimicrobial resistance genes. Conventional PCR-based SCCmec subtyping was undertaken when necessary. Extensive diversity was detected, including 38 spa types, 13 MLST-CCs (including 18 STs among 62 isolates assigned to STs), and 25 SCCmec types (including 2 possible novel SCCmec elements and 7 possible novel SCCmec subtypes). Fifty-four MLST-spa-SCCmec type combinations were identified. Overall, 68.5% of isolates were assigned to nosocomial lineages, with ST8-t190-MRSA-IID/IIE ± SCCM1 predominating (17.4%), followed by CC779/ST779-t878-MRSA-ψSCCmec-SCC-SCCCRISPR (7.6%) and CC22/ST22-t032-MRSA-IVh (5.4%). Community-associated clones, including CC1-t127/t386/t2279-MRSA-IV, CC59-t216-MRSA-V, CC8-t008-MRSA-IVa, and CC5-t002/t242-MRSA-IV/V, and putative animal-associated clones, including CC130-t12399-MRSA-XI, ST8-t064-MRSA-IVa, ST398-t011-MRSA-IVa, and CC6-t701-MRSA-V, were also identified. In total, 53.3% and 47.8% of isolates harbored genes for resistance to two or more classes of antimicrobial agents and two or more mobile genetic element-encoded virulence-associated factors, respectively. Effective ongoing surveillance of sporadic nosocomial MRSA is warranted for early detection of emerging clones and reservoirs of virulence, resistance, and SCCmec genes. PMID:24395241

[Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

PubMed

Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

1985-04-01

Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

Origin of polymorphism of the two-dimensional group-IV monochalcogenides

NASA Astrophysics Data System (ADS)

Wu, Minghui; Wei, Su-Huai; Huang, Li

2017-11-01

Unlike other two-dimensional (2D) isovalent materials, the 2D group IV monochalcogenides, M X (M =Si , Ge, Sn, and Pb; X =S , Se, and Te), are found to be either in a black phosphorene-derived distorted NaCl-type (d -NaCl) structure or a recently predicted P m a 2 structure. Both M and X atoms in the d -NaCl structure are threefold coordinated, whereas M and X in the P m a 2 structure are fourfold and twofold coordinated, respectively. Using first-principles total energy and electronic structure calculations and a global structural search technique, we systematically investigated the mechanism underlying the polymorphism of the 2D group-IV monochalcogenides. Our analysis show that the relative stability of the two distinct crystallographic phases depends on the strength of the M -M covalent bond and the electronegativity difference between the constituent elements M and X . For small cations, the covalency plays more important role, whereas for large cations the Coulomb interaction becomes more dominant. Therefore, the Si X and Ge X compounds assume the P m a 2 structure, whereas the M X compounds with heavy cation elements (M =Sn and Pb) tend to adopt the d -NaCl structure.

I-V characteristics of in-plane and out-of-plane strained edge-hydrogenated armchair graphene nanoribbons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cartamil-Bueno, S. J., E-mail: s.j.cartamilbueno@tudelft.nl, E-mail: rbolivar@ugr.es; Rodríguez-Bolívar, S., E-mail: s.j.cartamilbueno@tudelft.nl, E-mail: rbolivar@ugr.es

2015-06-28

The effects of tensile strain on the current-voltage (I-V) characteristics of hydrogenated-edge armchair graphene nanoribbons are investigated by using DFT theory. The strain is introduced in two different ways related to the two types of systems studied in this work: in-plane strained systems (A) and out-of-plane strained systems due to bending (B). These two kinds of strain lead to make a distinction among three cases: in-plane strained systems with strained electrodes (A1) and with unstrained electrodes (A2), and out-of-plane homogeneously strained systems with unstrained, fixed electrodes (B). The systematic simulations to calculate the electronic transmission between two electrodes were focusedmore » on systems of 8 and 11 dimers in width. The results show that the differences between cases A2 and B are negligible, even though the strain mechanisms are different: in the plane case, the strain is uniaxial along its length; while in the bent case, the strain is caused by the arc deformation. Based on the study, a new type of nanoelectromechanical system solid state switching device is proposed.« less

Cocoon formation in patients with midgut neuroendocrine tumors: a rare and unrecognized final pathway.

PubMed

Wang, Yi-Zarn; King, Heather; Diebold, Anne

2013-08-01

Neuroendocrine tumors (NETs) are relatively rare with an indolent nature. As a result, treatment is often delayed and passive. The most commonly recognized disease progression leading to death is from the sequelae of bowel obstruction, ischemia, or liver failure secondary to liver metastasis. We recently recognized a rare cocoon-like formation in patients with metastatic gastroenteropancreatic NETs and hypothesize that this may be a distinct, final pathway for these patients. Ten patients with stage IV gastroenteropancreatic NETs, seen at our center between October 2008 and November 2011, who developed a cocoon were identified. Patient's charts, operative reports, pathology, and tumor markers were reviewed. No discernable predictors were identified as precursors to this condition. One patient survived 13 months after cocoon diagnosis, and the remaining 9 patients were all deceased within 5 months. Surgical treatment was attempted in 6 patients and was only partially successful in 1 patient who had the earliest stage of cocoon formation (type 1). Cocoon-like formations in patients with stage IV gastroenteropancreatic NETs is rare and may be a terminal disease progression that has not been previously recognized. The best treatment option remains unknown. Surgical treatment is not advisable, with the exception of type 1 abdominal cocoons.

The Human Periallocortex: Layer Pattern in Presubiculum, Parasubiculum and Entorhinal Cortex. A Review

PubMed Central

Insausti, Ricardo; Muñoz-López, Mónica; Insausti, Ana M.; Artacho-Pérula, Emilio

2017-01-01

The cortical mantle is not homogeneous, so that three types of cortex can be distinguished: allocortex, periallocortex and isocortex. The main distinction among those three types is based on morphological differences, in particular the number of layers, overall organization, appearance, etc., as well as its connectivity. Additionally, in the phylogenetic scale, this classification is conserved among different mammals. The most primitive and simple cortex is the allocortex, which is characterized by the presence of three layers, with one cellular main layer; it is continued by the periallocortex, which presents six layers, although with enough differences in the layer pattern to separate three different fields: presubiculum (PrS), parasubiculum (PaS), and entorhinal cortex (EC). The closest part to the allocortex (represented by the subiculum) is the PrS, which shows outer (layers I–III) and inner (V–VI) principal layers (lamina principalis externa and lamina principalis interna), both separated by a cell poor band, parallel to the pial surface (layer IV or lamina dissecans). This layer organization is present throughout the anterior-posterior axis. The PaS continues the PrS, but its rostrocaudal extent is shorter than the PrS. The organization of the PaS shows the layer pattern more clearly than in the PrS. Up to six layers are recognizable in the PaS, with layer IV as lamina dissecans between superficial (layers I–III) and deep (V–VI) layers, as in the PrS. The EC presents even more clearly the layer pattern along both mediolateral and rostrocaudal extent. The layer pattern is a thick layer I, layer II in islands, layer III medium pyramids, layer IV as lamina dissecans (not present throughout the EC extent), layer V with dark and big pyramids and a multiform layer VI. The EC borders laterally the proisocortex (incomplete type of isocortex). Variations in the appearance of its layers justify the distinction of subfields in the EC, in particular in human and nonhuman primates. EC layers are not similar to those in the neocortex. The transition between the periallocortical EC and isocortex is not sharp, so that the proisocortex forms an intervening cortex, which fills the gap between the periallocortex and the isocortex. PMID:29046628

The Human Periallocortex: Layer Pattern in Presubiculum, Parasubiculum and Entorhinal Cortex. A Review.

PubMed

Insausti, Ricardo; Muñoz-López, Mónica; Insausti, Ana M; Artacho-Pérula, Emilio

2017-01-01

The cortical mantle is not homogeneous, so that three types of cortex can be distinguished: allocortex, periallocortex and isocortex. The main distinction among those three types is based on morphological differences, in particular the number of layers, overall organization, appearance, etc., as well as its connectivity. Additionally, in the phylogenetic scale, this classification is conserved among different mammals. The most primitive and simple cortex is the allocortex, which is characterized by the presence of three layers, with one cellular main layer; it is continued by the periallocortex, which presents six layers, although with enough differences in the layer pattern to separate three different fields: presubiculum (PrS), parasubiculum (PaS), and entorhinal cortex (EC). The closest part to the allocortex (represented by the subiculum) is the PrS, which shows outer (layers I-III) and inner (V-VI) principal layers ( lamina principalis externa and lamina principalis interna ), both separated by a cell poor band, parallel to the pial surface (layer IV or lamina dissecans ). This layer organization is present throughout the anterior-posterior axis. The PaS continues the PrS, but its rostrocaudal extent is shorter than the PrS. The organization of the PaS shows the layer pattern more clearly than in the PrS. Up to six layers are recognizable in the PaS, with layer IV as lamina dissecans between superficial (layers I-III) and deep (V-VI) layers, as in the PrS. The EC presents even more clearly the layer pattern along both mediolateral and rostrocaudal extent. The layer pattern is a thick layer I, layer II in islands, layer III medium pyramids, layer IV as lamina dissecans (not present throughout the EC extent), layer V with dark and big pyramids and a multiform layer VI. The EC borders laterally the proisocortex (incomplete type of isocortex). Variations in the appearance of its layers justify the distinction of subfields in the EC, in particular in human and nonhuman primates. EC layers are not similar to those in the neocortex. The transition between the periallocortical EC and isocortex is not sharp, so that the proisocortex forms an intervening cortex, which fills the gap between the periallocortex and the isocortex.

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

PubMed

Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

2014-04-01

The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

Association between the vaginal microbiota, menopause status, and signs of vulvovaginal atrophy.

PubMed

Brotman, Rebecca M; Shardell, Michelle D; Gajer, Pawel; Fadrosh, Doug; Chang, Kathryn; Silver, Michelle I; Viscidi, Raphael P; Burke, Anne E; Ravel, Jacques; Gravitt, Patti E

2014-05-01

The vaginal microbiota helps protect the female genital tract from disease. We sought to describe the composition of the vaginal microbiota in premenopausal, perimenopausal, and postmenopausal women and to explore the association between the microbiota and vulvovaginal atrophy (VVA). Eighty-seven women (aged 35-60 y) were classified as premenopausal (n = 30), perimenopausal (n = 29), or postmenopausal (n = 28) according to Stages of Reproductive Aging Workshop guidelines. Midvaginal bacterial community composition was characterized by 16S ribosomal RNA gene analysis. Bacterial communities clustered into six community state types (CSTs), of which four were dominated by Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, or Lactobacillus jensenii, and two (CST IV-A and CST IV-B) had low relative abundance of Lactobacillus. CST IV-A was characterized by Streptococcus and Prevotella, whereas CST IV-B was characterized by Atopobium. There were significant associations between menopause stage and CST (P = 0.004) and between VVA and CST (P = 0.002). Perimenopausal women were more likely to be classified as CST IV-A or L. gasseri CST, whereas postmenopausal women were often classified as CST IV-A. CSTs dominated by L. crispatus and L. iners were more prevalent in premenopausal women. Nineteen participants had signs of mild or moderate VVA. Compared with women with no VVA, the vaginal microbiota of women with mild or moderate atrophy had 25-fold greater odds of being classified as CST IV-A versus L. crispatus CST (adjusted odds ratio, 25.89; 95% credible interval, 2.98-406.79). A distinct bacterial community state (CST IV-A) with a low relative abundance of Lactobacillus is associated with VVA. Future studies recruiting a larger number of women are needed to replicate the findings. This study provides an impetus for future longitudinal studies designed to manage, modulate, and restore vaginal microbiota homeostasis, which would provide stronger evidence for a causal relationship with VVA and ultimately improve the treatment and prevention of atrophic vaginitis in menopause.

Association between the vaginal microbiota, menopause status and signs of vulvovaginal atrophy

PubMed Central

Brotman, Rebecca M.; Shardell, Michelle D.; Gajer, Pawel; Fadrosh, Doug; Chang, Kathryn; Silver, Michelle; Viscidi, Raphael P.; Burke, Anne E.; Ravel, Jacques; Gravitt, Patti E.

2013-01-01

Objectives The vaginal microbiota help protect the female genital tract from disease. We sought to describe the composition of the vaginal microbiota between pre-, peri- and postmenopausal women and to explore the association between the microbiota and vulvovaginal atrophy (VVA). Methods 87 women (age 35–60) were classified as premenopausal (n=30), perimenopausal (n=29) or postmenopausal (n=28) according to STRAW guidelines. Mid-vagina bacterial community composition was characterized by 16S rRNA gene analysis. Results Bacterial communities clustered into six community state types (CSTs), of which four were dominated by Lactobacillus crispatus, L. gasseri, L. iners, or L. jensenii; and two (CST-IV-A and IV-B) had low relative abundance of Lactobacillus. CST IV-A was characterized by Streptococcus and Prevotella, whereas CST IV-B by Atopobium. There was a significant association between menopause stage and CST (p-value=0.004) and VVA and CST (p-value=0.002). Perimenopausal women were more likely to be classified as CST IV-A or the L. gasseri CST, whereas postmenopausal women were mostly CST IV-A. CSTs dominated by L. crispatus and L. iners were more prevalent in premenopausal women. Nineteen participants had signs of mild or moderate VVA. Compared to women with no VVA, the vaginal microbiota of women with mild or moderate atrophy had 25-fold greater odds of being classified as CST IV-A vs. L. crispatus CST (aOR: 25.89, 95% Credible Interval:2.98-406.79). Conclusions A distinct bacterial community state (CST IV-A) with low relative abundance of Lactobacillus was associated with VVA. Future studies recruiting a larger number of women are needed to replicate the findings. This study provides an impetus for future longitudinal studies designed to manage, modulate and restore vaginal microbiota homeostasis which would provide stronger evidence for a causal relationship with VVA and ultimately improve treatment and prevention of atrophic vaginitis in menopause. PMID:24080849

Oral versus intravenous iron replacement therapy distinctly alters the gut microbiota and metabolome in patients with IBD

PubMed Central

Lee, Thomas; Clavel, Thomas; Smirnov, Kirill; Schmidt, Annemarie; Lagkouvardos, Ilias; Walker, Alesia; Lucio, Marianna; Michalke, Bernhard; Schmitt-Kopplin, Philippe; Fedorak, Richard; Haller, Dirk

2017-01-01

Objective Iron deficiency is a common complication in patients with IBD and oral iron therapy is suggested to exacerbate IBD symptoms. We performed an open-labelled clinical trial to compare the effects of per oral (PO) versus intravenous (IV) iron replacement therapy (IRT). Design The study population included patients with Crohn's disease (CD; N=31), UC (N=22) and control subjects with iron deficiency (non-inflamed, NI=19). After randomisation, participants received iron sulfate (PO) or iron sucrose (IV) over 3 months. Clinical parameters, faecal bacterial communities and metabolomes were assessed before and after intervention. Results Both PO and IV treatments ameliorated iron deficiency, but higher ferritin levels were observed with IV. Changes in disease activity were independent of iron treatment types. Faecal samples in IBD were characterised by marked interindividual differences, lower phylotype richness and proportions of Clostridiales. Metabolite analysis also showed separation of both UC and CD from control anaemic participants. Major shifts in bacterial diversity occurred in approximately half of all participants after IRT, but patients with CD were most susceptible. Despite individual-specific changes in phylotypes due to IRT, PO treatment was associated with decreased abundances of operational taxonomic units assigned to the species Faecalibacterium prausnitzii, Ruminococcus bromii, Dorea sp. and Collinsella aerofaciens. Clear IV-specific and PO-specific fingerprints were evident at the level of metabolomes, with changes affecting cholesterol-derived host substrates. Conclusions Shifts in gut bacterial diversity and composition associated with iron treatment are pronounced in IBD participants. Despite similar clinical outcome, oral administration differentially affects bacterial phylotypes and faecal metabolites compared with IV therapy. Trial registration number clinicaltrial.gov (NCT01067547). PMID:26848182

Genetics Home Reference: familial porencephaly

MedlinePlus

... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

A type IV burst associated with a coronal streamer disruption event

NASA Technical Reports Server (NTRS)

Kundu, M. R.

1987-01-01

A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

Noninvasive in situ evaluation of osteogenic differentiation by time-resolved laser-induced fluorescence spectroscopy.

PubMed

Ashjian, Peter; Elbarbary, Amir; Zuk, Patricia; DeUgarte, Daniel A; Benhaim, Prosper; Marcu, Laura; Hedrick, Marc H

2004-01-01

The clinical implantation of bioengineered tissues requires an in situ nondestructive evaluation of the quality of tissue constructs developed in vitro before transplantation. Time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) is demonstrated here to noninvasively monitor the formation of osteogenic extracellular matrix (ECM) produced by putative stem cells (PLA cells) derived from human adipose tissue. We show that this optical spectroscopy technique can assess the relative expression of collagens (types I, III, IV, and V) within newly forming osteogenic ECM. The results are consistent with those obtained by conventional histochemical techniques (immunofluorescence and Western blot) and demonstrate that TR-LIFS is a potential tool for monitoring the expression of distinct collagen types and the formation of collagen cross-links in intact tissue constructs.

Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

MedlinePlus

... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

viking: identification and characterization of a second type IV collagen in Drosophila.

PubMed

Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

1997-10-01

We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

STRUCTURE OF THE VIBRIO CHOLERAE TYPE IVB PILUS AND STABILITY COMPARISON WITH THE NEISSERIA GONORRHOEAE TYPE IVA PILUS

PubMed Central

Li, Juliana; Egelman, Edward H.; Craig, Lisa

2012-01-01

Type IV pili are multifunctional filaments displayed on many bacterial pathogens. Members of the Type IVa pilus subclass are found on a diverse group of human pathogens whereas Type IVb pili are almost exclusively on enteric bacteria. The Type IVa and IVb subclasses are distinguished by differences in the pilin subunits, including the fold of the globular domain. To understand the implications of the distinct pilin folds we compared the stabilities of pilin subunits and pilus filaments for the Type IVa GC pilus from Neisseria gonorrhoeae and the Type IVb toxin-coregulated pilus (TCP) from Vibrio cholerae. We show that while recombinant TCP pilin is more stable than GC pilin, the GC pili are more resistant than TCP to proteolysis, heat and chemical denaturation, remaining intact in 8 M urea. To understand these differences we determined the TCP structure by electron microscopy and 3D image reconstruction. TCP have a similar architecture to GC pili, with subunits arranged in a right-handed one-start helix and related by an 8.4 Å axial rise and a 96.8° azimuthal rotation. However, the TCP subunits are not as tightly packed as GC pilins and the distinct Type IVb pilin fold exposes a segment of the α-helical core of TCP. Hydrophobic interactions dominate for both pilus subtypes, but base-stacking by aromatic residues conserved among the Type IVa pilins may contribute to GC pilus stability. The extraordinary stability of GC pili may represent an adaptation of the Type IVa pili to harsh environments and the need to retract against external forces. PMID:22361030

Three-dimensional epithelial tissues generated from human embryonic stem cells.

PubMed

Hewitt, Kyle J; Shamis, Yulia; Carlson, Mark W; Aberdam, Edith; Aberdam, Daniel; Garlick, Jonathan A

2009-11-01

The use of pluripotent human embryonic stem (hES) cells for tissue engineering may provide advantages over traditional sources of progenitor cells because of their ability to give rise to multiple cell types and their unlimited expansion potential. We derived cell populations with properties of ectodermal and mesenchymal cells in two-dimensional culture and incorporated these divergent cell populations into three-dimensional (3D) epithelial tissues. When grown in specific media and substrate conditions, two-dimensional cultures were enriched in cells (EDK1) with mesenchymal morphology and surface markers. Cells with a distinct epithelial morphology (HDE1) that expressed cytokeratin 12 and beta-catenin at cell junctions became the predominant cell type when EDK1 were grown on surfaces enriched in keratinocyte-derived extracellular matrix proteins. When these cells were incorporated into the stromal and epithelial tissue compartments of 3D tissues, they generated multilayer epithelia similar to those generated with foreskin-derived epithelium and fibroblasts. Three-dimensional tissues demonstrated stromal cells with morphologic features of mature fibroblasts, type IV collagen deposition in the basement membrane, and a stratified epithelium that expressed cytokeratin 12. By deriving two distinct cell lineages from a common hES cell source to fabricate complex tissues, it is possible to explore environmental cues that will direct hES-derived cells toward optimal tissue form and function.

Localization of extracellular matrix components in developing mouse salivary glands by confocal microscopy

NASA Technical Reports Server (NTRS)

Hardman, P.; Spooner, B. S.

1992-01-01

The importance of the extracellular matrix (ECM) in epithelial-mesenchymal interactions in developing organisms is well established. Proteoglycans and interstitial collagens are required for the growth, morphogenesis, and differentiation of epithelial organs and the distribution of these molecules has been described. However, much less is known about other ECM macromolecules in developing epithelial organs. We used confocal microscopy to examine the distribution of laminin, heparan sulfate (BM-1) proteoglycan, fibronectin, and collagen types I, IV, and V, in mouse embryonic salivary glands. Organ rudiments were isolated from gestational day 13 mouse embryos and cultured for 24, 48, or 72 hours. Whole mounts were stained by indirect immunofluorescence and then examined using a Zeiss Laser Scan Microscope. We found that each ECM component examined had a distinct distribution and that the distribution of some molecules varied with culture time. Laminin was mainly restricted to the basement membrane. BM-1 proteoglycan was concentrated in the basement membrane and also formed a fine network throughout the mesenchyme. Type IV collagen was mainly located in the basement membrane of the epithelium, but it was also present throughout the mesenchyme. Type V collagen was distributed throughout the mesenchyme at 24 hours, but at 48 hours was principally located in the basement membrane. Type I collagen was distributed throughout the mesenchyme at all culture times, and accumulated in the clefts and particularly at the epithelial-mesenchymal interface as time in culture increased. Fibronectin was observed throughout the mesenchyme at all times.

Quantitative Proteome Analysis Reveals Increased Content of Basement Membrane Proteins in Arteries From Patients With Type 2 Diabetes Mellitus and Lower Levels Among Metformin Users.

PubMed

Preil, Simone A R; Kristensen, Lars P; Beck, Hans C; Jensen, Pia S; Nielsen, Patricia S; Steiniche, Torben; Bjørling-Poulsen, Marina; Larsen, Martin R; Hansen, Maria L; Rasmussen, Lars M

2015-10-01

The increased risk of cardiovascular diseases in type 2 diabetes mellitus has been extensively documented, but the origins of the association remain largely unknown. We sought to determine changes in protein expressions in arterial tissue from patients with type 2 diabetes mellitus and moreover hypothesized that metformin intake influences the protein composition. We analyzed nonatherosclerotic repair arteries gathered at coronary bypass operations from 30 patients with type 2 diabetes mellitus and from 30 age- and sex-matched nondiabetic individuals. Quantitative proteome analysis was performed by isobaric tag for relative and absolute quantitation-labeling and liquid chromatography-mass spectrometry, tandem mass spectrometry analysis on individual arterial samples. The amounts of the basement membrane components, α1-type IV collagen and α2-type IV collagen, γ1-laminin and β2-laminin, were significantly increased in patients with diabetes mellitus. Moreover, the expressions of basement membrane components and other vascular proteins were significantly lower among metformin users when compared with nonusers. Patients treated with or without metformin had similar levels of hemoglobin A1c, cholesterol, and blood pressure. In addition, quantitative histomorphometry showed increased area fractions of collagen-stainable material in tunica intima and media among patients with diabetes mellitus. The distinct accumulation of arterial basement membrane proteins in type 2 diabetes mellitus discloses a similarity between the diabetic macroangiopathy and microangiopathy and suggests a molecular explanation behind the alterations in vascular remodeling, biomechanical properties, and aneurysm formation described in diabetes mellitus. The lower amounts of basement membrane components in metformin-treated individuals are compatible with the hypothesis of direct beneficial drug effects on the matrix composition in the vasculature. © 2015 American Heart Association, Inc.

AHA classification of coronary and carotid atherosclerotic plaques by grating-based phase-contrast computed tomography.

PubMed

Hetterich, Holger; Webber, Nicole; Willner, Marian; Herzen, Julia; Birnbacher, Lorenz; Hipp, Alexander; Marschner, Mathias; Auweter, Sigrid D; Habbel, Christopher; Schüller, Ulrich; Bamberg, Fabian; Ertl-Wagner, Birgit; Pfeiffer, Franz; Saam, Tobias

2016-09-01

To evaluate the potential of grating-based phase-contrast computed-tomography (gb-PCCT) to classify human carotid and coronary atherosclerotic plaques according to modified American Heart Association (AHA) criteria. Experiments were carried out at a laboratory-based set-up consisting of X-ray tube (40 kVp), grating-interferometer and detector. Eighteen human carotid and coronary artery specimens were examined. Histopathology served as the standard of reference. Vessel cross-sections were classified as AHA lesion type I/II, III, IV/V, VI, VII or VIII plaques by two independent reviewers blinded to histopathology. Conservative measurements of diagnostic accuracies for the detection and differentiation of plaque types were evaluated. A total of 127 corresponding gb-PCCT/histopathology sections were analyzed. Based on histopathology, lesion type I/II was present in 12 (9.5 %), III in 18 (14.2 %), IV/V in 38 (29.9 %), VI in 16 (12.6 %), VII in 34 (26.8 %) and VIII in 9 (7.0 %) cross-sections. Sensitivity, specificity and positive and negative predictive value were ≥0.88 for most analyzed plaque types with a good level of agreement (Cohen's kappa = 0.90). Overall, results were better in carotid (kappa = 0.97) than in coronary arteries (kappa = 0.85). Inter-observer agreement was high with kappa = 0.85, p < 0.0001. These results indicate that gb-PCCT can reliably classify atherosclerotic plaques according to modified AHA criteria with excellent agreement to histopathology. • Different atherosclerotic plaque types display distinct morphological features in phase-contrast CT. • Phase-contrast CT can detect and differentiate AHA plaque types. • Calcifications caused streak artefacts and reduced sensitivity in type VI lesions. • Overall agreement was higher in carotid than in coronary arteries.

Community-associated and healthcare-associated methicillin-resistant Staphylococcus aureus virulence toward Caenorhabditis elegans compared.

PubMed

Day, Shandra R; Moore, Christopher M; Kundzins, John R; Sifri, Costi D

2012-11-15

Community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) strains have emerged as major human pathogens. CA-MRSA virulence appears to be distinct from healthcare-associated (HA) MRSA with several factors [α-hemolysin (Hla), Panton-Valentine leukocidin (PVL), α-type phenol soluble modulins (PSMα) and SCCmec IV] postulated to enhance virulence or fitness. Using the Caenorhabditis elegans infection model, we compared the virulence of clinical and laboratory isolates of CA-MRSA and HA-MRSA and explored the contribution of CA-MRSA associated virulence factors to nematode killing. All CA-MRSA strains were highly pathogenic to nematodes, while HA-MRSA strains demonstrated variable nematode killing. Nematode killing by isogenic mutants of hla or the loci for PVL, PSMα, PSMβ, PSMδ or SCCmec IV was not different than the parental strains. These results demonstrate that CA-MRSA is highly virulent, shows some strains of HA-MRSA are equally virulent toward nematodes and suggests CA-MRSA virulence in C. elegans is not linked to a single virulence factor.

Community-associated and healthcare-associated methicillin-resistant Staphylococcus aureus virulence toward Caenorhabditis elegans compared

PubMed Central

Day, Shandra R.; Moore, Christopher M.; Kundzins, John R.; Sifri, Costi D.

2012-01-01

Community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) strains have emerged as major human pathogens. CA-MRSA virulence appears to be distinct from healthcare-associated (HA) MRSA with several factors [α-hemolysin (Hla), Panton-Valentine leukocidin (PVL), α-type phenol soluble modulins (PSMα) and SCCmec IV] postulated to enhance virulence or fitness. Using the Caenorhabditis elegans infection model, we compared the virulence of clinical and laboratory isolates of CA-MRSA and HA-MRSA and explored the contribution of CA-MRSA associated virulence factors to nematode killing. All CA-MRSA strains were highly pathogenic to nematodes, while HA-MRSA strains demonstrated variable nematode killing. Nematode killing by isogenic mutants of hla or the loci for PVL, PSMα, PSMβ, PSMδ or SCCmec IV was not different than the parental strains. These results demonstrate that CA-MRSA is highly virulent, shows some strains of HA-MRSA are equally virulent toward nematodes and suggests CA-MRSA virulence in C. elegans is not linked to a single virulence factor. PMID:23076331

Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

PubMed Central

Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

1994-01-01

Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

Genetically distinct genogroup IV norovirus strains identified in wastewater.

PubMed

Kitajima, Masaaki; Rachmadi, Andri T; Iker, Brandon C; Haramoto, Eiji; Gerba, Charles P

2016-12-01

We investigated the prevalence and genetic diversity of genogroup IV norovirus (GIV NoV) strains in wastewater in Arizona, United States, over a 13-month period. Among 50 wastewater samples tested, GIV NoVs were identified in 13 (26 %) of the samples. A total of 47 different GIV NoV strains were identified, which were classified into two genetically distinct clusters: the GIV.1 human cluster and a unique genetic cluster closely related to strains previously identified in Japanese wastewater. The results provide additional evidence of the considerable genetic diversity among GIV NoV strains through the analysis of wastewater containing virus strains shed from all populations.

Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

MedlinePlus

... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

PubMed

McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

2014-10-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

PubMed Central

McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

2014-01-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

PubMed Central

Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

2014-01-01

Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

Construct and Differential Item Functioning in the Assessment of Prescription Opioid Use Disorders among American Adolescents

ERIC Educational Resources Information Center

Wu, Li-Tzy; Ringwalt, Christopher L.; Yang, Chongming; Reeve, Bryce B.; Pan, Jeng-Jong; Blazer, Dan G.

2009-01-01

DSM-IV's hierarchical distinction between abuse of and dependence on prescription opioids is not supported since the symptoms of abuse in adolescents are not less severe than dependence. The finding is based on the examination of the DSM-IV criteria for opioid use disorders using item response theory.

Qualitative or Quantitative Differences between Asperger's Disorder and Autism? Historical Considerations

ERIC Educational Resources Information Center

Sanders, James Ladell

2009-01-01

The histories of autism and Asperger's Disorder (AD), based on original contributions by Kanner and Asperger, are reviewed in relation to DSM-IV diagnostic criteria. Their original articles appear to have influenced the distinction between AD and autism made in the DSM-IV. Based on up-to-date empirical research, however, it appears that AD and…

Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

PubMed Central

Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

2011-01-01

Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

Analysis of the bacterial community in aged and aging pit mud of Chinese Luzhou-flavour liquor by combined PCR-DGGE and quantitative PCR assay.

PubMed

Liang, Huipeng; Li, Wenfang; Luo, Qingchun; Liu, Chaolan; Wu, Zhengyun; Zhang, Wenxue

2015-10-01

The community structure of bacteria in aged and aging pit mud, which was judged according to their sensory and physicochemical characteristics, was analysed using polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and quantitative real-time PCR (qPCR). The phyla Firmicutes, Actinobacteria, Proteobacteria, Synergistetes and Unclassified Bacteria were detected and the fermentative Firmicutes was predominant in both types of pit mud in the PCR-DGGE analysis. Among Firmicutes, Clostridiales was dominant in aged pit mud while Bacillales and Lactobacillales were dominant in aging pit mud. The diversity of bacterial communities in aged pit mud was higher than that in aging pit mud. In the qPCR analysis the abundance of Clostridium IV in aged pit mud was higher than that in aging pit mud and there were significant differences in the quantity of Clostridium IV between aged and aging pit mud of the same cellar (P < 0.05). There were some significant differences in the microbial community structure between aged and aging pit mud. The differences in the quantity of Clostridium IV might be involved in the distinction that the aged pit mud has a strong aroma while the aging pit mud does not. © 2014 Society of Chemical Industry.

Bartonella and Brucella—Weapons and Strategies for Stealth Attack

PubMed Central

Ben-Tekaya, Houchaima; Gorvel, Jean-Pierre; Dehio, Christoph

2013-01-01

Bartonella spp. and Brucella spp. are closely related α-proteobacterial pathogens that by distinct stealth-attack strategies cause chronic infections in mammals including humans. Human infections manifest by a broad spectrum of clinical symptoms, ranging from mild to fatal disease. Both pathogens establish intracellular replication niches and subvert diverse pathways of the host’s immune system. Several virulence factors allow them to adhere to, invade, proliferate, and persist within various host-cell types. In particular, type IV secretion systems (T4SS) represent essential virulence factors that transfer effector proteins tailored to recruit host components and modulate cellular processes to the benefit of the bacterial intruders. This article puts the remarkable features of these two pathogens into perspective, highlighting the mechanisms they use to hijack signaling and trafficking pathways of the host as the basis for their stealthy infection strategies. PMID:23906880

Protein Kinase LegK2 Is a Type IV Secretion System Effector Involved in Endoplasmic Reticulum Recruitment and Intracellular Replication of Legionella pneumophila ▿

PubMed Central

Hervet, Eva; Charpentier, Xavier; Vianney, Anne; Lazzaroni, Jean-Claude; Gilbert, Christophe; Atlan, Danièle; Doublet, Patricia

2011-01-01

Legionella pneumophila is the etiological agent of Legionnaires' disease. Crucial to the pathogenesis of this intracellular pathogen is its ability to subvert host cell defenses, permitting intracellular replication in specialized vacuoles within host cells. The Dot/Icm type IV secretion system (T4SS), which translocates a large number of bacterial effectors into host cell, is absolutely required for rerouting the Legionella phagosome. Many Legionella effectors display distinctive eukaryotic domains, among which are protein kinase domains. In silico analysis and in vitro phosphorylation assays identified five functional protein kinases, LegK1 to LegK5, encoded by the epidemic L. pneumophila Lens strain. Except for LegK5, the Legionella protein kinases are all T4SS effectors. LegK2 plays a key role in bacterial virulence, as demonstrated by gene inactivation. The legK2 mutant containing vacuoles displays less-efficient recruitment of endoplasmic reticulum markers, which results in delayed intracellular replication. Considering that a kinase-dead substitution mutant of legK2 exhibits the same virulence defects, we highlight here a new molecular mechanism, namely, protein phosphorylation, developed by L. pneumophila to establish a replicative niche and evade host cell defenses. PMID:21321072

Cloning, expression, and functional analysis of molecular motor pilT and pilU genes of type IV pili in Acidithiobacillus ferrooxidans.

PubMed

Li, Yongquan; Huang, Shuangsheng; Zhang, Xiaosu; Huang, Tao; Li, Hongyu

2013-02-01

PilT is a hexameric ATPase required for type IV pili (Tfp) retraction in gram-negative bacterium. Retraction of Tfp mediates intimate attachment and motility on inorganic solid surfaces. We investigated the cloning and expression of pilT and pilU genes of Acidithiobacillus ferrooxidans strains ATCC 23270, and the results indicate that PilT and PilU contain the canonical conserved AIRNLIRE and GMQTXXXXLXXL motifs that are the characteristic motifs of the PilT protein family; PilT and PilU also contain the canonical nucleotide-binding motifs, named with Walker A box (GxxGxGKT/S) and Walker B box (hhhhDE), respectively. The pilT and pilU genes were expressed to produce 37.1- and 42.0-kDa proteins, respectively, and co-transcribed induced by 10 % mineral powder. However, ATPase activity of PilT was distinctly higher than those of PilU. These results indicated that the PilT protein was the real molecular motor of Tfp, while PilU could play a key role in the assembly, modification, and twitching motility of Tfp in A. ferrooxidans. However, PilT and PilU were nonetheless interrelated in the forming and function of the molecular motor of Tfp.

Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

PubMed

Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

2015-09-01

To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

PubMed

Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

2018-07-01

Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

2010-04-20

Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

A review of current evidence regarding the ICD-11 proposals for diagnosing PTSD and complex PTSD.

PubMed

Brewin, Chris R; Cloitre, Marylène; Hyland, Philip; Shevlin, Mark; Maercker, Andreas; Bryant, Richard A; Humayun, Asma; Jones, Lynne M; Kagee, Ashraf; Rousseau, Cécile; Somasundaram, Daya; Suzuki, Yuriko; Wessely, Simon; van Ommeren, Mark; Reed, Geoffrey M

2017-12-01

The World Health Organization's proposals for posttraumatic stress disorder (PTSD) in the 11th edition of the International Classification of Diseases, scheduled for release in 2018, involve a very brief set of symptoms and a distinction between two sibling disorders, PTSD and Complex PTSD. This review of studies conducted to test the validity and implications of the diagnostic proposals generally supports the proposed 3-factor structure of PTSD symptoms, the 6-factor structure of Complex PTSD symptoms, and the distinction between PTSD and Complex PTSD. Estimates derived from DSM-based items suggest the likely prevalence of ICD-11 PTSD in adults is lower than ICD-10 PTSD and lower than DSM-IV or DSM-5 PTSD, but this may change with the development of items that directly measure the ICD-11 re-experiencing requirement. Preliminary evidence suggests the prevalence of ICD-11 PTSD in community samples of children and adolescents is similar to DSM-IV and DSM-5. ICD-11 PTSD detects some individuals with significant impairment who would not receive a diagnosis under DSM-IV or DSM-5. ICD-11 CPTSD identifies a distinct group who have more often experienced multiple and sustained traumas and have greater functional impairment than those with PTSD. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cheiloscopy and blood groups: Aid in forensic identification.

PubMed

Karim, Bushra; Gupta, Devanand

2014-10-01

Every person has certain features that make them radically distinct from others. One such feature is lip prints. Lip prints remain the same throughout life and are uninfluenced by injuries, diseases, or environmental changes. Different individuals have specific blood groups according to the various antigen-antibody reactions in their bloodstream. To determine the distribution of different patterns of lip prints among subjects having different ABO and Rh blood groups. To determine the correlation between respective characteristics of subjects. In this study, lip prints were obtained from 122 subjects (62 males and 60 females), and associated blood-group matching was performed to determine the predominant lip print type and to determine any correlation between lip print types and blood groups. Tsuchihashi's classification of type I (complete vertical grooves), type I' (incomplete vertical grooves), type II (forking grooves), type III (intersecting grooves), type IV (reticular grooves), and type V (indeterminate grooves) was used to compare with the ABO and Rh blood grouping systems. No correlation was found between lip prints and blood groups. No significant correlation exists between blood group and lip prints. Lip prints play a vital role in identification because they are unique.

Structural basis for the neutralization and genotype specificity of hepatitis E virus.

PubMed

Tang, Xuhua; Yang, Chunyan; Gu, Ying; Song, Cuiling; Zhang, Xiao; Wang, Yingbin; Zhang, Jun; Hew, Choy Leong; Li, Shaowei; Xia, Ningshao; Sivaraman, J

2011-06-21

Hepatitis E virus (HEV) causes acute hepatitis in humans, predominantly by contamination of food and water, and is characterized by jaundice and flu-like aches and pains. To date, no vaccines are commercially available to prevent the disease caused by HEV. Previously, we showed that a monoclonal antibody, 8C11, specifically recognizes a neutralizing conformational epitope on HEV genotype I. The antibody 8C11 blocks the virus-like particle from binding to and penetrating the host cell. Here, we report the complex crystal structure of 8C11 Fab with HEV E2s(I) domain at 1.9 Å resolution. The 8C11 epitopes on E2s(I) were identified at Asp(496)-Thr(499), Val(510)-Leu(514), and Asn(573)-Arg(578). Mutations and cell-model assays identified Arg(512) as the most crucial residue for 8C11 interaction with and neutralization of HEV. Interestingly, 8C11 specifically neutralizes HEV genotype I, but not the other genotypes. Because HEV type I and IV are the most abundant genotypes, to understand this specificity further we determined the structure of E2s(IV) at 1.79 Å resolution and an E2s(IV) complex with 8C11 model was generated. The comparison between the 8C11 complexes with type I and IV revealed the key residues that distinguish these two genotypes. Of particular interest, the residue at amino acid position 497 at the 8C11 epitope region of E2s is distinct among these two genotypes. Swapping this residue from one genotype to another inversed the 8C11 reactivity, demonstrating the essential role played by amino acid 497 in the genotype recognition. These studies may lead to the development of antibody-based drugs for the specific treatment against HEV.

Essential core of the Hawking–Ellis types

NASA Astrophysics Data System (ADS)

Martín-Moruno, Prado; Visser, Matt

2018-06-01

The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

Hypochondriasis and somatization: two distinct aspects of somatoform disorders?

PubMed

Leibbrand, R; Hiller, W; Fichter, M M

2000-01-01

We investigated boundaries and overlap between somatization and hypochondriasis on different levels of psychopathology: (1) comorbidity between hypochondriasis and somatization on the level of diagnoses in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV; American Psychiatric Association, 1994): (2) comorbidity with other mental disorders; (3) differences in clinical characteristics: and (4) overlap on the level of psychometric measures. The sample consisted of 120 psycho somatic inpatients. Somatoform, hypochondriacal, and depressive symptomatology, cognitions about body and health, and further aspects of general symptomatology were investigated. Diagnoses of Axis I and II were based on DSM-IV Our results suggest a large overlap on the level of DSM-IV-diagnoses: only 3 of 31 hypochondriacal patients had no multiple somatoform symptoms, while 58 of 86 patients with multiple somatoform symptoms had no hypochondriasis. However, the overlap between hypochondriacal and somatization symptomatology on the level of psychometric measurement is only moderate, indicating that hypochondriasis is a markedly distinct aspect of somatoform disorders.

Towards a new classification of stable phase schizophrenia into major and simple neuro-cognitive psychosis: Results of unsupervised machine learning analysis.

PubMed

Kanchanatawan, Buranee; Sriswasdi, Sira; Thika, Supaksorn; Stoyanov, Drozdstoy; Sirivichayakul, Sunee; Carvalho, André F; Geffard, Michel; Maes, Michael

2018-05-23

Deficit schizophrenia, as defined by the Schedule for Deficit Syndrome, may represent a distinct diagnostic class defined by neurocognitive impairments coupled with changes in IgA/IgM responses to tryptophan catabolites (TRYCATs). Adequate classifications should be based on supervised and unsupervised learning rather than on consensus criteria. This study used machine learning as means to provide a more accurate classification of patients with stable phase schizophrenia. We found that using negative symptoms as discriminatory variables, schizophrenia patients may be divided into two distinct classes modelled by (A) impairments in IgA/IgM responses to noxious and generally more protective tryptophan catabolites, (B) impairments in episodic and semantic memory, paired associative learning and false memory creation, and (C) psychotic, excitation, hostility, mannerism, negative, and affective symptoms. The first cluster shows increased negative, psychotic, excitation, hostility, mannerism, depression and anxiety symptoms, and more neuroimmune and cognitive disorders and is therefore called "major neurocognitive psychosis" (MNP). The second cluster, called "simple neurocognitive psychosis" (SNP) is discriminated from normal controls by the same features although the impairments are less well developed than in MNP. The latter is additionally externally validated by lowered quality of life, body mass (reflecting a leptosome body type), and education (reflecting lower cognitive reserve). Previous distinctions including "type 1" (positive)/"type 2" (negative) and DSM-IV-TR (eg, paranoid) schizophrenia could not be validated using machine learning techniques. Previous names of the illness, including schizophrenia, are not very adequate because they do not describe the features of the illness, namely, interrelated neuroimmune, cognitive, and clinical features. Stable-phase schizophrenia consists of 2 relevant qualitatively distinct categories or nosological entities with SNP being a less well-developed phenotype, while MNP is the full blown phenotype or core illness. Major neurocognitive psychosis and SNP should be added to the DSM-5 and incorporated into the Research Domain Criteria project. © 2018 John Wiley & Sons, Ltd.

Behavior outcome after ischemic and hemorrhagic stroke, with similar brain damage, in rats.

PubMed

Mestriner, Régis Gemerasca; Miguel, Patrícia Maidana; Bagatini, Pamela Brambilla; Saur, Lisiani; Boisserand, Lígia Simões Braga; Baptista, Pedro Porto Alegre; Xavier, Léder Leal; Netto, Carlos Alexandre

2013-05-01

Stroke causes disability and mortality worldwide and is divided into ischemic and hemorrhagic subtypes. Although clinical trials suggest distinct recovery profiles for ischemic and hemorrhagic events, this is not conclusive due to stroke heterogeneity. The aim of this study was to produce similar brain damage, using experimental models of ischemic (IS) and hemorrhagic (HS) stroke and evaluate the motor spontaneous recovery profile. We used 31 Wistar rats divided into the following groups: Sham (n=7), ischemic (IS) (n=12) or hemorrhagic (HS) (n=12). Brain ischemia or hemorrhage was induced by endotelin-1 (ET-1) and collagenase type IV-S (collagenase) microinjections, respectively. All groups were evaluated in the open field, cylinder and ladder walk behavioral tests at distinct time points as from baseline to 30 days post-surgery (30 PS). Histological and morphometric analyses were used to assess the volume of lost tissue and lesion length. Present results reveal that both forms of experimental stroke had a comparable long-term pattern of damage, since no differences were found in volume of tissue lost or lesion size 30 days after surgery. However, behavioral data showed that hemorrhagic rats were less impaired at skilled walking than ischemic ones at 15 and 30 days post-surgery. We suggest that experimentally comparable stroke design is useful because it reduces heterogeneity and facilitates the assessment of neurobiological differences related to stroke subtypes; and that spontaneous skilled walking recovery differs between experimental ischemic and hemorrhagic insults. Copyright © 2013 Elsevier B.V. All rights reserved.

Sedimentologic and Geometric Characterization of Turbidites of Brazos-Trinity Basin IV in the Gulf of Mexico: Preliminary Results of IODP Expedition 308

NASA Astrophysics Data System (ADS)

Gutierrez-Pastor, J.; Pirmez, C.; Flemings, P. B.; Behrmann, J. H.; John, C. M.

2005-12-01

Brazos Trinity Basin IV is located about 200 km offshore Texas, and belongs to a linked system of four intra slope mini basins. Basin IV provides a type section to characterize turbidites in salt withdrawal mini-basins of the Gulf of Mexico. IODP Expedition 308 has cored and logged complete pre-fan and fan sequences that are clearly distinguished with high-resolution seismic profiles at Brazos Trinity Basin IV at Sites U1319, U1320 and U1321. Seismically imaged pre-fan and fan units also can be distinguished and correlated with the sedimentological and logging data. Turbidite facies display distinct properties in terms of grain size, bed thickness, color, organic matter content, vertical organization of beds and lateral distribution in all the units of the fan through the basin. The pre-fan sequence is composed of terrigenous laminated clay with color banding and it is interpreted to result from deposition from fluvial plumes and/or muddy turbidity currents overspilling from basins upstream of Basin IV. The lower fan is characterized by laminated and bioturbated muds with thin beds of silt and sand, and represent the initial infill of the basin by mostly muddy turbidity currents, although an exceptionally sand-rich unit occurs at the base of the lower fan. The middle and upper fan represent the main pulses of turbidity current influx into Basin IV, and contain fine to medium sand turbidite beds organized in packets ranging in thickness from 5 to 25 m. The middle fan displays an overall upward increase in sand content at Site U1320, suggesting increased flow by-pass from the updip basins through time. Key examples of turbidites from each fan unit are analysed in detail to infer the depositional processes and infilling history of Brazos-Trinity Basin IV. The study of turbidites in a calibrated basin such as Basin IV provides ground truth for the sedimentological processes and resultant seismic facies, which can be used to interpret the infill history of other intraslope basins with similar seismic facies in the Gulf of Mexico where well calibration is not available.

Identification of novel mammalian hosts and Brazilian biome geographic distribution of Trypanosoma cruzi TcIII and TcIV.

PubMed

Barros, Juliana Helena S; Xavier, Samanta Cristina C; Bilac, Daniele; Lima, Valdirene Santos; Dario, Maria Augusta; Jansen, Ana Maria

2017-08-01

Trypanosoma cruzi is a parasitic protozoan responsible for Chagas disease. Seven different Discrete Typing Units (DTUs) of T. cruzi are currently identified in nature: TcI-TcVI, and TcBat whose distribution patterns in nature, hosts/reservoirs and eco-epidemiological importance are still little known. Here, we present novel data on the geographic distribution and diversity of mammalian hosts and vectors of T. cruzi DTUs TcIII and TcIV. In this study, we analyzed 61 T. cruzi isolates obtained from 18 species of mammals (five orders) and two Hemiptera genera. Samples were collected from five Brazilian biomes (Pantanal, Caatinga, Cerrado, Atlantic Rainforest, and Amazon) previously characterized as Z3 or mixed infection (TcI-Z3) by mini-exon gene PCR. To identify TcIII and TcIV genotypes, we applied restriction fragment length polymorphism analysis to the PCR-amplified histone 3 gene. DTUs TcIII and TcIV were identified in single and mixed infections from wide dispersion throughout five Brazilian biomes studied, with TcIV being the most common. Pantanal was the biome that displayed the largest number of samples characterized as TcIII and TcIV in single and mixed infections, followed by Atlantic Rainforest and Amazon. Species from the Didelphimorphia order displayed the highest frequency of infection and were found in all five biomes. We report, for the first time, the infection of a species of the Artiodactyla order by DTU TcIII. In addition, we describe new host species: five mammals (marsupials and rodents) and two genera of Hemiptera. Our data indicate that DTUs TcIII and TcIV are more widespread and infect a larger number of mammalian species than previously thought. In addition, they are transmitted in restricted foci and cycles, but in different microhabitats and areas with distinct ecological profiles. Finally, we show that DTUs TcIII and TcIV do not present any specific association with biomes or host species. Copyright © 2017. Published by Elsevier B.V.

Discriminatory Indices of Typing Methods for Epidemiologic Analysis of Contemporary Staphylococcus aureus Strains.

PubMed

Rodriguez, Marcela; Hogan, Patrick G; Satola, Sarah W; Crispell, Emily; Wylie, Todd; Gao, Hongyu; Sodergren, Erica; Weinstock, George M; Burnham, Carey-Ann D; Fritz, Stephanie A

2015-09-01

Historically, a number of typing methods have been evaluated for Staphylococcus aureus strain characterization. The emergence of contemporary strains of community-associated S. aureus, and the ensuing epidemic with a predominant strain type (USA300), necessitates re-evaluation of the discriminatory power of these typing methods for discerning molecular epidemiology and transmission dynamics, essential to investigations of hospital and community outbreaks. We compared the discriminatory index of 5 typing methods for contemporary S. aureus strain characterization. Children presenting to St. Louis Children's Hospital and community pediatric practices in St. Louis, Missouri (MO), with community-associated S. aureus infections were enrolled. Repetitive sequence-based PCR (repPCR), pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), staphylococcal protein A (spa), and staphylococcal cassette chromosome (SCC) mec typing were performed on 200 S. aureus isolates. The discriminatory index of each method was calculated using the standard formula for this metric, where a value of 1 is highly discriminatory and a value of 0 is not discriminatory. Overall, we identified 26 distinct strain types by repPCR, 17 strain types by PFGE, 30 strain types by MLST, 68 strain types by spa typing, and 5 strain types by SCCmec typing. RepPCR had the highest discriminatory index (D) of all methods (D = 0.88), followed by spa typing (D = 0.87), MLST (D = 0.84), PFGE (D = 0.76), and SCCmec typing (D = 0.60). The method with the highest D among MRSA isolates was repPCR (D = 0.64) followed by spa typing (D = 0.45) and MLST (D = 0.44). The method with the highest D among MSSA isolates was spa typing (D = 0.98), followed by MLST (D = 0.93), repPCR (D = 0.92), and PFGE (D = 0.89). Among isolates designated USA300 by PFGE, repPCR was most discriminatory, with 10 distinct strain types identified (D = 0.63). We identified 45 MRSA isolates which were classified as identical by PFGE, MLST, spa typing, and SCCmec typing (USA300, ST8, t008, SCCmec IV, respectively); within this collection, there were 5 distinct strain types identified by repPCR. The typing methods yielded comparable discriminatory power for S. aureus characterization overall; when discriminating among USA300 isolates, repPCR retained the highest discriminatory power. This property is advantageous for investigations conducted in the era of contemporary S. aureus infections.

Discriminatory Indices of Typing Methods for Epidemiologic Analysis of Contemporary Staphylococcus aureus Strains

PubMed Central

Rodriguez, Marcela; Hogan, Patrick G.; Satola, Sarah W.; Crispell, Emily; Wylie, Todd; Gao, Hongyu; Sodergren, Erica; Weinstock, George M.; Burnham, Carey-Ann D.; Fritz, Stephanie A.

2015-01-01

Abstract Historically, a number of typing methods have been evaluated for Staphylococcus aureus strain characterization. The emergence of contemporary strains of community-associated S. aureus, and the ensuing epidemic with a predominant strain type (USA300), necessitates re-evaluation of the discriminatory power of these typing methods for discerning molecular epidemiology and transmission dynamics, essential to investigations of hospital and community outbreaks. We compared the discriminatory index of 5 typing methods for contemporary S. aureus strain characterization. Children presenting to St. Louis Children's Hospital and community pediatric practices in St. Louis, Missouri (MO), with community-associated S. aureus infections were enrolled. Repetitive sequence-based PCR (repPCR), pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), staphylococcal protein A (spa), and staphylococcal cassette chromosome (SCC) mec typing were performed on 200 S. aureus isolates. The discriminatory index of each method was calculated using the standard formula for this metric, where a value of 1 is highly discriminatory and a value of 0 is not discriminatory. Overall, we identified 26 distinct strain types by repPCR, 17 strain types by PFGE, 30 strain types by MLST, 68 strain types by spa typing, and 5 strain types by SCCmec typing. RepPCR had the highest discriminatory index (D) of all methods (D = 0.88), followed by spa typing (D = 0.87), MLST (D = 0.84), PFGE (D = 0.76), and SCCmec typing (D = 0.60). The method with the highest D among MRSA isolates was repPCR (D = 0.64) followed by spa typing (D = 0.45) and MLST (D = 0.44). The method with the highest D among MSSA isolates was spa typing (D = 0.98), followed by MLST (D = 0.93), repPCR (D = 0.92), and PFGE (D = 0.89). Among isolates designated USA300 by PFGE, repPCR was most discriminatory, with 10 distinct strain types identified (D = 0.63). We identified 45 MRSA isolates which were classified as identical by PFGE, MLST, spa typing, and SCCmec typing (USA300, ST8, t008, SCCmec IV, respectively); within this collection, there were 5 distinct strain types identified by repPCR. The typing methods yielded comparable discriminatory power for S. aureus characterization overall; when discriminating among USA300 isolates, repPCR retained the highest discriminatory power. This property is advantageous for investigations conducted in the era of contemporary S. aureus infections. PMID:26376402

Observational properties of decameter type IV bursts

NASA Astrophysics Data System (ADS)

Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

2013-04-01

Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

Distinct Kynureninase and Hydroxykynureninase Activities in Microorganisms: Occurrence and Properties of a Single Physiologically Discrete Enzyme in Yeast

PubMed Central

Shetty, A. S.; Gaertner, F. H.

1973-01-01

(i) Saccharomyces cerevisiae grown in the presence of 1.0 mM l-tryptophan slowly excreted fluorescent material that was chromatographically identifiable as 3-hydroxyanthranilate but did not excrete detectable amounts of anthranilate nor rapidly deplete the medium of l-tryptophan. Under similar growth conditions, Neurospora crassa rapidly excretes anthranilate and rapidly depletes the medium of l-tryptophan. (ii) Chromatographic analysis of crude extracts from yeast revealed a single kynureninase-type enzyme whose synthesis was not measurably affected by the presence of tryptophan in the medium. Previous studies have provided evidence for two kynureninase-type enzymes in N. crassa, an inducible kynureninase and a constitutive hydroxykynureninase. (iii) Kinetic analysis of the partially purified yeast enzyme provided Michaelis constants for l-3-hydroxykynurenine and l-kynurenine of 6.7 × 10−6 and 5.4 × 10−4 M, respectively. This and other kinetic properties of the yeast enzyme are comparable to those reported for the constitutive enzyme from N. crassa. (iv) These findings suggest that S. cerevisiae has in common with N. crassa the biosynthetic enzyme hydroxykynureninase but lacks the catabolic enzyme kynureninase. Therefore, it can be predicted that, unlike N. crassa, S. cerevisiae does not carry out the tryptophan-anthranilate cycle. Distinct kynureninase-type enzymes may exist in other microorganisms and in mammals. PMID:4266242

A distinct type of cell in myocardium: interstitial Cajal-like cells (ICLCs)

PubMed Central

Kostin, S; Popescu, L M

2009-01-01

Abstract The existence of a novel type of interstitial cells in the heart, interstitial Cajal-like cells (ICLCs), had been described for the first time in 2005. Their identification was mainly based on ultrastructural criteria: very long (tens up to hundreds of micrometres) and moniliform prolongations, which are extremely thin (less than 0.2 μm), below the resolving power of light microscopy. Myocardial ICLCs were also identified by methylene-blue vital staining, silver impregnation, and immunoreactivity for CD 34, vimentin, CD117/c-kit, etc. Although a series of studies provided evidence for the existence of ICLCs in human atria and rat ventricles, further investigations in other laboratories, using additional techniques, are required to substantiate the consistency of these findings. Here we provide further evidence for the existence of ICLCs in human and mammalian hearts (by transmission and scanning electron microscopy, as well as confocal laser scanning microscopy). Noteworthy, we confirm that ICLCs communicate with neighbouring cells via shedding (micro)vesicles. Although these so-called ICLCs represent a distinct type of cells, different from classical interstitial cells of Cajal, or fibroblasts, their role(s) in myocardium remain(s) to be established. Several hypotheses are proposed: (i) adult stromal (mesenchymal) stem cells, which might participate in cardiac repair/remodelling; (ii) intercellular signalling (e.g. via shedding microvesicles); (iii) chemo-mechanical transducers and (iv) players in pacemaking and/or arrhytmogenesis, and so on. PMID:19183408

Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

PubMed

Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

2007-01-01

Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

Pseudomonas aeruginosa Pore-Forming Exolysin and Type IV Pili Cooperate To Induce Host Cell Lysis

PubMed Central

Basso, Pauline; Ragno, Michel; Elsen, Sylvie; Reboud, Emeline; Golovkine, Guillaume; Bouillot, Stephanie; Huber, Philippe; Lory, Stephen; Faudry, Eric

2017-01-01

ABSTRACT   Clinical strains of Pseudomonas aeruginosa lacking the type III secretion system genes employ a toxin, exolysin (ExlA), for host cell membrane disruption. Here, we demonstrated that ExlA export requires a predicted outer membrane protein, ExlB, showing that ExlA and ExlB define a new active two-partner secretion (TPS) system of P. aeruginosa. In addition to the TPS signals, ExlA harbors several distinct domains, which include one hemagglutinin domain, five arginine-glycine-aspartic acid (RGD) motifs, and a C-terminal region lacking any identifiable sequence motifs. However, this C-terminal region is important for the toxic activity, since its deletion abolishes host cell lysis. Using lipid vesicles and eukaryotic cells, including red blood cells, we demonstrated that ExlA has a pore-forming activity which precedes cell membrane disruption of nucleated cells. Finally, we developed a high-throughput cell-based live-dead assay and used it to screen a transposon mutant library of an ExlA-producing P. aeruginosa clinical strain for bacterial factors required for ExlA-mediated toxicity. The screen resulted in the identification of proteins involved in the formation of type IV pili as being required for ExlA to exert its cytotoxic activity by promoting close contact between bacteria and the host cell. These findings represent the first example of cooperation between a pore-forming toxin of the TPS family and surface appendages in host cell intoxication. PMID:28119472

Molecular Epidemiology of Human Oral Chagas Disease Outbreaks in Colombia

PubMed Central

Ramírez, Juan David; Montilla, Marleny; Cucunubá, Zulma M.; Floréz, Astrid Carolina; Zambrano, Pilar; Guhl, Felipe

2013-01-01

Background Trypanosoma cruzi, the causative agent of Chagas disease, displays significant genetic variability revealed by six Discrete Typing Units (TcI-TcVI). In this pathology, oral transmission represents an emerging epidemiological scenario where different outbreaks associated to food/beverages consumption have been reported in Argentina, Bolivia, Brazil, Ecuador and Venezuela. In Colombia, six human oral outbreaks have been reported corroborating the importance of this transmission route. Molecular epidemiology of oral outbreaks is barely known observing the incrimination of TcI, TcII, TcIV and TcV genotypes. Methodology and Principal Findings High-throughput molecular characterization was conducted performing MLMT (Multilocus Microsatellite Typing) and mtMLST (mitochondrial Multilocus Sequence Typing) strategies on 50 clones from ten isolates. Results allowed observing the occurrence of TcI, TcIV and mixed infection of distinct TcI genotypes. Thus, a majority of specific mitochondrial haplotypes and allelic multilocus genotypes associated to the sylvatic cycle of transmission were detected in the dataset with the foreseen presence of mitochondrial haplotypes and allelic multilocus genotypes associated to the domestic cycle of transmission. Conclusions These findings suggest the incrimination of sylvatic genotypes in the oral outbreaks occurred in Colombia. We observed patterns of super-infection and/or co-infection with a tailored association with the severe forms of myocarditis in the acute phase of the disease. The transmission dynamics of this infection route based on molecular epidemiology evidence was unraveled and the clinical and biological implications are discussed. PMID:23437405

Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

PubMed

Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

2014-01-01

Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

PubMed

Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

2017-08-01

SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

PubMed Central

Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

2009-01-01

Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

PubMed Central

Megli, Christina J.

2013-01-01

Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

SDSS-IV MaNGA: a distinct mass distribution explored in slow-rotating early-type galaxies

NASA Astrophysics Data System (ADS)

Rong, Yu; Li, Hongyu; Wang, Jie; Gao, Liang; Li, Ran; Ge, Junqiang; Jing, Yingjie; Pan, Jun; Fernández-Trincado, J. G.; Valenzuela, Octavio; Ortíz, Erik Aquino

2018-06-01

We study the radial acceleration relation (RAR) for early-type galaxies (ETGs) in the SDSS MaNGA MPL5 data set. The complete ETG sample show a slightly offset RAR from the relation reported by McGaugh et al. (2016) at the low-acceleration end; we find that the deviation is due to the fact that the slow rotators show a systematically higher acceleration relation than the McGaugh's RAR, while the fast rotators show a consistent acceleration relation to McGaugh's RAR. There is a 1σ significant difference between the acceleration relations of the fast and slow rotators, suggesting that the acceleration relation correlates with the galactic spins, and that the slow rotators may have a different mass distribution compared with fast rotators and late-type galaxies. We suspect that the acceleration relation deviation of slow rotators may be attributed to more galaxy merger events, which would disrupt the original spins and correlated distributions of baryons and dark matter orbits in galaxies.

Dominance-based ranking functions for interval-valued intuitionistic fuzzy sets.

PubMed

Chen, Liang-Hsuan; Tu, Chien-Cheng

2014-08-01

The ranking of interval-valued intuitionistic fuzzy sets (IvIFSs) is difficult since they include the interval values of membership and nonmembership. This paper proposes ranking functions for IvIFSs based on the dominance concept. The proposed ranking functions consider the degree to which an IvIFS dominates and is not dominated by other IvIFSs. Based on the bivariate framework and the dominance concept, the functions incorporate not only the boundary values of membership and nonmembership, but also the relative relations among IvIFSs in comparisons. The dominance-based ranking functions include bipolar evaluations with a parameter that allows the decision-maker to reflect his actual attitude in allocating the various kinds of dominance. The relationship for two IvIFSs that satisfy the dual couple is defined based on four proposed ranking functions. Importantly, the proposed ranking functions can achieve a full ranking for all IvIFSs. Two examples are used to demonstrate the applicability and distinctiveness of the proposed ranking functions.

Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

PubMed

Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

2015-06-16

Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

USGS Publications Warehouse

Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

2005-01-01

Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

PubMed

Zachariae, R; Bjerring, P; Arendt-Nielsen, L

1989-11-01

Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

PubMed

Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

2018-05-30

The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic Fusions of a CFA/I/II/IV MEFA (Multiepitope Fusion Antigen) and a Toxoid Fusion of Heat-Stable Toxin (STa) and Heat-Labile Toxin (LT) of Enterotoxigenic Escherichia coli (ETEC) Retain Broad Anti-CFA and Antitoxin Antigenicity

PubMed Central

Ruan, Xiaosai; Sack, David A.; Zhang, Weiping

2015-01-01

Immunological heterogeneity has long been the major challenge in developing broadly effective vaccines to protect humans and animals against bacterial and viral infections. Enterotoxigenic Escherichia coli (ETEC) strains, the leading bacterial cause of diarrhea in humans, express at least 23 immunologically different colonization factor antigens (CFAs) and two distinct enterotoxins [heat-labile toxin (LT) and heat-stable toxin type Ib (STa or hSTa)]. ETEC strains expressing any one or two CFAs and either toxin cause diarrhea, therefore vaccines inducing broad immunity against a majority of CFAs, if not all, and both toxins are expected to be effective against ETEC. In this study, we applied the multiepitope fusion antigen (MEFA) strategy to construct ETEC antigens and examined antigens for broad anti-CFA and antitoxin immunogenicity. CFA MEFA CFA/I/II/IV [CVI 2014, 21(2):243-9], which carried epitopes of seven CFAs [CFA/I, CFA/II (CS1, CS2, CS3), CFA/IV (CS4, CS5, CS6)] expressed by the most prevalent and virulent ETEC strains, was genetically fused to LT-STa toxoid fusion monomer 3xSTaA14Q-dmLT or 3xSTaN12S-dmLT [IAI 2014, 82(5):1823-32] for CFA/I/II/IV-STaA14Q-dmLT and CFA/I/II/IV-STaN12S-dmLT MEFAs. Mice intraperitoneally immunized with either CFA/I/II/IV-STa-toxoid-dmLT MEFA developed antibodies specific to seven CFAs and both toxins, at levels equivalent or comparable to those induced from co-administration of the CFA/I/II/IV MEFA and toxoid fusion 3xSTaN12S-dmLT. Moreover, induced antibodies showed in vitro adherence inhibition activities against ETEC or E. coli strains expressing these seven CFAs and neutralization activities against both toxins. These results indicated CFA/I/II/IV-STa-toxoid-dmLT MEFA or CFA/I/II/IV MEFA combined with 3xSTaN12S-dmLT induced broadly protective anti-CFA and antitoxin immunity, and suggested their potential application in broadly effective ETEC vaccine development. This MEFA strategy may be generally used in multivalent vaccine development. PMID:25803825

Genetic fusions of a CFA/I/II/IV MEFA (multiepitope fusion antigen) and a toxoid fusion of heat-stable toxin (STa) and heat-labile toxin (LT) of enterotoxigenic Escherichia coli (ETEC) retain broad anti-CFA and antitoxin antigenicity.

PubMed

Ruan, Xiaosai; Sack, David A; Zhang, Weiping

2015-01-01

Immunological heterogeneity has long been the major challenge in developing broadly effective vaccines to protect humans and animals against bacterial and viral infections. Enterotoxigenic Escherichia coli (ETEC) strains, the leading bacterial cause of diarrhea in humans, express at least 23 immunologically different colonization factor antigens (CFAs) and two distinct enterotoxins [heat-labile toxin (LT) and heat-stable toxin type Ib (STa or hSTa)]. ETEC strains expressing any one or two CFAs and either toxin cause diarrhea, therefore vaccines inducing broad immunity against a majority of CFAs, if not all, and both toxins are expected to be effective against ETEC. In this study, we applied the multiepitope fusion antigen (MEFA) strategy to construct ETEC antigens and examined antigens for broad anti-CFA and antitoxin immunogenicity. CFA MEFA CFA/I/II/IV [CVI 2014, 21(2):243-9], which carried epitopes of seven CFAs [CFA/I, CFA/II (CS1, CS2, CS3), CFA/IV (CS4, CS5, CS6)] expressed by the most prevalent and virulent ETEC strains, was genetically fused to LT-STa toxoid fusion monomer 3xSTaA14Q-dmLT or 3xSTaN12S-dmLT [IAI 2014, 82(5):1823-32] for CFA/I/II/IV-STaA14Q-dmLT and CFA/I/II/IV-STaN12S-dmLT MEFAs. Mice intraperitoneally immunized with either CFA/I/II/IV-STa-toxoid-dmLT MEFA developed antibodies specific to seven CFAs and both toxins, at levels equivalent or comparable to those induced from co-administration of the CFA/I/II/IV MEFA and toxoid fusion 3xSTaN12S-dmLT. Moreover, induced antibodies showed in vitro adherence inhibition activities against ETEC or E. coli strains expressing these seven CFAs and neutralization activities against both toxins. These results indicated CFA/I/II/IV-STa-toxoid-dmLT MEFA or CFA/I/II/IV MEFA combined with 3xSTaN12S-dmLT induced broadly protective anti-CFA and antitoxin immunity, and suggested their potential application in broadly effective ETEC vaccine development. This MEFA strategy may be generally used in multivalent vaccine development.

Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

PubMed

Gulubova, M V

1996-07-01

Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

Electrical transport properties of an isolated CdS microrope composed of twisted nanowires.

PubMed

Yu, Gui-Feng; Yu, Miao; Pan, Wei; Han, Wen-Peng; Yan, Xu; Zhang, Jun-Cheng; Zhang, Hong-Di; Long, Yun-Ze

2015-01-01

CdS is one of the important II-VI group semiconductors. In this paper, the electrical transport behavior of an individual CdS microrope composed of twisted nanowires is studied. It is found that the current-voltage (I-V) characteristics show two distinct power law regions from 360 down to 60 K. Space-charge-limited current (SCLC) theory is used to explain these temperature- and electric-field-dependent I-V curves. The I-V data can be well fitted by this theory above 100 K, and the corresponding carrier mobility, trap energy, and trap concentration are also obtained. However, the I-V data exhibit some features of the Coulomb blockade effect below 80 K.

Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

PubMed

Wang, Chao; Zhai, Wanying; Shan, Baoqing

2016-05-01

Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

Geovibrio ferrireducens, a phylogenetically distinct dissimilatory Fe(III)-reducing bacterium

USGS Publications Warehouse

Caccavo, F.; Coates, J.D.; Rossello-Mora, R. A.; Ludwig, W.; Schleifer, K.H.; Lovley, D.R.; McInerney, M.J.

1996-01-01

A new, phylogenetically distinct, dissimilatory, Fe(III)-reducing bacterium was isolated from surface sediment of a hydrocarbon-contaminated ditch. The isolate, designated strain PAL-1, was an obligately anaerobic, non-fermentative, motile, gram-negative vibrio. PAL-1 grew in a defined medium with acetate as electron donor and ferric pyrophosphate, ferric oxyhydroxide, ferric citrate, Co(III)-EDTA, or elemental sulfur as sole electron acceptor. PAL-1 also used proline, hydrogen, lactate, propionate, succinate, fumarate, pyruvate, or yeast extract as electron donors for Fe(III) reduction. It is the first bacterium known to couple the oxidation of an amino acid to Fe(III) reduction. PAI-1 did not reduce oxygen, Mn(IV), U(VI), Cr(VI), nitrate, sulfate, sulfite, or thiosulfate with acetate as the electron donor. Cell suspensions of PAL-1 exhibited dithionite-reduced minus air-oxidized difference spectra that were characteristic of c-type cytochromes. Analysis of the 16S rRNA gene sequence of PAL-1 showed that the strain is not related to any of the described metal-reducing bacteria in the Proteobacteria and, together with Flexistipes sinusarabici, forms a separate line of descent within the Bacteria. Phenotypically and phylogenetically, strain PAI-1 differs from all other described bacteria, and represents the type strain of a new genus and species. Geovibrio ferrireducens.

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

PubMed Central

Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

2014-01-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

PubMed

Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

2014-02-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

PubMed

Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

2008-01-01

To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

Impact of Genetic Deletion of Platform Apolipoproteins on the Size Distribution of the Murine Lipoproteome

PubMed Central

Gordon, Scott M.; Li, Hailong; Zhu, Xiaoting; Tso, Patrick; Reardon, Catherine A.; Shah, Amy S.; Lu, L. Jason; Davidson, W. Sean

2016-01-01

Given their association with cardiovascular disease protection, there has been intense interest in understanding the biology of high density lipoproteins (HDL). HDL is actually a family of diverse particle types, each made up of discrete - but as yet undetermined – combinations of proteins drawn from up to 95 lipophilic plasma proteins. The abundant apolipoproteins (apo) of the A class (apoA-I, apoA-II and apoA-IV) have been proposed to act as organizing platforms for auxiliary proteins, but this concept has not been systematically evaluated. We assessed the impact of genetic knock down of each platform protein on the particle size distribution of auxiliary HDL proteins. Loss of apoA-I or apoA-II massively reduced HDL lipids and changed the plasma size pattern and/or abundance of several plasma proteins. Surprisingly though, many HDL proteins were not affected, suggesting they assemble on lipid particles in the absence of apoA-I or apoA-II. In contrast, apoA-IV ablation had minor effects on plasma lipids and proteins, suggesting that it forms particles that largely exclude other apolipoproteins. Overall, the data indicate that distinct HDL subpopulations exist that do not contain, nor depend on, apoA-I, apoA-II or apoA-IV and these contribute substantially to the proteomic diversity of HDL. PMID:27385375

Recombination and positive selection contributed to the evolution of Listeria monocytogenes lineages III and IV, two distinct and well supported uncommon L. monocytogenes lineages.

PubMed

Tsai, Yeu-Harn Lucy; Maron, Steve B; McGann, Patrick; Nightingale, Kendra K; Wiedmann, Martin; Orsi, Renato H

2011-12-01

Listeriamonocytogenes lineages III and IV represent two uncommon lineages of the human and animal pathogen L. monocytogenes, characterized by occurrence of unusual phenotypic and genetic characteristics that differentiate them from the common lineages I and II. To gain further insights into the evolution of lineages III and IV, we amplified and sequenced housekeeping genes (i.e., gap, prs, purM, ribC, and sigB), internalin genes (i.e., inlA, inlB, inlC, inlG, inlC2, inlD, inlE, inlF, and inlH) and the virulence gene cluster containing prfA, plcA, hly, mpl, actA, and plcB for lineages III (n = 7) and IV (n = 4) isolates. Phylogenetic analyses of the sequences obtained along with previously reported sequence data for 40 isolates representing lineages I (n = 18), II (n = 21), and III (n = 1), showed that lineages III and IV represent divergent and monophyletic lineages. The virulence gene cluster as well as the inlAB operon were present in all isolates, with inlF absent from all lineages III and IV isolates. While all lineage IV isolates contained only inlC (in addition to inlAB), lineage III isolates showed considerable diversity with regard to internalin gene presence, including presence of (i) only inlC (n = 2), (ii) inlC and inlGC2DE (n = 3), (iii) only inlGC2DE (n = 2), and (iv) inlC and inlC2DE (n = 1). In addition to evidence for horizontal gene transfer events, among lineages III and IV isolates, in prs, actA, plcB, mpl, inlA, inlB, inlG, inlD, and inlE, we also found significant evidence for positive selection in the hly promoter region and, along the lineages III and IV branches, for actA (including in sites recognized for interactions with proteins involved in actin tail polymerization). In conclusion, lineages III and IV represent two distinct monophyletic groups with contributions of intragenic recombination to the evolution of their internalin genes as well as contributions of positive selection to evolution of the virulence genes island. Copyright © 2011 Elsevier B.V. All rights reserved.

Ultraviolet properties of IRAS-selected Be stars

NASA Technical Reports Server (NTRS)

Bjorkman, Karen S.; Snow, Theodore P.

1988-01-01

New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

Genetics Home Reference: congenital insensitivity to pain with anhidrosis

MedlinePlus

... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

Collagen type IV at the fetal-maternal interface.

PubMed

Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

2015-01-01

Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2012 CFR

2012-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2013 CFR

2013-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2014 CFR

2014-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2011 CFR

2011-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

Identification of Trypanosoma cruzi discrete typing units (DTUs) through the implementation of a high-resolution melting (HRM) genotyping assay.

PubMed

Higuera, Sonia L; Guhl, Felipe; Ramírez, Juan David

2013-04-20

Chagas disease, caused by Trypanosoma cruzi, is a geographically widespread anthropozoonosis that is considered a major public health problem in Latin America. Because this parasite presents high genetic variability, a nomenclature has been adopted to classify the parasite into six discrete typing units (DTUs): TcI, TcII, TcIII, TcIV, TcV, and TcVI, which present different eco-epidemiological, clinical, and geographic associations. Currently, the available genotyping methods present a series of drawbacks that implies the need for developing new methods for characterizing T. cruzi DTU's. The aim of this work was to genotype reference populations from T. cruzi by means of a High-Resolution Melting (HRM) genotyping assay. Amplification of the mini-exon gene allowed the genotyping of three distinct groups: TcI, TcII- TcIV- TcV, and TcIII-TcVI, while amplification of the 24sα gene generated non-overlapping melting temperature ranges for each DTU that were used to identify the groups in the six existing DTUs of Trypanosoma cruzi. The proposed genotyping assay allowed discrimination of the six genetic groups by obtaining specific melting curves for each DTU. The application of this technique is proposed because of its specificity, sensitivity, high performance, and low cost compared with other previously described characterization methods.

On the Directivity of Low-Frequency Type IV Radio Bursts

NASA Technical Reports Server (NTRS)

Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

2016-01-01

An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

PubMed

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

Genetic exchange of fimbrial alleles exemplifies the adaptive virulence strategy of Porphyromonas gingivalis.

PubMed

Kerr, Jennifer E; Abramian, Jared R; Dao, Doan-Hieu V; Rigney, Todd W; Fritz, Jamie; Pham, Tan; Gay, Isabel; Parthasarathy, Kavitha; Wang, Bing-yan; Zhang, Wenjian; Tribble, Gena D

2014-01-01

Porphyromonas gingivalis is a gram-negative anaerobic bacterium, a member of the human oral microbiome, and a proposed "keystone" pathogen in the development of chronic periodontitis, an inflammatory disease of the gingiva. P. gingivalis is a genetically diverse species, and is able to exchange chromosomal DNA between strains by natural competence and conjugation. In this study, we investigate the role of horizontal DNA transfer as an adaptive process to modify behavior, using the major fimbriae as our model system, due to their critical role in mediating interactions with the host environment. We show that P. gingivalis is able to exchange fimbrial allele types I and IV into four distinct strain backgrounds via natural competence. In all recombinants, we detected a complete exchange of the entire fimA allele, and the rate of exchange varies between the different strain backgrounds. In addition, gene exchange within other regions of the fimbrial genetic locus was identified. To measure the biological implications of these allele swaps we compared three genotypes of fimA in an isogenic background, strain ATCC 33277. We demonstrate that exchange of fimbrial allele type results in profound phenotypic changes, including the quantity of fimbriae elaborated, membrane blebbing, auto-aggregation and other virulence-associated phenotypes. Replacement of the type I allele with either the type III or IV allele resulted in increased invasion of gingival fibroblast cells relative to the isogenic parent strain. While genetic variability is known to impact host-microbiome interactions, this is the first study to quantitatively assess the adaptive effect of exchanging genes within the pan genome cloud. This is significant as it presents a potential mechanism by which opportunistic pathogens may acquire the traits necessary to modify host-microbial interactions.

Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

PubMed

Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

2007-01-01

Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Neurophysiological Distinction between Schizophrenia and Schizoaffective Disorder

PubMed Central

Mathalon, Daniel H.; Hoffman, Ralph E.; Watson, Todd D.; Miller, Ryan M.; Roach, Brian J.; Ford, Judith M.

2009-01-01

Schizoaffective disorder (SA) is distinguished from schizophrenia (SZ) based on the presence of prominent mood symptoms over the illness course. Despite this clinical distinction, SA and SZ patients are often combined in research studies, in part because data supporting a distinct pathophysiological boundary between the disorders are lacking. Indeed, few studies have addressed whether neurobiological abnormalities associated with SZ, such as the widely replicated reduction and delay of the P300 event-related potential (ERP), are also present in SA. Scalp EEG was acquired from patients with DSM-IV SA (n = 15) or SZ (n = 22), as well as healthy controls (HC; n = 22) to assess the P300 elicited by infrequent target (15%) and task-irrelevant distractor (15%) stimuli in separate auditory and visual ”oddball” tasks. P300 amplitude was reduced and delayed in SZ, relative to HC, consistent with prior studies. These SZ abnormalities did not interact with stimulus type (target vs. task-irrelevant distractor) or modality (auditory vs. visual). Across sensory modality and stimulus type, SA patients exhibited normal P300 amplitudes (significantly larger than SZ patients and indistinguishable from HC). However, P300 latency and reaction time were both equivalently delayed in SZ and SA patients, relative to HC. P300 differences between SA and SZ patients could not be accounted for by variation in symptom severity, socio-economic status, education, or illness duration. Although both groups show similar deficits in processing speed, SA patients do not exhibit the P300 amplitude deficits evident in SZ, consistent with an underlying pathophysiological boundary between these disorders. PMID:20140266

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

Collagen IV and basement membrane at the evolutionary dawn of metazoan tissues

PubMed Central

Fidler, Aaron L; Darris, Carl E; Chetyrkin, Sergei V; Pedchenko, Vadim K; Boudko, Sergei P; Brown, Kyle L; Gray Jerome, W; Hudson, Julie K; Rokas, Antonis; Hudson, Billy G

2017-01-01

The role of the cellular microenvironment in enabling metazoan tissue genesis remains obscure. Ctenophora has recently emerged as one of the earliest-branching extant animal phyla, providing a unique opportunity to explore the evolutionary role of the cellular microenvironment in tissue genesis. Here, we characterized the extracellular matrix (ECM), with a focus on collagen IV and its variant, spongin short-chain collagens, of non-bilaterian animal phyla. We identified basement membrane (BM) and collagen IV in Ctenophora, and show that the structural and genomic features of collagen IV are homologous to those of non-bilaterian animal phyla and Bilateria. Yet, ctenophore features are more diverse and distinct, expressing up to twenty genes compared to six in vertebrates. Moreover, collagen IV is absent in unicellular sister-groups. Collectively, we conclude that collagen IV and its variant, spongin, are primordial components of the extracellular microenvironment, and as a component of BM, collagen IV enabled the assembly of a fundamental architectural unit for multicellular tissue genesis. DOI: http://dx.doi.org/10.7554/eLife.24176.001 PMID:28418331

The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

DTIC Science & Technology

1999-05-01

Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

International Union of Basic and Clinical Pharmacology. XCIX. Angiotensin Receptors: Interpreters of Pathophysiological Angiotensinergic Stimuli

PubMed Central

Unal, Hamiyet; Kemp, Jacqueline R.; Tirupula, Kalyan C.; Eguchi, Satoru; Vanderheyden, Patrick M. L.; Thomas, Walter G.

2015-01-01

The renin angiotensin system (RAS) produced hormone peptides regulate many vital body functions. Dysfunctional signaling by receptors for RAS peptides leads to pathologic states. Nearly half of humanity today would likely benefit from modern drugs targeting these receptors. The receptors for RAS peptides consist of three G-protein–coupled receptors—the angiotensin II type 1 receptor (AT1 receptor), the angiotensin II type 2 receptor (AT2 receptor), the MAS receptor—and a type II trans-membrane zinc protein—the candidate angiotensin IV receptor (AngIV binding site). The prorenin receptor is a relatively new contender for consideration, but is not included here because the role of prorenin receptor as an independent endocrine mediator is presently unclear. The full spectrum of biologic characteristics of these receptors is still evolving, but there is evidence establishing unique roles of each receptor in cardiovascular, hemodynamic, neurologic, renal, and endothelial functions, as well as in cell proliferation, survival, matrix-cell interaction, and inflammation. Therapeutic agents targeted to these receptors are either in active use in clinical intervention of major common diseases or under evaluation for repurposing in many other disorders. Broad-spectrum influence these receptors produce in complex pathophysiological context in our body highlights their role as precise interpreters of distinctive angiotensinergic peptide cues. This review article summarizes findings published in the last 15 years on the structure, pharmacology, signaling, physiology, and disease states related to angiotensin receptors. We also discuss the challenges the pharmacologist presently faces in formally accepting newer members as established angiotensin receptors and emphasize necessary future developments. PMID:26315714

Prokaryotic Information Games: How and When to Take up and Secrete DNA.

PubMed

Stingl, Kerstin; Koraimann, Günther

2017-01-01

Besides transduction via bacteriophages natural transformation and bacterial conjugation are the most important mechanisms driving bacterial evolution and horizontal gene spread. Conjugation systems have evolved in eubacteria and archaea. In Gram-positive and Gram-negative bacteria, cell-to-cell DNA transport is typically facilitated by a type IV secretion system (T4SS). T4SSs also mediate uptake of free DNA in Helicobacter pylori, while most transformable bacteria use a type II secretion/type IV pilus system. In this chapter, we focus on how and when bacteria "decide" that such a DNA transport apparatus is to be expressed and assembled in a cell that becomes competent. Development of DNA uptake competence and DNA transfer competence is driven by a variety of stimuli and often involves intricate regulatory networks leading to dramatic changes in gene expression patterns and bacterial physiology. In both cases, genetically homogeneous populations generate a distinct subpopulation that is competent for DNA uptake or DNA transfer or might uniformly switch into competent state. Phenotypic conversion from one state to the other can rely on bistable genetic networks that are activated stochastically with the integration of external signaling molecules. In addition, we discuss principles of DNA uptake processes in naturally transformable bacteria and intend to understand the exceptional use of a T4SS for DNA import in the gastric pathogen H. pylori. Realizing the events that trigger developmental transformation into competence within a bacterial population will eventually help to create novel and effective therapies against the transmission of antibiotic resistances among pathogens.

Accurate prediction of bacterial type IV secreted effectors using amino acid composition and PSSM profiles.

PubMed

Zou, Lingyun; Nan, Chonghan; Hu, Fuquan

2013-12-15

Various human pathogens secret effector proteins into hosts cells via the type IV secretion system (T4SS). These proteins play important roles in the interaction between bacteria and hosts. Computational methods for T4SS effector prediction have been developed for screening experimental targets in several isolated bacterial species; however, widely applicable prediction approaches are still unavailable In this work, four types of distinctive features, namely, amino acid composition, dipeptide composition, .position-specific scoring matrix composition and auto covariance transformation of position-specific scoring matrix, were calculated from primary sequences. A classifier, T4EffPred, was developed using the support vector machine with these features and their different combinations for effector prediction. Various theoretical tests were performed in a newly established dataset, and the results were measured with four indexes. We demonstrated that T4EffPred can discriminate IVA and IVB effectors in benchmark datasets with positive rates of 76.7% and 89.7%, respectively. The overall accuracy of 95.9% shows that the present method is accurate for distinguishing the T4SS effector in unidentified sequences. A classifier ensemble was designed to synthesize all single classifiers. Notable performance improvement was observed using this ensemble system in benchmark tests. To demonstrate the model's application, a genome-scale prediction of effectors was performed in Bartonella henselae, an important zoonotic pathogen. A number of putative candidates were distinguished. A web server implementing the prediction method and the source code are both available at http://bioinfo.tmmu.edu.cn/T4EffPred.

Astrocytes express specific variants of CaM KII delta and gamma, but not alpha and beta, that determine their cellular localizations.

PubMed

Vallano, M L; Beaman-Hall, C M; Mathur, A; Chen, Q

2000-04-01

Multiple isoforms of type II Ca(2+)-calmodulin-dependent kinase (CaM KII) are composed of two major neuron-specific subunits, designated alpha and beta, and two less well-characterized subunits that are also expressed in non-neuronal tissues, designated delta and gamma. Regulated expression of these 4 gene products, and several variants produced by alternative splicing, shows temporal and regional specificity and influences intracellular targeting. We used immunoblotting and RT-PCR to analyze subunit and variant expression and distribution in cultured cerebellar astrocytes and neurons, and whole cerebellar cortex from rodent brain. The data indicate that: (i) astrocytes express a single splice variant of delta, namely delta(2); (ii) like neurons, astrocytes express two forms of CaM KII gamma; gamma(B) and gamma(A); (iii) these CaM KII variants are enriched in the supernate fraction in astrocytes, and the particulate fraction in neurons; (iv) unlike neurons, astrocytes do not express detectable levels of alpha or beta subunits or their respective splice variants. The results indicate that neurons and astrocytes express distinct CaM KII subunits and variants that localize to distinct subcellular compartments and, by inference, exert distinct cellular functions. Copyright 2000 Wiley-Liss, Inc.

Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

PubMed

Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

2018-06-01

The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

2008-01-15

We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

PubMed

de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

2007-10-01

The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

PubMed

Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

2016-07-01

To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

PubMed

Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

2013-10-01

To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

46 CFR 164.019-3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

2011-04-15

Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

Interstellar C IV and Si IV column densities toward early-type stars

NASA Technical Reports Server (NTRS)

Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

1980-01-01

Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

PubMed

Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

2013-04-01

Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

DOT National Transportation Integrated Search

1989-11-01

The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

Impaired Heme Binding and Aggregation of Mutant Cystathionine β-Synthase Subunits in Homocystinuria

PubMed Central

Janošík, Miroslav; Oliveriusová, Jana; Janošíková, Bohumila; Sokolová, Jitka; Kraus, Eva; Kraus, Jan P.; Kožich, Viktor

2001-01-01

During the past 20 years, cystathionine β-synthase (CBS) deficiency has been detected in the former Czechoslovakia with a calculated frequency of 1:349,000. The clinical manifestation was typical of homocystinuria, and about half of the 21 patients were not responsive to pyridoxine. Twelve distinct mutations were detected in 30 independent homocystinuric alleles. One half of the alleles carried either the c.833 T→C or the IVS11−2A→C mutation; the remaining alleles contained private mutations. The abundance of five mutant mRNAs with premature stop codons was analyzed by PCR-RFLP. Two mRNAs, c.828_931ins104 (IVS7+1G→A) and c.1226 G→A, were severely reduced in the cytoplasm as a result of nonsense-mediated decay. In contrast, the other three mRNAs—c.19_20insC, c.28_29delG, and c.210_235del26 (IVS1−1G→C)—were stable. Native western blot analysis of 14 mutant fibroblast lines showed a paucity of CBS antigen, which was detectable only in aggregates. Five mutations—A114V (c.341C→T), A155T (c.463G→A), E176K (c.526G→A), I278T (c.833T→C), and W409_G453del (IVS11−2A→C)—were expressed in Escherichia coli. All five mutant proteins formed substantially more aggregates than did the wild-type CBS, and no aggregates contained heme. These data suggest that abnormal folding, impaired heme binding, and aggregation of mutant CBS polypeptides may be common pathogenic mechanisms in CBS deficiency. PMID:11359213

Comparison of biofilm formation between major clonal lineages of methicillin resistant Staphylococcus aureus.

PubMed

Vanhommerig, Evelyn; Moons, Pieter; Pirici, Daniel; Lammens, Christine; Hernalsteens, Jean-Pierre; De Greve, Henri; Kumar-Singh, Samir; Goossens, Herman; Malhotra-Kumar, Surbhi

2014-01-01

Epidemic methicillin-resistant S. aureus (MRSA) clones cause infections in both hospital and community settings. As a biofilm phenotype further facilitates evasion of the host immune system and antibiotics, we compared the biofilm-forming capacities of various MRSA clones. Seventy-six MRSA classified into 13 clones (USA300, EMRSA-15, Hungarian/Brazilian etc.), and isolated from infections or from carriers were studied for biofilm formation under static and dynamic conditions. Static biofilms in microtitre plates were quantified colorimetrically. Dynamic biofilms (Bioflux 200, Fluxion, USA) were studied by confocal laser-scanning and time-lapse microscopy, and the total volume occupied by live/dead bacteria quantified by Volocity 5.4.1 (Improvision, UK). MRSA harbouring SCCmec IV produced significantly more biomass under static conditions than SCCmec I-III (P = 0.003), and those harbouring SCCmec II significantly less than those harbouring SCCmec I or III (P<0.001). In the dynamic model, SCCmec I-III harbouring MRSA were significantly better biofilm formers than SCCmec IV (P = 0.036). Only 16 strains successfully formed biofilms under both conditions, of which 13 harboured SCCmec IV and included all tested USA300 strains (n = 3). However, USA300 demonstrated remarkably lower percentages of cell-occupied space (6.6%) compared to the other clones (EMRSA-15 = 19.0%) under dynamic conditions. Time-lapse microscopy of dynamic biofilms demonstrated that USA300 formed long viscoelastic tethers that stretched far from the point of attachment, while EMRSA-15 consisted of micro-colonies attached densely to the surface. MRSA harbouring SCCmec types IV and I-III demonstrate distinct biofilm forming capacities, possibly owing to their adaptation to the community and hospital settings, respectively. USA300 demonstrated abundant biofilm formation under both conditions, which probably confers a competitive advantage, contributing to its remarkable success as a pathogen.

An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

DTIC Science & Technology

1994-09-01

wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

PubMed Central

Cosgrove, Dominic; Liu, Shiguang

2016-01-01

Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

Characterization and virulence clustering analysis of extraintestinal pathogenic Escherichia coli isolated from swine in China.

PubMed

Zhu, Yinchu; Dong, Wenyang; Ma, Jiale; Yuan, Lvfeng; Hejair, Hassan M A; Pan, Zihao; Liu, Guangjin; Yao, Huochun

2017-04-08

Swine extraintestinal pathogenic Escherichia coli (ExPEC) is an important pathogen that leads to economic and welfare costs in the swine industry worldwide, and is occurring with increasing frequency in China. By far, various virulence factors have been recognized in ExPEC. Here, we investigated the virulence genotypes and clonal structure of collected strains to improve the knowledge of phylogenetic traits of porcine ExPECs in China. We isolated 64 Chinese porcine ExPEC strains from 2013 to 14 in China. By multiplex PCR, the distribution of isolates belonging to phylogenetic groups B1, B2, A and D was 9.4%, 10.9%, 57.8% and 21.9%, respectively. Nineteen virulence-related genes were detected by PCR assay; ompA, fimH, vat, traT and iutA were highly prevalent. Virulence-related genes were remarkably more prevalent in group B2 than in groups A, B1 and D; notably, usp, cnf1, hlyD, papA and ibeA were only found in group B2 strains. Genotyping analysis was performed and four clusters of strains (named I to IV) were identified. Cluster IV contained all isolates from group B2 and Cluster IV isolates had the strongest pathogenicity in a mouse infection model. As phylogenetic group B2 and D ExPEC isolates are generally considered virulent, multilocus sequence typing (MLST) analysis was performed for these isolates to further investigate genetic relationships. Two novel sequence types, ST5170 and ST5171, were discovered. Among the nine clonal complexes identified among our group B2 and D isolates, CC12 and CC95 have been indicated to have high zoonotic pathogenicity. The distinction between group B2 and non-B2 isolates in virulence and genotype accorded with MLST analysis. This study reveals significant genetic diversity among ExPEC isolates and helps us to better understand their pathogenesis. Importantly, our data suggest group B2 (Cluster IV) strains have the highest risk of causing animal disease and illustrate the correlation between genotype and virulence.

Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

PubMed

Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

2015-06-01

The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

Genetics Home Reference: glycogen storage disease type IV

MedlinePlus

... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

PubMed

Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

2017-07-01

The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

Alport Syndrome Diagnosis

MedlinePlus

... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

Electrical transport properties of an isolated CdS microrope composed of twisted nanowires

NASA Astrophysics Data System (ADS)

Yu, Gui-Feng; Yu, Miao; Pan, Wei; Han, Wen-Peng; Yan, Xu; Zhang, Jun-Cheng; Zhang, Hong-Di; Long, Yun-Ze

2015-01-01

CdS is one of the important II-VI group semiconductors. In this paper, the electrical transport behavior of an individual CdS microrope composed of twisted nanowires is studied. It is found that the current-voltage ( I- V) characteristics show two distinct power law regions from 360 down to 60 K. Space-charge-limited current (SCLC) theory is used to explain these temperature- and electric-field-dependent I-V curves. The I-V data can be well fitted by this theory above 100 K, and the corresponding carrier mobility, trap energy, and trap concentration are also obtained. However, the I-V data exhibit some features of the Coulomb blockade effect below 80 K.

BK Polyomavirus Genotypes Represent Distinct Serotypes with Distinct Entry Tropism

PubMed Central

Pastrana, Diana V.; Ray, Upasana; Magaldi, Thomas G.; Schowalter, Rachel M.; Çuburu, Nicolas

2013-01-01

BK polyomavirus (BKV) causes significant urinary tract pathogenesis in immunosuppressed individuals, including kidney and bone marrow transplant recipients. It is currently unclear whether BKV-neutralizing antibodies can moderate or prevent BKV disease. We developed reporter pseudoviruses based on seven divergent BKV isolates and performed neutralization assays on sera from healthy human subjects. The results demonstrate that BKV genotypes I, II, III, and IV are fully distinct serotypes. While nearly all healthy subjects had BKV genotype I-neutralizing antibodies, a majority of subjects did not detectably neutralize genotype III or IV. Surprisingly, BKV subgenotypes Ib1 and Ib2 can behave as fully distinct serotypes. This difference is governed by as few as two residues adjacent to the cellular glycan receptor-binding site on the virion surface. Serological analysis of mice given virus-like particle (VLP)-based BKV vaccines confirmed these findings. Mice administered a multivalent VLP vaccine showed high-titer serum antibody responses that potently cross-neutralized all tested BKV genotypes. Interestingly, each of the neutralization serotypes bound a distinct spectrum of cell surface receptors, suggesting a possible connection between escape from recognition by neutralizing antibodies and cellular attachment mechanisms. The finding implies that different BKV genotypes have different cellular tropisms and pathogenic potentials in vivo. Individuals who are infected with one BKV serotype may remain humorally vulnerable to other BKV serotypes after implementation of T cell immunosuppression. Thus, prevaccinating organ transplant recipients with a multivalent BKV VLP vaccine might reduce the risk of developing posttransplant BKV disease. PMID:23843634

Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

PubMed

Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

2010-08-01

Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Does WISC-IV Underestimate the Intelligence of Autistic Children?

PubMed

Nader, Anne-Marie; Courchesne, Valérie; Dawson, Michelle; Soulières, Isabelle

2016-05-01

Wechsler Intelligence Scale for Children (WISC) is widely used to estimate autistic intelligence (Joseph in The neuropsychology of autism. Oxford University Press, Oxford, 2011; Goldstein et al. in Assessment of autism spectrum disorders. Guilford Press, New York, 2008; Mottron in J Autism Dev Disord 34(1):19-27, 2004). However, previous studies suggest that while WISC-III and Raven's Progressive Matrices (RPM) provide similar estimates of non-autistic intelligence, autistic children perform significantly better on RPM (Dawson et al. in Psychol Sci 18(8):657-662, doi: 10.1111/j.1467-9280.2007.01954.x , 2007). The latest WISC version introduces substantial changes in subtests and index scores; thus, we asked whether WISC-IV still underestimates autistic intelligence. Twenty-five autistic and 22 typical children completed WISC-IV and RPM. Autistic children's RPM scores were significantly higher than their WISC-IV FSIQ, but there was no significant difference in typical children. Further, autistic children showed a distinctively uneven WISC-IV index profile, with a "peak" in the new Perceptual Reasoning Index. In spite of major changes, WISC-IV FSIQ continues to underestimate autistic intelligence.

Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

PubMed

Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

2006-11-01

Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

PubMed

Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

2018-05-17

Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

PubMed

Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

2012-01-01

Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

Comparison of virulence factors and capsular types of Streptococcus agalactiae isolated from human and bovine infections.

PubMed

Emaneini, Mohammad; Khoramian, Babak; Jabalameli, Fereshteh; Abani, Samira; Dabiri, Hossein; Beigverdi, Reza

2016-02-01

Streptococcus agalactiae is a leading cause of human and bovine infections. A total of 194 S. agalactiae isolates, 55 isolates from bovines and 139 from humans, were analyzed for capsular types, virulence genes (scpB, hly, rib, bca and bac) and mobile genetic elements (IS1548 and GBSi1) using polymerase chain reaction (PCR) and multiplex PCR. Capsular type III was predominant (61%), followed by types V, II, Ib, and IV. The scpB, hly, bca and bac virulence genes were only found among human isolates. Twelve and 2 distinct virulence gene profiles were identified among human and bovine isolates respectively. The virulence gene profiles scpB- hly- IS1548- rib-bca (51%) and scpB- hly- IS1548- bca (19%) were only predominant among human isolates. The rib gene was the most common virulence gene in both human and bovine isolates. The study showed a high prevalence of virulence genes in S. agalactiae strains isolated from human infections, these result can support the idea that S. agalactiae isolated from humans and bovines are generally unrelated and probably belonged to separate populations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

PubMed Central

Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

2015-01-01

Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

Root canal morphology of South Asian Indian maxillary molar teeth

PubMed Central

Singh, Shishir; Pawar, Mansing

2015-01-01

Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

[Two main mistakes in classificatory and clinical function of DSM-IV, in the case of differential diagnosis between Asperger and autistic disorder].

PubMed

Areta, Joaquín E

2009-01-01

Symptomatic description of what the DSM-IV understands for Asperger's and Autistic Disorder was analyzed. As a result of this revision there was found that a great amount of diagnostic criteria overlap, and lead to the impossibility to make a clear differential diagnosis. The classifying function is, thus, criticized. The clinical function of this diagnostic distinction is analyzed through a clinical case. It is shown it's lack of utility when a therapeutic method should be implemented in a case of Autistic Disorder. It is concluded that the statistical value of the results obtained by using this classificatory instrument should be examined due to this lack of distinction. Also, according to the therapeutic approach witch the author makes reference, it is shown that the diagnostic of any both disorders does not modify the general intervention strategy.

Monoanionic molybdenum and tungsten tris(dithiolene) complexes: a multifrequency EPR study.

PubMed

Sproules, Stephen; Banerjee, Priyabrata; Weyhermüller, Thomas; Yan, Yong; Donahue, James P; Wieghardt, Karl

2011-08-01

Numerous Mo and W tris(dithiolene) complexes in varying redox states have been prepared and representative examples characterized crystallographically: [M(S(2)C(2)R(2))(3)](z) [M = Mo, R = Ph, z = 0 (1) or 1- (2); M = W, R = Ph, z = 0 (4) or 1- (5); R = CN, z = 2-, M = Mo (3) or W (6)]. Changes in dithiolene C-S and C-C bond lengths for 1 versus 2 and 4 versus 5 are indicative of ligand reduction. Trigonal twist angles (Θ) and dithiolene fold angles (α) increase and decrease, respectively, for 2 versus 1, 5 versus 4. Cyclic voltammetry reveals generally two reversible couples corresponding to 0/1- and 1-/2- reductions. The electronic structures of monoanionic molybdenum tris(dithiolene) complexes have been analyzed by multifrequency (S-, X-, Q-band) EPR spectroscopy. Spin-Hamiltonian parameters afforded by spectral simulation for each complex demonstrate the existence of two distinctive electronic structure types. The first is [Mo(IV)((A)L(3)(5-•))](1-) ((A)L = olefinic dithiolene, type A), which has the unpaired electron restricted to the tris(dithiolene) unit and is characterized by isotropic g-values and small molybdenum superhyperfine coupling. The second is formulated as [Mo(V)((B)L(3)(6-))](1-) ((B)L = aromatic dithiolene, type B) with spectra distinguished by a prominent g-anisotropy and hyperfine coupling consistent with the (d(z(2)))(1) paramagnet. The electronic structure disparity is also manifested in their electronic absorption spectra. The compound [W(bdt)(3)](1-) exhibits spin-Hamiltonian parameters similar to those of [Mo(bdt)(3)](1-) and thus is formulated as [W(V)((B)L(3)(6-))](1-). The EPR spectra of [W((A)L(3))](1-) display spin-Hamiltonian parameters that suggest their electronic structure is best represented by two resonance forms {[W(IV)((A)L(3)(5-•))](1-) ↔ [W(V)((A)L(3)(6-))](1-)}. The contrast with the corresponding [Mo(IV)((A)L(3)(5-•))](1-) complexes highlights tungsten's preference for higher oxidation states. © 2011 American Chemical Society

A Chromatin Insulator-Like Element in the Herpes Simplex Virus Type 1 Latency-Associated Transcript Region Binds CCCTC-Binding Factor and Displays Enhancer-Blocking and Silencing Activities

PubMed Central

Amelio, Antonio L.; McAnany, Peterjon K.; Bloom, David C.

2006-01-01

A previous study demonstrated that the latency-associated transcript (LAT) promoter and the LAT enhancer/reactivation critical region (rcr) are enriched in acetyl histone H3 (K9, K14) during herpes simplex virus type 1 (HSV-1) latency, whereas all lytic genes analyzed (ICP0, UL54, ICP4, and DNA polymerase) are not (N. J. Kubat, R. K. Tran, P. McAnany, and D. C. Bloom, J. Virol. 78:1139-1149, 2004). This suggests that the HSV-1 latent genome is organized into histone H3 (K9, K14) hyperacetylated and hypoacetylated regions corresponding to transcriptionally permissive and transcriptionally repressed chromatin domains, respectively. Such an organization implies that chromatin insulators, similar to those of cellular chromosomes, may separate distinct transcriptional domains of the HSV-1 latent genome. In the present study, we sought to identify cis elements that could partition the HSV-1 genome into distinct chromatin domains. Sequence analysis coupled with chromatin immunoprecipitation and luciferase reporter assays revealed that (i) the long and short repeats and the unique-short region of the HSV-1 genome contain clustered CTCF (CCCTC-binding factor) motifs, (ii) CTCF motif clusters similar to those in HSV-1 are conserved in other alphaherpesviruses, (iii) CTCF binds to these motifs on latent HSV-1 genomes in vivo, and (iv) a 1.5-kb region containing the CTCF motif cluster in the LAT region possesses insulator activities, specifically, enhancer blocking and silencing. The finding that CTCF, a cellular protein associated with chromatin insulators, binds to motifs on the latent genome and insulates the LAT enhancer suggests that CTCF may facilitate the formation of distinct chromatin boundaries during herpesvirus latency. PMID:16474142

Evaluating the virucidal efficacy of hydrogen peroxide vapour.

PubMed

Goyal, S M; Chander, Y; Yezli, S; Otter, J A

2014-04-01

Surface contamination has been implicated in the transmission of certain viruses, and surface disinfection can be an effective measure to interrupt the spread of these agents. To evaluate the in-vitro efficacy of hydrogen peroxide vapour (HPV), a vapour-phase disinfection method, for the inactivation of a number of structurally distinct viruses of importance in the healthcare, veterinary and public sectors. The viruses studied were: feline calicivirus (FCV, a norovirus surrogate); human adenovirus type 1; transmissible gastroenteritis coronavirus of pigs (TGEV, a severe acute respiratory syndrome coronavirus [SARS-CoV] surrogate); avian influenza virus (AIV); and swine influenza virus (SwIV). The viruses were dried on stainless steel discs in 20- or 40-μL aliquots and exposed to HPV produced by a Clarus L generator (Bioquell, Horsham, PA, USA) in a 0.2-m(3) environmental chamber. Three vaporized volumes of hydrogen peroxide were tested in triplicate for each virus: 25, 27 and 33 mL. No viable viruses were identified after HPV exposure at any of the vaporized volumes tested. HPV was virucidal (>4-log reduction) against FCV, adenovirus, TGEV and AIV at the lowest vaporized volume tested (25 mL). For SwIV, due to low virus titre on the control discs, >3.8-log reduction was shown for the 25-mL vaporized volume and >4-log reduction was shown for the 27-mL and 33-mL vaporized volumes. HPV was virucidal for structurally distinct viruses dried on surfaces, suggesting that HPV can be considered for the disinfection of virus-contaminated surfaces. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Comparative genome analysis of VSP-II and SNPs reveals heterogenic variation in contemporary strains of Vibrio cholerae O1 isolated from cholera patients in Kolkata, India

PubMed Central

Sekizuka, Tsuyoshi; Mizuno, Tamaki; Takemura, Taichiro; Yamashiro, Tetsu; Chowdhury, Goutam; Pazhani, Gururaja P.; Mukhopadhyay, Asish K.; Ramamurthy, Thandavarayan; Miyoshi, Shin-ichi; Kuroda, Makoto; Shinoda, Sumio; Ohnishi, Makoto

2017-01-01

Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years. PMID:28192431

Comparative genome analysis of VSP-II and SNPs reveals heterogenic variation in contemporary strains of Vibrio cholerae O1 isolated from cholera patients in Kolkata, India.

PubMed

Imamura, Daisuke; Morita, Masatomo; Sekizuka, Tsuyoshi; Mizuno, Tamaki; Takemura, Taichiro; Yamashiro, Tetsu; Chowdhury, Goutam; Pazhani, Gururaja P; Mukhopadhyay, Asish K; Ramamurthy, Thandavarayan; Miyoshi, Shin-Ichi; Kuroda, Makoto; Shinoda, Sumio; Ohnishi, Makoto

2017-02-01

Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years.

Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

PubMed

Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

2009-06-01

Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

The unique luminal staining pattern of cytokeratin 5/6 in adenoid cystic carcinoma of the breast may aid in differentiating it from its mimickers.

PubMed

Nakai, Tokiko; Ichihara, Shu; Kada, Akiko; Ito, Noriko; Moritani, Suzuko; Kawasaki, Tomonori; Uchiyama, Tomoko; Itami, Hiroe; Morita, Kouhei; Takano, Masato; Takeda, Maiko; Hatakeyama, Kinta; Ohbayashi, Chiho

2016-08-01

Adenoid cystic carcinoma (AdCC) of the breast is an uncommon but distinct neoplasm composed of a dual cell population polarized around true glandular (luminal) spaces and pseudolumina. The aim of this study was to clarify whether various immunohistochemical markers (CK7, EMA, CD117, p63, calponin, CD10, S100, CK5/6, CK14, vimentin, and type IV collagen) can distinguish between the two cell types in classical AdCC (n = 14) and in collagenous spherulosis (n = 5). The sensitivity and specificity of these 11 markers to distinguish luminal from abluminal cells were evaluated using a curve created by plotting the true-positive rate (sensitivity) against the false-positive rate (1 - specificity) at threshold settings of 0, 10, 50, and 70 %. The most sensitive and specific markers for luminal cells in AdCC were CK7 and EMA; those for abluminal cells were type IV collagen, p63, and vimentin. CD10 and S100 did not act as abluminal markers in AdCC. CK5/6, one of the basal/myoepithelial markers, was expressed more frequently in luminal than in abluminal cells of AdCC. Thus, CK5/6 immunostaining resulted in a reverse expression pattern, analogous to what we recently documented in clear cells in mammary adenomyoepithelioma. In conclusion, compared with myoepithelial/abluminal cells of normal breast or collagenous spherulosis, the neoplastic abluminal cells of classical AdCC are characterized by enhanced vimentin and attenuated CD10 and S100. Furthermore, the luminal cells of AdCC show a unique aberrant staining pattern for CK5/6 that may aid in the differential diagnosis.

Virulence factors encoded by Legionella longbeachae identified on the basis of the genome sequence analysis of clinical isolate D-4968.

PubMed

Kozak, Natalia A; Buss, Meghan; Lucas, Claressa E; Frace, Michael; Govil, Dhwani; Travis, Tatiana; Olsen-Rasmussen, Melissa; Benson, Robert F; Fields, Barry S

2010-02-01

Legionella longbeachae causes most cases of legionellosis in Australia and may be underreported worldwide due to the lack of L. longbeachae-specific diagnostic tests. L. longbeachae displays distinctive differences in intracellular trafficking, caspase 1 activation, and infection in mouse models compared to Legionella pneumophila, yet these two species have indistinguishable clinical presentations in humans. Unlike other legionellae, which inhabit freshwater systems, L. longbeachae is found predominantly in moist soil. In this study, we sequenced and annotated the genome of an L. longbeachae clinical isolate from Oregon, isolate D-4968, and compared it to the previously published genomes of L. pneumophila. The results revealed that the D-4968 genome is larger than the L. pneumophila genome and has a gene order that is different from that of the L. pneumophila genome. Genes encoding structural components of type II, type IV Lvh, and type IV Icm/Dot secretion systems are conserved. In contrast, only 42/140 homologs of genes encoding L. pneumophila Icm/Dot substrates have been found in the D-4968 genome. L. longbeachae encodes numerous proteins with eukaryotic motifs and eukaryote-like proteins unique to this species, including 16 ankyrin repeat-containing proteins and a novel U-box protein. We predict that these proteins are secreted by the L. longbeachae Icm/Dot secretion system. In contrast to the L. pneumophila genome, the L. longbeachae D-4968 genome does not contain flagellar biosynthesis genes, yet it contains a chemotaxis operon. The lack of a flagellum explains the failure of L. longbeachae to activate caspase 1 and trigger pyroptosis in murine macrophages. These unique features of L. longbeachae may reflect adaptation of this species to life in soil.

International Union of Basic and Clinical Pharmacology. XCIX. Angiotensin Receptors: Interpreters of Pathophysiological Angiotensinergic Stimuli [corrected].

PubMed

Karnik, Sadashiva S; Unal, Hamiyet; Kemp, Jacqueline R; Tirupula, Kalyan C; Eguchi, Satoru; Vanderheyden, Patrick M L; Thomas, Walter G

2015-10-01

The renin angiotensin system (RAS) produced hormone peptides regulate many vital body functions. Dysfunctional signaling by receptors for RAS peptides leads to pathologic states. Nearly half of humanity today would likely benefit from modern drugs targeting these receptors. The receptors for RAS peptides consist of three G-protein-coupled receptors—the angiotensin II type 1 receptor (AT1 receptor), the angiotensin II type 2 receptor (AT2 receptor), the MAS receptor—and a type II trans-membrane zinc protein—the candidate angiotensin IV receptor (AngIV binding site). The prorenin receptor is a relatively new contender for consideration, but is not included here because the role of prorenin receptor as an independent endocrine mediator is presently unclear. The full spectrum of biologic characteristics of these receptors is still evolving, but there is evidence establishing unique roles of each receptor in cardiovascular, hemodynamic, neurologic, renal, and endothelial functions, as well as in cell proliferation, survival, matrix-cell interaction, and inflammation. Therapeutic agents targeted to these receptors are either in active use in clinical intervention of major common diseases or under evaluation for repurposing in many other disorders. Broad-spectrum influence these receptors produce in complex pathophysiological context in our body highlights their role as precise interpreters of distinctive angiotensinergic peptide cues. This review article summarizes findings published in the last 15 years on the structure, pharmacology, signaling, physiology, and disease states related to angiotensin receptors. We also discuss the challenges the pharmacologist presently faces in formally accepting newer members as established angiotensin receptors and emphasize necessary future developments. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

PubMed Central

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-01-01

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

PubMed

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-10-23

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Four distinct immune microenvironment subtypes in gastric adenocarcinoma with special reference to microsatellite instability

PubMed Central

Heo, You Jeong; Kim, Seungtae; Kim, Nayoung KD; Park, Joon Oh; Kang, Won Ki; Lee, Jeeyun; Kim, Kyoung-Mee

2018-01-01

Introduction Programmed death-ligand 1 (PD-L1) can be overexpressed in tumours other than Epstein-Barr virus (EBV)-positive (EBV+) or microsatellite instability-high (MSI-H) gastric cancer (GC) subtypes. We aimed to determine the tumour immune microenvironment (TME) classification of GC to better understand tumour–immune interactions and help patient selection for future immunotherapy with special reference to MSI-H. Methods Immunohistochemistry (IHC) for PD-L1 and CD8+ T cells in three distinct subtypes of GC (43 EBV+, 79 MSI-H and 125 EBV−/MSS) were performed and analysed. In 66 MSI-H GC, mutation counts were compared with PD-L1 expression and survival of the patients. Results GC TME divided by PD-L1 IHC and tumour-infiltrating lymphocytes (TIL) measured by intratumoural CD8 density showed: (1) about 40% of GC are type I (PD-L1+/TIL+) consisting ~70% of MSI-H or EBV+ GC, and ~15% of EBV−/microsatellite stable (MSS) GC patients show the best survival in both disease-free (HR 2.044) and overall survival (HR 1.993); this type would respond to a checkpoint blockade therapy; (2) almost 30% of GC are type II (PD-L1−/TIL−) with the worst survival; (3) approximately 10% of GC are type III (PD-L1+/TIL−); and (4) up to 20% are type IV (PD-L1−/TIL+) and, unexpectedly, ~25% of EBV+ or MSI-H GC are within this subtype. In MSI-H GC, frequent frameshift mutations were observed in ARID1A, RNF43, NF1, MSH6, BRD3, NCOA3, BCORL1, TNKS2 and NPM1 and the numbers of frameshift mutation correlated significantly with PD-L1 expression (P<0.05). Discussion GC can be classified into four TME types based on PD-L1 and TIL, and numbers of frameshift mutation correlate well with PD-L1 expression in MSI-H GC. PMID:29636988

Four distinct immune microenvironment subtypes in gastric adenocarcinoma with special reference to microsatellite instability.

PubMed

Cho, Junhun; Chang, Young Hwan; Heo, You Jeong; Kim, Seungtae; Kim, Nayoung Kd; Park, Joon Oh; Kang, Won Ki; Lee, Jeeyun; Kim, Kyoung-Mee

2018-01-01

Programmed death-ligand 1 (PD-L1) can be overexpressed in tumours other than Epstein-Barr virus (EBV)-positive (EBV + ) or microsatellite instability-high (MSI-H) gastric cancer (GC) subtypes. We aimed to determine the tumour immune microenvironment (TME) classification of GC to better understand tumour-immune interactions and help patient selection for future immunotherapy with special reference to MSI-H. Immunohistochemistry (IHC) for PD-L1 and CD8 + T cells in three distinct subtypes of GC (43 EBV + , 79 MSI-H and 125 EBV - /MSS) were performed and analysed. In 66 MSI-H GC, mutation counts were compared with PD-L1 expression and survival of the patients. GC TME divided by PD-L1 IHC and tumour-infiltrating lymphocytes (TIL) measured by intratumoural CD8 density showed: (1) about 40% of GC are type I (PD-L1 + /TIL + ) consisting ~70% of MSI-H or EBV + GC, and ~15% of EBV - /microsatellite stable (MSS) GC patients show the best survival in both disease-free (HR 2.044) and overall survival (HR 1.993); this type would respond to a checkpoint blockade therapy; (2) almost 30% of GC are type II (PD-L1 - /TIL - ) with the worst survival; (3) approximately 10% of GC are type III (PD-L1 + /TIL - ); and (4) up to 20% are type IV (PD-L1 - /TIL + ) and, unexpectedly, ~25% of EBV + or MSI-H GC are within this subtype. In MSI-H GC, frequent frameshift mutations were observed in ARID1A , RNF43 , NF1 , MSH6 , BRD3 , NCOA3 , BCORL1 , TNKS2 and NPM1 and the numbers of frameshift mutation correlated significantly with PD-L1 expression (P<0.05). GC can be classified into four TME types based on PD-L1 and TIL, and numbers of frameshift mutation correlate well with PD-L1 expression in MSI-H GC.

Phenotypic and Genomic Analysis of Hypervirulent Human-associated Bordetella bronchiseptica

PubMed Central

2012-01-01

Background B. bronchiseptica infections are usually associated with wild or domesticated animals, but infrequently with humans. A recent phylogenetic analysis distinguished two distinct B. bronchiseptica subpopulations, designated complexes I and IV. Complex IV isolates appear to have a bias for infecting humans; however, little is known regarding their epidemiology, virulence properties, or comparative genomics. Results Here we report a characterization of the virulence of human-associated complex IV B. bronchiseptica strains. In in vitro cytotoxicity assays, complex IV strains showed increased cytotoxicity in comparison to a panel of complex I strains. Some complex IV isolates were remarkably cytotoxic, resulting in LDH release levels in A549 cells that were 10- to 20-fold greater than complex I strains. In vivo, a subset of complex IV strains was found to be hypervirulent, with an increased ability to cause lethal pulmonary infections in mice. Hypercytotoxicity in vitro and hypervirulence in vivo were both dependent on the activity of the bsc T3SS and the BteA effector. To clarify differences between lineages, representative complex IV isolates were sequenced and their genomes were compared to complex I isolates. Although our analysis showed there were no genomic sequences that can be considered unique to complex IV strains, there were several loci that were predominantly found in complex IV isolates. Conclusion Our observations reveal a T3SS-dependent hypervirulence phenotype in human-associated complex IV isolates, highlighting the need for further studies on the epidemiology and evolutionary dynamics of this B. bronchiseptica lineage. PMID:22863321

Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

2012-08-15

Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

Neurons of human nucleus accumbens.

PubMed

Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

2011-08-01

Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

Mycoplasma-induced BALB/c 3T3 collagenase is a mammalian enzyme.

PubMed Central

Kluve, B; Merrick, W C; Gershman, H

1983-01-01

A collagenase previously reported to accumulate in the medium of cultures of BALB/c 3T3 cells on infection with Mycoplasma orale [Kluve, Merrick, Stanbridge & Gershman (1981) Nature (London) 292, 855-857] was partially purified and characterized. With regard to purification properties, activation, sensitivity to inhibitors and relative molecular mass the enzyme was similar to previously reported vertebrate collagenases, but could not be unequivocally distinguished from bacterial collagenases. With regard to substrate-specificity and reaction products, however, the collagenase was typical of vertebrate collagenases and distinct from bacterial collagenases. Specifically, the enzyme displayed a preference for type III collagen and type I collagen, a somewhat decreased ability to degrade type II collagen, and a very limited ability to degrade type IV collagen. The initial products of the action of the collagenase on type I collagen were characterized as fragments one-quarter and three-quarters of the length of the intact collagen molecule. Because the properties of the collagenase produced by cultures of mycoplasma-infected BALB/c 3T3 cells are those of a mammalian-type (vertebrate-type) enzyme, we have concluded that the collagenase is a product of the mouse (BALB/c 3T3) genome, and is not produced by the mycoplasma. Therefore it appears that infection of BALB/c 3T3 mouse fibroblasts with Mycoplasma orale induces the mouse cells to produce and secrete collagenase. PMID:6309150

Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

PubMed

Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

2006-08-01

The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification.

PubMed Central

Gundersen, D E; Lee, I M; Rehner, S A; Davis, R E; Kingsbury, D T

1994-01-01

A global phylogenetic analysis using parsimony of 16S rRNA gene sequences from 46 mollicutes, 19 mycoplasmalike organisms (MLOs) (new trivial name, phytoplasmas), and several related bacteria placed the MLOs definitively among the members of the class Mollicutes and revealed that MLOs form a large discrete monophyletic clade, paraphyletic to the Acholeplasma species, within the Anaeroplasma clade. Within the MLO clade resolved in the global mollicutes phylogeny and a comprehensive MLO phylogeny derived by parsimony analyses of 16S rRNA gene sequences from 30 diverse MLOs representative of nearly all known distinct MLO groups, five major phylogenetic groups with a total of 11 distinct subclades (monophyletic groups or taxa) could be recognized. These MLO subclades (roman numerals) and designated type strains were as follows: i, Maryland aster yellows AY1; ii, apple proliferation AP-A; iii, peanut witches'-broom PnWB; iv, Canada peach X CX; v, rice yellow dwarf RYD; vi, pigeon pea witches'-broom PPWB; vii, palm lethal yellowing LY; viii, ash yellows AshY; ix, clover proliferation CP; x, elm yellows EY; and xi, loofah witches'-broom LfWB. The designations of subclades and their phylogenetic positions within the MLO clade were supported by a congruent phylogeny derived by parsimony analyses of ribosomal protein L22 gene sequences from most representative MLOs. On the basis of the phylogenies inferred in the present study, we propose that MLOs should be represented taxonomically at the minimal level of genus and that each phylogenetically distinct MLO subclade identified should represent at least a distinct species under this new genus. Images PMID:8071198

Proposal for a histopathological consensus classification of the periprosthetic interface membrane

PubMed Central

Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-01-01

Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

PubMed

Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-06-01

The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

Environmentally Safe and Effective Processes for Paint Removal

DTIC Science & Technology

1995-04-01

Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

Ehlers-Danlos syndrome type IV

PubMed Central

Germain, Dominique P

2007-01-01

Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

PubMed

Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

2016-01-01

Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

PubMed

Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

2016-05-01

To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

[Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

PubMed

Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

2012-01-01

Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed Central

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

PubMed

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Mechanisms of chiral discrimination by topoisomerase IV

PubMed Central

Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

2009-01-01

Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

PubMed

Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

2016-11-01

To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

PubMed Central

Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

2011-01-01

Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

PubMed

Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

2016-02-28

Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

PubMed

Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

2013-12-01

Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

PubMed

Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

2017-05-04

Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

[Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

PubMed

Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

2014-10-01

To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

Worldwide Spread of Dengue Virus Type 1

PubMed Central

Villabona-Arenas, Christian Julián; Zanotto, Paolo Marinho de Andrade

2013-01-01

Background DENV-1 is one of the four viral serotypes that causes Dengue, the most common mosquito-borne viral disease of humans. The prevalence of these viruses has grown in recent decades and is now present in more than 100 countries. Limited studies document the spread of DENV-1 over the world despite its importance for human health. Methodology/Principal Findings We used representative DENV-1 envelope gene sequences to unravel the dynamics of viral diffusion under a Bayesian phylogeographic approach. Data included strains from 45 distinct geographic locations isolated from 1944 to 2009. The estimated mean rate of nucleotide substitution was 6.56×10−4 substitutions/site/year. The larger genotypes (I, IV and V) had a distinctive phylogenetic structure and since 1990 they experienced effective population size oscillations. Thailand and Indonesia represented the main sources of strains for neighboring countries. Besides, Asia broadcast lineages into the Americas and the Pacific region that diverged in isolation. Also, a transmission network analysis revealed the pivotal role of Indochina in the global diffusion of DENV-1 and of the Caribbean in the diffusion over the Americas. Conclusions/Significance The study summarizes the spatiotemporal DENV-1 worldwide spread that may help disease control. PMID:23675416

Structural and electronic properties of the alkali metal incommensurate phases

NASA Astrophysics Data System (ADS)

Woolman, Gavin; Naden Robinson, Victor; Marqués, Miriam; Loa, Ingo; Ackland, Graeme J.; Hermann, Andreas

2018-05-01

Under pressure, the alkali elements sodium, potassium, and rubidium adopt nonperiodic structures based on two incommensurate interpenetrating lattices. While all elements form the same "host" lattice, their "guest" lattices are all distinct. The physical mechanism that stabilizes these phases is not known, and detailed calculations are challenging due to the incommensurability of the lattices. Using a series of commensurate approximant structures, we tackle this issue using density functional theory calculations. In Na and K, the calculations prove accurate enough to reproduce not only the stability of the host-guest phases, but also the complicated pressure dependence of the host-guest ratio and the two guest-lattice transitions. We find Rb-IV to be metastable at all pressures, and suggest it is a high-temperature phase. The electronic structure of these materials is unique: they exhibit two distinct, coexisting types of electride behavior, with both fully localized pseudoanions and electrons localized in 1D wells in the host lattice, leading to low conductivity. While all phases feature pseudogaps in the electronic density of states, the perturbative free-electron picture applies to Na, but not to K and Rb, due to significant d -orbital population in the latter.

Unilateral congenital terminal finger absences: a condition that differs from symbrachydactyly.

PubMed

Knight, Jeffrey B; Pritsch, Tamir; Ezaki, Marybeth; Oishi, Scott N

2012-01-01

To describe a type of nonhereditary unilateral transverse deficiency, which we have named hypodactyly, that is distinct from symbrachydactyly or amniotic disruption sequence. We identified 19 patients with unilateral congenital anomalies consisting of absent or short bulbous fingers that lack terminal ectodermal elements. Medical records and radiographs were retrospectively reviewed and contrasted with the typical findings of symbrachydactyly and amniotic disruption sequence. No associated syndromes or potentially causative diagnoses were identified in the hypodactyly patients. The digital absences were of a truncated pattern with thickened, tubular soft tissue coverage. Radiographs revealed a pattern of severity progression that is different from that of symbrachydactyly. Distal phalanges were the bony elements absent most frequently, followed sequentially by the middle phalanx and proximal phalanx. In all cases, metacarpals were present. Unlike symbrachydactyly, the ulnar 2 digits were more involved than the index and long fingers, and the thumb was the least involved digit. Hypodactyly appears to be a congenital hand anomaly that is clinically and radiographically different from symbrachydactyly or amniotic disruption sequence and is presumed to be caused by a distinct pathomechanism. Prognostic IV. Copyright © 2012 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

PubMed Central

Roos, David S.; Pohlschröder, Mechthild

2011-01-01

Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

Accentuated hyperparathyroidism in type II Bartter syndrome.

PubMed

Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

2016-07-01

Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

Amitriptyline induces brain-derived neurotrophic factor (BDNF) mRNA expression through ERK-dependent modulation of multiple BDNF mRNA variants in primary cultured rat cortical astrocytes and microglia.

PubMed

Hisaoka-Nakashima, Kazue; Kajitani, Naoto; Kaneko, Masahiro; Shigetou, Takahiro; Kasai, Miho; Matsumoto, Chie; Yokoe, Toshiki; Azuma, Honami; Takebayashi, Minoru; Morioka, Norimitsu; Nakata, Yoshihiro

2016-03-01

A significant role of brain-derived neurotrophic factor (BDNF) has been previously implicated in the therapeutic effect of antidepressants. To ascertain the contribution of specific cell types in the brain that produce BDNF following antidepressant treatment, the effects of the tricyclic antidepressant amitriptyline on rat primary neuronal, astrocytic and microglial cortical cultures were examined. Amitriptyline increased the expression of BDNF mRNA in astrocytic and microglial cultures but not neuronal cultures. Antidepressants with distinct mechanisms of action, such as clomipramine, duloxetine and fluvoxamine, also increased BDNF mRNA expression in astrocytic and microglial cultures. There are multiple BDNF mRNA variants (exon I, IIA, IV and VI) expressed in astrocytes and microglia and the variant induced by antidepressants has yet to be elaborated. Treatment with antidepressants increased the expression of exon I, IV and VI in astrocyte and microglia. Clomipramine alone significantly upregulated expression of exon IIA. The amitriptyline-induced expression of both total and individual BDNF mRNA variants (exon I, IV and VI) were blocked by MEK inhibitor U0126, indicating MEK/ERK signaling is required in the expression of BDNF. These findings indicate that non-neural cells are a significant target of antidepressants and further support the contention that glial production of BDNF is crucial role in the therapeutic effect of antidepressants. The current data suggest that targeting of glial function could lead to the development of antidepressants with a truly novel mechanism of action. Copyright © 2016 Elsevier B.V. All rights reserved.

Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, K. R.

1994-01-01

Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

Field occurrences and petrology of eclogites from the Dabie Mountains, Anhui, central China

NASA Astrophysics Data System (ADS)

Wang, X.; Jing, Y.; Liou, J. G.; Pan, G.; Liang, W.; Xia, M.; Maruyama, S.

1990-11-01

Four distinct types of eclogites are recognized according to their field occurrences and mineral parageneses in a gneiss terrane of the Dabie Mountains, a collision zone between the Sino-Korean and Yangtze cratons in central China. Some eclogites contain coesite and its quartz pseudomorphs enclosed in garnet and omphacite. Type I eclogites occur as layers in serpentinites and contain garnet, clinopyroxene, orthopyroxene, phengite, rutile, and coesite pseudomorph. Type II eclogites occur as lenticular bodies inside serpentinites and contain garnet, clinopyroxene, quartz, rutile, and edenitic hornblende. Type III eclogites occur as blocks of 2 cm to 20 m in size in a matrix of hornblende gneiss and biotite gneiss, and Type IV eclogites occur as thin layers interbedded with amphibolites. P- T estimates for these different eclogites indicate that they were formed under different physical conditions. All the eclogites were affected by later regional metamorphism for which the P- T conditions are estimated. This paper provides an introduction to the abundant eclogites from central China which have not been reported previously in Western literature. Specifically, the mode of field occurrence, petrography, mineral chemistry and formation conditions of the four types of eclogites are described. The paper is thus designed to establish a petrological framework for future detailed studies of the eclogites and their country rocks in an ancient zone of collision.

Genome of Herbaspirillum seropedicae Strain SmR1, a Specialized Diazotrophic Endophyte of Tropical Grasses

PubMed Central

Pedrosa, Fábio O.; Monteiro, Rose Adele; Wassem, Roseli; Cruz, Leonardo M.; Ayub, Ricardo A.; Colauto, Nelson B.; Fernandez, Maria Aparecida; Fungaro, Maria Helena P.; Grisard, Edmundo C.; Hungria, Mariangela; Madeira, Humberto M. F.; Nodari, Rubens O.; Osaku, Clarice A.; Petzl-Erler, Maria Luiza; Terenzi, Hernán; Vieira, Luiz G. E.; Steffens, Maria Berenice R.; Weiss, Vinicius A.; Pereira, Luiz F. P.; Almeida, Marina I. M.; Alves, Lysangela R.; Marin, Anelis; Araujo, Luiza Maria; Balsanelli, Eduardo; Baura, Valter A.; Chubatsu, Leda S.; Faoro, Helisson; Favetti, Augusto; Friedermann, Geraldo; Glienke, Chirlei; Karp, Susan; Kava-Cordeiro, Vanessa; Raittz, Roberto T.; Ramos, Humberto J. O.; Ribeiro, Enilze Maria S. F.; Rigo, Liu Un; Rocha, Saul N.; Schwab, Stefan; Silva, Anilda G.; Souza, Eliel M.; Tadra-Sfeir, Michelle Z.; Torres, Rodrigo A.; Dabul, Audrei N. G.; Soares, Maria Albertina M.; Gasques, Luciano S.; Gimenes, Ciela C. T.; Valle, Juliana S.; Ciferri, Ricardo R.; Correa, Luiz C.; Murace, Norma K.; Pamphile, João A.; Patussi, Eliana Valéria; Prioli, Alberto J.; Prioli, Sonia Maria A.; Rocha, Carmem Lúcia M. S. C.; Arantes, Olívia Márcia N.; Furlaneto, Márcia Cristina; Godoy, Leandro P.; Oliveira, Carlos E. C.; Satori, Daniele; Vilas-Boas, Laurival A.; Watanabe, Maria Angélica E.; Dambros, Bibiana Paula; Guerra, Miguel P.; Mathioni, Sandra Marisa; Santos, Karine Louise; Steindel, Mario; Vernal, Javier; Barcellos, Fernando G.; Campo, Rubens J.; Chueire, Ligia Maria O.; Nicolás, Marisa Fabiana; Pereira-Ferrari, Lilian; da Conceição Silva, José L.; Gioppo, Nereida M. R.; Margarido, Vladimir P.; Menck-Soares, Maria Amélia; Pinto, Fabiana Gisele S.; Simão, Rita de Cássia G.; Takahashi, Elizabete K.; Yates, Marshall G.; Souza, Emanuel M.

2011-01-01

The molecular mechanisms of plant recognition, colonization, and nutrient exchange between diazotrophic endophytes and plants are scarcely known. Herbaspirillum seropedicae is an endophytic bacterium capable of colonizing intercellular spaces of grasses such as rice and sugar cane. The genome of H. seropedicae strain SmR1 was sequenced and annotated by The Paraná State Genome Programme—GENOPAR. The genome is composed of a circular chromosome of 5,513,887 bp and contains a total of 4,804 genes. The genome sequence revealed that H. seropedicae is a highly versatile microorganism with capacity to metabolize a wide range of carbon and nitrogen sources and with possession of four distinct terminal oxidases. The genome contains a multitude of protein secretion systems, including type I, type II, type III, type V, and type VI secretion systems, and type IV pili, suggesting a high potential to interact with host plants. H. seropedicae is able to synthesize indole acetic acid as reflected by the four IAA biosynthetic pathways present. A gene coding for ACC deaminase, which may be involved in modulating the associated plant ethylene-signaling pathway, is also present. Genes for hemagglutinins/hemolysins/adhesins were found and may play a role in plant cell surface adhesion. These features may endow H. seropedicae with the ability to establish an endophytic life-style in a large number of plant species. PMID:21589895

Genome of Herbaspirillum seropedicae strain SmR1, a specialized diazotrophic endophyte of tropical grasses.

PubMed

Pedrosa, Fábio O; Monteiro, Rose Adele; Wassem, Roseli; Cruz, Leonardo M; Ayub, Ricardo A; Colauto, Nelson B; Fernandez, Maria Aparecida; Fungaro, Maria Helena P; Grisard, Edmundo C; Hungria, Mariangela; Madeira, Humberto M F; Nodari, Rubens O; Osaku, Clarice A; Petzl-Erler, Maria Luiza; Terenzi, Hernán; Vieira, Luiz G E; Steffens, Maria Berenice R; Weiss, Vinicius A; Pereira, Luiz F P; Almeida, Marina I M; Alves, Lysangela R; Marin, Anelis; Araujo, Luiza Maria; Balsanelli, Eduardo; Baura, Valter A; Chubatsu, Leda S; Faoro, Helisson; Favetti, Augusto; Friedermann, Geraldo; Glienke, Chirlei; Karp, Susan; Kava-Cordeiro, Vanessa; Raittz, Roberto T; Ramos, Humberto J O; Ribeiro, Enilze Maria S F; Rigo, Liu Un; Rocha, Saul N; Schwab, Stefan; Silva, Anilda G; Souza, Eliel M; Tadra-Sfeir, Michelle Z; Torres, Rodrigo A; Dabul, Audrei N G; Soares, Maria Albertina M; Gasques, Luciano S; Gimenes, Ciela C T; Valle, Juliana S; Ciferri, Ricardo R; Correa, Luiz C; Murace, Norma K; Pamphile, João A; Patussi, Eliana Valéria; Prioli, Alberto J; Prioli, Sonia Maria A; Rocha, Carmem Lúcia M S C; Arantes, Olívia Márcia N; Furlaneto, Márcia Cristina; Godoy, Leandro P; Oliveira, Carlos E C; Satori, Daniele; Vilas-Boas, Laurival A; Watanabe, Maria Angélica E; Dambros, Bibiana Paula; Guerra, Miguel P; Mathioni, Sandra Marisa; Santos, Karine Louise; Steindel, Mario; Vernal, Javier; Barcellos, Fernando G; Campo, Rubens J; Chueire, Ligia Maria O; Nicolás, Marisa Fabiana; Pereira-Ferrari, Lilian; Silva, José L da Conceição; Gioppo, Nereida M R; Margarido, Vladimir P; Menck-Soares, Maria Amélia; Pinto, Fabiana Gisele S; Simão, Rita de Cássia G; Takahashi, Elizabete K; Yates, Marshall G; Souza, Emanuel M

2011-05-01

The molecular mechanisms of plant recognition, colonization, and nutrient exchange between diazotrophic endophytes and plants are scarcely known. Herbaspirillum seropedicae is an endophytic bacterium capable of colonizing intercellular spaces of grasses such as rice and sugar cane. The genome of H. seropedicae strain SmR1 was sequenced and annotated by The Paraná State Genome Programme--GENOPAR. The genome is composed of a circular chromosome of 5,513,887 bp and contains a total of 4,804 genes. The genome sequence revealed that H. seropedicae is a highly versatile microorganism with capacity to metabolize a wide range of carbon and nitrogen sources and with possession of four distinct terminal oxidases. The genome contains a multitude of protein secretion systems, including type I, type II, type III, type V, and type VI secretion systems, and type IV pili, suggesting a high potential to interact with host plants. H. seropedicae is able to synthesize indole acetic acid as reflected by the four IAA biosynthetic pathways present. A gene coding for ACC deaminase, which may be involved in modulating the associated plant ethylene-signaling pathway, is also present. Genes for hemagglutinins/hemolysins/adhesins were found and may play a role in plant cell surface adhesion. These features may endow H. seropedicae with the ability to establish an endophytic life-style in a large number of plant species.

Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

PubMed

Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

2009-06-01

Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

NASA Astrophysics Data System (ADS)

Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

1996-08-01

Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

[Role of Langerhans cells in the physiopathology of atopic dermatitis].

PubMed

Bieber, T

1995-12-01

The demonstration of IgE receptors on the surface of epidermal dendritic cells and on other antigen presenting cells is a crucial element in the understanding of the pathophysiological role of these cells in the genesis of atopic disease, and especially the atopic dermatitis (AD). The sensibilisation phase to an aeroallergen at the level of nasal or bronchial mucosa and even at the skin may be mediated by dendritic cells expressing Fc epsilon RI. Distinct forms of AD may then represent the equivalent of the ellicitation phase of the classical allergic contact dermatitis. Fc epsilon RI would lead, via specific IgE, to an efficient antigen capture, to the activation of the dendritic cells and finally to an antigen presentation. Thus, AD may represent the paradigma of an IgE-mediated type IV reaction.

Geologic youth of galapagos islands confirmed by marine stratigraphy and paleontology.

PubMed

Hickman, C S; Lipps, J H

1985-03-29

Six distinctive types of fossiliferous marine deposits occur on the Galádpagos Islands that provide evidence for the age of emergence of the islands above sea level and hence a maximum age for the islands' terrestrial biota. These subtidal to supratidal deposits include (i) volcanic tuffs with fossils, (ii) limestones and sandstones interbedded with basalt, (iii) terrace deposits, (iv) beach rock, (v) supratidal talus deposits, and (vi) recently uplifted tidal and subtidal rocks and sand. With the exception of (vi), the deposits were previously assigned ages varying from Miocene to Pleistocene, but all are less than about 2 million years old. This age, together with independently determined geologic ages, indicate that the islands emerged from the sea relatively recently and that all evolution of the islands' unique terrestrial biota occurred within the past 3 to 4 million years.

A new, empirically established hypochondriasis diagnosis.

PubMed

Fink, Per; Ørnbøl, Eva; Toft, Tomas; Sparle, Kaj Christensen; Frostholm, Lisbeth; Olesen, Frede

2004-09-01

The narrow ICD-10 and DSM-IV definition of hypochondriasis makes it rarely used yet does not prevent extensive diagnosis overlap. This study identified a distinct hypochondriasis symptom cluster and defined diagnostic criteria. Consecutive patients (N=1,785) consulting primary care physicians for new illness were screened for somatization, anxiety, depression, and alcohol abuse. A stratified subgroup of 701 patients were interviewed with the Schedules for Clinical Assessment in Neuropsychiatry and questions addressing common hypochondriasis symptoms. Symptom patterns were analyzed by latent class analysis. Patients fell into three classes based on six symptoms: preoccupation with the idea of harboring an illness or with bodily function, rumination about illness, suggestibility, unrealistic fear of infection, fascination with medical information, and fear of prescribed medication. All symptoms, particularly rumination, were frequent in one of the classes. Classification allowed definition of new diagnostic criteria for hypochondriasis and division of the cases into "mild" and "severe." The weighted prevalence of severe cases was 9.5% versus 5.8% for DSM-IV hypochondriasis. Compared with DSM-IV hypochondriasis, this approach produced less overlap with other somatoform disorders, similar overlap with nonsomatoform psychiatric disorders, and similar assessments by primary care physicians. Severe cases of the new hypochondriasis lasted 2 or more years in 54.3% of the subjects and 1 month or less in 27.2%. These results suggest that rumination about illness plus at least one of five other symptoms form a distinct diagnostic entity performing better than the current DSM-IV hypochondriasis diagnosis. However, these criteria are preliminary, awaiting cross-validation in other subject groups.

Factor structure of DSM-IV criteria for obsessive compulsive personality disorder in patients with binge eating disorder.

PubMed

Grilo, C M

2004-01-01

To examine the factor structure of DSM-IV criteria for obsessive compulsive personality disorder (OCPD) in patients with binge eating disorder (BED). Two hundred and eleven consecutive out-patients with axis I diagnoses of BED were reliably assessed with semi-structured diagnostic interviews. The eight criteria for the OCPD diagnosis were examined with reliability and correlational analyses. Exploratory factor analysis was performed to identify potential components. Cronbach's coefficient alpha for the OCPD criteria was 0.77. Principal components factor analysis with varimax rotation revealed a three-factor solution (rigidity, perfectionism, and miserliness), which accounted for 65% of variance. The DSM-IV criteria for OCPD showed good internal consistency. Exploratory factor analysis, however, revealed three components that may reflect distinct interpersonal, intrapersonal (cognitive), and behavioral features.

Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

PubMed Central

Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

2005-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

Thalamocortical Connections Drive Intracortical Activation of Functional Columns in the Mislaminated Reeler Somatosensory Cortex

PubMed Central

Wagener, Robin J.; Witte, Mirko; Guy, Julien; Mingo-Moreno, Nieves; Kügler, Sebastian; Staiger, Jochen F.

2016-01-01

Neuronal wiring is key to proper neural information processing. Tactile information from the rodent's whiskers reaches the cortex via distinct anatomical pathways. The lemniscal pathway relays whisking and touch information from the ventral posteromedial thalamic nucleus to layer IV of the primary somatosensory “barrel” cortex. The disorganized neocortex of the reeler mouse is a model system that should severely compromise the ingrowth of thalamocortical axons (TCAs) into the cortex. Moreover, it could disrupt intracortical wiring. We found that neuronal intermingling within the reeler barrel cortex substantially exceeded previous descriptions, leading to the loss of layers. However, viral tracing revealed that TCAs still specifically targeted transgenically labeled spiny layer IV neurons. Slice electrophysiology and optogenetics proved that these connections represent functional synapses. In addition, we assessed intracortical activation via immediate-early-gene expression resulting from a behavioral exploration task. The cellular composition of activated neuronal ensembles suggests extensive similarities in intracolumnar information processing in the wild-type and reeler brains. We conclude that extensive ectopic positioning of neuronal partners can be compensated for by cell-autonomous mechanisms that allow for the establishment of proper connectivity. Thus, genetic neuronal fate seems to be of greater importance for correct cortical wiring than radial neuronal position. PMID:26564256

Analysis of class II (hydrolytic) and class I (beta-lyase) apurinic/apyrimidinic endonucleases with a synthetic DNA substrate.

PubMed Central

Levin, J D; Demple, B

1990-01-01

We have developed simple and sensitive assays that distinguish the main classes of apurinic/apyrimidinic (AP) endonucleases: Class I enzymes that cleave on the 3' side of AP sites by beta-elimination, and Class II enzymes that cleave by hydrolysis on the 5' side. The distinction of the two types depends on the use of a synthetic DNA polymer that contains AP sites with 5'-[32P]phosphate residues. Using this approach, we now show directly that Escherichia coli endonuclease IV and human AP endonuclease are Class II enzymes, as inferred previously on the basis of indirect assays. The assay method does not exhibit significant interference by nonspecific nucleases or primary amines, which allows the ready determination of different AP endonuclease activities in crude cell extracts. In this way, we show that virtually all of the Class II AP endonuclease activity in E. coli can be accounted for by two enzymes: exonuclease III and endonuclease IV. In the yeast Saccharomyces cerevisiae, the Class II AP endonuclease activity is totally dependent on a single enzyme, the Apn1 protein, but there are probably multiple Class I enzymes. The versatility and ease of our approach should be useful for characterizing this important class of DNA repair enzymes in diverse systems. PMID:1698278

Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts

PubMed Central

Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.

2016-01-01

Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

Measurement and potential barrier evolution analysis of cold field emission in fracture fabricated Si nanogap

NASA Astrophysics Data System (ADS)

Banerjee, Amit; Hirai, Yoshikazu; Tsuchiya, Toshiyuki; Tabata, Osamu

2017-06-01

Cold field emission characteristics of a fracture fabricated Si nanogap (˜100 nm) were investigated with an ascending electric field (voltage) sweep. The nanogap was formed by controlled fracture of a free-standing silicon micro-beam along <111> direction by a microelectromechanical device, which results in flat, smooth, and conformal electrode pairs. This facilitates simultaneous large area emission, which gives rise to a significant current at low bias voltage, which usually remains indiscernible in nanogaps of this size. The measured emission current-voltage (I-V) characteristics clearly depict two distinct regimes: a linear (I ∝ V) regime at low bias voltage and a nonlinear [ln(I/V 2) ∝ V -1] regime at high bias voltage, separated by a transition point. We propose that the linear regime is owed to direct tunneling of electrons, whereas the nonlinear regime is due to Fowler-Nordheim type emission. This proposition essentially implies that the tunneling potential barrier gradually evolved from a rectangular shape to a triangular shape with increasing field (V). This type of evolution is usually observed in molecular size gaps. We have attempted to correlate the I-V curves acquired through the experiments with the electric field induced barrier shape evolution by numerical calculations involving standard quantum mechanics. The observed linear regime at low bias voltage (<5 V) in a relatively large size gap (˜100 nm) is attributed to the fabrication method adopted in this study. The reported study and the fabricated device are significant for developing a futuristic thermotunneling refrigerator that will find a wide range of application in nanoelectronic devices.

Functional analysis of an unusual type IV pilus in the Gram‐positive Streptococcus sanguinis

PubMed Central

Gurung, Ishwori; Spielman, Ingrid; Davies, Mark R.; Lala, Rajan; Gaustad, Peter; Biais, Nicolas

2015-01-01

Summary Type IV pili (Tfp), which have been studied extensively in a few Gram‐negative species, are the paradigm of a group of widespread and functionally versatile nano‐machines. Here, we performed the most detailed molecular characterisation of Tfp in a Gram‐positive bacterium. We demonstrate that the naturally competent S treptococcus sanguinis produces retractable Tfp, which like their Gram‐negative counterparts can generate hundreds of piconewton of tensile force and promote intense surface‐associated motility. Tfp power ‘train‐like’ directional motion parallel to the long axis of chains of cells, leading to spreading zones around bacteria grown on plates. However, S . sanguinis  Tfp are not involved in DNA uptake, which is mediated by a related but distinct nano‐machine, and are unusual because they are composed of two pilins in comparable amounts, rather than one as normally seen. Whole genome sequencing identified a locus encoding all the genes involved in Tfp biology in S . sanguinis. A systematic mutational analysis revealed that Tfp biogenesis in S . sanguinis relies on a more basic machinery (only 10 components) than in Gram‐negative species and that a small subset of four proteins dispensable for pilus biogenesis are essential for motility. Intriguingly, one of the piliated mutants that does not exhibit spreading retains microscopic motility but moves sideways, which suggests that the corresponding protein controls motion directionality. Besides establishing S . sanguinis as a useful new model for studying Tfp biology, these findings have important implications for our understanding of these widespread filamentous nano‐machines. PMID:26435398

(2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, D.; Wang, L.; Beconi, M.

2010-11-10

A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

USGS Publications Warehouse

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

Piscine Reovirus: Genomic and Molecular Phylogenetic Analysis from Farmed and Wild Salmonids Collected on the Canada/US Pacific Coast

PubMed Central

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul; Richmond, Zina; Johns, Robert; Purcell, Maureen K.; Johnson, Stewart C.; Saksida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period. PMID:26536673

Genetics Home Reference: mucolipidosis type IV

MedlinePlus

... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

Mass loss in the interacting semi-detached binary delta librae

NASA Technical Reports Server (NTRS)

Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

1995-01-01

The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

PubMed

Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

2007-09-01

Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

[Mucolipidoses type IV in a patient with mapuche ancestry].

PubMed

Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

2008-07-01

We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

47 CFR 2.1204 - Import conditions.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., Office of Engineering and Technology, FCC. (iv) Distinctly different models of a product and separate... of units than shown above, written approval must be obtained from the Chief, Office of Engineering... exclusively by the U.S. Government. (7) Three or fewer radio receivers, computers, or other unintentional...

47 CFR 2.1204 - Import conditions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... section, written approval must be obtained from the Chief, Office of Engineering and Technology, FCC; and... approval must be obtained from the Chief, Office of Engineering and Technology, FCC. (iv) Distinctly... fewer radio receivers, computers, or other unintentional radiators as defined in part 15 of this chapter...

47 CFR 2.1204 - Import conditions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... section, written approval must be obtained from the Chief, Office of Engineering and Technology, FCC; and... approval must be obtained from the Chief, Office of Engineering and Technology, FCC. (iv) Distinctly... fewer radio receivers, computers, or other unintentional radiators as defined in part 15 of this chapter...

Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

PubMed

Mak, Ki M; Mei, Rena

2017-08-01

Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Odorant transfer characteristics of white bread during baking.

PubMed

Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

2011-01-01

The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

Differentiating Bipolar Disorder–Not Otherwise Specified and Severe Mood Dysregulation

PubMed Central

Towbin, Kenneth; Axelson, David; Leibenluft, Ellen; Birmaher, Boris

2013-01-01

Objective Bipolar Disorder–Not Otherwise Specified (BP-NOS) and Severe Mood Dysregulation (SMD) are severe mood disorders that were both defined to address questions about the diagnosis of bipolar disorder (BD) in youth. SMD and BP-NOS are distinct phenotypes that differ in clinical presentation and longitudinal course. The purpose of this review is to inform clinicians about the clinical features of the two phenotypes and about the research literature distinguishing them. Method We review the literature on SMD as studied in the National Institute of Mental Health Intramural Research Program and on BP-NOS in youth. For BP-NOS, we focus on the phenotype defined in the Course of Bipolar Youth (COBY) study, since this has received the most study. Results SMD is characterized by impairing, chronic irritability without distinct manic episodes. Most commonly, BP-NOS is characterized by manic, mixed or hypomanic episodes that are too short to meet DSM-IV-TR duration criterion. Research provides strong, albeit suggestive, evidence that SMD is not a form of BD; the most convincing evidence are longitudinal data indicating that youth with SMD are not at high risk to develop BD as they age. The BP-NOS phenotype appears to be on a diagnostic continuum with BD type I and type II. BP-NOS and BD- type I subjects have similar symptom and family history profiles, and youth with BP-NOS are at high risk to develop BD as they age. Currently, little research guides treatment for either phenotype. Conclusions Pressing research needs include identifying effective treatments for these phenotypes, ascertaining biomarkers that predict conversion from BP-NOS to BD, elucidating associations between SMD and other disorders, and defining the neural circuitry mediating each condition. PMID:23622848

Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

PubMed

Busek, P; Stremenová, J; Krepela, E; Sedo, A

2008-01-01

Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

PubMed

Pakravan, Nafiseh; Hassan, Zuhair Mohammad

2018-03-01

Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

PubMed Central

Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

1932-01-01

The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

Demography and Intercontinental Spread of the USA300 Community-Acquired Methicillin-Resistant Staphylococcus aureus Lineage

PubMed Central

Glaser, Philippe; Martins-Simões, Patrícia; Villain, Adrien; Barbier, Maxime; Tristan, Anne; Bouchier, Christiane; Ma, Laurence; Bes, Michele; Laurent, Frederic; Guillemot, Didier; Wirth, Thierry

2016-01-01

ABSTRACT Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) was recognized worldwide during the 1990s; in less than a decade, several genetically distinct CA-MRSA lineages carrying Panton-Valentine leukocidin genes have emerged on every continent. Most notably, in the United States, the sequence type 18-IV (ST8-IV) clone known as USA300 has become highly prevalent, outcompeting methicillin-susceptible S. aureus (MSSA) and other MRSA strains in both community and hospital settings. CA-MRSA bacteria are much less prevalent in Europe, where the European ST80-IV European CA-MRSA clone, USA300 CA-MRSA strains, and other lineages, such as ST22-IV, coexist. The question that arises is whether the USA300 CA-MRSA present in Europe (i) was imported once or on very few occasions, followed by a broad geographic spread, anticipating an increased prevalence in the future, or (ii) derived from multiple importations with limited spreading success. In the present study, we applied whole-genome sequencing to a collection of French USA300 CA-MRSA strains responsible for sporadic cases and micro-outbreaks over the past decade and United States ST8 MSSA and MRSA isolates. Genome-wide phylogenetic analysis demonstrated that the population structure of the French isolates is the product of multiple introductions dating back to the onset of the USA300 CA-MRSA clone in North America. Coalescent-based demography of the USA300 lineage shows that a strong expansion occurred during the 1990s concomitant with the acquisition of the arginine catabolic mobile element and antibiotic resistance, followed by a sharp decline initiated around 2008, reminiscent of the rise-and-fall pattern previously observed in the ST80 lineage. A future expansion of the USA300 lineage in Europe is therefore very unlikely. PMID:26884428

Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

PubMed

Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

2004-06-01

We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

Diagnostic orphans: comparing self-report lifetime course to groups with DSM-IV alcohol abuse and dependence.

PubMed

McBride, Orla; Adamson, Gary; Bunting, Brendan; McCann, Siobhan

2009-01-01

Research has highlighted the significant alcohol symptoms and mental health problems experienced by diagnostic orphans - individuals who experience 1-2 criteria of DSM-IV alcohol dependence but do not meet the criteria for a DSM-IV alcohol use disorder. This study used a sub-sample (n=34827) from the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC), and formed mutually exclusive groups to compare the self-report retrospective course of diagnostic orphans to individuals with DSM-IV abuse and dependence. Multinomial logistic regressions were conducted to examine the associations between the groups and a range of demographic and clinical variables. Collectively, the findings demonstrate that diagnostic orphans shared similar characteristics to the abuse and dependence groups, but appeared to experience specific comorbid mental health problems. Orphan status has the potential to be a persistent condition and may result in significant dysfunction. In conclusion, diagnostic orphans represent a distinct group that may benefit from cost-effective treatment or intervention, designed to prevent the escalation of alcohol symptoms.

Increased levels of circulating platelet-derived microparticles are associated with metastatic cutaneous melanoma.

PubMed

Moreau, Joséphine; Pelletier, Fabien; Biichle, Sabeha; Mourey, Guillaume; Puyraveau, Marc; Badet, Nicolas; Caubet, Matthieu; Laresche, Claire; Garnache-Ottou, Francine; Saas, Philippe; Seilles, Estelle; Aubin, François

2017-10-01

We investigated the plasma levels of PMPs in patients with 45 stage III and 45 stage IV melanoma. PMPs were characterised by flow cytometry and their thrombogenic activity. We also investigated the link between PMPs circulating levels and tumor burden. The circulating levels of PMPs were significantly higher in stage IV (8500 μL -1 ) than in patients with stage III (2041 μL -1 ) melanoma (P=.0001). We calculated a highly specific (93.3%) and predictive (91.7%) cut-off value (5311 μL -1 ) allowing the distinction between high-risk stage III and metastatic stage IV melanoma. The thrombogenic activity of PMPs was significantly higher in patients with stage IV melanoma (clotting time: 40.7 second vs 65 second, P=.0001). There was no significant association between the radiological tumoral syndrome and the plasma level of PMPs. Our data suggest the role of PMPs in metastatic progression of melanoma. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Should the DSM V drop Asperger syndrome?

PubMed

Ghaziuddin, Mohammad

2010-09-01

The DSM IV defines Asperger syndrome (AS) as a pervasive developmental (autistic spectrum) disorder characterized by social deficits and rigid focused interests in the absence of language impairment and cognitive delay. Since its inclusion in the DSM-IV, there has been a dramatic increase in its recognition both in children and adults. However, because studies have generally failed to demonstrate a clear distinction between AS and autism, some researchers have called for its elimination from the forthcoming DSM V. This report argues for a modification of its diagnostic criteria and its continued retention in the diagnostic manual.

Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

PubMed

Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

2011-01-01

Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

NASA Astrophysics Data System (ADS)

Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

2018-03-01

We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

2001-01-01

Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

Depressive Personality Disorder: A Comparison of Three Self-Report Measures

ERIC Educational Resources Information Center

Miller, Joshua D.; Tant, Adam; Bagby, R. Michael

2010-01-01

Depressive personality disorder (DPD) was included in the appendix of the "Diagnostic and Statistical Manual of Mental Disorders", Fourth Edition ("DSM-IV") for further study. Questions abound regarding this disorder in terms of its distinctiveness from extant diagnostic constructs and clinical significance.This study examines…

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

PubMed

Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

2017-04-15

Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

PubMed Central

Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

2017-01-01

ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

Comparative brain morphology of Neotropical parrots (Aves, Psittaciformes) inferred from virtual 3D endocasts.

PubMed

Carril, Julieta; Tambussi, Claudia Patricia; Degrange, Federico Javier; Benitez Saldivar, María Juliana; Picasso, Mariana Beatriz Julieta

2016-08-01

Psittaciformes are a very diverse group of non-passerine birds, with advanced cognitive abilities and highly developed locomotor and feeding behaviours. Using computed tomography and three-dimensional (3D) visualization software, the endocasts of 14 extant Neotropical parrots were reconstructed, with the aim of analysing, comparing and exploring the morphology of the brain within the clade. A 3D geomorphometric analysis was performed, and the encephalization quotient (EQ) was calculated. Brain morphology character states were traced onto a Psittaciformes tree in order to facilitate interpretation of morphological traits in a phylogenetic context. Our results indicate that: (i) there are two conspicuously distinct brain morphologies, one considered walnut type (quadrangular and wider than long) and the other rounded (narrower and rostrally tapered); (ii) Psittaciformes possess a noticeable notch between hemisphaeria that divides the bulbus olfactorius; (iii) the plesiomorphic and most frequently observed characteristics of Neotropical parrots are a rostrally tapered telencephalon in dorsal view, distinctly enlarged dorsal expansion of the eminentia sagittalis and conspicuous fissura mediana; (iv) there is a positive correlation between body mass and brain volume; (v) psittacids are characterized by high EQ values that suggest high brain volumes in relation to their body masses; and (vi) the endocranial morphology of the Psittaciformes as a whole is distinctive relative to other birds. This new knowledge of brain morphology offers much potential for further insight in paleoneurological, phylogenetic and evolutionary studies. © 2015 Anatomical Society.

Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

PubMed

Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

2013-11-01

Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

USDA-ARS?s Scientific Manuscript database

The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

PubMed

Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

2018-03-09

Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

Ultrasensitive response motifs: basic amplifiers in molecular signalling networks

PubMed Central

Zhang, Qiang; Bhattacharya, Sudin; Andersen, Melvin E.

2013-01-01

Multi-component signal transduction pathways and gene regulatory circuits underpin integrated cellular responses to perturbations. A recurring set of network motifs serve as the basic building blocks of these molecular signalling networks. This review focuses on ultrasensitive response motifs (URMs) that amplify small percentage changes in the input signal into larger percentage changes in the output response. URMs generally possess a sigmoid input–output relationship that is steeper than the Michaelis–Menten type of response and is often approximated by the Hill function. Six types of URMs can be commonly found in intracellular molecular networks and each has a distinct kinetic mechanism for signal amplification. These URMs are: (i) positive cooperative binding, (ii) homo-multimerization, (iii) multistep signalling, (iv) molecular titration, (v) zero-order covalent modification cycle and (vi) positive feedback. Multiple URMs can be combined to generate highly switch-like responses. Serving as basic signal amplifiers, these URMs are essential for molecular circuits to produce complex nonlinear dynamics, including multistability, robust adaptation and oscillation. These dynamic properties are in turn responsible for higher-level cellular behaviours, such as cell fate determination, homeostasis and biological rhythm. PMID:23615029

Raman spectroscopic studies of defect structures and phase transition in hyper-stoichiometric UO(2+x).

PubMed

He, Heming; Shoesmith, David

2010-07-28

A method to determine the defect structures in hyper-stoichiometric UO(2+x) using a combination of XRD and Raman spectroscopy has been developed. A sequence of phase transitions, from cubic to tetragonal symmetry, occurs with increasing degree of non-stoichiometry. This sequence proceeds from a cubic phase through an intermediate t''-type tetragonal (axial ratio c/a = 1) phase to a final t-type tetragonal (c/a not = 1) phase. Four distinct structural defect regions can be identified in the stoichiometry range, UO(2) to U(3)O(7): (i) a random point defect structure (x (in UO(2+x)) < or = 0.05); (ii) a non-stoichiometry region (0.05 < or = x < or = 0.15) over which point defects are gradually eliminated and replaced by the Willis 2:2:2 cluster; (iii) a mixture of Willis and cuboctahedral clusters (0.15 < or = x < or = 0.23); (iv) the cuboctahedral cluster (x > or = 0.23). The geometry and steric arrangement of these defects is primarily determined by the concentration of the excess-oxygen interstitials.

Salen- Zr(IV) complex grafted into amine-tagged MIL-101(Cr) as a robust multifunctional catalyst for biodiesel production and organic transformation reactions

NASA Astrophysics Data System (ADS)

Hassan, Hassan M. A.; Betiha, Mohamed A.; Mohamed, Shaimaa K.; El-Sharkawy, E. A.; Ahmed, Emad A.

2017-08-01

The synthesis of metal-organic frameworks (MOFs), porous coordination polymers with functional groups has received immense interest due to the functional groups can offer desirable properties and allow post-synthetic modification. Herein, for the first time, Zr(IV)-Sal Schiff base complex incorporated into amino-functionalized MIL-101(Cr) framework by salicylaldehyde condensing to amino group, and coordinating Zr(IV) ion have been successfully synthesized. The worthiness of the synthesized material as a catalyst has been examined for the esterification of oleic acid (free fatty acid) with methanol producing biodiesel (methyl oleate), Knoveonagel condensation reaction of aldehydes and Friedel-Crafts acylation of anisole. Our findings demonstrated that Salen-Zr(IV) grafted to framework of NH2-MIL-101(Cr) as a solid acid catalyst exhibited distinct catalytic performance for the production of biodiesel by esterification of oleic acid with methanol, Knoveonagel condensation and Friedel-Crafts acylation. These could be attributed to high surface area which allow high distribution of Zr(IV) species lead to a sufficient contact with the reactants species. Furthermore, the catalyst showed excellent recycling efficiency due to the strong interaction between the Zr(IV) ions and chelating groups in the NH2-MIL-101(Cr)-Sal.

Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

PubMed

Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

2014-09-01

Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

Exploring new classification criteria for the earliest type stars: the 3400 Aregion

NASA Astrophysics Data System (ADS)

Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

2002-02-01

We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

NASA Astrophysics Data System (ADS)

Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

2018-04-01

A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

PubMed

Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

2014-04-01

There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

A study of lip print pattern in Goan dental students - A digital approach.

PubMed

Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

2012-10-01

To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

Anomalous ionization seen in the spectra of B supergiants

NASA Technical Reports Server (NTRS)

Cassinelli, J. P.; Abbott, D. C.

1981-01-01

An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

Singular cosmological evolution using canonical and ghost scalar fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

2015-09-01

We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

PubMed

Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

2018-02-06

Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

Intravenous Cocaine Priming Reinstates Cocaine-Induced Conditioned Place Preference

ERIC Educational Resources Information Center

Lombas, Andres S.; Freeman, Kevin B.; Roma, Peter G.; Riley, Anthony L.

2007-01-01

Separate groups of rats underwent an unbiased conditioned place preference (CPP) procedure involving alternate pairings of distinct environments with intravenous (IV) injections of cocaine (0.75 mg/kg) or saline immediately or 15 min after injection. A subsequent extinction phase consisted of exposure to both conditioning environments preceded by…

Binge Eating Disorder: A Review of a New "DSM" Diagnosis

ERIC Educational Resources Information Center

Myers, Laura L.; Wiman, Allison M.

2014-01-01

In 1994, binge eating disorder (BED) was introduced as a disorder requiring further study in the "American Psychiatric Association's Diagnostic and Statistical Manual of Mental Disorders", fourth edition ("DSM-IV"). It is now listed as a distinct eating disorder in the "DSM-5", along with bulimia nervosa and anorexia…

Chitinase modifying proteins from phylogenetically distinct lineages of Brassica pathogens

USDA-ARS?s Scientific Manuscript database

Chitinase modifying proteins (CMPs) are secreted fungal proteases that truncate specific plant class IV chitinases by cleaving peptide bonds in their amino termini. We recently identified a CMP from the Zea mays (maize) pathogen Fusarium verticillioides and found that it is a member of the fungalysi...

Maternal Ratings of Attention Problems in ADHD: Evidence for the Existence of a Continuum

ERIC Educational Resources Information Center

Lubke, Gitta H.; Hudziak, James J.; Derks, Eske M.; van Bijsterveldt, Toos C. E. M.; Boomsma, Dorret I.

2009-01-01

Objective: To investigate whether items assessing attention problems provide evidence of quantitative differences or categorically distinct subtypes of attention problems (APs) and to investigate the relation of empirically derived latent classes to "DSM-IV" diagnoses of subtypes of attention-deficit/hyperactivity disorder (ADHD), for…

Identification of a c-Type Cytochrome Specific for Manganese Dioxide (MnO2) Reduction in Anaeromyxobacter dehalogenans Strain 2CP-C

NASA Astrophysics Data System (ADS)

Pfiffner, S. M.; Nissen, S.; Liu, X.; Chourey, K.; Vishnivetskaya, T. A.; Hettich, R.; Loeffler, F.

2014-12-01

Anaeromyxobacter dehalogenans is a metabolically versatile Deltaproteobacterium and conserves energy from the reduction of various electron acceptors, including insoluble MnO2 and ferric oxides/oxyhydroxides (FeOOH). The goal of this study was to identify c-type cytochromes involved in electron transfer to MnO2. The characterization of deletion mutants has revealed a number of c-type cytochromes involved in electron transfer to solid metal oxides in Shewanella spp. and Geobacter spp; however, a genetic system for Anaeromyxobacter is not available. The A. dehalogenans str. 2CP-C genome encodes 68 putative c-type cytochromes, which all lack functional assignments. To identify c-type cytochromes involved in electron transfer to solid MnO2, protein expression profiles of A. dehalogenans str. 2CP-C cells grown with acetate as electron donor and MnO2, ferric citrate, FeOOH, nitrate or fumarate as electron acceptors were compared. Whole cell proteomes were analyzed after trypsin proteolysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Distinct c-type cytochrome expression patterns were observed with cells grown with different electron acceptors. A. dehalogenans str. 2CP-C grown with MnO2 expressed 25 out of the 68 c-type cytochromes encoded on the genome. The c-type cytochrome Adeh_1278 was only expressed in strain 2CP-C grown with MnO2. Reverse transcription PCR confirmed that the Adeh_1278 gene was transcribed in MnO2-grown cells but not in cells grown with other terminal electron acceptors. The expression of the Adeh_1278 gene correlated with Mn(IV) reduction activity. Adeh_1278 has three heme binding motifs and is predicted to be located in the periplasm. The identification of Adeh_1278 as a protein uniquely expressed when MnO2 serves as electron acceptor suggests its utility as a biomarker for MnO2 reduction. This example demonstrates the value of the LC-MS/MS approach for identifying specific proteins of interest and making functional assignments to proteins, including c-type cytochromes that have not been characterized. The distinctive expression of c-type cytochromes in response to growth with different terminal electron acceptors offers opportunities for functional (i.e., activity) in situ monitoring using metaproteomics or transcript-targeted approaches.

Comparing personality disorder models: cross-method assessment of the FFM and DSM-IV-TR.

PubMed

Samuel, Douglas B; Widiger, Thomas W

2010-12-01

The current edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR; American Psychiatric Association, 2000) defines personality disorders as categorical entities that are distinct from each other and from normal personality traits. However, many scientists now believe that personality disorders are best conceptualized using a dimensional model of traits that span normal and abnormal personality, such as the Five-Factor Model (FFM). However, if the FFM or any dimensional model is to be considered as a credible alternative to the current model, it must first demonstrate an increment in the validity of the assessment offered within a clinical setting. Thus, the current study extended previous research by comparing the convergent and discriminant validity of the current DSM-IV-TR model to the FFM across four assessment methodologies. Eighty-eight individuals receiving ongoing psychotherapy were assessed for the FFM and the DSM-IV-TR personality disorders using self-report, informant report, structured interview, and therapist ratings. The results indicated that the FFM had an appreciable advantage over the DSM-IV-TR in terms of discriminant validity and, at the domain level, convergent validity. Implications of the findings and directions for future research are discussed.

Comparing Personality Disorder Models: Cross-Method Assessment of the FFM and DSM-IV-TR

PubMed Central

Samuel, Douglas B.; Widiger, Thomas A.

2010-01-01

The current edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR; American Psychiatric Association, 2000) defines personality disorders as categorical entities that are distinct from each other and from normal personality traits. However, many scientists now believe that personality disorders are best conceptualized using a dimensional model of traits that span normal and abnormal personality, such as the Five-Factor Model (FFM). However, if the FFM or any dimensional model is to be considered as a credible alternative to the current model, it must first demonstrate an increment in the validity of the assessment offered within a clinical setting. Thus, the current study extended previous research by comparing the convergent and discriminant validity of the current DSM-IV-TR model to the FFM across four assessment methodologies. Eighty-eight individuals receiving ongoing psychotherapy were assessed for the FFM and the DSM-IV-TR personality disorders using self-report, informant report, structured interview, and therapist ratings. The results indicated that the FFM had an appreciable advantage over the DSM-IV-TR in terms of discriminant validity and, at the domain level, convergent validity. Implications of the findings and directions for future research are discussed. PMID:21158596

Neuroradiology and histopathology in two cases of adult medulloblastoma.

PubMed

Romero-Rojas, Alfredo E; Diaz-Perez, Julio A; Raju, Sharat; Lozano-Castillo, Alfonso

2014-04-01

Medulloblastoma (MB) is the most common central nervous system neoplasm in children and only rarely presents in the adult population. Recent molecular biology findings have characterized MB as a heterogeneous neoplasm distinguished by well-defined tumour subsets each with specific histologic and molecular features. Available immunohistochemical stains can now be used to differentiate the distinct molecular types of MB. This report analyzed the histopathologic and neuroradiologic features of two new cases of adult MB. Imaging studies in these patients revealed the morphological appearance of high-grade, well-circumscribed heterogeneous tumours with necrosis, located laterally within the posterior cranial fossa. Histopathology of resected samples demonstrated high-grade tumours (WHO grade IV) containing sheets of undifferentiated neural cells with high mitotic activity and evidence of necrosis. The histopathologic and molecular characteristics of these cases of MB are reviewed for potential applications in new molecular methods of imaging.

Characterizing the inverses of block tridiagonal, block Toeplitz matrices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boffi, Nicholas M.; Hill, Judith C.; Reuter, Matthew G.

2014-12-04

We consider the inversion of block tridiagonal, block Toeplitz matrices and comment on the behaviour of these inverses as one moves away from the diagonal. Using matrix M bius transformations, we first present an O(1) representation (with respect to the number of block rows and block columns) for the inverse matrix and subsequently use this representation to characterize the inverse matrix. There are four symmetry-distinct cases where the blocks of the inverse matrix (i) decay to zero on both sides of the diagonal, (ii) oscillate on both sides, (iii) decay on one side and oscillate on the other and (iv)more » decay on one side and grow on the other. This characterization exposes the necessary conditions for the inverse matrix to be numerically banded and may also aid in the design of preconditioners and fast algorithms. Finally, we present numerical examples of these matrix types.« less

Systemic drug-related intertriginous and flexural exanthema (SDRIFE).

PubMed

Elmariah, Sarina B; Cheung, Wang; Wang, Nadia; Kamino, Hideko; Pomeranz, Miriam K

2009-08-15

A 72-year-old man with a history of metastatic melanoma presented with a two-day history of erythematous and edematous plaques, with scattered bullae on the neck, chest, axillae, and inguinal and gluteal folds, which began five days after infusion of an experimental drug. The clinical and histopathologic findings were consistent with systemic drug-related intertriginous and flexural exanthema (SDRIFE), which is an uncommon drug reaction that results in symmetric erythema that affects the buttocks, groin, and/or thighs as well other flexural folds. The clinical manifestations of SDRIFE are highly characteristic and include distinctive primary cutaneous lesions with a specific distribution and course; however, heterogeneity exists with respect to histopathologic features, skin test results, and in vitro investigations. The exact mechanism of SDRIFE remains unknown but is thought to result from a type IV delayed hypersensitivity immune response. Treatment is symptomatic and includes topical or oral glucocorticoids.

Microbially-mediated method for synthesis of non-oxide semiconductor nanoparticles

DOEpatents

Phelps, Tommy J.; Lauf, Robert J.; Moon, Ji Won; Rondinone, Adam J.; Love, Lonnie J.; Duty, Chad Edward; Madden, Andrew Stephen; Li, Yiliang; Ivanov, Ilia N.; Rawn, Claudia Jeanette

2014-06-24

The invention is directed to a method for producing non-oxide semiconductor nanoparticles, the method comprising: (a) subjecting a combination of reaction components to conditions conducive to microbially-mediated formation of non-oxide semiconductor nanoparticles, wherein said combination of reaction components comprises i) anaerobic microbes, ii) a culture medium suitable for sustaining said anaerobic microbes, iii) a metal component comprising at least one type of metal ion, iv) a non-metal component containing at least one non-metal selected from the group consisting of S, Se, Te, and As, and v) one or more electron donors that provide donatable electrons to said anaerobic microbes during consumption of the electron donor by said anaerobic microbes; and (b) isolating said non-oxide semiconductor nanoparticles, which contain at least one of said metal ions and at least one of said non-metals. The invention is also directed to non-oxide semiconductor nanoparticle compositions produced as above and having distinctive properties.

Neurogenic Radial Glia-like Cells in Meninges Migrate and Differentiate into Functionally Integrated Neurons in the Neonatal Cortex.

PubMed

Bifari, Francesco; Decimo, Ilaria; Pino, Annachiara; Llorens-Bobadilla, Enric; Zhao, Sheng; Lange, Christian; Panuccio, Gabriella; Boeckx, Bram; Thienpont, Bernard; Vinckier, Stefan; Wyns, Sabine; Bouché, Ann; Lambrechts, Diether; Giugliano, Michele; Dewerchin, Mieke; Martin-Villalba, Ana; Carmeliet, Peter

2017-03-02

Whether new neurons are added in the postnatal cerebral cortex is still debated. Here, we report that the meninges of perinatal mice contain a population of neurogenic progenitors formed during embryonic development that migrate to the caudal cortex and differentiate into Satb2 + neurons in cortical layers II-IV. The resulting neurons are electrically functional and integrated into local microcircuits. Single-cell RNA sequencing identified meningeal cells with distinct transcriptome signatures characteristic of (1) neurogenic radial glia-like cells (resembling neural stem cells in the SVZ), (2) neuronal cells, and (3) a cell type with an intermediate phenotype, possibly representing radial glia-like meningeal cells differentiating to neuronal cells. Thus, we have identified a pool of embryonically derived radial glia-like cells present in the meninges that migrate and differentiate into functional neurons in the neonatal cerebral cortex. Copyright © 2016 Elsevier Inc. All rights reserved.

Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

PubMed

Ghoshal, Uday C

2017-07-30

A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

PubMed

Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

2017-10-17

Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Technical Reports Server (NTRS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-01-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Astrophysics Data System (ADS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-08-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

PubMed

Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

2003-03-01

Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

Critical Role of Interdomain Interactions in the Conformational Change and Catalytic Mechanism of Endoplasmic Reticulum Aminopeptidase 1.

PubMed

Stamogiannos, Athanasios; Maben, Zachary; Papakyriakou, Athanasios; Mpakali, Anastasia; Kokkala, Paraskevi; Georgiadis, Dimitris; Stern, Lawrence J; Stratikos, Efstratios

2017-03-14

Endoplasmic reticulum aminopeptidase 1 (ERAP1) is an intracellular enzyme that is important for the generation of antigenic epitopes and major histocompatibility class I-restricted adaptive immune responses. ERAP1 processes a vast variety of different peptides but still shows length and sequence selectivity, although the mechanism behind these properties is poorly understood. X-ray crystallographic analysis has revealed that ERAP1 can assume at least two distinct conformations in which C-terminal domain IV is either proximal or distal to active site domain II. To improve our understanding of the role of this conformational change in the catalytic mechanism of ERAP1, we used site-directed mutagenesis to perturb key salt bridges between domains II and IV. Enzymatic analysis revealed that these mutations, although located away from the catalytic site, greatly reduce the catalytic efficiency and change the allosteric kinetic behavior. The variants were more efficiently activated by small peptides and bound a competitive inhibitor with weaker affinity and faster dissociation kinetics. Molecular dynamics analysis suggested that the mutations affect the conformational distribution of ERAP1, reducing the population of closed states. Small-angle X-ray scattering indicated that both the wild type and the ERAP1 variants are predominantly in an open conformational state in solution. Overall, our findings suggest that electrostatic interactions between domains II and IV in ERAP1 are crucial for driving a conformational change that regulates the structural integrity of the catalytic site. The extent of domain opening in ERAP1 probably underlies its specialization for antigenic peptide precursors and should be taken into account in inhibitor development efforts.

Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

PubMed

Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

2013-04-01

Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

PubMed

Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

2017-12-01

The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

PubMed

Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

2017-08-01

We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

Discovery of DPP IV inhibitors by pharmacophore modeling and QSAR analysis followed by in silico screening.

PubMed

Al-Masri, Ihab M; Mohammad, Mohammad K; Taha, Mutasem O

2008-11-01

Dipeptidyl peptidase IV (DPP IV) deactivates the natural hypoglycemic incretin hormones. Inhibition of this enzyme should restore glucose homeostasis in diabetic patients making it an attractive target for the development of new antidiabetic drugs. With this in mind, the pharmacophoric space of DPP IV was explored using a set of 358 known inhibitors. Thereafter, genetic algorithm and multiple linear regression analysis were employed to select an optimal combination of pharmacophoric models and physicochemical descriptors that yield selfconsistent and predictive quantitative structure-activity relationships (QSAR) (r(2) (287)=0.74, F-statistic=44.5, r(2) (BS)=0.74, r(2) (LOO)=0.69, r(2) (PRESS) against 71 external testing inhibitors=0.51). Two orthogonal pharmacophores (of cross-correlation r(2)=0.23) emerged in the QSAR equation suggesting the existence of at least two distinct binding modes accessible to ligands within the DPP IV binding pocket. Docking experiments supported the binding modes suggested by QSAR/pharmacophore analyses. The validity of the QSAR equation and the associated pharmacophore models were established by the identification of new low-micromolar anti-DPP IV leads retrieved by in silico screening. One of our interesting potent anti-DPP IV hits is the fluoroquinolone gemifloxacin (IC(50)=1.12 muM). The fact that gemifloxacin was recently reported to potently inhibit the prodiabetic target glycogen synthase kinase 3beta (GSK-3beta) suggests that gemifloxacin is an excellent lead for the development of novel dual antidiabetic inhibitors against DPP IV and GSK-3beta.

Extraction behaviour and mechanism of Pt(iv) and Pd(ii) by liquid-liquid extraction with an ionic liquid [HBBIm]Br.

PubMed

Liu, Wenhui; Wang, Qi; Zheng, Yan; Wang, Shubin; Yan, Yan; Yang, Yanzhao

2017-06-06

In this study, a method of one-step separation and recycling of high purity Pd(ii) and Pt(iv) using an ionic liquid, 1-butyl-3-benzimidazolium bromate ([HBBIm]Br), was investigated. The effects of [HBBIm]Br concentration, initial metal concentration, and loading capacity of [HBBIm]Br were examined in detail. It was observed that [HBBIm]Br was a very effective extractant for selectively extracting Pd(ii) and precipitating Pt(iv). Through selectively extracting Pd(ii) and precipitating Pt(iv), each metal with high purity was separately obtained from mixed Pd(ii) and Pt(iv) multi-metal solution. The method of one-step separation of Pd(ii) and Pt(iv) is simple and convenient. The anion exchange mechanism between [HBBIm]Br and Pt(iv) was proven through Job's method and FTIR and 1 H NMR spectroscopies. The coordination mechanism between [HBBIm]Br and Pd(ii) was demonstrated via single X-ray diffraction and was found to be robust and distinct, as supported by the ab initio quantum-chemical studies. The crystals of the [PdBr 2 ·2BBIm] complex were formed first. Moreover, the influence of the concentrations of hydrochloric acid, sodium chloride, and sodium nitrate on the precipitation of Pt(iv) and extraction of Pd(ii) was studied herein. It was found that only the concentration of H + could inhibit the separation of Pt(iv) because H + could attract the anion PtCl 6 2- ; thus, the exchange (anion exchange mechanism) between the anions PtCl 6 2- and Br - was prevented. However, both the concentration of H + and Cl - can obviously inhibit the extraction of Pd(ii) because H + and Cl - are the reaction products and increasing their concentration can inhibit the progress of the reaction (coordination mechanism).

Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

DOE PAGES

Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

2015-03-01

Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

PubMed

Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

2015-10-01

Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

ClinicalTrials.gov

2014-02-14

Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

Specific Phobia among U.S. Adolescents: Phenomenology and Typology

PubMed Central

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2014-01-01

Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

PubMed

Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

2002-12-06

Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

Oxidative mobilization of cerium and uranium and enhanced release of "immobile" high field strength elements from igneous rocks in the presence of the biogenic siderophore desferrioxamine B

NASA Astrophysics Data System (ADS)

Kraemer, Dennis; Kopf, Sebastian; Bau, Michael

2015-09-01

Polyvalent trace elements such as the high field strength elements (HFSE) are commonly considered rather immobile during low-temperature water-rock interaction. Hence, they have become diagnostic tools that are widely applied in geochemical studies. We present results of batch leaching experiments focused on the mobilization of certain HFSE (Y, Zr, Hf, Th, U and rare earth elements) from mafic, intermediate and felsic igneous rocks in the presence and absence, respectively, of the siderophore desferrioxamine B (DFOB). Our data show that DFOB strongly enhances the mobility of these trace elements during low-temperature water-rock interaction. The presence of DFOB produces two distinct features in the Rare Earths and Yttrium (REY) patterns of leaching solutions, regardless of the mineralogical and chemical composition or the texture of the rock type studied. Bulk rock-normalized REY patterns of leaching solutions with DFOB show (i) a very distinct positive Ce anomaly and (ii) depletion of La and other light REY relative to the middle REY, with a concave downward pattern between La and Sm. These features are not observed in experiments with hydrochloric acid, acetic acid or deionized water. In DFOB-bearing leaching solutions Ce and U are decoupled from and selectively enriched relative to light REY and Th, respectively, due to oxidation to Ce(IV) and U(VI). Oxidation of Ce3+ and U4+ is promoted by the significantly higher stability of the Ce(IV) and U(VI) DFOB complexes as compared to the Ce(III) and U(IV) DFOB complexes. This is similar to the relationship between the Ce(IV)- and Ce(III)-pentacarbonate complexes that cause positive Ce anomalies in alkaline lakes. However, while formation of Ce(IV) carbonate complexes is confined to alkaline environments, Ce(IV) DFOB complexes may produce positive Ce anomalies even in mildly acidic and near-neutral natural waters. Siderophore-promoted dissolution processes also significantly enhance mobility of other 'immobile' HFSE and may not only cause or modify Ce anomalies and Th-U fractionation, but also mobilization of and fractionation between Zr, Hf, Th and redox-insensitive REY during weathering, pedogenesis, diagenesis and incongruent dissolution of particles in seawater and freshwater. Siderophores may significantly affect the use of HFSE as geochemical tools. Concave downward light REY patterns may be used as a biosignature for water-rock interaction in the presence of siderophores. Enhanced and preferential mobilization of U relative to Th in the presence of siderophores may produce Th-U signals comparable to those indicative of weathering under oxidized conditions, which might constrain the use of U concentrations and Th/U ratios as a paleoredox-proxy. The enhanced mobilization of Zr and especially Hf from igneous rocks in the presence of DFOB might have implications for the use of the latter as a tracer for the impact of continental weathering on seawater chemistry. Because siderophore complexes affect the particle-reactivity of Hf and Zr, they may prevent effective removal of terrigenous Hf and Zr during aggregation/coagulation of riverine particles in estuaries. Siderophore-promoted solubilization and stabilization might hence be an additional way to transport continental Hf and Zr to the oceans. Furthermore, siderophore-enhanced mobilization may also have implications for the remediation techniques employed to immobilize HFSE such as U, Th and REY, at nuclear waste and reprocessing sites and at REY ore processing plants, where soils are commonly contaminated with these (sometimes radioactive) heavy metals.

Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

1994-01-01

High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

PubMed

Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

2006-04-01

A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

Mucinous (colloid) adenocarcinomas secrete distinct O-acylated forms of sialomucins: a histochemical study of gastric, colorectal and breast adenocarcinomas.

PubMed

Sáez, C; Japón, M A; Poveda, M A; Segura, D I

2001-12-01

Mucinous (colloid) adenocarcinomas represent a distinct group of tumours defined by the presence of large amounts of extracellular mucins. By using histochemical methods, we analysed mucins secreted by mucinous versus non-mucinous adenocarcinomas and looked for differential secretion profiles. Sixty-four adenocarcinomas were studied (23 colorectal, 17 gastric, and 24 breast tumours). Thirty-two tumours were of the colloid type. The following methods were applied to paraffin tissue sections: (i) Alcian blue (pH 2.5) and periodic acid-Schiff (PAS); (ii) high iron diamine and Alcian blue (pH 2.5); (iii) periodic acid borohydride, potassium hydroxide, and PAS; (iv) periodic acid-thionine Schiff, potassium hydroxide, and PAS; and (v) periodic acid-borohydride and PAS. Most adenocarcinomas secreted acidic mucins, with sialomucins predominating over sulfomucins, except for non-mucinous adenocarcinomas of the breast which showed predominant neutral mucins. All mucinous adenocarcinomas contained C9-O-acyl sialic acid as mono, di(C8,C9)-, or tri(C7,C8,C9)-O-acyl forms. Acidic mucins secreted by the majority of non-colloid adenocarcinomas consisted of non-O-acylated sialomucins. C9-O-acylation of sialic acid is a characteristic feature of mucinous adenocarcinomas and can be readily detected by histochemical methods.

Biochemical characterization of two GH70 family 4,6-α-glucanotransferases with distinct product specificity from Lactobacillus aviarius subsp. aviarius DSM 20655.

PubMed

Meng, Xiangfeng; Gangoiti, Joana; de Kok, Niels; van Leeuwen, Sander S; Pijning, Tjaard; Dijkhuizen, Lubbert

2018-07-01

Nine GtfB-like 4,6-α-glucanotransferases (4,6-α-GTs) (represented by GtfX of L. aviarius subsp. aviarius DSM 20655) were identified to show distinct characteristics in conserved motifs I-IV. In particular, the "fingerprint" Tyr in motif III of these nine GtfB-type 4,6-α-GTs was found to be replaced by a Trp. In L. aviarius subsp. aviarius DSM20655, a second GtfB-like protein (GtfY), containing the canonical GtfB Tyr residue in motif III, was located directly upstream of GtfX. Biochemical characterization revealed that both GtfX and GtfY showed GtfB-like 4,6-α-GT activity, cleaving (α1→4) linkages and catalyzing the synthesis of (α1→6) linkages. Nonetheless, they differ in product specificity; GtfY only synthesizes consecutive (α1→6) linkages, yielding linear α-glucan products, but GtfX catalyzes the synthesis of (α1→6) linkages predominantly at branch points (22%) rather than in linear segments (10%). The highly branched α-glucan produced by GtfX from amylose V is resistant to digestion by α-amylase, offering great potential as dietary fibers. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.

PubMed

Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D

2004-06-18

To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.

Potato leafroll virus structural proteins manipulate overlapping, yet distinct protein interaction networks during infection.

PubMed

DeBlasio, Stacy L; Johnson, Richard; Sweeney, Michelle M; Karasev, Alexander; Gray, Stewart M; MacCoss, Michael J; Cilia, Michelle

2015-06-01

Potato leafroll virus (PLRV) produces a readthrough protein (RTP) via translational readthrough of the coat protein amber stop codon. The RTP functions as a structural component of the virion and as a nonincorporated protein in concert with numerous insect and plant proteins to regulate virus movement/transmission and tissue tropism. Affinity purification coupled to quantitative MS was used to generate protein interaction networks for a PLRV mutant that is unable to produce the read through domain (RTD) and compared to the known wild-type PLRV protein interaction network. By quantifying differences in the protein interaction networks, we identified four distinct classes of PLRV-plant interactions: those plant and nonstructural viral proteins interacting with assembled coat protein (category I); plant proteins in complex with both coat protein and RTD (category II); plant proteins in complex with the RTD (category III); and plant proteins that had higher affinity for virions lacking the RTD (category IV). Proteins identified as interacting with the RTD are potential candidates for regulating viral processes that are mediated by the RTP such as phloem retention and systemic movement and can potentially be useful targets for the development of strategies to prevent infection and/or viral transmission of Luteoviridae species that infect important crop species. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

PubMed

Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

2013-11-22

Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

Origin and evolution of dengue virus type 3 in Brazil.

PubMed

de Araújo, Josélio Maria Galvão; Bello, Gonzalo; Romero, Hector; Nogueira, Rita Maria Ribeiro

2012-01-01

The incidence of dengue fever and dengue hemorrhagic fever in Brazil experienced a significant increase since the emergence of dengue virus type-3 (DENV-3) at the early 2000s. Despite the major public health concerns, there have been very few studies of the molecular epidemiology and time-scale of this DENV lineage in Brazil. In this study, we investigated the origin and dispersion dynamics of DENV-3 genotype III in Brazil by examining a large number (n=107) of E gene sequences sampled between 2001 and 2009 from diverse Brazilian regions. These Brazilian sequences were combined with 457 DENV-3 genotype III E gene sequences from 29 countries around the world. Our phylogenetic analysis reveals that there have been at least four introductions of the DENV-3 genotype III in Brazil, as signified by the presence of four phylogenetically distinct lineages. Three lineages (BR-I, BR-II, and BR-III) were probably imported from the Lesser Antilles (Caribbean), while the fourth one (BR-IV) was probably introduced from Colombia or Venezuela. While lineages BR-I and BR-II succeeded in getting established and disseminated in Brazil and other countries from the Southern Cone, lineages BR-III and BR-IV were only detected in one single individual each from the North region. The phylogeographic analysis indicates that DENV-3 lineages BR-I and BR-II were most likely introduced into Brazil through the Southeast and North regions around 1999 (95% HPD: 1998-2000) and 2001 (95% HPD: 2000-2002), respectively. These findings show that importation of DENV-3 lineages from the Caribbean islands into Brazil seems to be relatively frequent. Our study further suggests that the North and Southeast Brazilian regions were the most important hubs of introduction and spread of DENV-3 lineages and deserve an intense epidemiological surveillance.

Structure of the human type IV collagen COL4A6 gene, which is mutated in Alport syndrome-associated leiomyomatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xu; Zhou, Jing; Reeders, S.T.

1996-05-01

Basement membrane (type IV) collagen, a subfamily of the collagen protein family, is encoded by six distinct genes in mammals. Three of those, COL4A3, COL4A4, and COL4A5, are linked with Alport syndrome (hereditary nephritis). Patients with leimoyomatosis associated with Alport syndrome have been shown to have deletions in the 5{prime} end of the COL4A6 gene, in addition to having deletions in COL4A6. The human COL4A6 gene is reported to be 425 kb as determined by mapping of overlapping YAC clones by probes for its 5{prime} and 3{prime} ends. In the present study we describe the complete exon/intron size pattern ofmore » the human COL4A6 gene. The 12 {lambda} phage clones characterized in the study spanned a total of 110 kb, including 85 kb of the actual gene and 25 kb of flanking sequences. The overlapping clones contained all 46 exons of the gene and all introns, except for intron 2. Since the total size of the exons and all introns except for intron 2 is about 85 kb, intron 2 must be about 340 kb. All exons of the gene were assigned to EcoRI restriction fragments to facilitate analysis of the gene in patients with leiomyomatosis associated with Alport syndrome. The exon size pattern of COL4A6 is highly homologous with that of the human and mouse COL4A2 genes, with 27 of the 46 exons of COL4A6 being identical in size between the genes. 42 refs., 2 figs., 3 tabs.« less

Novel Bacterial Topoisomerase Inhibitors with Potent Broad-Spectrum Activity against Drug-Resistant Bacteria.

PubMed

Charrier, Cédric; Salisbury, Anne-Marie; Savage, Victoria J; Duffy, Thomas; Moyo, Emmanuel; Chaffer-Malam, Nathan; Ooi, Nicola; Newman, Rebecca; Cheung, Jonathan; Metzger, Richard; McGarry, David; Pichowicz, Mark; Sigerson, Ralph; Cooper, Ian R; Nelson, Gary; Butler, Hayley S; Craighead, Mark; Ratcliffe, Andrew J; Best, Stuart A; Stokes, Neil R

2017-05-01

The novel bacterial topoisomerase inhibitor class is an investigational type of antibacterial inhibitor of DNA gyrase and topoisomerase IV that does not have cross-resistance with the quinolones. Here, we report the evaluation of the in vitro properties of a new series of this type of small molecule. Exemplar compounds selectively and potently inhibited the catalytic activities of Escherichia coli DNA gyrase and topoisomerase IV but did not block the DNA breakage-reunion step. Compounds showed broad-spectrum inhibitory activity against a wide range of Gram-positive and Gram-negative pathogens, including biodefence microorganisms and Mycobacterium tuberculosis No cross-resistance with fluoroquinolone-resistant Staphylococcus aureus and E. coli isolates was observed. Measured MIC 90 values were 4 and 8 μg/ml against a panel of contemporary multidrug-resistant isolates of Acinetobacter baumannii and E. coli , respectively. In addition, representative compounds exhibited greater antibacterial potency than the quinolones against obligate anaerobic species. Spontaneous mutation rates were low, with frequencies of resistance typically <10 -8 against E. coli and A. baumannii at concentrations equivalent to 4-fold the MIC. Compound-resistant E. coli mutants that were isolated following serial passage were characterized by whole-genome sequencing and carried a single Arg38Leu amino acid substitution in the GyrA subunit of DNA gyrase. Preliminary in vitro safety data indicate that the series shows a promising therapeutic index and potential for low human ether-a-go-go-related gene (hERG) inhibition (50% inhibitory concentration [IC 50 ], >100 μM). In summary, the compounds' distinct mechanism of action relative to the fluoroquinolones, whole-cell potency, low potential for resistance development, and favorable in vitro safety profile warrant their continued investigation as potential broad-spectrum antibacterial agents. Copyright © 2017 American Society for Microbiology.

[Functional morphology of blowfly Calliphora vicina hemocytes].

PubMed

Kind, T V

2012-01-01

In the hemolymph of Calliphora seven types of hemocytes were revealed. These are prohemocytes, which are the stem cells, stable and unstable hyaline cells, thrombocytoids, spindle cells, juvenile plasmatocytes and plasmatocytes I-IV, which represent sequential stages of one cell line differentiation were registered. The margin between them is completion of the crop emptying and beginning of wandering stage. In the feeding and crop emptying larvae take place rising of hyaline cells, thrombocytoids and hyaline cells amount with parallel growth of their defense function. The second wave of hemogenesis occur in the end of crop emptying period. It is accompanied by burst of plasmatocyte I production with their subsequent differentiation to plasmatocytes II-IV. Production of stable hyaline cells and respectively prothrombocytoids may be regulated not only by hormonal background but also by inorganic or organic particles invaded into the hemocel. Three types of hemocytes are involved in loosing of hemolymph from alien particles, notably thrombocytoids, juvenile plasmatocytes and plasmatocytes I and II. Thrombocytoids are responsible for parasitic eggs encapsulation. In addition they can phagocytize tiny organic and inorganic particles. Juvenile plasmatocytes respond to alien invasion almost as quickly as thrombocytoids at the onset of invasion. Plasmatocytes I and II start phagocytosis more slowly, hours post invasion, frequently accumulating the particles previously catched by thrombocytoids. Plasmatocytes I can absorb foreign particles and group in morules and can also surround filled thrombocytoids forming distinctive capsules. Both morules and capsules are temporary structures and disintegrate some hours lately. It is supposed the existence of three levels of immune defence: the fast response reaction of thrombocytoids and juvenile plasmatocytes and slow cellular reactions of plasmatocytes I. They are prerequisites for more extensive humoral response.

Complete Genome Analysis of Three Novel Picornaviruses from Diverse Bat Species▿

PubMed Central

Lau, Susanna K. P.; Woo, Patrick C. Y.; Lai, Kenneth K. Y.; Huang, Yi; Yip, Cyril C. Y.; Shek, Chung-Tong; Lee, Paul; Lam, Carol S. F.; Chan, Kwok-Hung; Yuen, Kwok-Yung

2011-01-01

Although bats are important reservoirs of diverse viruses that can cause human epidemics, little is known about the presence of picornaviruses in these flying mammals. Among 1,108 bats of 18 species studied, three novel picornaviruses (groups 1, 2, and 3) were identified from alimentary specimens of 12 bats from five species and four genera. Two complete genomes, each from the three picornaviruses, were sequenced. Phylogenetic analysis showed that they fell into three distinct clusters in the Picornaviridae family, with low homologies to known picornaviruses, especially in leader and 2A proteins. Moreover, group 1 and 2 viruses are more closely related to each other than to group 3 viruses, which exhibit genome features distinct from those of the former two virus groups. In particular, the group 3 virus genome contains the shortest leader protein within Picornaviridae, a putative type I internal ribosome entry site (IRES) in the 5′-untranslated region instead of the type IV IRES found in group 1 and 2 viruses, one instead of two GXCG motifs in 2A, an L→V substitution in the DDLXQ motif in 2C helicase, and a conserved GXH motif in 3C protease. Group 1 and 2 viruses are unique among picornaviruses in having AMH instead of the GXH motif in 3Cpro. These findings suggest that the three picornaviruses belong to two novel genera in the Picornaviridae family. This report describes the discovery and complete genome analysis of three picornaviruses in bats, and their presence in diverse bat genera/species suggests the ability to cross the species barrier. PMID:21697464

Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

PubMed

Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

2016-10-01

The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

PubMed

Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

2012-06-01

The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

PubMed Central

Watanabe, Ikuya; Wallace, Cameron

2008-01-01

The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

Compassion fatigue and burnout: prevalence among oncology nurses.

PubMed

Potter, Patricia; Deshields, Teresa; Divanbeigi, Joyce; Berger, Julie; Cipriano, Doreen; Norris, Lori; Olsen, Sarah

2010-10-01

This descriptive, cross-sectional survey was conducted in inpatient nursing units and outpatient clinics in a cancer center in the midwestern United States. The sample of 153 healthcare providers included RNs, medical assistants, and radiology technicians. The fourth revision of the 30-item Professional Quality of Life (ProQOL R-IV) scale was used for measuring compassion fatigue, compassion satisfaction, and burnout. A series of cross tab analyses examined the relationship between participant demographics and three ProQOL R-IV subscales. The study sample scored similarly on compassion satisfaction and burnout when compared with participants who used the ProQOL R-IV in previous studies. Value exists in analyzing the prevalence of burnout and compassion fatigue among oncology healthcare providers. Understanding the needs of distinct demographic groups offers valuable direction for intervention program development. Applying internal evidence in the design of a relevant stress-reduction program will better equip healthcare providers to recognize and manage compassion fatigue and burnout.

Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

PubMed Central

Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

2007-01-01

Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

PubMed Central

Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

2014-01-01

Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

PubMed

Breadon, Jonith Y; Barnes, Chad A

2007-01-01

Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

Tri-city study of Ecstasy use problems: a latent class analysis.

PubMed

Scheier, Lawrence M; Ben Abdallah, Arbi; Inciardi, James A; Copeland, Jan; Cottler, Linda B

2008-12-01

This study used latent class analysis to examine distinctive subtypes of Ecstasy users based on 24 abuse and dependence symptoms underlying standard DSM-IV criteria. Data came from a three site, population-based, epidemiological study to examine diagnostic nosology for Ecstasy use. Subject inclusion criteria included lifetime Ecstasy use exceeding five times and once in the past year, with participants ranging in age between 16 and 47 years of age from St. Louis, Miami, U.S. and Sydney, Australia. A satisfactory model typified four latent classes representing clearly differentiated diagnostic clusters including: (1) a group of sub-threshold users endorsing few abuse and dependence symptoms (negatives), (2) a group of 'diagnostic orphans' who had characteristic features of dependence for a select group of symptoms (mild dependent), (3) a 'transitional group' mimicking the orphans with regard to their profile of dependence also but reporting some abuse symptoms (moderate dependent), and (4) a 'severe dependent' group with a distinct profile of abuse and dependence symptoms. A multinomial logistic regression model indicated that certain latent classes showed unique associations with external non-diagnostic markers. Controlling for demographic characteristics and lifetime quantity of Ecstasy pill use, criminal behavior and motivational cues for Ecstasy use were the most efficient predictors of cluster membership. This study reinforces the heuristic utility of DSM-IV criteria applied to Ecstasy but with a different collage of symptoms that produced four distinct classes of Ecstasy users.

Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

PubMed

Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

2017-09-01

Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

ERIC Educational Resources Information Center

Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

2015-01-01

In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

Evidence for a supermassive black hole in the nucleus of the Seyfert galaxy NGC 5548

NASA Technical Reports Server (NTRS)

Crenshaw, D. Michael; Blackwell, James H., Jr.

1990-01-01

The international campaign to monitor the variable Seyfert 1 galaxy NGC 5548 with the IUE has provided an extensive and well-sampled set of spectroscopic observations. These observations are used to study the response of the C IV 1550 A emission-line profile to changes in the photoionizing continuum. Near the end of the IUE campaign, the continuum flux at 1440 A and the total C IV flux dopped by factors of 2.9 and 1.8, respectively, in 16 days. The red wing of the C IV profile responded more rapidly to the sharp continuum drop than the blue wing, indicating that clouds in the inner broad-line region (BLR) are undergoing gravitational infall. These results provide direct evidence that the central engine is a supermassive object, presumably a black hole, with a mass on the order of 10 to the 7th solar masses. Analysis of the profile variations also demonstrates that excess emission in the blue wing of C IV is from a component that is physically distinct from the bulk of the BLR.

Magnetic resonance imaging in patients with obsessive-compulsive disorder with good versus poor insight.

PubMed

Aigner, Martin; Zitterl, Werner; Prayer, Daniela; Demal, Ulrike; Bach, Michael; Prayer, Lucas; Stompe, Thomas; Lenz, Gerhard

2005-11-30

The DSM-IV provides two subtypes of obsessive-compulsive disorder (OCD), labelled as OCD with insight and OCD with poor insight. For the latter, patients generally fail to recognize that the obsessions or compulsions are excessive or unreasonable. Several studies have shown significant brain abnormalities in OCD patients. However, at present, it remains unclear whether a specific pattern of structural brain abnormalities is related to poor insight in OCD. In the present study, magnetic resonance imaging (MRI) findings were compared in OCD patients with insight versus those with poor insight. Outpatients with diagnoses of OCD according to DSM-IV (300.30) and ICD-10 (F42) (n = 84; mean age 38+/-13; 35 females, 49 males) were dichotomized into the two subtypes. All subjects underwent an MRI examination. MRI findings were rated as "MRI abnormality" and "normal MRI." In our sample, 48% of the patients had MRI abnormalities. There was a highly significant difference between the two groups according to frequencies of MRI abnormalities, with 83% of the patients with poor insight showing MRI abnormalities compared with only 21% of the patients with insight. The specifier "poor insight" helps to identify a subgroup of OCD with a higher frequency of brain abnormalities of various types. This distinction should be taken into account in future studies concerning the course and therapeutic outcome of OCD.

Trauma and conditional risk of posttraumatic stress disorder in two American Indian reservation communities.

PubMed

Beals, Janette; Belcourt-Dittloff, Annjeanette; Garroutte, Eva M; Croy, Calvin; Jervis, Lori L; Whitesell, Nancy Rumbaugh; Mitchell, Christina M; Manson, Spero M

2013-06-01

To determine conditional risk of posttraumatic stress disorder (PTSD) in two culturally distinct American Indian reservation communities. Data derived from the American Indian Service Utilization, Psychiatric Epidemiology, Risk and Protective Factors Project, a cross-sectional population-based survey that was completed between 1997 and 2000. This study focused on 1,967 participants meeting the DSM-IV criteria for trauma exposure. Traumas were grouped into interpersonal, non-interpersonal, witnessed, and "trauma to close others" categories. Analyses examined distribution of worst traumas, conditional rates of PTSD following exposure, and distributions of PTSD cases deriving from these events. Bivariate and multivariate logistic regressions estimated associations of lifetime PTSD with trauma type. Overall, 15.9 % of those exposed to DSM-IV trauma qualified for lifetime PTSD, a rate comparable to similar US studies. Women were more likely to develop PTSD than were men. The majority (60 %) of cases of PTSD among women derived from interpersonal trauma exposure (in particular, sexual and physical abuse); among men, cases were more evenly distributed across trauma categories. Previous research has demonstrated higher rates of both trauma exposure and PTSD in American Indian samples compared to other Americans. This study shows that conditional rates of PTSD are similar to those reported elsewhere, suggesting that the elevated prevalence of this disorder in American Indian populations is largely due to higher rates of trauma exposure.

Toward a Typology of High-Risk Major Stressful Events and Situations in Posttraumatic Stress Disorder and Related Psychopathology

PubMed Central

2010-01-01

The diagnosis of posttraumatic stress disorder (PTSD) was introduced in 1980 with the publication of the Diagnostic and Statistical Manual of the American Psychiatric Association, Third Edition (DSM-III). DSM-III put forward a novel syndrome consisting of intrusive, avoidance/numbing, and arousal symptoms as distinctive psychopathology following exposure to traumatic events. The traumatic stressors, although expanded in later editions published in 1987 (DSM-III-R) and 1994 (DSM-IV), focus on life-threatening events and situations. However, at least 12 studies, most of them recent, have found associations between the PTSD symptoms and the PTSD symptom syndrome with stressors, such as unemployment and divorce that would not qualify, even in the broadened DSM-IV diagnosis, as traumatic stressors. These findings challenge the basic assumption on which the PTSD diagnosis is based, the assumption that exposure to life-threatening stressors is the primary cause of a unique set of stress response symptoms. The purpose of this paper is to show how to confront this challenge by developing a typology of stressful situations and events that can be tested systematically for their relation to the PTSD symptom syndrome and other relevant variables. The typology includes but is not limited to the types of situations and events defined as “traumatic” in the DSMs. PMID:20975984

Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

PubMed

Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

2010-08-01

A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

Level III and IV Ecoregions by State

EPA Pesticide Factsheets

Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Level III and IV Ecoregions by EPA Region

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

27 CFR 4.62 - Mandatory statements.

Code of Federal Regulations, 2010 CFR

2010-04-01

..., type, and distinctive designation. The advertisement shall contain a conspicuous statement of the class, type, or distinctive designation to which the product belongs, corresponding with the statement of class, type, or distinctive designation which is required to appear on the label of the product. (c...

Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

PubMed

Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

2010-11-01

Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

PubMed Central

Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

2013-01-01

Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

PubMed

Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

2005-03-01

To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

PubMed

Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

2016-03-01

The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

NASA Astrophysics Data System (ADS)

Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

2018-04-01

We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

Acute pancreatitis complicating choledochal cysts in children.

PubMed

Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

2017-03-01

To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

Mapping structural landmarks, ligand binding sites and missense mutations to the collagen IV heterotrimers predicts major functional domains, novel interactions and variation in phenotypes in inherited diseases affecting basement membranes

PubMed Central

Des Parkin, J.; San Antonio, James D.; Pedchenko, Vadim; Hudson, Billy; Jensen, Shane T.; Savige, Judy

2016-01-01

Collagen IV is the major protein found in basement membranes. It comprises 3 heterotrimers (α1α1α2, α3α4α5, and α5α5α6) that form distinct networks, and are responsible for membrane strength and integrity. We constructed linear maps of the collagen IV heterotrimers (‘interactomes’) that indicated major structural landmarks, known and predicted ligand-binding sites, and missense mutations, in order to identify functional and disease-associated domains, potential interactions between ligands, and genotype-phenotype relationships. The maps documented more than 30 known ligand-binding sites as well as motifs for integrins, heparin, von Willebrand factor (VWF), decorin and bone morphogenetic protein (BMP). They predicted functional domains for angiogenesis and haemostasis, and disease domains for autoimmunity, tumor growth and inhibition, infection and glycation. Cooperative ligand interactions were indicated by binding site proximity, for example, between integrins, matrix metalloproteinases and heparin. The maps indicated that mutations affecting major ligand-binding sites, for example for Von Hippel Lindau (VHL) protein in the α1 chain or integrins in the α5 chain, resulted in distinctive phenotypes (Hereditary Angiopathy, Nephropathy, Aneurysms and muscle Cramps (HANAC) syndrome, and early onset Alport syndrome respectively). These maps further our understanding of basement membrane biology and disease, and suggest novel membrane interactions, functions, and therapeutic targets. PMID:21280145

Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

PubMed

Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

2012-07-01

Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

[Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

PubMed

Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

2003-01-01

The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

Subtypes of depression and their overlap in a naturalistic inpatient sample of major depressive disorder.

PubMed

Musil, Richard; Seemüller, Florian; Meyer, Sebastian; Spellmann, Ilja; Adli, Mazda; Bauer, Michael; Kronmüller, Klaus-Thomas; Brieger, Peter; Laux, Gerd; Bender, Wolfram; Heuser, Isabella; Fisher, Robert; Gaebel, Wolfgang; Schennach, Rebecca; Möller, Hans-Jürgen; Riedel, Michael

2018-03-01

Subtyping depression is important in order to further delineate biological causes of depressive syndromes. The aim of this study was to evaluate clinical and outcome characteristics of distinct subtypes of depression and to assess proportion and features of patients fulfilling criteria for more than one subtype. Melancholic, atypical and anxious subtypes of depression were assessed in a naturalistic sample of 833 inpatients using DSM-IV specifiers based on operationalized criteria. Baseline characteristics and outcome criteria at discharge were compared between distinct subtypes and their overlap. A substantial proportion of patients (16%) were classified with more than one subtype of depression, 28% were of the distinct anxious, 7% of the distinct atypical and 5% of the distinct melancholic subtype. Distinct melancholic patients had shortest duration of episode, highest baseline depression severity, but were more often early improvers; distinct anxious patients had higher NEO-Five Factor Inventory (NEO-FFI) neuroticism scores compared with patients with unspecific subtype. Melancholic patients with overlap of anxious features had worse treatment outcome compared to distinct melancholic and distinct anxious subtype. Distinct subtypes differed in only few variables and patients with overlap of depression subtypes may have independent clinical and outcome characteristics. Studies investigating biological causes of subtypes of depression should take influence of features of other subtypes into account. Copyright © 2017 John Wiley & Sons, Ltd.

Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

PubMed

Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

2017-12-28

The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

Specific phobia among U.S. adolescents: phenomenology and typology.

PubMed

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2012-12-01

Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

PubMed Central

Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

1996-01-01

We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Level III and IV Ecoregions of the Continental United States

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

PubMed Central

Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

2014-01-01

Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

PubMed

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels

PubMed Central

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred

2016-01-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857

The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

PubMed

Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

2007-06-01

Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

2006-10-15

Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

PubMed

Dickens, J C; Prestwich, G D

1989-02-01

For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

PubMed

Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

2017-03-01

We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

PubMed

Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

2015-10-01

To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

2006-12-15

We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

PubMed Central

Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

2014-01-01

Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

PubMed

Hardy, Christine D; Cozzarelli, Nicholas R

2003-03-01

DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

First record of Arthromelodes Jeannel in China, with description of a new species (Coleoptera, Staphylinidae, Pselaphinae).

PubMed

Yin, Zi-Wei

2018-01-01

A new species of Arthromelodes Jeannel, A. choui sp. n. , is described from northern Taitung, Taiwan, representing the first record of the genus in China. The species is distinctive, and may be readily separated from its congeners by the unique structures of male tergite 1(IV), and the aedeagus.

Profiles of Personal Resiliency in Child and Adolescent Psychiatric Inpatients

ERIC Educational Resources Information Center

Kumar, Geetha; Steer, Robert A.; Gulab, Nazli A.

2010-01-01

To ascertain whether children and adolescents whose ages ranged from 9 to 17 years described distinct profiles of personal resiliency, the Resiliency Scales for Children and Adolescents (RSCA) were administered to 100 youth who were admitted to an inpatient psychiatric unit and were diagnosed with various "DSM-IV-TR" disorders along with the Beck…

Distinct Subgroups of Former Foster Youth during Young Adulthood: Implications for Policy and Practice

ERIC Educational Resources Information Center

Courtney, Mark E.; Hook, Jennifer L.; Lee, JoAnn S.

2012-01-01

The Fostering Connections to Success and Increasing Adoptions Act of 2008 ("Fostering Connections Act") fundamentally changed the nature of federal support for young people in state care by extending entitlement funding under Title IV-E of the Social Security Act to age 21 beginning in FY2011. While the Fostering Connections Act provides…

A Family History Study of Asperger Syndrome

ERIC Educational Resources Information Center

Ghaziuddin, Mohammad

2005-01-01

Asperger syndrome (AS) is a childhood-onset disorder often described as a mild variant of autism. Although classified as a distinct disorder in the DSM-IV, its overlap with autism continues to be a matter of ongoing debate. While the family genetic origins of autism are well established, few studies have investigated this topic in AS using current…

Homotypic versus Heterotypic Continuity of Anxiety Symptoms in Young Adolescents: Evidence for Distinctions between DSM-IV Subtypes

ERIC Educational Resources Information Center

Ferdinand, Robert F.; Dieleman, Gwen; Ormel, Johan; Verhulst, Frank C.

2007-01-01

Objective: To investigate homotypic and heterotypic longitudinal patterns of symptoms of separation anxiety disorder (SAD), generalized anxiety disorder (GAD), social phobia (SoPh), panic disorder (PD), and obsessive compulsive disorder (OCD) in young adolescents from the Dutch general population. Method: 2,067 individuals (51.4% girls) from a…

Clinical experience with intravenous Augmentin in the treatment of paediatric infections.

PubMed

Ploechl, E; Huber, E G

1986-01-01

The clinical efficacy of intravenous Augmentin (a formulation containing amoxycillin plus clavulanic acid) was investigated in an open study in fifty-eight children with a mean age of 6 years (range 1-15 years). The normal dosage was in the range 100-200 mg/kg/day Augmentin, administered parenterally by short i.v. infusion in 3 or 4 divided doses. Most patients were hospitalised for lower respiratory tract infections. Complete clinical cure or distinct clinical improvement was achieved in all assessable cases. Bacteriological success was obtained in 92% of the assessable cases. In two patients, mild, transient exanthema was noted after i.v. Augmentin was replaced by oral Augmentin. No additional therapeutic measures were required.

Lesch typology and temperament in opioid dependence: a cross-sectional study.

PubMed

Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

2014-08-01

The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

Electrical and Electron-Phonon Interactions in Graphene-Based Nanostructures and Aptamer-Based Electrical Sensors

NASA Astrophysics Data System (ADS)

Qian, Jun

This research work contains two main parts: the theoretical study of confined phonon modes and electron states in confined graphene nanostructures; the experimental part including two topics about fabricating a graphene-FET aptamer-sensor for cocaine detection and the study of the electronic transport properties of dsDNA. In the theory part, we study the confined optical phonon modes in graphene nanoribbons (GNR) and rectangular graphene quantum dots (RGQD) by the elastic continuum model. The carrier states are studied by effective mass approximation. The phonon bottleneck effect is expected in general for RGQDs. The scattering rates are calculated for specific RGQDs with carefully chosen dimensions to fulfill the momentum and energy conservation conditions. In the experimental part, we have developed a combined technique of semiconductor processes and molecular biological protocols to fabricate a signal-off graphene-FET aptamer-sensor for cocaine. In addition, DNA transport properties were studied by STM on GNP-dsDNA-Au conjugates in atmospheric condition. The dsDNA-complexes exhibit as a slightly n-type semiconductor by simulated with a Landauer-type model. A geometrical model is proposed to explain the distinct I-V spectra.

Two Isoforms of Geobacter sulfurreducens PilA Have Distinct Roles in Pilus Biogenesis, Cytochrome Localization, Extracellular Electron Transfer, and Biofilm Formation

PubMed Central

Richter, Lubna V.; Sandler, Steven J.

2012-01-01

Type IV pili of Geobacter sulfurreducens are composed of PilA monomers and are essential for long-range extracellular electron transfer to insoluble Fe(III) oxides and graphite anodes. A previous analysis of pilA expression indicated that transcription was initiated at two positions, with two predicted ribosome-binding sites and translation start codons, potentially producing two PilA preprotein isoforms. The present study supports the existence of two functional translation start codons for pilA and identifies two isoforms (short and long) of the PilA preprotein. The short PilA isoform is found predominantly in an intracellular fraction. It seems to stabilize the long isoform and to influence the secretion of several outer-surface c-type cytochromes. The long PilA isoform is required for secretion of PilA to the outer cell surface, a process that requires coexpression of pilA with nine downstream genes. The long isoform was determined to be essential for biofilm formation on certain surfaces, for optimum current production in microbial fuel cells, and for growth on insoluble Fe(III) oxides. PMID:22408162

A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

PubMed

Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

2009-05-01

Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

[Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

PubMed

Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

2010-01-01

Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

Audiological findings in children with mucopolysaccharidoses type i-iv.

PubMed

Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

Functional deficiencies of subsarcolemmal mitochondria in the type 2 diabetic human heart

PubMed Central

Croston, Tara L.; Thapa, Dharendra; Holden, Anthony A.; Tveter, Kevin J.; Lewis, Sara E.; Shepherd, Danielle L.; Nichols, Cody E.; Long, Dustin M.; Olfert, I. Mark; Jagannathan, Rajaganapathi

2014-01-01

The mitochondrion has been implicated in the development of diabetic cardiomyopathy. Examination of cardiac mitochondria is complicated by the existence of spatially distinct subpopulations including subsarcolemmal (SSM) and interfibrillar (IFM). Dysfunction to cardiac SSM has been reported in murine models of type 2 diabetes mellitus; however, subpopulation-based mitochondrial analyses have not been explored in type 2 diabetic human heart. The goal of this study was to determine the impact of type 2 diabetes mellitus on cardiac mitochondrial function in the human patient. Mitochondrial subpopulations from atrial appendages of patients with and without type 2 diabetes were examined. Complex I- and fatty acid-mediated mitochondrial respiration rates were decreased in diabetic SSM compared with nondiabetic (P ≤ 0.05 for both), with no change in IFM. Electron transport chain (ETC) complexes I and IV activities were decreased in diabetic SSM compared with nondiabetic (P ≤ 0.05 for both), with a concomitant decline in their levels (P ≤ 0.05 for both). Regression analyses comparing comorbidities determined that diabetes mellitus was the primary factor accounting for mitochondrial dysfunction. Linear spline models examining correlative risk for mitochondrial dysfunction indicated that patients with diabetes display the same degree of state 3 and electron transport chain complex I dysfunction in SSM regardless of the extent of glycated hemoglobin (HbA1c) and hyperglycemia. Overall, the results suggest that independent of other pathologies, mitochondrial dysfunction is present in cardiac SSM of patients with type 2 diabetes and the degree of dysfunction is consistent regardless of the extent of elevated HbA1c or blood glucose levels. PMID:24778174

The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

PubMed

Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

2002-04-02

The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

Risk evaluation for in-vehicle sign information.

DOT National Transportation Integrated Search

2016-05-01

The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

Nonstatic radiating spheres in general relativity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krori, K.D.; Borgohain, P.; Sarma, R.

1985-02-15

The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

DTIC Science & Technology

2010-05-01

Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

NASA Astrophysics Data System (ADS)

Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

2013-09-01

Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

PubMed

Satya, Ramadass; Vijayakumar, Vani

2006-10-01

A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

PubMed

Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

2014-06-01

The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

Biomarker for Glycogen Storage Diseases

ClinicalTrials.gov

2017-07-03

Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

Characterization of the oropharynx: anatomy, histology, immunology, squamous cell carcinoma and surgical resection.

PubMed

Fossum, Croix C; Chintakuntlawar, Ashish V; Price, Daniel L; Garcia, Joaquin J

2017-06-01

Understanding the structure and function of the oropharynx is paramount for providing excellent patient care. In clinical oncology, the oropharynx is generally divided into four distinct components: (i) the base of the tongue; (ii) the soft palate; (iii) the palatine tonsillar fossa; and (iv) the pharyngeal wall. The oropharyngeal mucosa is distinct from other mucosal surfaces in the body, as it is composed of a reticulated epithelium with a discontinuous basement membrane, also known as lymphoepithelium. This review describes the anatomy, histology, immunology and surgical resection of the oropharynx as they relate to oncological care. © 2016 John Wiley & Sons Ltd.

The New Element Berkelium (Atomic Number 97)

DOE R&D Accomplishments Database

Seaborg, G. T.; Thompson, S. G.; Ghiorso, A.

1950-04-26

An isotope of the element with atomic number 97 has been discovered as a product of the helium-ion bombardment of americium. The name berkelium, symbol Bk, is proposed for element 97. The chemical separation of element 97 from the target material and other reaction products was made by combinations of precipitation and ion exchange adsorption methods making use of its anticipated (III) and (IV) oxidation states and its position as a member of the actinide transition series. The distinctive chemical properties made use of in its separation and the equally distinctive decay properties of the particular isotope constitute the principal evidence for the new element.

Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

PubMed Central

Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

2014-01-01

Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

Self aligned hysteresis free carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

2016-04-01

Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

PubMed

Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

2018-05-01

Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

PubMed

Boos, A

2000-01-01

Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

PubMed Central

Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

2017-01-01

The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

PubMed

Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

2016-01-01

Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

Entrapment of viral capsids in nuclear PML cages is an intrinsic antiviral host defense against varicella-zoster virus.

PubMed

Reichelt, Mike; Wang, Li; Sommer, Marvin; Perrino, John; Nour, Adel M; Sen, Nandini; Baiker, Armin; Zerboni, Leigh; Arvin, Ann M

2011-02-03

The herpesviruses, like most other DNA viruses, replicate in the host cell nucleus. Subnuclear domains known as promyelocytic leukemia protein nuclear bodies (PML-NBs), or ND10 bodies, have been implicated in restricting early herpesviral gene expression. These viruses have evolved countermeasures to disperse PML-NBs, as shown in cells infected in vitro, but information about the fate of PML-NBs and their functions in herpesvirus infected cells in vivo is limited. Varicella-zoster virus (VZV) is an alphaherpesvirus with tropism for skin, lymphocytes and sensory ganglia, where it establishes latency. Here, we identify large PML-NBs that sequester newly assembled nucleocapsids (NC) in neurons and satellite cells of human dorsal root ganglia (DRG) and skin cells infected with VZV in vivo. Quantitative immuno-electron microscopy revealed that these distinctive nuclear bodies consisted of PML fibers forming spherical cages that enclosed mature and immature VZV NCs. Of six PML isoforms, only PML IV promoted the sequestration of NCs. PML IV significantly inhibited viral infection and interacted with the ORF23 capsid surface protein, which was identified as a target for PML-mediated NC sequestration. The unique PML IV C-terminal domain was required for both capsid entrapment and antiviral activity. Similar large PML-NBs, termed clastosomes, sequester aberrant polyglutamine (polyQ) proteins, such as Huntingtin (Htt), in several neurodegenerative disorders. We found that PML IV cages co-sequester HttQ72 and ORF23 protein in VZV infected cells. Our data show that PML cages contribute to the intrinsic antiviral defense by sensing and entrapping VZV nucleocapsids, thereby preventing their nuclear egress and inhibiting formation of infectious virus particles. The efficient sequestration of virion capsids in PML cages appears to be the outcome of a basic cytoprotective function of this distinctive category of PML-NBs in sensing and safely containing nuclear aggregates of aberrant proteins.

Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

PubMed Central

Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

2016-01-01

Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

PubMed Central

Harastani, Houda H.; Tokajian, Sima T.

2014-01-01

Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

DTIC Science & Technology

1983-12-01

2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

PubMed

Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

2017-01-01

Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasanth, V.; Chen, Yao; Feng, Shiwei

2016-10-10

Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

Identification of a Novel Feline Picornavirus from the Domestic Cat

PubMed Central

Lau, Susanna K. P.; Woo, Patrick C. Y.; Yip, Cyril C. Y.; Choi, Garnet K. Y.; Wu, Ying; Bai, Ru; Fan, Rachel Y. Y.; Lai, Kenneth K. Y.; Chan, Kwok-Hung

2012-01-01

While picornaviruses are known to infect different animals, their existence in the domestic cat was unknown. We describe the discovery of a novel feline picornavirus (FePV) from stray cats in Hong Kong. From samples from 662 cats, FePV was detected in fecal samples from 14 cats and urine samples from 2 cats by reverse transcription-PCR (RT-PCR). Analysis of five FePV genomes revealed a distinct phylogenetic position and genomic features, with low sequence homologies to known picornaviruses especially in leader and 2A proteins. Among the viruses that belong to the closely related bat picornavirus groups 1 to 3 and the genus Sapelovirus, G+C content and sequence analysis of P1, P2, and P3 regions showed that FePV is most closely related to bat picornavirus group 3. However, FePV possessed other distinct features, including a putative type IV internal ribosome entry site/segment (IRES) instead of type I IRES in bat picornavirus group 3, protein cleavage sites, and H-D-C catalytic triad in 3Cpro different from those in sapeloviruses and bat picornaviruses, and the shortest leader protein among known picornaviruses. These results suggest that FePV may belong to a new genus in the family Picornaviridae. Western blot analysis using recombinant FePV VP1 polypeptide showed a high seroprevalence of 33.6% for IgG among the plasma samples from 232 cats tested. IgM was also detected in three cats positive for FePV in fecal samples, supporting recent infection in these cats. Further studies are important to understand the pathogenicity, epidemiology, and genetic evolution of FePV in these common pet animals. PMID:22031936

Crystal structure of tetra­wickmanite, Mn2+Sn4+(OH)6

PubMed Central

Lafuente, Barbara; Yang, Hexiong; Downs, Robert T.

2015-01-01

The crystal structure of tetra­wickmanite, ideally Mn2+Sn4+(OH)6 [mangan­ese(II) tin(IV) hexa­hydroxide], has been determined based on single-crystal X-ray diffraction data collected from a natural sample from Långban, Sweden. Tetra­wickmanite belongs to the octa­hedral-framework group of hydroxide-perovskite minerals, described by the general formula BB’(OH)6 with a perovskite derivative structure. The structure differs from that of an ABO3 perovskite in that the A site is empty while each O atom is bonded to an H atom. The perovskite B-type cations split into ordered B and B′ sites, which are occupied by Mn2+ and Sn4+, respectively. Tetra­wickmanite exhibits tetra­gonal symmetry and is topologically similar to its cubic polymorph, wickmanite. The tetra­wickmanite structure is characterized by a framework of alternating corner-linked [Mn2+(OH)6] and [Sn4+(OH)6] octa­hedra, both with point-group symmetry -1. Four of the five distinct H atoms in the structure are statistically disordered. The vacant A site is in a cavity in the centre of a distorted cube formed by eight octa­hedra at the corners. However, the hydrogen-atom positions and their hydrogen bonds are not equivalent in every cavity, resulting in two distinct environments. One of the cavities contains a ring of four hydrogen bonds, similar to that found in wickmanite, while the other cavity is more distorted and forms crankshaft-type chains of hydrogen bonds, as previously proposed for tetra­gonal stottite, Fe2+Ge4+(OH)6. PMID:25878828

Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

PubMed

Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

2015-07-01

In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

PubMed

Madabhushi, Ram; Marians, Kenneth J

2009-01-30

In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

C-terminal motifs in promyelocytic leukemia protein isoforms critically regulate PML nuclear body formation.

PubMed

Li, Chuang; Peng, Qiongfang; Wan, Xiao; Sun, Haili; Tang, Jun

2017-10-15

Promyelocytic leukemia protein (PML) nuclear bodies (NBs), which are sub-nuclear protein structures, are involved in a variety of important cellular functions. PML-NBs are assembled by PML isoforms, and contact between small ubiquitin-like modifiers (SUMOs) with the SUMO interaction motif (SIM) are critically involved in this process. PML isoforms contain a common N-terminal region and a variable C-terminus. However, the contribution of the C-terminal regions to PML-NB formation remains poorly defined. Here, using high-resolution microscopy, we show that mutation of the SIM distinctively influences the structure of NBs formed by each individual PML isoform, with that of PML-III and PML-V minimally changed, and PML-I and PML-IV dramatically impaired. We further identify several C-terminal elements that are important in regulating NB structure and provide strong evidence to suggest that the 8b element in PML-IV possesses a strong ability to interact with SUMO-1 and SUMO-2, and critically participates in NB formation. Our findings highlight the importance of PML C-termini in NB assembly and function, and provide molecular insight into the PML-NB assembly of each distinctive isoform. © 2017. Published by The Company of Biologists Ltd.

Binge eating disorder should be included in DSM-IV: a reply to Fairburn et al.'s "the classification of recurrent overeating: the binge eating disorder proposal".

PubMed

Spitzer, R L; Stunkard, A; Yanovski, S; Marcus, M D; Wadden, T; Wing, R; Mitchell, J; Hasin, D

1993-03-01

Extensive recent research supports a proposal that a new eating disorder, binge eating disorder (BED), be included in DSM-IV. BED criteria define a relatively pure group of individuals who are distressed by recurrent binge eating who do not exhibit the compensatory features of bulimia nervosa. This large number of patients currently can only be diagnosed as eating disorder not otherwise specified (EDNOS). Recognizing this new disorder will help stimulate research and clinical programs for these patients. Fairburn et al.'s critique of BED fails to acknowledge the large body of knowledge that indicates that BED represents a distinct and definable subgroup of eating disordered patients and that the diagnosis provides useful information about psychopathology, prognosis, and outcome (Fairburn, Welch, & Hay [in press]. The classification of recurrent overeating: The "binge eating disorder" proposal. International Journal of Eating Disorders.) Against any reasonable standard for adding a new diagnosis to DSM-IV, BED meets the test.

Simulation of dendritic growth reveals necessary and sufficient parameters to describe the shapes of dendritic trees

NASA Astrophysics Data System (ADS)

Trottier, Olivier; Ganguly, Sujoy; Bowne-Anderson, Hugo; Liang, Xin; Howard, Jonathon

For the last 120 years, the development of neuronal shapes has been of great interest to the scientific community. Over the last 30 years, significant work has been done on the molecular processes responsible for dendritic development. In our ongoing research, we use the class IV sensory neurons of the Drosophila melanogaster larva as a model system to understand the growth of dendritic arbors. Our main goal is to elucidate the mechanisms that the neuron uses to determine the shape of its dendritic tree. We have observed the development of the class IV neuron's dendritic tree in the larval stage and have concluded that morphogenesis is defined by 3 distinct processes: 1) branch growth, 2) branching and 3) branch retraction. As the first step towards understanding dendritic growth, we have implemented these three processes in a computational model. Our simulations are able to reproduce the branch length distribution, number of branches and fractal dimension of the class IV neurons for a small range of parameters.

What is generalized anxiety disorder?

PubMed

Rickels, K; Rynn, M A

2001-01-01

Generalized, persistent, and free-floating anxiety was first described by Freud in 1894, although the diagnostic term generalized anxiety disorder (GAD) was not included in classification systems until 1980 (Diagnostic and Statistical Manual for Mental Disorders, Third Edition [DSM-III]). Initially considered a residual category to be used when no other diagnosis could be made, it is now widely accepted that GAD represents a distinct diagnostic category. Since 1980, revisions to the diagnostic criteria for GAD in the DSM-III-R and DSM-IV classifications have markedly redefined this disorder, increasing the duration criterion to 6 months and increasing the emphasis on worry and psychic symptoms. This article reviews the development of the diagnostic criteria for defining GAD from Freud to DSM-IV and compares the DSM-IV criteria with the criteria set forth in the tenth revision of the International Classification of Diseases. The impact of the changes in diagnostic criteria on research into GAD, and on diagnosis, differential diagnosis, and treatment of GAD, will be discussed.

Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

2015-01-01

A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

Unblending Borderline Personality and Bipolar Disorders.

PubMed

di Giacomo, Ester; Aspesi, Flora; Fotiadou, Maria; Arntz, Arnoud; Aguglia, Eugenio; Barone, Lavinia; Bellino, Silvio; Carpiniello, Bernardo; Colmegna, Fabrizia; Lazzari, Marina; Lorettu, Liliana; Pinna, Federica; Sicaro, Aldo; Signorelli, Maria Salvina; Clerici, Massimo

2017-08-01

Borderline Personality (BPD) and Bipolar (BP) disorders stimulate an academic debate between their distinction and the inclusion of Borderline in the Bipolar spectrum. Opponents to this inclusion attribute the important differences and possible diagnostic incomprehension to overlapping symptoms. We tested 248 Borderline and 113 Bipolar patients, consecutively admitted to the Psychiatric Unit, through DSM-IV Axis I and II Disorders (SCID-I/II), Hamilton Depression Rating Scale (HAM-D), Hamilton Anxiety Rating Scale (HAM-A), Young Mania Rating Scale (YMRS) and Borderline Personality Disorder Severity Index-IV (BPDSI-IV). All the tests statistically discriminated the disorders (p < 0.0001). Overlapping symptoms resulted significantly different (impulsivity = 5.32 in BPD vs 1.55 in BP, p < 0.0001; emotional instability = 7.11 in BPD vs 0.55 in BP, p < 0.0001) and the range of their scores gives the opportunity for an even more precise discrimination. Distinctive traits (e.g. irritability or sexual arousal) are also discussed in order to try to qualify the core of these disorders to a higher degree. Comorbidity proves to be extremely small (3.6%). However, Borderline patients with manic features offer a privileged point of view for a deeper analysis. This allows for the possibility of a more precise examination of the nature and load of each symptom. Borderline Personality and Bipolar Disorders can be distinguished with high precision using common and time-sparing tests. The importance of discriminating these clinical features may benefit from this evidence. Copyright © 2017. Published by Elsevier Ltd.

Continuing education for maternal child health nurses: a means to improve the health care of mothers and children.

PubMed Central

Bolte, I M; Presler, E P

1983-01-01

The University of Kentucky College of Nursing is in the 7th year of implementing a 7-year federally funded continuing education project. The major goal of MCH (maternal child health) Project 969, which is scheduled to terminate Sept. 30, 1984, is to develop and offer a series of quality continuing education courses for three distinct populations--practicing maternal child health nurses, State nurse consultants, and nurse supervisors at county or district levels. The purpose of these courses is to improve the practice of the participating nurses and thereby ultimately to improve the health status of mothers and children in Region IV of the Department of Health and Human Services. Evaluation of the project by its staff after its first 5 years showed that (a) it has provided a series of continuing education courses of high quality; (b) met its goals and objectives; (c) provided continuing education for practicing maternal child health nurses that has improved MCH nursing practice in Region IV; (d) provided continuing education for State nurse consultants that has enabled them to become more effective leaders in their respective States; (e) used previously untapped resources in Region IV to make the concept of regional continuing education in maternal child health nursing a reality; and (f) generated a networking system among State nurse consultants, nurse educators, and nurse leaders in other service-oriented Title V programs that has been most effective in meeting the learning needs of the three distinct populations it serves. PMID:6419272

A Comprehensive Analysis of RALF Proteins in Green Plants Suggests There Are Two Distinct Functional Groups

PubMed Central

Campbell, Liam; Turner, Simon R.

2017-01-01

Rapid Alkalinization Factors (RALFs) are small, cysteine-rich peptides known to be involved in various aspects of plant development and growth. Although RALF peptides have been identified within many species, a single wide-ranging phylogenetic analysis of the family across the plant kingdom has not yet been undertaken. Here, we identified RALF proteins from 51 plant species that represent a variety of land plant lineages. The inferred evolutionary history of the 795 identified RALFs suggests that the family has diverged into four major clades. We found that much of the variation across the family exists within the mature peptide region, suggesting clade-specific functional diversification. Clades I, II, and III contain the features that have been identified as important for RALF activity, including the RRXL cleavage site and the YISY motif required for receptor binding. In contrast, members of clades IV that represent a third of the total dataset, is highly diverged and lacks these features that are typical of RALFs. Members of clade IV also exhibit distinct expression patterns and physico-chemical properties. These differences suggest a functional divergence of clades and consequently, we propose that the peptides within clade IV are not true RALFs, but are more accurately described as RALF-related peptides. Expansion of this RALF–related clade in the Brassicaceae is responsible for the large number of RALF genes that have been previously described in Arabidopsis thaliana. Future experimental work will help to establish the nature of the relationship between the true RALFs and the RALF-related peptides, and whether they function in a similar manner. PMID:28174582

The LIM and POU homeobox genes ttx-3 and unc-86 act as terminal selectors in distinct cholinergic and serotonergic neuron types.

PubMed

Zhang, Feifan; Bhattacharya, Abhishek; Nelson, Jessica C; Abe, Namiko; Gordon, Patricia; Lloret-Fernandez, Carla; Maicas, Miren; Flames, Nuria; Mann, Richard S; Colón-Ramos, Daniel A; Hobert, Oliver

2014-01-01

Transcription factors that drive neuron type-specific terminal differentiation programs in the developing nervous system are often expressed in several distinct neuronal cell types, but to what extent they have similar or distinct activities in individual neuronal cell types is generally not well explored. We investigate this problem using, as a starting point, the C. elegans LIM homeodomain transcription factor ttx-3, which acts as a terminal selector to drive the terminal differentiation program of the cholinergic AIY interneuron class. Using a panel of different terminal differentiation markers, including neurotransmitter synthesizing enzymes, neurotransmitter receptors and neuropeptides, we show that ttx-3 also controls the terminal differentiation program of two additional, distinct neuron types, namely the cholinergic AIA interneurons and the serotonergic NSM neurons. We show that the type of differentiation program that is controlled by ttx-3 in different neuron types is specified by a distinct set of collaborating transcription factors. One of the collaborating transcription factors is the POU homeobox gene unc-86, which collaborates with ttx-3 to determine the identity of the serotonergic NSM neurons. unc-86 in turn operates independently of ttx-3 in the anterior ganglion where it collaborates with the ARID-type transcription factor cfi-1 to determine the cholinergic identity of the IL2 sensory and URA motor neurons. In conclusion, transcription factors operate as terminal selectors in distinct combinations in different neuron types, defining neuron type-specific identity features.

Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

PubMed

Hardie, Andrew D; Kereshi, Borko

2014-06-01

Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

Distribution of Diverse Escherichia coli between Cattle and Pasture.

PubMed

NandaKafle, Gitanjali; Seale, Tarren; Flint, Toby; Nepal, Madhav; Venter, Stephanus N; Brözel, Volker S

2017-09-27

Escherichia coli is widely considered to not survive for extended periods outside the intestines of warm-blooded animals; however, recent studies demonstrated that E. coli strains maintain populations in soil and water without any known fecal contamination. The objective of this study was to investigate whether the niche partitioning of E. coli occurs between cattle and their pasture. We attempted to clarify whether E. coli from bovine feces differs phenotypically and genotypically from isolates maintaining a population in pasture soil over winter. Soil, bovine fecal, and run-off samples were collected before and after the introduction of cattle to the pasture. Isolates (363) were genotyped by uidA and mutS sequences and phylogrouping, and evaluated for curli formation (Rough, Dry, And Red, or RDAR). Three types of clusters emerged, viz. bovine-associated, clusters devoid of cattle isolates and representing isolates endemic to the pasture environment, and clusters with both. All isolates clustered with strains of E. coli sensu stricto, distinct from the cryptic species Clades I, III, IV, and V. Pasture soil endemic and bovine fecal populations had very different phylogroup distributions, indicating niche partitioning. The soil endemic population was largely comprised of phylogroup B1 and had a higher average RDAR score than other isolates. These results indicate the existence of environmental E. coli strains that are phylogenetically distinct from bovine fecal isolates, and that have the ability to maintain populations in the soil environment.

Compact groups in theory and practice - IV. The connection to large-scale structure

NASA Astrophysics Data System (ADS)

Mendel, J. Trevor; Ellison, Sara L.; Simard, Luc; Patton, David R.; McConnachie, Alan W.

2011-12-01

We investigate the properties of photometrically selected compact groups (CGs) in the Sloan Digital Sky Survey. In this paper, the fourth in a series, we focus on understanding the characteristics of our observed CG sample with particular attention paid to quantifying and removing contamination from projected foreground or background galaxies. Based on a simple comparison of pairwise redshift likelihoods, we find that approximately half of CGs in the parent sample contain one or more projected (interloping) members; our final clean sample contains 4566 galaxies in 1086 CGs. We show that half of the remaining CGs are associated with rich groups (or clusters), i.e. they are embedded sub-structure. The other half have spatial distributions and number-density profiles consistent with the interpretation that they are either independently distributed structures within the field (i.e. they are isolated) or associated with relatively poor structures. Comparisons of late-type and red-sequence fractions in radial annuli show that galaxies around apparently isolated CGs resemble the field population by 300 to 500 kpc from the group centre. In contrast, the galaxy population surrounding embedded CGs appears to remain distinct from the field out beyond 1 to 2 Mpc, consistent with results for rich groups. We take this as additional evidence that the observed distinction between CGs, i.e. isolated versus embedded, is a separation between different host environments.

Reduced cortical call to arms differentiates psychopathy from antisocial personality disorder.

PubMed

Drislane, L E; Vaidyanathan, U; Patrick, C J

2013-04-01

Psychopathy and antisocial personality disorder (ASPD) are both characterized by impulsive, externalizing behaviors. Researchers have argued, however, that psychopathy is distinguished from ASPD by the presence of interpersonal-affective features that reflect an underlying deficit in emotional sensitivity. No study to date has tested for differential relations of these disorders with the brain's natural orienting response to sudden aversive events. Method Electroencephalography was used to assess cortical reactivity to abrupt noise probes presented during the viewing of pleasant, neutral and unpleasant pictures in 140 incarcerated males diagnosed using the Psychopathy Checklist - Revised and DSM-IV criteria for ASPD. The primary dependent measure was the P3 event-related potential response to the noise probes. Psychopaths showed significantly smaller amplitude of P3 response to noise probes across trials of all types compared with non-psychopaths. Follow-up analyses revealed that this overall reduction was attributable specifically to the affective-interpersonal features of psychopathy. By contrast, no group difference in general amplitude of probe P3 was evident for ASPD versus non-ASPD participants. The findings demonstrate a reduced cortical orienting response to abrupt aversive stimuli in participants exhibiting features of psychopathy that are distinct from ASPD. The specificity of the observed effect fits with the idea that these distinctive features of psychopathy reflect a deficit in defensive reactivity, or mobilization of the brain's defensive system, in the context of threat cues.

Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

DTIC Science & Technology

2017-05-17

490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

PubMed

Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

2017-01-01

The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

Differential distribution of annexins-I, -II, -IV, and -VI in synovium.

PubMed Central

Goulding, N J; Dixey, J; Morand, E F; Dodds, R A; Wilkinson, L S; Pitsillides, A A; Edwards, J C

1995-01-01

OBJECTIVES--To examine the distribution of four annexins in non-inflamed rheumatoid arthritic and osteoarthritic synovial tissue. METHODS--Frozen sections were stained with monoclonal antibodies (MAb) specific for annexins-I, -II, -IV, and -VI, and for cell lineage related markers including CD68 and CD14 (macrophages), prolyl hydroxylase (fibroblasts), and CD3 (T cells). RESULTS--Each of the annexins was present in synovial tissues in significant amounts in the three groups studied. Annexin-I was predominantly found within the synovial lining layer and double labelling showed it to be present predominantly in cells of the macrophage lineage. In rheumatoid specimens there was increased staining within the lining layer, perivascularly and on macrophages within the tissue stroma. Annexin-II was present in a distribution similar to that of annexin-I, but with more prominent perivascular staining. Annexins-IV and -VI were seen chiefly in association with areas of lymphocyte infiltration in rheumatoid tissue, whereas annexins-I and -II were absent from these areas. Endothelial cells stained weakly positive for annexins-I and -II, and more strongly for -IV and -VI. CONCLUSIONS--This study demonstrates that annexins (particularly annexin-I, a putative mediator of the anti-inflammatory activities of glucocorticoids) are abundant in rheumatoid and non-rheumatoid synovial tissue, annexins-IV and -VI having a distribution distinct from that of -I and -II. Images PMID:7492225

Virus replication as a phenotypic version of polynucleotide evolution.

PubMed

Antoneli, Fernando; Bosco, Francisco; Castro, Diogo; Janini, Luiz Mario

2013-04-01

In this paper, we revisit and adapt to viral evolution an approach based on the theory of branching process advanced by Demetrius et al. (Bull. Math. Biol. 46:239-262, 1985), in their study of polynucleotide evolution. By taking into account beneficial effects, we obtain a non-trivial multivariate generalization of their single-type branching process model. Perturbative techniques allows us to obtain analytical asymptotic expressions for the main global parameters of the model, which lead to the following rigorous results: (i) a new criterion for "no sure extinction", (ii) a generalization and proof, for this particular class of models, of the lethal mutagenesis criterion proposed by Bull et al. (J. Virol. 18:2930-2939, 2007), (iii) a new proposal for the notion of relaxation time with a quantitative prescription for its evaluation, (iv) the quantitative description of the evolution of the expected values in four distinct "stages": extinction threshold, lethal mutagenesis, stationary "equilibrium", and transient. Finally, based on these quantitative results, we are able to draw some qualitative conclusions.

Microbially-mediated method for synthesis of non-oxide semiconductor nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phelps, Tommy J.; Lauf, Robert J.; Moon, Ji-Won

The invention is directed to a method for producing non-oxide semiconductor nanoparticles, the method comprising: (a) subjecting a combination of reaction components to conditions conducive to microbially-mediated formation of non-oxide semiconductor nanoparticles, wherein said combination of reaction components comprises i) anaerobic microbes, ii) a culture medium suitable for sustaining said anaerobic microbes, iii) a metal component comprising at least one type of metal ion, iv) a non-metal component comprising at least one non-metal selected from the group consisting of S, Se, Te, and As, and v) one or more electron donors that provide donatable electrons to said anaerobic microbes duringmore » consumption of the electron donor by said anaerobic microbes; and (b) isolating said non-oxide semiconductor nanoparticles, which contain at least one of said metal ions and at least one of said non-metals. The invention is also directed to non-oxide semiconductor nanoparticle compositions produced as above and having distinctive properties.« less

Live cell imaging of phosphoinositide dynamics during Legionella infection.

PubMed

Weber, Stephen; Hilbi, Hubert

2014-01-01

The "accidental" pathogen Legionella pneumophila replicates intracellularly in a distinct compartment, the Legionella-containing vacuole (LCV). To form this specific pathogen vacuole, the bacteria translocate via the Icm/Dot type IV secretion system approximately 300 different effector proteins into the host cell. Several of these secreted effectors anchor to the cytoplasmic face of the LCV membrane by binding to phosphoinositide (PI) lipids. L. pneumophila thus largely controls the localization of secreted bacterial effectors and the recruitment of host factors to the LCV through the modulation of the vacuole membrane PI pattern. The LCV PI pattern and its dynamics can be studied in real-time using fluorescently labeled protein probes stably produced by the soil amoeba Dictyostelium discoideum. In this chapter, we describe a protocol to (1) construct and handle amoeba model systems as a tool for observing PIs in live cell imaging, (2) capture rapid changes in membrane PI patterning during uptake events, and (3) observe the dynamics of LCV PIs over the course of a Legionella infection.

Phase transformation and deformation behavior of NiTi-Nb eutectic joined NiTi wires

PubMed Central

Wang, Liqiang; Wang, Cong; Zhang, Lai-Chang; Chen, Liangyu; Lu, Weijie; Zhang, Di

2016-01-01

NiTi wires were brazed together via eutectic reaction between NiTi and Nb powder deposited at the wire contact region. Phase transformation and deformation behavior of the NiTi-Nb eutectic microstructure were investigated using transmission electron microscopy (TEM) and cyclic loading-unloading tests. Results show that R phase and B19′ martensite transformation are induced by plastic deformation. R phase transformation, which significantly contributes to superelasticity, preferentially occurs at the interfaces between NiTi and eutectic region. Round-shaped Nb-rich phase with rod-like and lamellar-type eutectics are observed in eutectic regions. These phases appear to affect the deformation behavior of the brazed NiTi-Nb region via five distinct stages in stress-strain curves: (I) R phase reorientation, (II) R phase transformation from parent phase, (III) elastic deformation of reoriented martensite accompanied by the plastic deformation of Nb-rich phase and lamellar NiTi-Nb eutectic, (IV) B19′ martensitic transformation, and (V) plastic deformation of the specimen. PMID:27049025

Molecular electronics--resonant transport through single molecules.

PubMed

Lörtscher, Emanuel; Riel, Heike

2010-01-01

The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.

An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

PubMed Central

MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

2012-01-01

SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

Bacterial Biofilms as Complex Communities

NASA Astrophysics Data System (ADS)

Vlamakis, Hera

2010-03-01

Many microbial populations form surface-associated multicellular communities known as biofilms. These multicellular communities are encased in a self-produced extracellular matrix composed of polysaccharides and proteins. Division of labor is a key feature of these communities and different cells serve distinct functions. We have found that in biofilms of the bacterium Bacillus subtilis, different cell types including matrix-producing and sporulating cells coexist and localize to distinct regions within the structured community. We were interested in understanding how these different cell types arise. Using fluorescence reporters under the control of promoters that are specific for distinct cell types we were able to follow the dynamics of differentiation throughout biofilm development. We found that a series of extracellular signals leads to differentiation of distinct cell types during biofilm formation. In addition, we found that extracellular matrix functions as a differentiation signal for timely sporulation within a biofilm and mutants unable to produce matrix were delayed in sporulation. Our results indicate that within a biofilm, cell-cell signaling is directional in that one cell type produces a signal that is sensed by another distinct cell type. Furthermore, once differentiated, cells become resistant to the action of other signaling molecules making it possible to maintain distinct cell populations over prolonged periods.

Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

PubMed

Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

2018-01-09

Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

PubMed Central

Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

2017-01-01

Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

PubMed Central

Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

2004-01-01

NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

PubMed

Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

2013-11-01

The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

Influence of hospital type on survival in stage IV colorectal cancer.

PubMed

Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

2016-08-01

Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

PubMed Central

Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

2018-01-01

Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

PubMed Central

SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

1998-01-01

Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

PubMed

Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

2005-01-01

The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

PubMed

Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

2015-08-01

Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

PubMed Central

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

2012-01-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

PubMed

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

2012-10-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

[Joint endoprosthesis pathology. Histopathological diagnostics and classification].

PubMed

Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

2011-05-01

Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

NATIONAL COASTAL CONDITION REPORT IV | Science ...

EPA Pesticide Factsheets

The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

PubMed Central

Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

2014-01-01

A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

Sfg

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

Vet

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

PubMed

Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

2008-12-01

Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

PubMed Central

Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

2007-01-01

The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

Ca2+ binding and conformational changes in a calmodulin domain.

PubMed

Evenäs, J; Malmendal, A; Thulin, E; Carlström, G; Forsén, S

1998-09-29

Calcium activation of the C-terminal domain of calmodulin was studied using 1H and 15N NMR spectroscopy. The important role played by the conserved bidentate glutamate Ca2+ ligand in the binding loops is emphasized by the striking effects resulting from a mutation of this glutamic acid to a glutamine, i.e. E104Q in loop III and E140Q in loop IV. The study involves determination of Ca2+ binding constants, assignments, and structural characterizations of the apo, (Ca2+)1, and (Ca2+)2 states of the E104Q mutant and comparisons to the wild-type protein and the E140Q mutant [Evenäs et al. (1997) Biochemistry 36, 3448-3457]. NMR titration data show sequential Ca2+ binding in the E104Q mutant. The first Ca2+ binds to loop IV and the second to loop III, which is the order reverse to that observed for the E140Q mutant. In both mutants, the major structural changes occur upon Ca2+ binding to loop IV, which implies a different response to Ca2+ binding in the N- and C-terminal EF-hands. Spectral characteristics show that the (Ca2+)1 and (Ca2+)2 states of the E104Q mutant undergo global exchange on a 10-100 micros time scale between conformations seemingly similar to the closed and open structures of this domain in wild-type calmodulin, paralleling earlier observations for the (Ca2+)2 state of the E140Q mutant, indicating that both glutamic acid residues, E104 and E140, are required for stabilization of the open conformation in the (Ca2+)2 state. To verify that the NOE constraints cannot be fulfilled in a single structure, solution structures of the (Ca2+)2 state of the E104Q mutant are calculated. Within the ensemble of structures the precision is good. However, the clearly dynamic nature of the state, a large number of violated distance restraints, ill-defined secondary structural elements, and comparisons to the structures of calmodulin indicate that the ensemble does not provide a good picture of the (Ca2+)2 state of the E104Q mutant but rather represents the distance-averaged structure of at least two distinct different conformations.

Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

PubMed

Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

2009-02-01

Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

PubMed Central

Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

2014-01-01

We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

PubMed

Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

PubMed

Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

2015-08-01

Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

PubMed

Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

2012-11-01

It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

Genetics of Lesch's typology of alcoholism.

PubMed

Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

2008-02-15

It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

PubMed

Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

2017-09-01

The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Slope Stability of Geosynthetic Clay Liner Test Plots

EPA Science Inventory

Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

Discrepancy between WISC-III and WISC-IV Cognitive Profile in Autism Spectrum: What Does It Reveal about Autistic Cognition?

PubMed

Nader, Anne-Marie; Jelenic, Patricia; Soulières, Isabelle

2015-01-01

The cognitive profile and measured intellectual level vary according to assessment tools in children on the autism spectrum, much more so than in typically developing children. The recent inclusion of intellectual functioning in the diagnostic process for autism spectrum disorders leads to the crucial question on how to assess intelligence in autism, especially as some tests and subtests seem more sensitive to certain neurodevelopmental conditions. Our first aim was to examine the cognitive profile on the current version of the most widely used test, the Wechsler Intelligence Scales for Children (WISC-IV), for a homogenous subgroup of children on the autism spectrum, i.e. corresponding to DSM-IV diagnosis of "autism". The second aim was to compare cognitive profiles obtained on the third edition versus 4th edition of WISC, in order to verify whether the WISC-IV yields a more distinctive cognitive profile in autistic children. The third aim was to examine the impact of the WISC-IV on the cognitive profile of another subgroup, children with Asperger's Syndrome. 51 autistic, 15 Asperger and 42 typically developing children completed the WISC-IV and were individually matched to children who completed the WISC-III. Divergent WISC-IV profiles were observed despite no significant intelligence quotient difference between groups. Autistic children scored significantly higher on the Perceptual Reasoning Index than on the Verbal Comprehension Index, a discrepancy that nearly tripled in comparison to WISC-III results. Asperger children scored higher on the VCI than on other indexes, with the lowest score found on the Processing Speed Index. WISC-IV cognitive profiles were consistent with, but more pronounced than WISC-III profiles. Cognitive profiles are a valuable diagnostic tool for differential diagnosis, keeping in mind that children on the autism spectrum might be more sensitive to the choice of subtests used to assess intelligence.

Discrepancy between WISC-III and WISC-IV Cognitive Profile in Autism Spectrum: What Does It Reveal about Autistic Cognition?

PubMed Central

Nader, Anne-Marie; Jelenic, Patricia; Soulières, Isabelle

2015-01-01

The cognitive profile and measured intellectual level vary according to assessment tools in children on the autism spectrum, much more so than in typically developing children. The recent inclusion of intellectual functioning in the diagnostic process for autism spectrum disorders leads to the crucial question on how to assess intelligence in autism, especially as some tests and subtests seem more sensitive to certain neurodevelopmental conditions. Our first aim was to examine the cognitive profile on the current version of the most widely used test, the Wechsler Intelligence Scales for Children (WISC-IV), for a homogenous subgroup of children on the autism spectrum, i.e. corresponding to DSM-IV diagnosis of “autism”. The second aim was to compare cognitive profiles obtained on the third edition versus 4th edition of WISC, in order to verify whether the WISC-IV yields a more distinctive cognitive profile in autistic children. The third aim was to examine the impact of the WISC-IV on the cognitive profile of another subgroup, children with Asperger’s Syndrome. 51 autistic, 15 Asperger and 42 typically developing children completed the WISC-IV and were individually matched to children who completed the WISC-III. Divergent WISC-IV profiles were observed despite no significant intelligence quotient difference between groups. Autistic children scored significantly higher on the Perceptual Reasoning Index than on the Verbal Comprehension Index, a discrepancy that nearly tripled in comparison to WISC-III results. Asperger children scored higher on the VCI than on other indexes, with the lowest score found on the Processing Speed Index. WISC-IV cognitive profiles were consistent with, but more pronounced than WISC-III profiles. Cognitive profiles are a valuable diagnostic tool for differential diagnosis, keeping in mind that children on the autism spectrum might be more sensitive to the choice of subtests used to assess intelligence. PMID:26673881

A novel GBE1 gene variant in a child with glycogen storage disease type IV.

PubMed

Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

2016-08-01

Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

PubMed

Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

2002-06-01

Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

PubMed

Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

2009-01-01

Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

PubMed Central

2011-01-01

Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

Effect of microwave disinfection on compressive and tensile strengths of dental stones.

PubMed

Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

2013-01-01

Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

PubMed

Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

2013-09-01

A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

PubMed

Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

2017-11-01

Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

PubMed

Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

2008-03-01

Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

PubMed Central

Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

2009-01-01

Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

PubMed

Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

2014-03-01

Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

PubMed

Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

2017-06-01

To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2012 CFR

2012-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2011 CFR

2011-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2013 CFR

2013-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2014 CFR

2014-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

Standard-Cell, Open-Architecture Power Conversion Systems

DTIC Science & Technology

2005-10-01

TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

ClinicalTrials.gov

2018-04-20

Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

Effects of intravenous delivery systems on infused red blood cells.

PubMed

Gibson, J S; Leff, R D; Roberts, R J

1984-03-01

The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

PubMed

Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

2013-05-01

Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.